CN111850147B - Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme - Google Patents
Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme Download PDFInfo
- Publication number
- CN111850147B CN111850147B CN202010713260.9A CN202010713260A CN111850147B CN 111850147 B CN111850147 B CN 111850147B CN 202010713260 A CN202010713260 A CN 202010713260A CN 111850147 B CN111850147 B CN 111850147B
- Authority
- CN
- China
- Prior art keywords
- primer
- amplification
- salmonella
- nucleic acid
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a method for visually detecting salmonella based on nucleic acid amplification coupling G quadruplet DNA enzyme. The invention firstly performs LAMP amplification on target nucleic acid, converts double-stranded DNA of LAMP amplification products into single-stranded DNA by introducing nicking endonuclease and restriction endonuclease, specifically triggers M-G molecular machine amplification, converts nucleic acid signals into signals for generating G quadruplets, and finally converts the signals into visible color change by utilizing the mimic enzyme characteristic of the G quadruplets. The invention realizes the specific detection of the salmonella and solves the problem that the nucleic acid amplification result detected by a visualization method is not specific enough.
Description
Technical Field
The invention belongs to the field of microbial detection, and particularly relates to a method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme.
Background
According to the report of the world health organization, salmonella is one of the causes of four diarrhea diseases worldwide. It is estimated that salmonella causes about 340 million infections and 681316 deaths per year, with almost 2/3 cases occurring in children under the age of 5, and salmonella infection remains a worldwide food safety problem. According to the incidents of salmonella contamination in food counted by the CDC, salmonella is susceptible to fast-digestion food such as eggs, meat, fresh-cut fruits and milk which is not sterilized at high temperature, and therefore, accurate and efficient salmonella detection is becoming more and more important in order to ensure the safety of food.
The conventional detection method for salmonella in food is a plate culture method, comprises colony counting and standard biochemical identification, generally requires 2 to 3 days for primary identification of pathogenic bacteria, additionally requires a week for further confirmation of the types of pathogenic bacteria, and wastes time and labor. Immunological detection methods based on the interaction between antigen and antibody and nucleic acid-based detection methods are also increasingly applied to the detection of salmonella in food. Compared with the traditional plate culture method, the detection time of immunological detection is greatly shortened, but the cross reaction with related bacterial antigens, inaccurate detection result caused by antigen variation and high detection cost limit the wide application of the method. Nucleic acid-based detection methods, such as Polymerase Chain Reaction (PCR), have been developed that exhibit greater sensitivity and specificity. However, PCR requires precise temperature control equipment and is not suitable for field detection.
Loop-mediated isothermal amplification (LAMP) is a method for rapidly and effectively amplifying nucleic acid under simple conditions (such as a water bath) without complex temperature cycle, and has the characteristics of time saving, easy operation and low cost. The conventional method for LAMP detection mainly comprises real-time fluorescence acquisition and gel electrophoresis, wherein the former method needs a precise fluorescence acquisition device, and the latter method has long operation time, and the two methods are limited in the field detection field. The visual detection method has the advantages of convenience in operation, visual results and the like, and has great advantages in the field of field detection. The components (such as pyrophosphate ion, magnesium ion, hydrogen ion, etc.) in the LAMP system change greatly before and after the reaction, and are often used in visualization methods for determining the progress of the LAMP reaction, such as HNB method, calcein method, nephelometry, pH dye method, etc. Such methods cannot eliminate interference caused by non-specifically amplified nucleic acid chain extension, which in turn affects detection accuracy.
The nicking endonuclease mediated isothermal amplification is to add nicking endonuclease and polymerase simultaneously in the system, to utilize nicking endonuclease to produce nick on the template strand, and then to utilize the strand displacement activity of DNA polymerase to strip the downstream strand while the upstream strand of nick is extended, so as to produce single-stranded nucleic acid without high-temperature denaturation and achieve the aim of circular amplification. The nicking endonuclease-mediated isothermal amplification reaction is flexible in design, and can generate single-stranded DNA according to requirements by proper rational design, and further can be used as a molecule generating machine for converting nucleic acid sequence information.
DNase is a nuclease with catalytic activity, can crack a specific substrate in the presence of a cofactor, and has the advantages of simple structure, programmability, easy functionalization and the like. G tetrad DNase is a specific space structure formed by G-rich sequences, can simulate the activity of peroxidase in the presence of a cofactor hemin (hemin), and oxidizes 2, 2-diaza-bis (3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt (ABTS) to change the color of the ABTS. The G quadruplet DNA enzyme is generated by utilizing a nucleic acid amplification technology, and target detection is realized by catalyzing a substrate to generate color change, so that a specific visual color development detection method is developed.
Disclosure of Invention
In order to solve the problems in the background art, the invention provides a method for realizing salmonella detection by developing a G quadruplet DNA enzyme catalytic substrate generated by LAMP and nicking endonuclease mediated linear amplification cascade, and solves the problem that the nucleic acid amplification result detected by a visualization method is not specific enough.
The technical scheme adopted by the invention comprises the following steps:
1) extracting the genome DNA of a sample to be detected;
2) LAMP amplification: taking 1 mu L of genome DNA extracted in the step 1) as a template, performing LAMP amplification in an LAMP amplification system, and incubating for 20min at 65 ℃ to obtain an LAMP amplification product;
3) carrying out ScrFI restriction endonuclease cleavage on the LAMP amplification product obtained in the step 2) to obtain a restriction enzyme cleavage product;
4) generating a plurality of single-stranded DNAs with the same 3' end by the cycle of nicking endonuclease cutting, DNA polymerase extension and strand displacement of the restriction enzyme cutting product obtained in the step 3): to 20. mu.L of the restriction enzyme cleavage product obtained in step 3), 10 × Isothermal Amplification Buffer II Pack Buffer, Bst 3.0DNA polymerase, Nt.BstNBI nicking endonuclease and dNTPs were added and the resultant mixture was digested with ddH 2 O is complemented to 25 mu L and incubated for 10min at 58.8 ℃;
5) generation of G-rich sequences: adding 5 μ L of 1 μ M molecular machine M-G into the product obtained in step 4), incubating for 10min, incubating at 95 deg.C for 5min, and immediately placing on ice for 10 min;
6) and (3) color development reaction: to 30. mu.L of the G-rich sequence-containing product obtained in step 5) were added 1 XHEPES buffer, 200nM cofactor hemin (hemin) and 1. mu.L of 1M HCl, and mixed, followed by 2mM ABTS 2- And H 2 O 2 The final reaction volume is 100 mu L, and the visual detection of the salmonella is realized through reaction color development.
LA in the step 2)The total volume of the MP amplification system was 10. mu.L, which included 1. mu.L of genomic DNA template, 1.6. mu.M of inner 1 and inner 2 primers, 0.2. mu.M of outer 1 and outer 2 primers, 0.4. mu.M of loop 1 and loop 2 primers, 1.4mM dNTPs, 3.2U of Bst DNA Polymerase Fragment, 1 XThermoPol Buffer, 6mM MgSO 2 4 。
The nucleotide sequences of the inner primer 1, the inner primer 2, the outer primer 1, the outer primer 2, the loop primer 1 and the loop primer 2 are shown as follows:
an inner primer 1:
TCCCGGCAGAGTTCCCATTGAAGAGTCATCATGACGCAGCTGTTGAA
an inner primer 2: TTCCCGCTGCCGGTATTTGTTGCTACGTTTTGCTTCACGGA
An outer primer 1: GCGATAATATGGGGCGGAAT
An outer primer 2: CGCCTTTGCTGGTTTTAGGT
Loop primer 1: TATTCGGTGGTTTTAAGCGTACTC
And (3) a loop primer 2: GCCGTAACAACCAATACAAATGG are provided.
The amplification product of the step 2) contains a recognition site CCGGG and a recognition site GAGTC of the restriction endonuclease ScrFI.
The inner primer 1 contains a nicking endonuclease recognition site GAGTC.
The cutting conditions of the ScrFI restriction endonuclease in the step 3) are as follows: 10 μ L of LAMP amplification product, 50mM Tris-HCl buffer (pH7.9), 100mM NaCl, 6mM MgSO 4 100. mu.g/mL bovine serum albumin BSA, 10U restriction enzymes ScrFI, ddH 2 Supplementing O to 20 μ L, incubating at 37 deg.C for 60min, and treating at 95 deg.C for 10min to inactivate enzyme.
In the step 4), the 10 × Isothermal Amplification Buffer II Pack Buffer, Bst 3.0DNA polymerase, Nt.BstNBI nicking endonuclease and dNTPs are respectively added in the following amounts: mu.L of 10 × Isothermal Amplification Buffer II Pack Buffer, 4.8U of Bst 3.0DNA polymerase, 10U of Nt.BstNBI nicking endonuclease, 0.32mM dNTPs.
The molecular machine M-G in the step 5) consists of three parts in sequence: the first part is a LAMP amplification product complementary region, the second part is a nicking endonuclease recognition site complementary region, and the third part is a G-rich sequence complementary region;
the nucleotide sequence of the molecular machinery M-G is:
TCCCAACCCGCCCTACCCTTTTGACTCGGCAGAGTTCCCATTGAAAT；
wherein the nucleotide sequence of the LAMP amplification product complementary region is GGCAGAGTTCCCATTGAAAT, the nucleotide sequence of the nicking endonuclease recognition site complementary region is GACTC, and the nucleotide sequence of the G-rich sequence complementary region is TCCCAACCCGCCCTACCC.
In the step 6), if the sample to be detected contains salmonella, the solution turns green; if the sample to be detected does not contain salmonella, the solution is colorless.
As shown in fig. 1 (I): for traditional LAMP amplification, most of the products are single-stem-loop structure DNA, double-stem-loop structure DNA and cauliflower structure DNA formed by combining a plurality of stem loops with different stem lengths, wherein most of the products exist in a double-stranded form and have certain regularity.
As shown in fig. 1 (II): the amplified product can be cleaved into regular double-stranded DNA by treating the product with a restriction enzyme.
As shown in fig. 1 (III): inserting nicking endonuclease recognition sites in a connecting region of two sequences of an inner primer of LAMP to enable amplification products of a rosette structure or a neck ring structure of LAMP to contain a plurality of nicking endonuclease recognition sites; because the polymerase and the nicking endonuclease exist simultaneously, nicking is generated on double-stranded DNA by using the nicking endonuclease, then the downstream strand is stripped while the upstream strand of the nicking is extended by using the strand displacement activity of the DNA polymerase, and the processes of nicking by using the nicking endonuclease, extending by using the polymerase and displacing the strand are circularly repeated, so that a large amount of single-stranded nucleic acid with the same 3' end can be generated.
In order to promote the generation of G quadruplet DNA enzyme, LAMP and linear amplification cascade mediated by nicking endonuclease are adopted in the technology, sequences with the same 3 'end and cut by restriction endonuclease are used as trigger chains, and a complementary recognition region of a molecular machine M-G is designed according to 20 basic groups at the 3' end of the sequences, so that the sequences can specifically respond to LAMP amplification products to generate G-rich sequences. The molecular machines M-G mainly comprise three parts: the complementary region of the LAMP amplification product (FIG. 1-i), the complementary region of the nicking endonuclease recognition site (FIG. 1-ii), and the complementary region of the G-rich sequence (FIG. 1-iii). After M-G is added, a trigger molecule machine is specifically triggered at the 3' end of the trigger chain, and the trigger molecule machine is extended under the action of DNA polymerase, so that the nicking endonuclease recognition site forms a double chain, and the nicking endonuclease recognition site can be recognized and nicked by a nicking endonuclease recognition site complementary region; at the same time, the continued extension of the nucleic acid enables synthesis of a G-rich sequence based on the region iii of M-G. Due to the high strand displacement activity of DNA polymerase, the strand of nucleic acid upstream of the nick continues to extend, stripping the G-rich sequence downstream of the nick. In such a reciprocating way, the G-rich sequence is continuously generated, and the existence of the trigger chain is converted into the accumulation of the G-rich sequence.
The invention has the beneficial effects that:
LAMP amplification is initiated through characteristic genes of salmonella, regular LAMP products are cut by using restriction endonuclease, nicking sites are identified by nicking endonuclease, and single-chain LAMP products with the same 3' end are accumulated in large quantity through nicking endonuclease extension and strand displacement, so that the linear cascade amplification mediated by nicking endonuclease is initiated to generate a G-rich sequence, a G quadruplet space structure formed by the G-rich sequence in the presence of potassium ions is combined with hemin to form DNA enzyme to catalyze ABTS for color development, and specific visual detection of the characteristic genes of salmonella is realized.
Drawings
FIG. 1 is a schematic diagram of visualized detection of enzymatic substrate development of G quadruplet DNA enzyme generated by LAMP and nicking endonuclease mediated linear amplification cascade. In the figure: the inner primer of LAMP contains nicking endonuclease recognition sites; (I) is a stem loop LAMP product generated by LAMP; (II) regular short double-stranded DNA is obtained after adding restriction enzyme for treatment; (III) repeatedly nicking and extending by nicking endonuclease and polymerase to obtain single-stranded DNA with same 3' end; M-G is a molecular machine consisting of a region (i) complementary to the LAMP amplification product, a region (ii) complementary to the nicking endonuclease recognition site, and a region (iii) complementary to the G-rich sequence.
FIG. 2 shows the sensitivity of visual detection of Salmonella invA by LAMP and nicking endonuclease mediated linear amplification cascade to G quadruplet DNA enzyme. (A) Sensitivity of real-time fluorescent LAMP. (B) And (4) visualizing the detection sensitivity.
FIG. 3 is a diagram showing the visualized detection of the specificity of Salmonella invA by the G quadruplet DNA enzyme generated by LAMP and nicking endonuclease mediated linear amplification cascade. (A) And (5) real-time fluorescence LAMP detection results. (B) And visualizing the detection result. The species selected for specificity verification included Salmonella typhimurium cmcc (b)50115(Salmonella), vibrio parahaemolyticus KP9(V.p KP9), vibrio parahaemolyticus ATCC17802(v.p17802), and escherichia fergusonii (e.fergusonii). N represents the control without template.
FIG. 4 shows the results of detection of Salmonella in contaminated milk. N represents the control without template.
Detailed Description
The invention is further illustrated by the following examples in conjunction with the drawings.
The implementation process of the invention is as follows:
1. design of primers and molecular machinery
Aiming at salmonella invA gene (GenBank accession No. NC-003197), LAMP primer and corresponding molecular machine M-G for generating and forming G quadruplet DNA enzyme are synthesized, wherein the LAMP primer comprises an inner primer 1 containing nicking endonuclease Nt.BstNBI recognition site GAGTC.
The sequence of the molecular machine M-G containing the complementary sequence of the recognition site of the nicking endonuclease nt.TCC CAACCCGCCCTACCCTTTTGACTCGGCAGAGTTCCCATTGAAAT
Designing a primer aiming at the invA gene of salmonella, and inserting a nicking endonuclease recognition site between F1c and F2 of the LAMP inner primer 1, wherein the primer is specifically as follows:
LAMP inner primer 1 containing nicking endonuclease recognition sites: TCCCGGCAGAGTTCCCATTGAAGAGTCATCATGACGCAGCTGTTGAA
Inner primer 2 of LAMP: TTCCCGCTGCCGGTATTTGTTGCTACGTTTTGCTTCACGGA
Outer primer 1 of LAMP: GCGATAATATGGGGCGGAAT
Outer primer 2 of LAMP: CGCCTTTGCTGGTTTTAGGT
Loop primer 1 of LAMP: TATTCGGTGGTTTTAAGCGTACTC
Loop primer 2 of LAMP: GCCGTAACAACCAATACAAATGG
In the sequence of the indicated molecular machines M-G: the nucleotide sequence of the LAMP amplification product complementary region is GGCAGAGTTCCCATTGAAAT, the nucleotide sequence of the nicking endonuclease recognition site complementary region is GACTC, and the nucleotide sequence of the G-rich sequence complementary region is TCCCAACCCGCCCTACCC.
2. LAMP and nicking endonuclease mediated linear amplification cascade
2.1) LAMP amplification
Amplification conditions for LAMP were as follows: the LAMP reaction was performed in a total volume of 10. mu.L, including 1. mu.L of Salmonella DNA template, 1.6. mu.M of inner primer 1 and inner primer 2, 0.2. mu.M of outer primer 1 and outer primer 2, 0.4. mu.M of loop primer 1 and loop primer 2, 1.4mM dNTPs, 3.2U of Bst DNA Polymerase Fragment, 1 × ThermoPol Buffer, 6mM MgSO 4 Incubation at 65 ℃ for 20 min.
2.2) carrying out ScrFI restriction endonuclease cleavage on the LAMP amplification product to obtain a restriction endonuclease cleavage product (i.e. the product is cleaved into double-stranded DNA)
The LAMP primer is used for amplifying salmonella invA gene to obtain a product containing a recognition site CCGGG of a restriction enzyme ScrFI, the ScrFI is used for cutting the double-stranded part of the LAMP amplification product, and the obtained product is F1c-F2F1 double-stranded (figure 1-II).
The ScrFI cleavage conditions were: 10 μ L LAMP reaction product, 50mM Tris-HCl (pH7.9), 100mM NaCl, 6mM MgSO 4 、100μg/mL BSA、10U ScrFI、ddH 2 Supplementing O to 20 μ L, incubating at 37 deg.C for 60min, and treating at 95 deg.C for 10min to inactivate enzyme.
2.3) generating multiple strands of single-stranded DNA having the same 3' end by repeating the cycle of nicking with nicking endonuclease, extension with DNA polymerase and strand displacement
The specific implementation mode is as follows: mu.L of the ScrFI cleavage product was added with 1.5. mu.L of 10 × Isothermal Amplification Buffer II Pack, 4.8U Bst 3.0DNA Polymerase, 10U Nt.BstNBI, 0.32mM dNTPs, ddH 2 O is complemented to 25 mu L and incubated for 10min at 58.8 ℃;
2.4) Generation of G-rich sequences
The restriction endonuclease ScrFI cleavage product F1c-F2F1 was able to hybridize with the molecular machinery M-G containing the complementary sequence GACTC of the recognition site (GAGTC) of the nicking endonuclease Nt.
The specific implementation mode is as follows: then 5. mu.L of 1. mu.M M-G was added and incubated for 10min, and then incubated at 95 ℃ for 5min, and immediately placed on ice for 10 min.
3. Establishing G tetrad DNA enzyme color developing system
The implementation method of the G quadruplex DNA enzyme chromogenic system comprises the following steps: to 30. mu.L of the product containing the G-rich sequence was added 1 XHEPES buffer, 200nM hemin and 1. mu.L of 1M HCl and mixed well, followed by 2mM ABTS 2- And H 2 O 2 The reaction was allowed to reach a final volume of 100. mu.L, and the color change was visually observed.
To verify the generation of G-rich sequences, they spontaneously folded into G-quadruplets in buffer in the presence of potassium ions, and formed dnase with peroxidase activity in the presence of the cofactor hemin (hemin), which catalyzed the oxidation of colorless ABTS to green by hydrogen peroxide, the entire reaction process is shown in fig. 1. When the target gene does not exist in the sample, LAMP can not be used for specific amplification, further G quadruplet DNA enzyme is not generated, ATBS oxidation reaction can not be catalyzed, and the solution is colorless. And when the content of salmonella in the sample is higher, the LAMP specific product yield is higher, the concentration of the generated trigger chain is higher, more G quadruplet mimic enzyme is generated by stimulation, and the final color change is more obvious.
Example 1: sensitivity testing
The genomic DNA of Salmonella typhimurium CMCC (B)50115 was extracted using a commercially available bacterial genomic DNA extraction kit (Beijing Baitacg Biotechnology Co., Ltd.), and the concentration thereof was measured by a micro ultraviolet spectrophotometer (Thermo Fisher, USA) to calculate the copy number.
Ten times of gradient dilution is carried out on the extracted salmonella genome DNA by sterile water to ensure that the concentration is 10 4 ，10 3 ，10 2 ，10 1 Copies/. mu.L (copies/. mu.L).
And (3) amplifying by using an invA primer by using the salmonella genome DNA with the gradient dilution as a template. The 10 mu L system comprises 1 mu L salmonella DNA template, 1.6 mu M inner primer 1 and inner primerPrimer 2, 0.2. mu.M outer primer 1 and outer primer 2, 0.4. mu.M loop primer 1 and loop primer 2, 1.4mM dNTPs, 3.2U Bst DNA Polymerase Large Fragment, 1 × ThermoPol Buffer, 6mM MgSO 4 Incubation at 65 ℃ for 20 min. 50mM Tris-HCl (pH7.9), 100mM NaCl, 6mM MgSO was added thereto 4 、100μg/mL BSA、10U ScrFI、ddH 2 Supplementing O to 20 μ L, incubating at 37 deg.C for 60min, and treating at 95 deg.C for 10 min. Then, 1.5. mu.L of 10 × Isothermal Amplification Buffer II Pack, 4.8U Bst 3.0DNA Polymerase, 10U Nt.BstNBI, 0.32mM dNTPs, ddH were added 2 O is complemented to 25 mu L and incubated for 10min at 58.8 ℃; then 5. mu.L of 1. mu.M M-G was added, and incubation was continued for 10min, followed by incubation at 95 ℃ for 5min, and immediately placed on ice for 10 min.
The amplification product was mixed with 1 XHEPES buffer, 200nM Hemin and 1. mu.L 1M HCl, followed by 2mM ABTS 2- And H 2 O 2 The final volume of the reaction was set to 100. mu.L, and the color change was visually observed after 5 min.
The results are shown in fig. 2, and the visual detection sensitivity in fig. 2(B) is comparable to the real-time fluorescence LAMP sensitivity in fig. 2(a), and the higher the salmonella content is, the more obvious the final color change is.
Example 2: experiment of specificity
Genomic DNA was extracted from Salmonella typhimurium CMCC (B)50115, Vibrio parahaemolyticus KP9(V.p KP9), Vibrio parahaemolyticus ATCC17802(V.p17802), and Escherichia fergusonii (E.fergusonii) using a commercially available bacterial genomic DNA extraction kit (Beijing Baitach Biotechnology, Ltd.), and the concentrations thereof were measured by a micro ultraviolet spectrophotometer (Thermo Fisher, USA) to calculate the copy number.
The four genomic DNAs were used as templates and amplified with invA primers. The 10. mu.L system included 1. mu.L Salmonella DNA template, 1.6. mu.M inner primer 1 and inner primer 2, 0.2. mu.M outer primer 1 and outer primer 2, 0.4. mu.M loop primer 1 and loop primer 2, 1.4mM dNTPs, 3.2U Bst DNA Polymerase Large Fragment, 1 × ThermoPol Buffer, 6mM MgSO 2 4 Incubation at 65 ℃ for 20 min. 50mM Tris-HCl (pH7.9), 100mM NaCl, 6mM MgSO was added thereto 4 、100μg/mL BSA、10U ScrFI、ddH 2 O to 20. mu.L, incubated at 37 ℃After 60min, the mixture is treated at a high temperature of 95 ℃ for 10 min. Then, 1.5. mu.L of 10 × Isothermal Amplification Buffer II Pack, 4.8U Bst 3.0DNA Polymerase, 10U Nt.BstNBI, 0.32mM dNTPs, ddH were added 2 O is complemented to 25 mu L and incubated for 10min at 58.8 ℃; then 5. mu.L of 1. mu.M M-G was added, and incubation was continued for 10min, followed by incubation at 95 ℃ for 5min, and immediately placed on ice for 10 min.
The amplification product was mixed with 1 XHEPES buffer, 200nM hemin and 1. mu.L 1M HCl, followed by 2mM ABTS 2- And H 2 O 2 The final volume of the reaction was set to 100. mu.L, and the color change was visually observed after 5 min.
As shown in FIG. 3, the detection specificity visualized in FIG. 3(B) is consistent with the detection specificity of real-time fluorescent LAMP in FIG. 3 (A).
Example 3: detection of salmonella in milk
After streaking separation of the salmonella preservation strain, a single colony is picked and transferred to an LB broth liquid culture medium, the culture is carried out for 6 hours at 37 ℃, 10 times of gradient dilution is carried out by using physiological saline, and a plate is counted. Then respectively taking the diluent to inoculate into sterile milk for 10 times dilution, respectively inoculating 8 multiplied by 10 6 CFU/mL to 8X 10 1 CFU/mL Salmonella.
The genomic DNA of the contaminated milk was extracted using a commercially available bacterial genomic DNA extraction kit (Beijing Baitach Biotechnology Co., Ltd.).
The four genomic DNAs were used as templates and amplified with invA primers. The 10. mu.L system included 1. mu.L Salmonella DNA template, 1.6. mu.M inner primer 1 and inner primer 2, 0.2. mu.M outer primer 1 and outer primer 2, 0.4. mu.M loop primer 1 and loop primer 2, 1.4mM dNTPs, 3.2U Bst DNA Polymerase Large Fragment, 1 × ThermoPol Buffer, 6mM MgSO 2 4 Incubation at 65 ℃ for 20 min. 50mM Tris-HCl (pH7.9), 100mM NaCl, 6mM MgSO was added thereto 4 、100μg/mL BSA、10U ScrFI、ddH 2 Supplementing O to 20 μ L, incubating at 37 deg.C for 60min, and treating at 95 deg.C for 10 min. Then, 1.5. mu.L of 10 × Isothermal Amplification Buffer II Pack, 4.8U Bst 3.0DNA Polymerase, 10U Nt.BstNBI, 0.32mM dNTPs, ddH were added 2 O is complemented to 25 mu L and incubated for 10min at 58.8 ℃; then 5. mu.L of 1. mu.M M-G was added,the incubation was continued for 10min, followed by 5min at 95 ℃ and immediately on ice for 10 min.
The amplification product was mixed with 1 XHEPES buffer, 200nM hemin and 1. mu.L 1M HCl, followed by 2mM ABTS 2- And H 2 O 2 The final volume of the reaction was set at 100. mu.L, and the color change was visually observed after 5 min.
The results are shown in FIG. 4, and show that the present invention can detect Salmonella in 800CFU/mL contaminated milk.
The gene sequence involved in the invention is as follows:
SEQ ID No.1；
name: inner primer 1
The source is as follows: artificially synthesized
TCCCGGCAGAGTTCCCATTGAAGAGTCATCATGACGCAGCTGTTGAA
SEQ ID No.2；
Name: inner primer 2
The source is as follows: artificially synthesized
TTCCCGCTGCCGGTATTTGTTGCTACGTTTTGCTTCACGGA
SEQ ID No.3；
Name: outer primer 1
The source is as follows: artificially synthesized
GCGATAATATGGGGCGGAAT
SEQ ID No.4；
Name: outer primer 2
The source is as follows: artificially synthesized
CGCCTTTGCTGGTTTTAGGT
SEQ ID No.5；
Name: loop primer 1
The source is as follows: artificially synthesized
TATTCGGTGGTTTTAAGCGTACTC
SEQ ID No.6；
Name: loop primer 2
The source is as follows: artificially synthesized
GCCGTAACAACCAATACAAATGG
SEQ ID No.7；
Name: molecular machines M-G
The source is as follows: artificially synthesized
TCCCAACCCGCCCTACCCTTTTGACTCGGCAGAGTTCCCATTGAAAT。
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> method for visually detecting salmonella based on nucleic acid amplification coupling G quadruplet DNA enzyme
<130> 200722
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tcccggcaga gttcccattg aagagtcatc atgacgcagc tgttgaa 47
<210> 2
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttcccgctgc cggtatttgt tgctacgttt tgcttcacgg a 41
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tattcggtgg ttttaagcgt actc 24
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gccgtaacaa ccaatacaaa tgg 23
<210> 7
<211> 47
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tcccaacccg ccctaccctt ttgactcggc agagttccca ttgaaat 47
Claims (5)
1. A method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme for non-disease diagnosis purpose is characterized by comprising the following steps:
1) extracting genome DNA of a sample to be detected;
2) LAMP amplification: taking the genomic DNA extracted in the step 1) as a template, performing LAMP amplification in an LAMP amplification system, and incubating at 65 ℃ to obtain an LAMP amplification product;
the amplification product of the step 2) contains restriction enzymeScrFIThe recognition site CCGGG and the nicking endonuclease recognition site GAGTC;
3) performing LAMP amplification product obtained in the step 2)ScrFICutting with restriction enzyme to obtain a restriction enzyme cutting product;
4) generating a plurality of single-stranded DNAs by the restriction enzyme cutting products obtained in the step 3) through the cyclic reciprocation of the nicking endonuclease cutting, the DNA polymerase extension and the strand displacement processes: adding 1 × Isothermal Amplification Buffer II Pack Buffer, Bst 3.0DNA polymerase, Nt.BstNBI nicking endonuclease and dNTPs into the restriction enzyme cleavage product obtained in step 3), and using ddH 2 Supplementing O, and incubating at 58.8 ℃ for 10 min;
5) generation of G-rich sequences: adding a 1 mu M molecular machine M-G into the product obtained in the step 4) to continue incubation, then incubating at 95 ℃ for 5min, and immediately placing on ice;
6) and (3) color development reaction: adding 1 XHEPES buffer solution, cofactor hemin and HCl into 30 μ L of the G-rich sequence product obtained in step 5), mixing, and adding ABTS 2- And H 2 O 2 The final reaction volume is 100 mu L, and the visual detection of the salmonella is realized through reaction color development;
the primers for LAMP amplification in the step 2) are an inner primer 1, an inner primer 2, an outer primer 1, an outer primer 2, a loop primer 1 and a loop primer 2, and the nucleotide sequences are as follows:
an inner primer 1:
TCCCGGCAGAGTTCCCATTGAAGAGTCATCATGACGCAGCTGTTGAA
an inner primer 2: TTCCCGCTGCCGGTATTTGTTGCTACGTTTTGCTTCACGGA
An outer primer 1: GCGATAATATGGGGCGGAAT
An outer primer 2: CGCCTTTGCTGGTTTTAGGT
Loop primer 1: TATTCGGTGGTTTTAAGCGTACTC
And (3) a loop primer 2: GCCGTAACAACCAATACAAATGG;
the molecular machine M-G in the step 5) consists of three parts in sequence: the first part is a LAMP amplification product complementary region, the second part is a nicking endonuclease recognition site complementary region, and the third part is a G-rich sequence complementary region;
the nucleotide sequence of the molecular machinery M-G is:
TCCCAACCCGCCCTACCCTTTTGACTCGGCAGAGTTCCCATTGAAAT；
wherein the nucleotide sequence of the LAMP amplification product complementary region is GGCAGAGTTCCCATTGAAAT, the nucleotide sequence of the nicking endonuclease recognition site complementary region is GACTC, and the nucleotide sequence of the G-rich sequence complementary region is TCCCAACCCGCCCTACCC.
2. The method for detecting salmonella based on nucleic acid amplification coupled G quadruplet DNase visualization for non-disease diagnosis purpose according to claim 1, wherein the LAMP amplification system in the step 2) has a total volume of 10 μ L including 1 μ LL genomic DNA template, 1.6. mu.M inner primer 1 and inner primer 2, 0.2. mu.M outer primer 1 and outer primer 2, 0.4. mu.M loop primer 1 and loop primer 2, 1.4mM dNTPs, 3.2U Bst DNA Polymerase Fragment, 1 × ThermoPol Buffer, 6mM MgSO 4 。
3. The method for the visual detection of Salmonella based on the nucleic acid amplification coupled G quadruplet DNase for non-disease diagnosis purpose as claimed in claim 1, wherein in the step 3), the detection of Salmonella is performed byScrFIThe cutting conditions for the restriction enzyme cleavage are as follows: 10 μ L LAMP amplification product, 50mM Tris-HCl buffer, 100mM NaCl, 6mM MgSO 4 100. mu.g/mL bovine serum albumin, 10U restriction enzymeScrFI、ddH 2 O to 20. mu.L, incubating at 37 ℃ for 60min, and treating at 95 ℃ for 10 min.
4. The method for visually detecting salmonella based on nucleic acid Amplification coupled G quadruplet DNase for non-disease diagnosis purpose according to claim 1, wherein in the step 4), 10 × Isothermal Amplification Buffer II Pack Buffer, Bst 3.0DNA polymerase, Nt.BstNBI nicking endonuclease and dNTPs are respectively added in the following amounts: mu.L of 10 × Isothermal Amplification Buffer II Pack Buffer, 4.8U of Bst 3.0DNA polymerase, 10U of Nt.BstNBI nicking endonuclease, 0.32mM dNTPs.
5. The method for visually detecting the salmonella based on the nucleic acid amplification coupling G quadruplet DNA enzyme for the non-disease diagnosis purpose as claimed in claim 1, wherein in the step 6), if the sample to be detected contains the salmonella, the solution turns green; if the sample to be detected does not contain salmonella, the solution is colorless.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010713260.9A CN111850147B (en) | 2020-07-22 | 2020-07-22 | Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010713260.9A CN111850147B (en) | 2020-07-22 | 2020-07-22 | Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111850147A CN111850147A (en) | 2020-10-30 |
| CN111850147B true CN111850147B (en) | 2022-08-30 |
Family
ID=72950954
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010713260.9A Active CN111850147B (en) | 2020-07-22 | 2020-07-22 | Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111850147B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112816682B (en) * | 2021-01-28 | 2024-03-26 | 浙江省农业科学院 | Triple helix DNA molecular switch probe and application thereof in OTA colorimetric rapid detection |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868158A (en) * | 2017-03-17 | 2017-06-20 | 广东省生态环境技术研究所 | The detection method and detection kit of a kind of salmonella |
| CN107084962A (en) * | 2017-05-24 | 2017-08-22 | 济南大学 | A kind of method for detecting salmonella |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102373284B (en) * | 2011-11-17 | 2012-12-26 | 山东出入境检验检疫局检验检疫技术中心 | Kit capable of quickly detecting amplification of incising incision enzyme nucleic acid of salmonella at constant temperature |
| US11773430B2 (en) * | 2016-10-17 | 2023-10-03 | Arizona Board Of Regents On Behalf Of Arizona State University | Unimolecular aptamer-based sensors for pathogen detection |
| CN107058287B (en) * | 2017-01-16 | 2020-06-16 | 浙江大学 | Method for generating single-chain product in constant-temperature amplification system |
| CN109468363A (en) * | 2018-11-27 | 2019-03-15 | 中国农业大学 | A kind of visualization Cascaded amplification functional nucleic acid sensor of salmonella quantitative detection |
| CN110283919B (en) * | 2019-05-10 | 2021-01-01 | 中国农业大学 | Biosensor and method for quantitative detection of salmonella |
-
2020
- 2020-07-22 CN CN202010713260.9A patent/CN111850147B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106868158A (en) * | 2017-03-17 | 2017-06-20 | 广东省生态环境技术研究所 | The detection method and detection kit of a kind of salmonella |
| CN107084962A (en) * | 2017-05-24 | 2017-08-22 | 济南大学 | A kind of method for detecting salmonella |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111850147A (en) | 2020-10-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Petsios et al. | Conventional and molecular methods used in the detection and subtyping of Yersinia enterocolitica in food | |
| JP6480511B2 (en) | Compositions and methods for quantifying nucleic acid sequences in a sample | |
| Oberst et al. | PCR-based DNA amplification and presumptive detection of Escherichia coli O157: H7 with an internal fluorogenic probe and the 5′ nuclease (TaqMan) assay | |
| Vishnubhatla et al. | Rapid 5′ nuclease (TaqMan) assay for detection of virulent strains of Yersinia enterocolitica | |
| CN104726549B (en) | Novel nicking enzyme-based double-stranded nucleic acid isothermal amplification detection method | |
| JP2023537096A (en) | NUCLEIC ACID DETECTION KIT, METHOD AND APPLICATION THEREOF | |
| DK2902506T3 (en) | DETECTION OF LISTERIA SPECIES IN FOODS AND ENVIRONMENTAL TESTS, PROCEDURES AND COMPOSITIONS THEREOF | |
| US20160047826A1 (en) | Compositions and methods for detection of a target in a molecular assay using ph changes | |
| CN111850147B (en) | Method for visually detecting salmonella based on nucleic acid amplification coupled G quadruplet DNA enzyme | |
| CN115074419A (en) | Method for isothermal amplification of nucleic acid target sequences | |
| JP2018068317A (en) | Kit for quantitative determination method of target nucleic acid | |
| US6268143B1 (en) | Automated high throughput E. coli o157:H7 PCR detection system and uses thereof | |
| CN112680536A (en) | Method for detecting pathogenic microorganism RNA based on criprpr-cas 12f1 | |
| CN116891903A (en) | Cross primer isothermal amplification technology-based detection primer, kit and method for cheese bacillus paracasei | |
| Zhang et al. | Loop‐Mediated Isothermal Amplification Assays for Detecting Yersinia pseudotuberculosis in Milk Powders | |
| CN109852670A (en) | A kind of high specific nucleic acid detection reagent and its application method | |
| KR101752274B1 (en) | Primer set for high sensitive real-time multiplex loop-mediated isothermal amplification reaction for determining type of shiga toxin genes stx1 and stx2 of Enterohemorrhagic Escherichia coli, and method for determining type of shiga toxin genes of Enterohemorrhagic Escherichia coli using the same | |
| CN113046420B (en) | Method for asymmetrically amplifying multiple target nucleic acids | |
| US11530456B2 (en) | Detection of endonuclease activity | |
| JP2013039077A (en) | Primer and kit for detecting food poisoning-causing coliform bacteria | |
| Charoenpanich et al. | A pH sensitive, loop-mediated isothermal amplification assay for detection of Salmonella in food | |
| US20120009575A1 (en) | Inducible nucleic acid targets for detection of pathogens, methods and compositions thereof | |
| Williams | The development of a novel biosensor for single species detection using environmental DNA | |
| KR20130007815A (en) | Primer and probe set for detection and quantification of listeria monocytogenes | |
| EP4253560A1 (en) | Enhanced detection of single-stranded nucleic acids using fokl-assisted digestion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |