CN112680359B - Microalgae culture medium and application thereof - Google Patents
Microalgae culture medium and application thereof Download PDFInfo
- Publication number
- CN112680359B CN112680359B CN202011566006.7A CN202011566006A CN112680359B CN 112680359 B CN112680359 B CN 112680359B CN 202011566006 A CN202011566006 A CN 202011566006A CN 112680359 B CN112680359 B CN 112680359B
- Authority
- CN
- China
- Prior art keywords
- microalgae
- culture medium
- euglena
- kitchen waste
- microalgae culture
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The application belongs to the technical field of microalgae culture, and particularly relates to a microalgae culture medium and application thereof. In a first aspect, the present application provides a microalgae culture medium, comprising: carbon source, KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water; the carbon source is selected from kitchen waste hydrolysate and/or glycerol products; the water is selected from seawater or fresh water. The second aspect of the application discloses application of the microalgae culture medium in promoting microalgae proliferation and promoting microalgae accumulation of polysaccharide. The microalgae culture medium and the application thereof can obviously promote the accumulation of microalgae biomass and microalgae polysaccharide, and the microalgae culture medium has high efficiency of culturing microalgae, low cost and wide industrial application prospect.
Description
Technical Field
The application belongs to the technical field of microalgae culture, and particularly relates to a microalgae culture medium and application thereof.
Background
Microalgae are autotrophic plants which are widely distributed on land and sea, rich in nutrition and high in photosynthetic efficiency, and polysaccharides, proteins, pigments and the like generated by cell metabolism, so that the microalgae have good development prospects in the fields of food, medicine, genetic engineering, liquid fuel and the like. Algae are very different in size, wherein the microalgae group whose morphology can only be identified under a microscope is called microalgae (microalgae), so that the microalgae is not a taxonomic name.
Microalgae are rich in various nutritional components, for example, euglena is rich in various excellent components including euglena polysaccharide, amino acids, unsaturated fatty acids, vitamins and antioxidant components. Wherein the euglena polysaccharide is composed of linear beta-1, 3-glucan, is not easy to digest by human body, can adsorb redundant substances in human body and eliminate the substances in vitro, and has extremely high antioxidation effect. In addition, the euglena has strong ability to synthesize amino acids, and contains all amino acids required by human beings. In japan and europe, euglena has been widely used as a rich nutritional additive in foods and health products. Nude algae is approved as a new food raw material in 2013 in China, and is also brought into the feed raw material catalog in 2018 by Ministry of agriculture.
In the process of culturing microalgae by adopting the traditional microalgae culture medium, the following problems exist, on one hand, the cost of the traditional microalgae culture medium is higher, and the cost of microalgae culture is increased; on the other hand, the value-added rate of microalgae and the yield of polysaccharide are low, and the current commercial demand cannot be met. Therefore, the development of a cheap culture medium capable of significantly promoting microalgae biomass and microalgae polysaccharide is a technical problem to be solved urgently by those skilled in the art.
Disclosure of Invention
In view of the above, the application provides a microalgae culture medium and an application thereof, which can significantly promote the accumulation of microalgae biomass and microalgae polysaccharide, and the microalgae culture medium has high efficiency and low cost for culturing microalgae, and has a wide industrial application prospect.
The first aspect of the present application provides a microalgae culture medium, comprising:
carbon source, KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water;
the carbon source is selected from kitchen waste hydrolysate and/or glycerol products.
More preferably, the carbon source is kitchen waste hydrolysate and glycerol products.
Preferably, the kitchen waste hydrolysate is kitchen waste hydrolysate obtained by hydrolyzing dry kitchen waste with enzyme.
Wherein the total sugar content of the kitchen waste is 550.3mg/g, the starch content is 481.1mg/g, the protein content is 89.4mg/g, and the total lipid content is 141.6mg/g.
The kitchen waste comprises wheat, rice, corn, potatoes, sweet potatoes and products thereof, and preferably, the kitchen waste is a wheat product. The collection sites for the kitchen waste include, but are not limited to, canteens, restaurants, homes, and markets.
Preferably, the enzyme is selected from one or more of glucoamylase, gamma-amylase and glucosidase.
Preferably, the water comprises, in terms of concentration:
specifically, the glycerol product is crude glycerol, and the concentration of the crude glycerol in the water is 100-400mM.
More preferably, the concentration of the kitchen waste hydrolysate is 20-40g/L; the concentration of the crude glycerol is 200-400mM. Most preferably, the concentration of the kitchen waste hydrolysate is 20g/L; the concentration of the crude glycerol was 200mM.
Preferably, the glycerol product has a glycerol content of 75% to 95%.
Wherein the glycerol product is crude glycerol from industrial byproduct sources.
Wherein the glycerol product may be crude or commercial glycerol, the crude glycerol comprising glycerol, water, ash, sodium chloride, and methanol; 75-95 parts of glycerol, 3.5-18.5 parts of water, 0.27 part of ash, 0.2 part of sodium chloride and 0.15 part of methanol by mass.
The second aspect of the application discloses the application of the microalgae culture medium in promoting microalgae proliferation and microalgae accumulation of polysaccharide.
Preferably, the plant is selected from the group consisting of Euglena, chlorella, dunaliella salina and Haematococcus pluvialis.
More preferably, said is selected from euglena.
Wherein, the microalgae source is selected from seawater or fresh water, for example, when culturing euglena, the water is selected from fresh water.
Preferably, the method of applying comprises: inoculating microalgae into the microalgae culture medium for heterotrophic or mixotrophic culture; the microalgae culture medium comprises a carbon source and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water;
the carbon source is selected from kitchen waste hydrolysate and/or glycerol products;
the water is selected from seawater or fresh water.
Preferably, the microalgae culture medium comprises, in terms of concentration, in the water:
preferably, the method of applying comprises: inoculating microalgae into the first microalgae culture medium for heterotypic or mixed culture, adding the glycerol product into the first microalgae culture medium when the microalgae enters the exponential phase of the microalgae, and continuously culturing the microalgae until the culture is finished; the first microalgae culture medium comprises kitchen waste hydrolysate and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water.
Preferably, the first microalgae culture medium comprises, in terms of concentration, in the water:
preferably, the method of applying comprises: inoculating microalgae into the second microalgae culture medium for heterotypic or mixed culture, adding the kitchen waste hydrolysate into the second microalgae culture medium when the microalgae enter the exponential phase of the microalgae, and continuously culturing the microalgae until the culture is finished; the second microalgae culture medium comprises glycerol product and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water.
Preferably, the glycerol product is selected from crude glycerol; in said water, calculated as concentration, comprising:
wherein the exponential phase of the microalgae is from 2 to 4 days calculated from the first day of inoculation.
Preferably, the initial density of the microalgae inoculated into the microalgae culture medium is 1 × 10 5 -1×10 6 one/mL.
More preferably, the initial density of the microalgae inoculated into the microalgae culture medium is 1.5 × 10 5 one/mL.
Preferably, the culture period of the microalgae from the beginning to the end of inoculation culture is 4-8 days.
More preferably, the culture period of the microalgae from the beginning to the end of inoculation is 6 days.
More preferably, the culturing of the microalgae is heterotrophic.
The third aspect of the application discloses a preparation method of the microalgae culture medium, which comprises the following steps:
mixing carbon source and KH 2 PO 4 、MgSO 4 ·7H 2 Mixing O, potassium citrate, vitamin B1, vitamin B12 and water, and sterilizing to obtain microalgae culture medium; wherein the carbon source is selected from kitchen waste hydrolysate and/or glycerol products.
Preferably, the sterilization method is a conventional sterilization method such as filtration sterilization through a 0.22 μm membrane, high temperature sterilization, and ultraviolet sterilization.
Preferably, the carbon source can be added to the microalgae culture medium in a mode that the kitchen waste hydrolysate or glycerol product is added independently, or the kitchen waste hydrolysate and the glycerol product are added in batches.
The kitchen waste hydrolysate and glycerol product batch adding method comprises the following steps:
firstly, hydrolysate of kitchen waste and KH 2 PO 4 、MgSO 4 ·7H 2 Mixing O, potassium citrate, vitamin B1, vitamin B12 and water to prepare a first microalgae culture medium, and inoculating microalgaeAfter the microalgae is cultured in the first culture medium, adding a glycerol product into the first culture medium in the exponential phase of the microalgae, and continuing culturing to complete the preparation of the microalgae culture medium;
firstly, glycerin product and KH are prepared 2 PO 4 、MgSO 4 ·7H 2 Mixing O, potassium citrate, vitamin B1, vitamin B12 and water, preparing a second microalgae culture medium, inoculating microalgae to the second culture medium, adding kitchen waste hydrolysate to the second culture medium in the exponential phase of the microalgae, and continuing to culture to complete the preparation of the microalgae culture medium.
The application develops a novel low-cost microalgae culture medium, and the microalgae culture medium comprises a carbon source and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water, wherein the carbon source is selected from kitchen waste hydrolysate or/and glycerol products. Wherein, the kitchen waste is discarded waste, and the glycerol product is an industrial byproduct, so that the sources of the kitchen waste hydrolysate or/and the glycerol product are very wide and cheap, and the culture cost of microalgae can be reduced. The experimental result shows that the microalgae culture medium containing the kitchen waste hydrolysate has the effects of promoting microalgae biomass and promoting microalgae polysaccharide accumulation; the microalgae culture medium containing the glycerol product has the effects of promoting microalgae biomass and promoting microalgae polysaccharide accumulation; the microalgae culture medium containing the kitchen waste hydrolysate and the crude glycerol also has the effects of promoting microalgae biomass and promoting microalgae polysaccharide accumulation. The results show that the kitchen waste hydrolysate and the crude glycerol can promote heterotrophic metabolism of microalgae to improve cell division efficiency and polysaccharide metabolism regardless of being used as a single carbon source or a combined carbon source, and the kitchen waste hydrolysate and the crude glycerol can promote accumulation of euglena biomass and euglena polysaccharide.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
Fig. 1 is a measurement result of glucose content in a kitchen waste hydrolysis process provided in an embodiment of the present application, where an abscissa represents hydrolysis time (unit: hour), and an ordinate represents glucose concentration (unit: g/L);
FIG. 2 is a graph showing the growth curve of Euglena inoculated into different microalgal media according to the example of the present application, with the abscissa representing the culture time (unit: day) and the ordinate representing the number of cells (unit: 10) 6 Per mL), wherein A is a growth curve of euglena under the condition of mixed culture of the euglena in the microalgal culture medium of kitchen waste hydrolysate with different concentrations, B is a growth curve of the euglena under the condition of heterotrophic culture of the euglena in the microalgal culture medium of the kitchen waste hydrolysate with different concentrations, C is a growth curve of the euglena under the condition of mixed culture of the euglena in the microalgal culture medium of crude glycerol with different concentrations, and D is a growth curve of the euglena under the condition of heterotrophic culture of the euglena in the microalgal culture medium of crude glycerol with different concentrations;
FIG. 3 is a graph showing the growth curve of Euglena inoculated to a microalgae culture medium containing kitchen garbage hydrolysate and crude glycerol, wherein the abscissa represents the culture time (unit: day) and the ordinate represents the cell number (unit: 10) 6 Per mL), wherein A is a culture medium inoculated to the 1st day and is a first microalgae culture medium containing kitchen waste hydrolysate, crude glycerol is a naked algae polyculture and heterotrophic growth curve of the first microalgae culture medium added to the 3 rd day, B is a culture medium inoculated to the 1st day and is a second microalgae culture medium containing crude glycerol, and the kitchen waste hydrolysate is a naked algae polyculture and heterotrophic growth curve of the second microalgae culture medium added to the 3 rd day;
FIG. 4 is a diagram illustrating biomass variation of Euglena inoculated in different microalgae culture media to a plateau stage according to an embodiment of the present application, where the ordinate is Euglena biomass (unit: g/L), where A is the Euglena biomass inoculated in a mixed culture state of the microalgae culture media containing kitchen waste hydrolysate at different concentrations, B is the Euglena biomass inoculated in a heterotrophic state of the microalgae culture media containing kitchen waste hydrolysate at different concentrations, C is the Euglena biomass inoculated in a mixed culture state of the microalgae culture media containing crude glycerol at different concentrations, D is the Euglena biomass inoculated in a heterotrophic state of the microalgae culture media containing crude glycerol at different concentrations, E is the first microalgae culture medium containing kitchen waste hydrolysate at day 1, crude glycerol is the Euglena biomass in a mixed culture and heterotrophic state at day 3 when the first microalgae culture medium is started to be added, and F is the second microalgae culture medium containing crude glycerol at day 1 when the second microalgae culture medium and the heterotrophic culture medium are started to be added at day 3;
fig. 5 is a graph showing the change of the content of euglena polysaccharide inoculated in different microalgae culture media until plateau phase provided by the embodiment of the application, wherein the ordinate represents the dry weight ratio (unit:% dry weight) of the euglena polysaccharide, a represents the content of the euglena polysaccharide inoculated in the mixed culture state of the microalgae culture medium containing kitchen waste hydrolysate with different concentrations, B represents the content of the euglena polysaccharide inoculated in the heterotrophic state of the microalgae culture medium containing kitchen waste hydrolysate with different concentrations, C represents the content of the euglena polysaccharide inoculated in the mixed culture state of the microalgae culture medium containing crude glycerol with different concentrations, D represents the content of the euglena polysaccharide inoculated in the heterotrophic state of the microalgae culture medium containing crude glycerol with different concentrations, E represents the first microalgae culture medium containing kitchen waste hydrolysate with different concentrations, crude glycerol starts to be added with the first microalgae culture medium on day 3 and has the content of the euglena polysaccharide inoculated in the mixed culture state, F represents the culture medium containing crude glycerol on day 1 and starts to be added with the second microalgae culture medium with the mixed culture medium with the kitchen waste hydrolysate on day 3;
FIG. 6 shows that Euglena provided in the present application is inoculated into different microalgae culture media and cultured to the Euglena EgGSL1 gene transcription level at day 4, and the ordinate represents the relative expression amount of the Euglena EgGSL1 gene; a is the relative expression quantity of euglena EgGSL1 gene inoculated in a microalgae culture medium mixotrophic state containing kitchen waste hydrolysate with different concentrations, B is the relative expression quantity of the euglena EgGSL1 gene inoculated in a microalgae culture medium heterotrophic state containing kitchen waste hydrolysate with different concentrations, C is the relative expression quantity of the euglena EgGSL1 gene inoculated in a microalgae culture medium mixotrophic state containing crude glycerol with different concentrations, D is the relative expression quantity of the euglena EgGSL1 gene inoculated in a microalgae culture medium heterotrophic state containing crude glycerol with different concentrations, E is the relative expression quantity of the euglena EgGSL1 gene inoculated in a culture medium mixotrophic state containing kitchen waste hydrolysate on day 1, E is the first microalgae culture medium inoculated with kitchen waste hydrolysate, crude glycerol is added in the first microalgae culture medium on day 3 to be mixotrophic and heterotrophic state, F is the relative expression quantity of the euglena EgGSL1 gene inoculated in day 1 culture medium inoculated with crude glycerol, and the second microalgae culture medium is added with the second relative expression quantity of the heterotrophic state of the euglena EgGSL1 gene;
FIG. 7 shows that Euglena provided in the present application is inoculated into different microalgae culture media and cultured to the Euglena EgGSL2 gene transcription level at day 4, and the ordinate represents the relative expression amount of the Euglena EgGSL2 gene; a is the relative expression quantity of euglena EgGSL2 genes inoculated in a microalgae culture medium containing kitchen waste hydrolysate with different concentrations in a mixed culture state, B is the relative expression quantity of the euglena EgGSL2 genes inoculated in a microalgae culture medium containing kitchen waste hydrolysate with different concentrations in a heterotrophic state, C is the relative expression quantity of the euglena EgGSL2 genes inoculated in a microalgae culture medium containing crude glycerol with different concentrations in a mixed culture state, D is the relative expression quantity of the euglena EgGSL2 genes inoculated in a microalgae culture medium containing crude glycerol with different concentrations in a heterotrophic state, E is the first microalgae culture medium inoculated with kitchen waste hydrolysate on day 1, crude glycerol is the first microalgae culture medium inoculated in the first microalgae culture medium on day 3 in a mixed culture state and the euglena EgGSL2 genes inoculated in the heterotrophic state, F is the second microalgae culture medium inoculated on day 1 in a second microalgae culture medium containing crude glycerol in a mixed culture medium added with the second microalgae culture medium on day 3 in a mixed culture medium added with the second euglena EgGSL gene in the heterotrophic state and the second microalgae culture medium added with the second glutathione expressed quantity.
Detailed Description
The microalgae culture medium and the application thereof can obviously promote the accumulation of microalgae biomass and microalgae polysaccharide, and the microalgae culture medium has high efficiency of culturing microalgae, low cost and wide industrial application prospect.
The technical solutions in the embodiments of the present application will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.
The reagents or raw materials used in the following examples are commercially available or self-made.
Example 1
The embodiment of the application provides a kitchen waste collection and hydrolysis test, which comprises the following specific steps:
1. the kitchen waste is collected in dining halls of Chinese university of Guangzhou river, and is mainly made of noodles, steamed bread, bread and rice. And (3) placing the collected kitchen waste in an oven for overnight drying at the temperature of 60 ℃, and then placing the kitchen waste in the temperature of-20 ℃ for storage.
2. 300g of the oven-dried kitchen waste is crushed by a stirrer and put into a 2.5L hydrolysis tank, the reaction volume is adjusted to 2.0L by pure water, 10mL of commercial glucoamylase is added and the mixture is hydrolyzed at 55 ℃ and 300rpm for 24h, and the obtained product is marked as a sample solution. During the hydrolysis process, the pH of the sample solution is kept at about 4.0 by using an acid regulator.
3. Sampling 1mL from the bioreactor at intervals during enzymolysis for 24h to determine the glucose content; after the completion of the enzymatic hydrolysis, 1mL of the sample was also taken for glucose content measurement. The glucose content determination step comprises the following steps: the sample solution was centrifuged at 5000rpm for 10min to collect the supernatant, and vacuum filtered through a 0.22 μm membrane. Glucose content was then determined by high performance liquid chromatography. The chromatographic conditions were as follows: chromatographic conditions are as follows: waters high Performance liquid chromatography was equipped with a Bio-rad Aminex HPX-87H column and a Waters refractive index detector. The mobile phase was 5mM sulfuric acid, and the flow rate was 0.5mL/min. The flow column temperature and refractive index detector temperature were 65 ℃ and 35 ℃ respectively. And (4) establishing a standard curve by taking glucose as a standard substance, and calculating the glucose content in the sample solution.
4. And after the hydrolysis process is finished, centrifuging the sample solution at 5000rpm for 10min at room temperature to obtain a supernatant, and then performing vacuum filtration on the supernatant by using a 0.22-micron membrane to obtain sterile and clear kitchen waste hydrolysate.
The glucose content determination result in the kitchen waste hydrolysis process is shown in fig. 1, through determination, the glucose content of the kitchen waste hydrolysate in the embodiment is shown in fig. 1, and in 1 hour, the glucoamylase rapidly hydrolyzes the starch content in the kitchen waste to enable the glucose concentration to reach 90g/L; after 24 hours of hydrolysis, the glucose concentration can reach 116g/L. Fig. 1 shows that the kitchen waste is enzymolyzed into hydrolysate which is high in glucose.
Example 2
The embodiment of the application provides an analysis experiment for kitchen waste and kitchen waste hydrolysate obtained in the embodiment 1, and the method comprises the following specific steps:
the total sugar components of the kitchen waste and the kitchen waste hydrolysate are detected by a phenol-sulfuric acid method: 2g of kitchen waste and 2mL of kitchen waste hydrolysate obtained in example 1 are collected, freeze-dried for 48h by using a Ningbo Xinzhi freeze-drying machine, and then placed into a 50mL centrifuge tube, and 1mL of deionized water is added into the tube. After vortexing for 30s, 1mL of 5% phenol solution was added to the centrifuge tube, followed by slow addition of 5mL of 98% concentrated sulfuric acid along the tube wall. Incubating in water bath at 25 deg.C for 10min, and then transferring to 30 deg.C for 20min. After the steps are carried out by taking commercial pure glucose as a standard substance, respectively adding the reaction liquid of the standard substance, the reaction liquid of the kitchen waste and the reaction liquid of the hydrolysis liquid of the kitchen waste into a 96-well plate which is arranged in sequence in advance, and detecting the light absorption value under 483nm by using a Bio-Tek enzyme-linked immunosorbent assay. And drawing a standard curve according to the pore values of different standard substance concentrations, and calculating the total sugar content of the kitchen waste and the kitchen waste hydrolysate by using the standard curve and the sample adding volume of the sample.
The starch component of the kitchen waste is detected by an enzyme hydrolysis method: 2g of kitchen waste was collected and placed in a funnel containing filter paper, first rinsed with 10mL of diethyl ether to remove the fat from the kitchen waste, and then rinsed with 85% ethanol to remove the soluble sugars from the kitchen waste. And detecting the residual kitchen waste by adopting a phenol-sulfuric acid method.
Detecting soluble protein components of the kitchen waste and the kitchen waste hydrolysate: 2g of kitchen waste and 2mL of kitchen waste hydrolysate obtained in example 1 are collected, freeze-dried for 48h by using a Ningbo Xinzhi freeze-drying machine, and then put into a 5mL centrifuge tube, and 1mL of pyrolysis solution of IPA is added, and the mixture is uniformly mixed and then is kept stand overnight at the temperature of minus 20 ℃. The overnight solution was placed on ice, vortexed for 30s after every 10min, centrifuged for 10min at 12,000rpm after 12 repetitions, and the supernatant collected in a 1.5mL Eppendorf tube. The samples were added to the sample wells of a 96-well plate in proportion, and less than 20. Mu.L of the sample was made up to 20. Mu.L with RIPA lysate. Adding the standard substance in the Byunnan BCA protein concentration determination kit into the standard substance hole according to the proportion, and supplementing less than 20 mu L of RIPA lysate to 20 mu L. Adding 200 mu L of BCA working solution into the sample wells and the standard wells, placing the 96-well plate in an incubator at 37 ℃ for incubation for 30min, detecting the light absorption value under 562nm by using a Bio-Tek microplate reader, drawing a standard curve according to the standard well value, and calculating the protein concentration by using the standard curve and the sample adding volume.
Detecting the total lipid components of the kitchen waste and the kitchen waste hydrolysate: 2g of kitchen waste and 2mL of kitchen waste hydrolysate obtained in example 1 are collected, freeze-dried for 48h by using a Ningbo Xinzhi freeze-drying machine, and then placed into a 15mL centrifuge tube, and 3.8mL of methanol, chloroform and deionized water are added according to a volume ratio of 2.8. Carrying out ultrasonic crushing for 5min by using a Xinzhi ultrasonic cell crusher under the power of 30%, then adding chloroform and deionized water into a tube according to the volume ratio of 1.
The measurement results of the components of the kitchen waste and the kitchen waste hydrolysate are shown in table 1, wherein the recovery rate is the percentage of the component content in the kitchen waste hydrolysate to the component content of the kitchen waste raw material, and through measurement, the main component content of the kitchen waste in the experiment is shown in table 1, wherein the total sugar content in the kitchen waste is 550.3mg/g, the starch content is 481.1mg/g, the protein content is 89.4mg/g, and the total lipid content is 141.6mg/g; the main component content of the kitchen waste hydrolysate in the embodiment is shown in table 1, wherein the total sugar content in the kitchen waste hydrolysate is 427.7mg/g, the recovery rate reaches 77.7%, the protein content is 10.5mg/g, and the total lipid content is 10.9mg/g. Table 1 shows that total sugar, especially starch, in the kitchen waste is completely enzymatically hydrolyzed into glucose.
TABLE 1 determination results of contents of main components of kitchen waste and kitchen waste hydrolysate
| Components | Kitchen garbage (mg/g) | Kitchen garbage hydrolysate (mg/g) | Recovery (%) |
| Total sugar | 550.3±20.3 | 427.7±16.1 | 77.7 |
| Starch | 481.1±17.7 | N.D. | - |
| Lipid | 141.6±5.9 | 10.9±0.6 | 7.7 |
| Protein | 89.4±4.5 | 10.5±0.9 | 11.7 |
Wherein "-" means absent.
Example 3
The embodiment of the application provides preparation of different microalgae culture media, and the preparation method comprises the following specific steps:
preparing microalgae culture media of kitchen waste hydrolysate with different concentrations: the preparation comprises fresh water and KH 2 PO 4 0.02g/L、MgSO 4 ·7H 2 A microalgae culture medium containing 0.025g/L of O, 0.5 mu g/L of vitamin B, 0.04g/L of potassium citrate and 0.4mg/L of vitamin B and not containing a carbon source; respectively adding 10g/L, 20g/L, 30g/L and 40g/L of kitchen waste hydrolysate into the microalgae culture medium without the carbon source according to a proportion; and preparing the microalgae culture medium containing the kitchen waste hydrolysate with different concentrations.
Preparation of microalgae culture media of crude glycerol with different concentrations: the preparation comprises fresh water and KH 2 PO 4 0.02g/L、MgSO 4 ·7H 2 A microalgae culture medium containing 0.025g/L of O, 0.5 mu g/L of vitamin B, 0.04g/L of potassium citrate and 0.4mg/L of vitamin B and not containing a carbon source; the microalgae culture media containing crude glycerol at different concentrations were prepared by adding crude glycerol at 100mM, 200mM, 300mM, and 400mM to the microalgae culture media containing no carbon source. Wherein the crude glycerol has the following components: 85% glycerol, 6.5% water, 0.27% ash, 0.2% sodium chloride and 0.15% methanol.
Preparing a microalgae culture medium containing kitchen waste hydrolysate and crude glycerol oil: the preparation comprises fresh water and KH 2 PO 4 0.02g/L、MgSO 4 ·7H 2 0.025g/L of O, 0.5 mu g/L of vitamin B, 0.04g/L of potassium citrate and 0.4mg/L of vitamin B; adding the kitchen waste hydrolysate into a microalgae culture medium without a carbon source at the concentration of 10g/L to prepare a first microalgae culture medium containing the kitchen waste hydrolysate, then inoculating euglena into the first microalgae culture medium, and then adding 100mM crude glycerol into the first microalgae culture medium on the 3 rd day.
Preparing a microalgae culture medium containing kitchen waste hydrolysate and crude glycerol: the preparation comprises fresh water and KH 2 PO 4 0.02g/L、MgSO 4 ·7H 2 0.025g/L of O and 0 of vitamin B12.5 mu g/L of microalgae culture medium containing no carbon source, 0.04g/L of potassium citrate and 0.4mg/L of vitamin B; adding the crude glycerol into a microalgae culture medium containing no carbon source at the concentration of 100mM to prepare a second microalgae culture medium containing the crude glycerol, then inoculating euglena into the second microalgae culture medium, and then adding 10g/L kitchen waste hydrolysate into the second microalgae culture medium on the 3 rd day.
Example 4
The present application provides a growth curve assay for inoculating euglena into different microalgal media of example 3, comprising the following specific steps:
euglena gracilis was isolated from Ming lake water area of Yangzhou river-south university. The culture of euglena gracilis is divided into a heterotrophic mode and a mixed culture mode (photoautotrophy and heterotrophic simultaneous culture), the conventional heterotrophic and mixed culture modes of euglena gracilis are adopted in the embodiment of the application, sterile aeration culture is carried out in a constant-temperature incubator, the sterile aeration rate is 3L/min, and the culture temperature is 25 +/-1 ℃. Wherein the light intensity is 0 μmol in heterotrophic mode -2 s -1 (ii) a The illumination intensity is 120 +/-10 mu mol under the mixed culture mode -2 s -1 12h/12h light-dark period. Initial Euglena density of 1.5 × 10 5 Individual cells/mL.
Inoculating Euglena into microalgae culture medium containing kitchen waste hydrolysate with different concentrations, wherein the culture method comprises mixed culture and heterotrophic culture, and the initial inoculation density of Euglena is 1.5 × 10 5 The growth cycle of Euglena was determined by counting the concentration of individual cells/mL, and then using a phytoplankton counting box every day, and a growth curve was plotted. The result of euglena growth curve measurement is shown in fig. 2, wherein H0 in fig. 2A and 2B is the microalgae culture medium prepared in example 3 and containing no carbon source, H0 in fig. 2A and 2B is a control group, and the rest are experimental groups, and H10, H20, H30 and H40 are microalgae culture media containing kitchen waste hydrolysate prepared by adding 10g/L, 20g/L, 30g/L and 40g/L kitchen waste hydrolysate, respectively. FIG. 2A shows the growth curve of Euglena mixedly cultured in a microalgae culture medium containing kitchen waste hydrolysate, with an initial inoculation density of 1.5 × 10 5 Individual cells/mL, starting on day 2, the control group H0 Euglena started to enter the fast growth phase at day 6The Euglena grows smoothly in the day, the 1st to 5 th days of inoculation is the logarithmic growth phase of Euglena, the Euglena grows into the plateau phase in the 6 th day, and the growth reaches 5.2 multiplied by 10 6 Individual cells/mL; when kitchen waste hydrolysate is used as a carbon source, the growth of euglena is obviously better than that of a control group, wherein the kitchen waste hydrolysate containing 20g/L is optimal, from the 2 nd day, the euglena starts to enter a rapid growth stage, from the 4 th day, the euglena grows smoothly, the inoculated 1st to 3 th days are the logarithmic growth phase of the euglena, the euglena grows to a plateau phase in the 4 th day, and the growth reaches 8.6 multiplied by 10 6 Individual cells/mL. In this example, FIG. 2B shows the heterotrophic growth curve of Euglena in a microalgal culture medium containing kitchen waste hydrolysate, with an initial inoculation density of 1.5X 10 5 Starting from day 2, the control group H0 Euglena starts to enter the rapid growth stage under mixed culture, the Euglena grows smoothly at day 7, the inoculated day 1-6 is the logarithmic growth phase of Euglena, the Euglena growth enters the plateau phase at day 7, and the cell/mL reaches 5.5 × 10 6 Individual cells/mL; when kitchen waste hydrolysate is used as a carbon source, the growth of euglena is obviously better than that of a control group, wherein 20g/L kitchen waste hydrolysate is optimal, euglena starts to enter a rapid growth stage from day 2, the euglena grows smoothly on day 5, the inoculated day 1-4 is the logarithmic growth stage of the euglena, the euglena grows into a plateau stage on day 5, and the growth reaches 8.9 multiplied by 10 6 Individual cells/mL.
Inoculating Euglena into microalgae culture medium containing crude glycerol with different concentrations, wherein the culture modes are mixed culture and heterotrophic, and the initial inoculation density of Euglena is 1.5 × 10 5 The individual cells/mL, and then the concentration of euglena was calculated daily using a phytoplankton counting box to determine the growth cycle of euglena, and a growth curve was drawn. The results of the Euglena growth curve measurement are shown in FIG. 2, in which H0 of FIGS. 2C and 2D is the microalgae medium containing no carbon source prepared in example 3, H0 of FIGS. 2C and 2D is the control group, and the rest are the experimental groups, and G100, G200, G300 and G400 are microalgae media containing crude glycerol prepared by adding crude glycerol of 100mM, 200mM, 300mM and 400mM, respectively. FIG. 2C is a graph showing the growth curve of Euglena in a microalgal culture medium containing crude glycerol, at an initial inoculation density of 1.5X 10 5 Individual cells/mL, from day 2, control EuglenaStarting to enter into rapid growth stage, wherein the Euglena grows smoothly on day 6, the inoculated day 1-5 is the logarithmic growth phase of Euglena, and the Euglena grows into plateau phase on day 6 to reach 5.2 × 10 6 Individual cells/mL; when crude glycerol is used as a carbon source, the growth of the euglena is obviously better than that of a control group G0, wherein the optimal performance is realized by using 200mM crude glycerol, the euglena starts to enter a rapid growth stage from day 2, the euglena grows smoothly on day 5, the inoculated day 1-4 is the logarithmic growth phase of the euglena, the euglena grows into a plateau phase on day 5, and the growth reaches 7.0 multiplied by 10 6 Individual cells/mL. FIG. 2D is a graph showing the growth curve of Euglena heterotrophically in a microalgal culture medium containing raw glycerol at an initial inoculum density of 1.5X 10 5 Starting from day 2, the control group Euglena starts to enter into rapid growth stage under heterotrophic condition, the Euglena grows smoothly at day 7, the inoculated day 1-6 is the logarithmic growth phase of Euglena, the Euglena grows into plateau phase at day 7, and the cell/mL reaches 5.5 × 10 6 Individual cells/mL; when crude glycerol is used as a carbon source, the growth of the euglena is obviously better than that of a control group, wherein the crude glycerol of 200mM is optimal, the euglena starts to enter a rapid growth stage from day 2, the growth of the euglena is smooth on day 6, the inoculated day 1-5 is the logarithmic growth stage of the euglena, the growth of the euglena enters a plateau stage on day 6, and the growth reaches 7.4 multiplied by 10 6 Individual cells/mL. Fig. 2 shows that in the heterotrophic state, the euglena plateau phase is significantly advanced compared to the mixotrophic state, and the growth state of the group using kitchen waste hydrolysate or crude glycerol as a carbon source is significantly higher than that of the group without adding kitchen waste hydrolysate or crude glycerol, wherein the effect of 20g/L kitchen waste hydrolysate and 200mM crude glycerol is optimal.
The euglena is inoculated to a first microalgae culture medium containing kitchen waste hydrolysate, and then 100mM crude glycerol is added to the first microalgae culture medium on the 3 rd day. FIG. 3A shows the growth curve of Euglena in mixed culture and heterotrophic culture with 20g/L kitchen waste hydrolysate and 200mM crude glycerol as combined carbon source, the culture medium inoculated on day 1 as the first microalgae culture medium containing kitchen waste hydrolysate, and crude glycerol added to the first microalgae culture medium on day 3, with initial inoculation density of 1.5 × 10 5 Individual cells/mL, in polyculture, starting from day 2, euglenaEntering into rapid growth stage, wherein the Euglena grows smoothly on day 7, the inoculated day 1-6 is the logarithmic growth phase of Euglena, and the Euglena growth on day 7 enters into plateau phase to 9.7 × 10 6 Individual cells/mL; under heterotrophic conditions, from day 2, euglena starts to enter into rapid growth stage, euglena grows smoothly on day 8, the inoculated day 1-7 is Euglena logarithmic growth stage, and the Euglena growth stage on day 8 reaches 1.0 × 10 7 Individual cells/mL.
And (3) inoculating the euglena to a second microalgae culture medium containing crude glycerol, and then adding 10g/L kitchen waste hydrolysate to the second microalgae culture medium on the 3 rd day. FIG. 3B shows that the Euglena has a combined carbon source of 20g/L kitchen waste hydrolysate and 200mM crude glycerol, the culture medium inoculated on day 1 is a second microalgae culture medium containing crude glycerol, the kitchen waste hydrolysate has a growth curve under the mixotrophic and heterotrophic culture of Euglena with the second microalgae culture medium added on day 3, and the initial inoculation density is 1.5 × 10 5 Each cell/mL, in mixed culture, from day 2, the Euglena starts to enter into rapid growth stage, the Euglena grows smoothly at day 6, the inoculated day 1-5 is the logarithmic growth phase of Euglena, the Euglena growth enters into plateau phase at day 6, and the growth reaches 9.0 × 10 6 Individual cells/mL; under mixed culture, from day 2, euglena starts to enter into rapid growth stage, euglena grows smoothly at day 7, the inoculated day 1-6 is Euglena logarithmic growth stage, and the Euglena growth stage at day 7 reaches 9.2 × 10 6 Individual cells/mL. FIG. 3 shows that the growth of Euglena is significantly improved under the condition of using kitchen waste hydrolysate and crude glycerol as carbon sources compared with the condition of using single carbon source.
Example 5
The embodiment of the application provides a plateau stage biomass measurement of euglena under different culture conditions, and the method comprises the following specific steps:
inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate with different concentrations for mixed culture and heterotrophic culture; inoculating the euglena in the embodiment 4 to a microalgae culture medium containing crude glycerol with different concentrations for mixed culture and heterotrophic culture; inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate and crude glycerol for mixed culture and heterotrophic culture; then, the euglena in plateau phase under different culture conditions was centrifuged at 5,000rpm for 10min at 4 ℃ to collect algal puree in a pre-weighed 1.5ml leppendorf tube, and the procedure was repeated three times after vortexing 30s after resuspending the algal puree with phosphate buffer, and centrifuged at 5,000rpm for 10min at 4 ℃ to collect the algal puree. And (3) putting the 1.5mL Eppendorf tube filled with the algae mud into a 60 ℃ oven to be dried to constant weight, accurately weighing the tube containing the euglena by an analysis electronic balance, and calculating the final euglena biomass.
The results of the bioassays of Euglena are shown in FIG. 4. FIG. 4 shows the biomass content of euglena in plateau phase under different culture conditions, wherein FIG. 4A shows that the euglena biomass is in a mixotrophic state in a microalgae culture medium containing kitchen waste hydrolysate with different concentrations, wherein the biomass of a control group H0 is 3.8g/L, and the biomass is optimal under the microalgae culture medium using 20g/L kitchen waste hydrolysate as a carbon source, and the biomass reaches 6.3g/L; FIG. 4B shows the euglena biomass in heterotrophic state in the microalgae culture medium containing different concentrations of kitchen waste hydrolysate, wherein the biomass of H0 in the control group is 4.0g/L, and the biomass is up to 6.5g/L, which is optimal in the microalgae culture medium using 20g/L kitchen waste hydrolysate as a carbon source; FIG. 4C shows the amount of Euglena biomass in a state of polyculture in a microalgal culture medium containing crude glycerol at various concentrations, wherein the control group G0 biomass was 3.8G/L, and the amount of biomass reached 5.1G/L, which was optimal in a microalgal culture medium using 200mM crude glycerol as a carbon source; FIG. 4D shows the biomass of Euglena in heterotrophic state in microalgal culture medium containing crude glycerol at different concentrations, wherein the biomass of control group G0 is 4.0G/L, and the biomass is 5.4G/L with 20G/L kitchen waste hydrolysate as the carbon source. FIG. 4E shows a microalgae culture medium using 20g/L kitchen waste hydrolysate and 200mM crude glycerol as a combined carbon source, and the culture medium inoculated with the day 1 is a first microalgae culture medium containing kitchen waste hydrolysate, and the crude glycerol contains the euglena biomass in the mixed culture state and the heterotrophic state at the beginning of adding the first microalgae culture medium at the day 3, and the euglena biomass is respectively 7.1g/L and 7.3g/L; FIG. 4F shows that 20g/L of kitchen waste hydrolysate and 200mM of crude glycerol are used as combined carbon sources, the culture medium inoculated to the 1st day is a second microalgae culture medium containing crude glycerol, and the quantities of euglena biomass in a mixed culture state and a heterotrophic state of the kitchen waste hydrolysate at the 3 rd day after the second microalgae culture medium is added are respectively 6.6g/L and 6.7g/L. Fig. 4 shows that when the kitchen waste hydrolysate or the crude glycerol is used as the carbon source, the euglena biomass is obviously improved, and in addition, when the kitchen waste hydrolysate and the crude glycerol are jointly used as the carbon source, the euglena biomass reaches the maximum value and is obviously higher than that of other groups.
Example 6
The embodiment of the application provides a method for measuring the content of polysaccharide in a plateau phase of euglena under different culture conditions, which comprises the following specific steps:
inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate with different concentrations for mixed culture and heterotrophic culture; inoculating the euglena in the example 4 to a microalgae culture medium containing crude glycerol with different concentrations for mixed culture and heterotrophic culture; inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate and crude glycerol for mixed culture and heterotrophic culture; then, euglena in plateau phase under different culture conditions was centrifuged at 5,000rpm at 4 ℃ for 10min to collect algal puree in a pre-weighed 1.5mL Eppendorf tube, and this step was repeated three times after vortexing 30s after resuspending the algal puree with phosphate buffer, and centrifuged at 5,000rpm at 4 ℃ for 10min to collect the algal puree. Placing algae in Ningbo Xinzhi freeze-drying machine for freeze-drying for 24h, transferring to 5mL centrifuge tube, adding 1mL 0.5M NaOH solution into the sample, heating at 50 deg.C for 1h, and repeatedly shaking during heating period. After centrifugation, the supernatant was added to 1mL of 5% phenol solution, followed by slow addition of 5mL of 98% concentrated sulfuric acid along the walls of the tube. Incubating in water bath at 25 deg.C for 10min, and then transferring to 30 deg.C for 20min. After the above procedure using commercially available pure glucose as a standard, the absorbance at 483nm was measured by means of a Bio-Tek microplate reader. And drawing a standard curve according to the pore values of different standard substance concentrations, and calculating the euglena polysaccharide content of the plateau stage under different culture conditions by using the standard curve and the sample loading volume of the sample.
The result of the determination of the content of euglena polysaccharide is shown in fig. 5. FIG. 5 shows the euglena polysaccharide content in plateau phase under different culture conditions, wherein FIG. 5A shows the euglena biomass in the state of mixed culture of microalgae culture media containing kitchen waste hydrolysate with different concentrations, wherein the content of the euglena polysaccharide in a control group H0 is 19.1%, while the euglena polysaccharide is optimal under the microalgae culture media using 40g/L kitchen waste hydrolysate as a carbon source, and the euglena polysaccharide reaches 41.5%; FIG. 5B shows the euglena biomass in the heterotrophic state of the microalgae culture medium containing different concentrations of kitchen waste hydrolysate, wherein the content of euglena polysaccharide in the control group H0 is 18.8%, while the euglena biomass is optimal in the microalgae culture medium using 40g/L kitchen waste hydrolysate as the carbon source, and the euglena polysaccharide reaches 40.2%; FIG. 5C shows the amount of Euglena biomass in a state of polyculture in a microalgal culture medium containing crude glycerol at various concentrations, in which the content of Euglena polysaccharide in control group G0 was 19.1%, while it was most preferable in a microalgal culture medium using 200mM crude glycerol as a carbon source, with Euglena polysaccharide reaching 24.6%; FIG. 5D shows the amount of euglena biomass in heterotrophic state in microalgal media containing different concentrations of crude glycerol, where the control group G0 had a content of euglena polysaccharide of 18.8%, and performed optimally in microalgal media with 200mM crude glycerol as the carbon source, with a euglena polysaccharide of 24.5%. FIG. 5E shows that 20g/L of kitchen waste hydrolysate and 200mM of crude glycerol are used as a combined carbon source, the culture medium inoculated on day 1 is a first microalgae culture medium containing the kitchen waste hydrolysate, and the quantities of euglena polysaccharides in a mixotrophic state and a heterotrophic state are respectively 25.7% and 25.5% when the crude glycerol is added into the first microalgae culture medium on day 3; FIG. 5F shows a microalgae culture medium with 20g/L kitchen garbage hydrolysate and 200mM crude glycerol as a combined carbon source, and the culture medium inoculated on day 1 is a second microalgae culture medium containing crude glycerol, and the biomass of euglena in the mixotrophic and heterotrophic states of the kitchen garbage hydrolysate is 45.7% and 45.9% respectively when the second microalgae culture medium is added on day 3. FIG. 5 shows that when kitchen waste hydrolysate or crude glycerol is used as a carbon source, the euglena polysaccharide content is obviously improved compared with that of a normal culture medium.
Example 7
The embodiment of the application provides the measurement of the expression quantity of beta-1, 3-glucan synthase genes EgGSL1 (LC 225614) and EgGSL2 (LC 225615) of euglena under different culture conditions, and the specific steps are as follows:
inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate with different concentrations for mixed culture and heterotrophic culture; inoculating the euglena in the example 4 to a microalgae culture medium containing crude glycerol with different concentrations for mixed culture and heterotrophic culture;inoculating the euglena in the embodiment 4 to a microalgae culture medium containing kitchen waste hydrolysate and crude glycerol for mixed culture and heterotrophic culture; then, selecting euglena cultured on the 4 th day, centrifuging at 5,000rpm for 10min at 4 ℃ to collect algae mud into a pre-weighed 1.5mL Eppendorf tube, re-suspending the algae mud with phosphate buffer solution, then vortexing for 30s, centrifuging at 5,000rpm for 10min at 4 ℃ to collect the algae mud, repeating the step for three times, putting the algae mud into liquid nitrogen for freezing, and putting the algae mud into a refrigerator at-80 ℃ for later use. Extracting naked algae RNA by Plant RNAKit of Omega company, detecting the quality of the extracted RNA by using NanoDrop, and adopting Vazyme
II 1st Strand cDNA Synthesis Kit reverse transcribes RNA into cDNA. qPCR primers were designed using the OligoArchitect in-line primer design tool, and qPCR experiments were performed using the AceQ qPCR SYBR Green Master Mix from Vazyme. Adding the premixed solution into eight connected tubes with a pre-designed arrangement sequence according to the principle of 18 mu L of premixed solution (containing RNase-free Water, aceQ qPCR SYBR Green Master Mix, primers) in each tube, then adding 2 mu L of cDNA into sample adding holes which are arranged in advance, and sealing the eight connected tubes by using a sealing plate, wherein the eight connected tubes are all placed on ice in the whole sample adding process. The sealed eight tubes were placed in a Bio-rad CFX connect for qPCR experiments. After the detection is finished, the cycle number (Ct) required for the fluorescence intensity to reach the set value in each sample adding hole is detected, and the qPCR result adopts 2 -Ct Calculating by an algorithm, wherein Ct is the Ct value of the target gene minus the Ct value of the reference gene. The primer of the EgGSL1 is Forward TCTTAACGCTGGACACGG, reversegTGCCTGCAATGCT; the primer of the EgGSL2 is Forward ATGAAGGTCTTCTGGCTCGT, reverse TGCCAATTAACCATCCAT. The results of the assay of the beta-1, 3-glucan synthase gene of Euglena are shown in FIGS. 6 and 7.
Fig. 6 shows the transcription level of euglena EgGSL1 gene at day 4 under different cultivation conditions, wherein fig. 6A and 6B show that the transcription level of euglena EgGSL1 gene is mixotrophic or heterotrophic in microalgal culture medium containing different concentrations of kitchen waste hydrolysate, respectively, and the transcription level of euglena EgGSL1 is significantly higher than that of control group H0 in microalgal culture medium (H30 and H40) using kitchen waste hydrolysate of more than 20g/L as carbon source; FIGS. 6C and 6D show that the transcription level of Euglena EgGSL1 gene in the mixotrophic or heterotrophic state in microalgal medium containing crude glycerol at different concentrations, respectively, is significantly increased in the microalgal medium G200 with crude glycerol as a carbon source relative to the control G0; FIG. 6E shows the EGGSL1 transcript levels in the mixotrophic and heterotrophic states starting from day 3 when crude glycerol was added to the first microalgal culture medium using 20g/L of kitchen waste hydrolysate and 200mM of crude glycerol as a combined carbon source and the culture medium inoculated on day 1 as the first microalgal culture medium containing kitchen waste hydrolysate, wherein the transcript levels in the mixotrophic and heterotrophic states are not substantially different; FIG. 6F shows the EGGSL1 transcript levels in the mixotrophic and heterotrophic states starting with the addition of kitchen waste hydrolysate on day 3 using 20g/L kitchen waste hydrolysate and 200mM raw glycerol as a combined carbon source and inoculating the culture medium on day 1 with a second microalgae culture medium containing raw glycerol, wherein the transcript levels in the mixotrophic and heterotrophic states are not substantially different.
FIG. 7 shows the Gymnodinium rugulosa EgGSL2 gene transcription level at day 4 under different culture conditions, wherein FIGS. 7A and 7B show that the Gymnodinium rugulosa EgGSL2 gene transcription level in a mixotrophic or heterotrophic state respectively in microalgae culture media containing kitchen waste hydrolysate with different concentrations, and the Gymnodinium rugulosa EgGSL2 transcription level in microalgae culture media (H30 and H40) using kitchen waste hydrolysate as a carbon source at a concentration of more than 20g/L is significantly higher than that in a control group H0; FIGS. 7C and 7D show that the transcription level of Euglena EgGSL2 gene in the mixotrophic or heterotrophic state in microalgal media containing different concentrations of raw glycerol and the transcription level of Euglena EgGSL2 in microalgal media G200 using 200mM raw glycerol as a carbon source were significantly elevated relative to the control group G0, respectively; FIG. 7E shows the EGGSL2 transcript levels in the mixotrophic and heterotrophic states starting on day 3 with the addition of crude glycerol to the first microalgal culture medium with 20g/L of kitchen waste hydrolysate and 200mM crude glycerol as the combined carbon source and the medium inoculated on day 1 as the first microalgal culture medium containing kitchen waste hydrolysate, wherein the transcript levels in the mixotrophic and heterotrophic states are not substantially different; FIG. 7F shows the EGGSL2 transcript levels in the mixotrophic and heterotrophic states starting with the addition of kitchen waste hydrolysate on day 3 using 20g/L kitchen waste hydrolysate and 200mM raw glycerol as a combined carbon source and inoculating the culture medium on day 1 with a second microalgae medium containing raw glycerol, wherein the transcript levels in the mixotrophic and heterotrophic states are not substantially different. FIGS. 6 and 7 show that key genes EgGSL1 and EgGSL2 of euglena beta-1, 3-glucan synthase are obviously improved compared with a normal culture medium when kitchen waste hydrolysate or crude glycerol is used as a carbon source. As can be seen, the microalgae culture medium of the application promotes the accumulation of the euglena polysaccharide by promoting the euglena beta-1, 3-glucan synthase gene.
In summary, the experimental data of the above embodiments indicate that the kitchen waste hydrolysate and the crude glycerol can substantially promote the accumulation of the euglena biomass, and compared with the euglena biomass under the condition of a normal culture medium, both the kitchen waste hydrolysate and the crude glycerol can substantially increase the euglena biomass, wherein the biomass is better when the kitchen waste hydrolysate is used as a carbon source. In addition, the gymnodinia polysaccharide result shows that the gymnodinia polysaccharide content can be increased by the kitchen waste hydrolysate and the crude glycerol, wherein the gymnodinia polysaccharide content can be obviously increased by the kitchen waste hydrolysate, and the gymnodinia polysaccharide content is also obviously increased under the condition of the combined carbon source of the kitchen waste hydrolysate and the crude glycerol.
The foregoing is only a preferred embodiment of the present application and it should be noted that, as will be apparent to those skilled in the art, numerous modifications and adaptations can be made without departing from the principles of the present application and such modifications and adaptations are intended to be considered within the scope of the present application.
Claims (8)
1. The microalgae culture medium is applied to promoting microalgae proliferation and promoting microalgae to accumulate polysaccharides;
the microalgae is selected from euglena;
the microalgae culture medium comprises:
carbon source, KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water;
the carbon source is selected from kitchen waste hydrolysate and/or glycerol products;
the water is selected from seawater or fresh water.
2. The application of the food waste hydrolysate according to claim 1, wherein the food waste hydrolysate is food waste hydrolysate obtained by hydrolyzing dry food waste with enzyme.
3. Use according to claim 2, wherein the enzyme is selected from one or more of the group consisting of glucoamylase, gamma-amylase and glucosidase.
4. Use according to claim 1, characterized in that it comprises, in said water, in terms of concentration:
5. use according to claim 1, characterized in that the glycerol product has a glycerol content of 75% to 95%.
6. The application according to claim 1, wherein the method of applying comprises:
inoculating microalgae into the microalgae culture medium of any one of claims 1 to 5 for heterotrophic or mixotrophic culture.
7. The application according to claim 1, wherein the method of applying comprises:
inoculating microalgae into a first microalgae culture medium for heterotypic or polyculture culture, adding the glycerol product into the first microalgae culture medium when the microalgae enters the exponential phase of the microalgae, and continuously culturing the microalgae;
the first microalgae culture medium comprises kitchen waste hydrolysate and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water.
8. The application according to claim 1, wherein the method of applying comprises:
inoculating microalgae into a second microalgae culture medium for heterotypic or mixed culture, adding the kitchen waste hydrolysate into the second microalgae culture medium when the microalgae enters the exponential phase of the microalgae, and continuously culturing the microalgae;
the second microalgae culture medium comprises glycerol product and KH 2 PO 4 、MgSO 4 ·7H 2 O, potassium citrate, vitamin B1, vitamin B12 and water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011566006.7A CN112680359B (en) | 2020-12-25 | 2020-12-25 | Microalgae culture medium and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011566006.7A CN112680359B (en) | 2020-12-25 | 2020-12-25 | Microalgae culture medium and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112680359A CN112680359A (en) | 2021-04-20 |
| CN112680359B true CN112680359B (en) | 2023-03-31 |
Family
ID=75451833
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011566006.7A Active CN112680359B (en) | 2020-12-25 | 2020-12-25 | Microalgae culture medium and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112680359B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2013039085A (en) * | 2011-08-18 | 2013-02-28 | Ihi Corp | Method for producing ethanol |
| CN106497793A (en) * | 2016-11-24 | 2017-03-15 | 王江新 | A kind of Euglena culture medium and its cultural method |
| CN107058441A (en) * | 2017-06-29 | 2017-08-18 | 暨南大学 | It is a kind of to improve the method that microalgae produces content astaxanthin |
| CN108148763A (en) * | 2018-03-08 | 2018-06-12 | 青岛旭能生物工程有限责任公司 | A kind of method that the very thin Euglena yield of shake flask fermentation is improved by feeding method |
| CN112662563A (en) * | 2020-12-25 | 2021-04-16 | 暨南大学 | Culture medium for promoting microalgae to accumulate high value-added active substances and preparation method thereof |
| WO2021229296A1 (en) * | 2020-05-13 | 2021-11-18 | Sophie's BioNutrients Pte. Ltd. | Improved bioreactor system for cultivating microalgae |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2804738A1 (en) * | 2009-07-08 | 2011-01-13 | Moustafa Ahmed El-Shafie | Method and system for processing a biomass for producing biofuels and other products |
| KR20160114573A (en) * | 2013-10-03 | 2016-10-05 | 보드 오브 리전츠, 더 유니버시티 오브 텍사스 시스템 | Systems and methods for converting biomass to biocrude via hydrothermal liquefaction |
| CN103834570B (en) * | 2014-03-10 | 2016-01-20 | 临沂大学 | The substratum of Phaeodactylum tricornutum and Nitzschia closterlum mixed culture and cultural method |
| CN105713837B (en) * | 2015-02-15 | 2019-02-15 | 汪凡越 | A kind of separation method of high polysaccharide chlorella vulgaris |
| CN105624044A (en) * | 2016-03-02 | 2016-06-01 | 上海市南洋模范中学 | Method for achieving culturing and production increasing of euglena gracilis and water body purification |
| CN111607522A (en) * | 2020-04-15 | 2020-09-01 | 安徽小溪生态科技发展有限公司 | Method for producing chlorella by microwave hydrolysis of kitchen waste |
| US20210352932A1 (en) * | 2020-05-13 | 2021-11-18 | Sophie's BioNutrients Pte. Ltd. | Methods of producing plant protein from food waste using microalgae |
-
2020
- 2020-12-25 CN CN202011566006.7A patent/CN112680359B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2013039085A (en) * | 2011-08-18 | 2013-02-28 | Ihi Corp | Method for producing ethanol |
| CN106497793A (en) * | 2016-11-24 | 2017-03-15 | 王江新 | A kind of Euglena culture medium and its cultural method |
| CN107058441A (en) * | 2017-06-29 | 2017-08-18 | 暨南大学 | It is a kind of to improve the method that microalgae produces content astaxanthin |
| CN108148763A (en) * | 2018-03-08 | 2018-06-12 | 青岛旭能生物工程有限责任公司 | A kind of method that the very thin Euglena yield of shake flask fermentation is improved by feeding method |
| WO2021229296A1 (en) * | 2020-05-13 | 2021-11-18 | Sophie's BioNutrients Pte. Ltd. | Improved bioreactor system for cultivating microalgae |
| CN112662563A (en) * | 2020-12-25 | 2021-04-16 | 暨南大学 | Culture medium for promoting microalgae to accumulate high value-added active substances and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 江涛 ; 滕德强 ; 江天久 ; 吕颂辉 ; 杨维东 ; .海洋微藻溶血毒素研究进展.热带亚热带植物学报.2012,(第03期),全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112680359A (en) | 2021-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6807329B2 (en) | Methods and applications for culturing ω-7 fatty acid compounds and yellow-green algae to produce the compounds | |
| CN106916747B (en) | Chlorella sorokiniana strain and culture method and application thereof | |
| Yang et al. | Use of stillage grain from a rice-spirit distillery in the solid state fermentation of Ganoderma lucidum | |
| CN102160642A (en) | Method for preparing Cordyceps rice food | |
| JP5775862B2 (en) | Method for culturing microalgae and method for using microalgae | |
| Agwa et al. | Heterotrophic cultivation of Chlorella sp. using different waste extracts | |
| CN108991318B (en) | Seaweed fermented beverage | |
| CN113498834A (en) | Integrated fermentation method of edible and medicinal fungus fermented beverage | |
| US20210340582A1 (en) | Mortierellaalpina strain and use thereof, microbial oil containing ara at sn-2 position and preparation and uses thereof | |
| CN110627919B (en) | Intestinal prebiotics black skin termitomyces albuminosus polysaccharide ORP-1 and preparation method and application thereof | |
| CN112680359B (en) | Microalgae culture medium and application thereof | |
| Ibrahim et al. | Importance of chlorella and different applications. | |
| CN107739721A (en) | Produce bacillus sp.W2017 and its application of agar-agar digestive enzyme | |
| CN116948836A (en) | Ganoderma lucidum strain with high flavone yield, culture medium, culture method and application thereof | |
| CN114058522B (en) | Saccharomyces cerevisiae for high yield of squalene, application and breeding method thereof | |
| CN115595332A (en) | Method for preparing tremella fermentation liquor by combining compound enzyme with microbial fermentation | |
| Yao et al. | Relationship between saccharifying capacity and isolation sources for strains of the Rhizopus arrhizus complex | |
| CN103849575A (en) | Production method of single-cell protein | |
| Nadeem | Conversion of Potato Peels into Single Cell Protein: Potato Peels into Single Cell Protein | |
| Fa´ bregas et al. | Mixotrophic productivity of the marine diatom Phaeodactylum tricornutum cultured with soluble fractions of rye, wheat and potato | |
| CN114875104B (en) | Mulberry leaf ferment stock solution and preparation method and application thereof | |
| CN109161490B (en) | Candida tropicalis HY4-17-21 for producing nucleic acid and preparation method thereof | |
| CN114369558B (en) | Serratia marcescens and application thereof in naringinase production | |
| CN110283861B (en) | Method for producing ganoderan by using ganoderma lucidum strains generated by mutagenesis | |
| JP6014700B2 (en) | Method for culturing microalgae and method for using microalgae |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |