CN112680536A

CN112680536A - Method for detecting pathogenic microorganism RNA based on criprpr-cas 12f1

Info

Publication number: CN112680536A
Application number: CN202110140101.9A
Authority: CN
Inventors: 韦阳道; 魏小斌; 万逸
Original assignee: Hainan University; Haikou Peoples Hospital
Current assignee: Hainan University; Haikou Peoples Hospital
Priority date: 2021-02-02
Filing date: 2021-02-02
Publication date: 2021-04-20

Abstract

The invention relates to a method developed based on RT-PCR and T7RNA transcription amplification technology combined with trans-cutting capability after activation of cruispr-cas 12f1 enzyme by RNA, in particular to the field of rapid diagnosis of pathogenic microorganisms.

Description

Method for detecting pathogenic microorganism RNA based on criprpr-cas 12f1

Technical Field

A method for detecting pathogenic microorganism RNA based on a criprpr-cas 12f1 system is characterized by comprising the following steps: the detection of pathogenic microorganisms has better specificity.

Background

Pathogenic microorganisms are various and have great harm to human beings, animals and plants, and detection methods for the pathogenic microorganisms mainly focus on a culture method, fluorescent quantitative PCR and microorganism sequencing. In recent years, the discovery of a CRISPR/Cas (clustered regularly interspersed short palindromic repeats) system provides a high-specificity and high-sensitivity method for detecting microorganisms. The crispr/cas system is an adaptive immune defense developed by archaea and bacteria during long-term evolution, and is used to fight invading viruses as well as foreign DNA. Crispr/Cas systems are largely divided into 2 broad categories, including Class1 and Class2, where Class1 is the use of multiprotein response complexes, Class2 is the single protein effector, and binds guide RNA forming complexes to exert the ability to target cleavage, Class2 includes the II, V, VI types, including Cas9, Cas12, Cas13, and Cas12f1 systems (Koonin, E. V., & Makarova, K.S. (2019), Origins and evolution of CRISPR-Cas systems, Photocalcium Transactions of the Royal Society B, 374(1772), 20180087.). The current applications of detection methods focus on Cas9, Cas12 and Cas13 systems, wherein the CRISPR/Cas9 system has the ability to cleave double-stranded DNA in a PAM site-dependent targeting manner, according to which Zhou et al mutates a key site in the RUVC or HNH structure of Cas9 protein, thereby allowing Cas9 protein to form a notch-like function, and combines with a strand displacement technique to obtain a highly sensitive detection method (Zhou, w, Hu, l, Ying, l, Zhao, z, Chu, p, k, & Yu, x.f. (2018). For example, Wang et al designs a visual virus detection method by modifying one end of a probe into a blue light visible molecule, and the target strand is exponentially increased mainly through a constant temperature amplification technology, so that the blue light visible molecule at one end of the probe is released after cas12a is subjected to trans-cleavage, and emits blue light under the irradiation of the blue light. The system has good detection sensitivity which can reach 100aM (Wang, B., Wang, R., Wang, D., Wu, J., Li, J., Wang, J., & Wang, Y. (2019). Cas12aVDet: a CRISPR/Cas12a-based platform for rapid and visual nuclear acid detection. Analytical chemistry, 91(19), 12156-. The crishpr/Cas 13 system has the ability to cleave single-stranded RNA and to cleave RNA in trans, and is widely used in biosensing detection systems, for example, Myhrvold et al designs a primer with T7 promoter for isothermal amplification and obtains ssRNA target strand by T7 transcription, and develops the detection method of SHERLOCK, which has the characteristics of short reduction time and high sensitivity specificity (Myhrvold, C., Freije, C. A., Gootenberg, J. S., Abudayyeh, O., Metsky, H. C., Durbin, A. F., Sabei, P.C. (2018), Field-purified viral diagnosis using CRISPR-Cas13, Science, 360(6387), 448. 448). While the currently known crisp/Cas14 system has the ability to target the cleavage of double-stranded and single-stranded DNA with a PAM site and to cut in trans, this greatly limits the utility of this system due to its specific recognition site targeting the 11 th to 12 th bases of the single-stranded DNA region, while other targeting sites have poor specificity (Harrington, l. b., burst, d., hen, j. s., Paez-Espino, d., Ma, e., Witte, i. p., lou., & Doudna, j.a. (2018) Programmed DNA deletion minor CRISPR-Cas14 enzymes. Science, 362(6416), 9. 839. 842. Karvelis, t., Bigelyte, g, g.young, j. k. g.g. 638, z., hodaingyaks. k. g.g. red. CRISPR. r. this system has limited the utility of this system by its application to the use of this system (Harrington, l. b. d. c. CRISPR. c. this publication, j.c. c. 638, c. 48(9), 5016-5023.). The invention utilizes RT-PCR and T7RNA transcription technology to synthesize RNA short chain, and simultaneously uses RNA as a target substrate to cause cas12f1 trans-cutting, thereby developing a set of detection method for detecting pathogenic microorganisms with high sensitivity and high specificity, and widening the application of the system.

Disclosure of Invention

In order to achieve the aim of solving the problem that the crispr/cas12f1 system has poor specificity in detecting pathogenic microorganisms, the method for detecting the pathogenic microorganisms based on the combination of the RT-PCR and the T7RNA transcription technology of cas12f1 is provided;

the technical scheme adopted by the invention is as follows:

1. designing different specific primers according to pathogenic microorganism RNA, wherein a T7 promoter sequence (taatacgactcactatagg) is added to the Forward primer 5';

2. inoculating pathogenic microorganism into 1ml LB, culturing at 37 deg.C for 12h, extracting pathogenic microorganism RNA of bacteria with bacterial RNA extraction kit (Omega), and reacting at 37 deg.C for 1h to generate cDNA chain with RNA as template and PrimeScript II 1st Strand cDNA synthesis kit (Takara);

3. using the cDNA chain as a template, amplifying double-stranded DNA with a T7 promoter by using a PCR technology, and then adding 1ul T7RNA polymerase (20U/ul) to react for 3h at 37 ℃;

4. using the RNA transcript as a detection target, sgRNA and cas12f1 protein were used at a ratio of 500 nM: incubation at a concentration ratio of 500nM in 20mM tris-hcl, 20mM NaCl, pH9.0 buffer, 37 ℃ for 30min, wherein the sequence of sgRNA is: CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGAAAGAAUGAAGGAAUGCAACCUGCGGGUAACGUCAAUUGC(the underlined site recognizes the target region of the substrate), and then a detection target and 100nM of a fluorescent probe (5 '5-FAM-TTTTTTTTTTTT-BHQ 13') were added to detect the fluorescence signal value at 37 ℃ at 492nM for excitation light and 520nM for emission light.

Drawings

FIG. 1 cas12f1 experimental principle diagram for diagnosing pathogenic microorganism

FIG. 2 is an electrophoretogram of RNA of different pathogenic microorganisms;

FIG. 3 is a synthetic electrophoretogram of cDNA of different pathogenic microorganisms;

FIG. 4 PCR electrophoretogram of different pathogenic microorganisms;

FIG. 5T 7 electrophoretogram after RNA polymerase transcription;

FIG. 6 is a bar graph of fluorescence intensities of different pathogenic microorganisms;

FIG. 7 is a bar graph of fluorescence intensity of different Salmonella typhi amplicon concentrations.

Detailed Description

The present invention is further illustrated by the following specific examples, which are intended to assist those of ordinary skill in the art in more fully understanding the present invention, but are not intended to be in any way limiting;

example 1

Escherichia coli (E.coli) Inoculated into LB medium, cultured at 37 ℃ for 12 hours, centrifuged at 6000rpm/min for 4min, after discarding the supernatant, the pathogenic microorganism RNA was extracted using bacterial RNA extraction kit (Omega), and then reacted at 37 ℃ for 1h using PrimeScript II 1st Strand cDNA Synthesis kit (Takara) to synthesize cDNA strands, 1ul Forward primer (taatacgactcactataggGGAGGAAGGGAGTAAAGTTAAT), 1ul Reverse primer (GGAGTTAGCCGGTGCTTCT), 9.5ul sterile water, 12.5ul premixed enzyme (Takara) were added using cDNA strands as templates. The PCR procedure was 95 ℃ for 5min, 95 ℃ for 30s, 64 ℃ for 30s, 72 ℃ for 30s, and 20 cycles, after the PCR was completed, 1ul of T7RNA polymerase (20ul/ul), 4ul of buffer Mix (NEB), and 10ul of DEPC water were added, and the mixture was incubated at 37 ℃ for 3h to perform the RNA transcription reaction. 500nM cas12f1 with 500nM sgRNA in buffer (20mM Tris-hcl, 20mM NaCl, 10mM Mg²⁺) Incubating at 37 ℃ for 30min, adding the transcription product and 100nM fluorescent probe, and detecting the fluorescent signal intensity at 37 ℃ under the conditions of excitation wavelength of 492nM and emission wavelength of 520 nM;

example 2

Klebsiella pneumoniae (C.) (K.pneumonia) Inoculated into LB medium, cultured at 37 ℃ for 12 hours, centrifuged at 6000rpm/min for 4min, after discarding the supernatant, the pathogenic microorganism RNA was extracted using bacterial RNA extraction kit (Omega), and then reacted at 37 ℃ for 1h using PrimeScript II 1st Strand cDNA Synthesis kit (Takara) to synthesize cDNA strands, 1ul Forward primer (taatacgactcactataggGGAGGAAGGCGGTGAGGT), 1ul Reverse primer (ACGGAGTTAGCCGGTGCTTCT), 9.5ul sterile water, 12.5ul premixed enzyme (Takara) were added using cDNA strands as templates. The PCR procedure was carried out at 95 ℃ for 5min, 95 ℃ for 30s, 66 ℃ for 30s, 72 ℃ for 30s, and 20 cycles, after completion of the PCR, 1ul of T7RNA polymerase (20ul/ul), 4ul of buffer Mi was addedx (NEB), 10ul DEPC water, incubated at 37 ℃ for 3h for RNA transcription. 500nM cas12f1 with 500nM sgRNA in buffer (20mM Tris-hcl, 20mM NaCl, 10mM Mg²⁺) Incubating at 37 ℃ for 30min, adding the transcription product and 100nM fluorescent probe, and detecting the fluorescent signal intensity at 37 ℃ under the conditions of excitation wavelength of 492nM and emission wavelength of 520 nM;

example 3

Pseudomonas aeruginosa (P.aeruginosa) Inoculated into LB medium, cultured at 37 ℃ for 12 hours, centrifuged at 6000rpm/min for 4min, after discarding the supernatant, the pathogenic microorganism RNA was extracted using bacterial RNA extraction kit (Omega), and then reacted at 37 ℃ for 1h using PrimeScript II 1st Strand cDNA Synthesis kit (Takara) to synthesize cDNA strands, 1ul Forward primer (taatacgactcactataggGGAGGAAGGGCAGTAAGTT), 1ul Reverse primer (ACGAAGTTAGCCGGTGCTTA), 9.5ul sterile water, 12.5ul premixed enzyme (Takara) were added using cDNA strands as templates. The PCR procedure was carried out at 95 ℃ for 5min, 95 ℃ for 30s, 62 ℃ for 30s, 72 ℃ for 30s, and 20 cycles, after completion of the PCR, 1ul of T7RNA polymerase (20ul/ul), 4ul of buffer Mix (NEB), and 10ul of DEPC water were added, and the mixture was incubated at 37 ℃ for 3 hours to carry out the RNA transcription reaction. 500nM cas12f1 with 500nM sgRNA in buffer (20mM Tris-hcl, 20mM NaCl, 10mM Mg²⁺) Incubating at 37 ℃ for 30min, adding the transcription product and 100nM fluorescent probe, and detecting the fluorescent signal intensity at 37 ℃ under the conditions of excitation wavelength of 492nM and emission wavelength of 520 nM;

example 4

Salmonella typhi (A)E.typhi) Inoculated into LB medium, cultured at 37 ℃ for 12 hours, centrifuged at 6000rpm/min for 4min, after discarding the supernatant, the pathogenic microorganism RNA was extracted using bacterial RNA extraction kit (Omega), and then reacted at 37 ℃ for 1h using PrimeScript II 1st Strand cDNA Synthesis kit (Takara) to synthesize cDNA strands, 1ul Forward primer (taatacgactcactataggGGAGGAAGGTGTTGTGGTTA), 1ul Reverse primer (GAGTTAGCCGGTGCTTCTTC), 9.5ul sterile water, 12.5ul premixed enzyme (Takara) were added using cDNA strands as templates. The PCR procedure was carried out at 95 ℃ for 5min, 95 ℃ for 30s, 64 ℃ for 30s, 72 ℃ for 30s, and 20 cycles, after completion of the PCR, 1ul of T7RNA polymerase (20ul/ul), 4ul of buffer Mix (NEB), and 10ul of DEPC water were added, and the mixture was incubated at 37 ℃ for 20ul of PCRAnd incubating for 3h to perform RNA transcription reaction. 500nM cas12f1 with 500nM sgRNA in buffer (20mM Tris-hcl, 20mM NaCl, 10mM Mg²⁺) Incubating at 37 ℃ for 30min, adding the transcription product and 100nM fluorescent probe, and detecting the fluorescent signal intensity at 37 ℃ under the conditions of excitation wavelength of 492nM and emission wavelength of 520 nM;

example 6

And (3) sensitivity detection: the Salmonella typhi amplicons (GGAGGAAGGTGTTGTGGTTAATAACCGCAGCAATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTC) were diluted to 1 am in a 10-fold gradient for PCR amplification, followed by addition of 1ul T7RNA polymerase (20ul/ul), 4ul buffer Mix (NEB), 10ul DEPC water and incubation at 37 ℃ for 3 h. After the transcription product is added with the incubated 500nM cas12f1-sgRNA compound and 100nM fluorescent probe, the transcription product is placed at 37 ℃, the excitation wavelength is 492nM, and the fluorescence signal intensity is detected under the emission wavelength is 520 nM.

Claims

1. A method for detecting pathogenic microorganism RNA based on cas12f1 enzyme, which is characterized in that: after the pathogenic microorganism RNA is extracted, short double-stranded DNA with a promoter containing T7 is obtained by RT-PCR amplification technology, and then the final substrate RNA is obtained by transcription of T7 RNA.

2. The RNA is taken as a target substrate to cause the trans-cutting capability of the cas12f1 enzyme to the single-stranded DNA probe, and the detection with high specificity and high sensitivity is further obtained through the change of the fluorescence signal intensity of the probe.

3. The method of claim 1, wherein the cas12f1 is a method for detecting pathogenic microorganisms, comprising: pathogenic RNA of Salmonella typhi (A)E.typhi) Klebsiella pneumoniae (C.) (K.pneumonia) Pseudomonas aeruginosaK.pneumonia) And Escherichia coli (E.coli)。

4. The method of claim 1, wherein the cas12f1 is a method for detecting pathogenic microorganisms, comprising: designing a pathogenic microorganism RNA specific primer, wherein a T7 promoter sequence (taatacgactcactatagg) is added to the 5' end of a forward primer.

5. The primer design of claim 3, wherein: e.coli Forward primer (taatacgactcactataggGGAGGAAGGGAGTAAAGTTAAT), Reverse primer (GGAGTTAGCCGGTGCTTCT); klebsiella Forward primer (taatacgactcactataggGGAGGAAGGCGGTGAGGT), Reverse primer (ACGGAGTTAGCCGGTGCTTCT); pseudomonas aeruginosa Forward primer (taatacgactcactataggGGAGGAAGGGCAGTAAGTT), Reverse primer (ACGAAGTTAGCCGGTGCTTA); salmonella typhi Forward primer (taatacgactcactataggGGAGGAAGGTGTTGTGGTTA), Reverse primer (GAGTTAGCCGGTGCTTCTTC).

6. RNA transcription following RT-PCR amplification according to claim 1, characterized in that: the transcribed sequence after E.coli amplification is GGAGGAAGGGAGUAAAGUUAAUACCUUUGCUCAUUGACGUUACCCGCAGAAGAAGCACCGGCUAACUCC (the underlined part is the detection target region and the shaded part is the detection mismatch region).

7. RNA transcription following RT-PCR amplification according to claim 1, characterized in that: the transcribed sequence after Klebsiella pneumoniae amplification is GGAGGAAGGCGGUGAGGUUAAUAACCUCAUCGAUUGACGUUACCCGCAGAAGAAGCACCGGCUAACUCCGU (the underlined part is the detection target region and the shaded part is the detection mismatch region).

8. RNA transcription following RT-PCR amplification according to claim 1, characterized in that: the sequence transcribed after the amplification of the pseudomonas aeruginosa is GGAGGAAGGGCAGUAAGUUAAUACCUUGCUGUUUUGACGUUACCAACAGAAUAAGCACCGGCUAACUUCGU (the dotted part is the target region for detection and the shaded part is the mismatch region for detection)

RNA transcription following RT-PCR amplification according to claim 1, characterized in that: the sequence transcribed after amplification of the salmonella typhi is GGAGGAAGGUGUUGUGGUUAAUAACCGCAGCAAUUGACGUUACCCGCAGAAGAAGCACCGGCUAACUC

(the scribed portion is the detection target area).