CN112646905A

CN112646905A - Double visual single nucleotide polymorphism detection method and application thereof

Info

Publication number: CN112646905A
Application number: CN202011617365.0A
Authority: CN
Inventors: 张建民; 温俊平; 廖明; 林琦杰; 瞿孝云; 陈凯风; 邬雨倩; 黄雪欢
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-12-30
Filing date: 2020-12-30
Publication date: 2021-04-13

Abstract

The invention discloses a double visual single nucleotide polymorphism detection method and application thereof. The double visualization SNP detection method provided by the invention judges whether the sample to be detected contains SNP or not by detecting the sample to be detected through double activation cross amplification, and the method displays the result through visualization effect. The method has strong specificity and high sensitivity, can realize visual double verification of SNP through color and fluorescent products, can directly obtain results through observation without the assistance of electrophoresis or other instruments, can efficiently and accurately detect the salmonella pullorum based on the method, and has the detection limit of 1500 copies/mu L.

Description

Double visual single nucleotide polymorphism detection method and application thereof

Technical Field

The invention belongs to the field of gene detection, and particularly relates to a double visualization single nucleotide polymorphism detection method and application thereof.

Background

A Single Nucleotide Polymorphism (SNP) is a DNA sequence polymorphism caused by a mutation of a single nucleotide at the genome level, i.e., a difference of a single base in a DNA sequence. In nature, SNPs widely exist, and have important significance in the aspects of drug development, clinical examination, tumor diagnosis and the like for the detection and analysis of the SNPs.

The current mainstream SNP detection technology comprises a high-throughput sequencing technology, a capillary electrophoresis technology, a flow fluorescence hybridization technology, a denaturing high performance liquid chromatography detection, an allele specific oligonucleotide fragment analysis, a PCR-pyrophosphoric acid sequencing technology, an ARMS-PCR technology, an HRM technology and the like, and the methods have long or long time-consuming process, inconvenient or poor specificity, or high cost in SNP detection, or are easy to cause aerosol pollution.

Pullorum Disease (Pullor Disease) is an acute and systemic Disease caused by Salmonella Pullorum, which mainly harms chicks within 1 week of age, and the mortality rate of the chicks infected with Salmonella Pullorum is high, so that adult chicks do not have obvious pathological changes, and only the egg yield of hens is reduced. Pullorum can spread vertically, affecting the yield and quality of chicken products, and causing great loss in farms.

The early rapid detection of the salmonella pullorum is the basis for the prevention, control and purification of the disease. Clinically, pullorum disease and avian typhoid disease caused by salmonella gallinarum and avian enteritis caused by salmonella enteritidis have similar symptoms, and are difficult to distinguish from pathological symptoms. The traditional separation and identification method has long process, such as biochemical test or slide agglutination test, which is easy to have non-specific reaction and lack of sensitivity. As the salmonella pullorum, the salmonella gallinarum and the salmonella enteritidis all belong to D serogroups according to the White-Kauffmann-Le Minor typing rule, the antigen expressions are very close to each other, and have cross expressions, and the antigens cannot be distinguished purely according to serology. At present, Polymerase Chain Reaction (PCR) -based salmonella pullorum disease detection methods exist, but the methods are poor in specificity, the salmonella pullorum disease and the salmonella typhi cannot be distinguished, the operation is complex and time-consuming, or the cover is opened and agarose gel electrophoresis is carried out, so that aerosol pollution is easily caused, professional personnel and expensive instruments are required, and the methods cannot be applied to the existing environment for purifying the pullorum disease in poultry farms.

Therefore, based on the problems, the development of a convenient, rapid, sensitive and specific visual rapid SNP detection method for salmonella pullorum has important practical significance and research value.

Disclosure of Invention

The present invention aims to provide a primer set;

it is another object of the present invention to provide a probe;

another object of the present invention is to provide a method for detecting SNP;

the invention also aims to provide the application of the primer group or the probe in detecting the salmonella pullorum;

the invention also aims to provide the application of the SNP detection method in screening the SNP locus of the salmonella pullorum.

The technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided:

the primer group targets the 237 th site of the rfbS gene of salmonella pullorum.

Further, the sequences of the primer sets are:

primer 7 a: 5'-GGAAGAGGAACAATGAAGCTACCA-3' (SEQ ID NO. 1);

primer 6 a: 5'-CACGACAGAAAATAATTGGATCG-3' (SEQ ID NO. 2);

primer 5 a: 5'-ACTATTGCTTGCTATGGAAGAC-3' (SEQ ID NO. 3);

primer 3 a: 5'-TAACGAACCTGCAACAGCTTTAAT-3' (SEQ ID NO. 4);

and (3) primer 4 s: 5'-GGCAGTGATGTTCCACAAT-3' (SEQ ID NO. 5);

primer 1s-5 a: 5' -ACTATTGCTTGCTATGGAAGACAATACTGCATCAAGTGATGAGA TAGACTCTAC(SEQ ID NO.8)-C3spacer-3’；

Wherein the 49 th base of the primer 1s-5a from the 5' endCIs an RNA base.

The rfbS gene of salmonella pullorum is a specific DNA sequence with Single Nucleotide Polymorphism (SNP). At the 237 th site of the rfbS gene, salmonella pullorum is guanine, salmonella gallinarum and salmonella enteritidis are adenine, and strains of other serotypes or species do not contain the gene or have large changes. According to the invention, a specific primer group for the following detection method is designed according to the single nucleotide polymorphism of salmonella pullorum at 237 th site of rfbS gene.

In a second aspect of the present invention, there is provided:

the probe targets a 237 th site of the rfbS gene of salmonella pullorum.

Wherein the probe contains a fluorescent group and a quenching group, the fluorescent group is preferably FAM, and the quenching group is preferably Eclipse.

Of course, other fluorophores and quenching moieties that are conventional in the art can also be used.

The probe 2 a: 5' -TCTTATGCCTATCAGAGTATT (SEQ ID NO.6) [ FAM]AGAGTCTAT(SEQ ID NO.7)-3’；

Wherein the 25 th base of the probe 2a from the 5' endGIs an RNA base.

The rfbS gene of salmonella pullorum is a specific DNA sequence with Single Nucleotide Polymorphism (SNP). At the 237 th site of the rfbS gene, salmonella pullorum is guanine, salmonella gallinarum and salmonella enteritidis are adenine, and strains of other serotypes or species do not contain the gene or have large changes. According to the invention, a specific probe for the following detection method is designed and obtained according to the single nucleotide polymorphism of salmonella pullorum at 237 th site of rfbS gene.

In a third aspect of the present invention, there is provided:

an SNP detection method comprising:

setting RNA basic group and RNA modifying enzyme on the starting primer and the verification probe, amplifying the primer to be detected, and judging whether the sample to be detected contains SNP according to the amplification result;

the SNP detection method judges whether a sample to be detected contains SNP or not through a visual effect;

the visual effect preferably includes a color reaction and a fluorescence reaction.

The principle of the SNP detection method in the invention is based on the dual-activation cross amplification rule. By designing RNA base complementary with the 237 th site on the primer, when the RNA base on the primer is complementarily combined with the gene to be detected, RNase H2 enzyme is activated to cut, so that the blocking of the blocking group is disabled, and the amplification reaction is started. When the RNA base on the primer is not complementary with the gene to be detected, the blocking is still effective, and the amplification cannot be continued. In the reaction, a designed verification probe is also added, an RNA base matched with the same mononucleotide mutation site is designed on the probe, and when the RNA base on the probe is complementarily combined with a gene to be detected, the RNaseH2 enzyme is also activated to be cut, so that a fluorescent luminescent group and a fluorescent quenching group on the probe are separated to generate a fluorescent product. And when the RNA base on the probe is not mutually complemented with the gene to be detected, a fluorescent product is not generated. The dual visual detection of the color and the fluorescence of the SNP locus of the rfbS gene of the salmonella pullorum can be realized through the dual recognition effects of the PH indicator cresol red, the primer and the verification probe. Good specificity and high sensitivity, and has the prospect of applying to the first line of the basic level to realize the double visual rapid detection of the salmonella pullorum.

Further, the reaction step principle of the SNP detection method is as follows:

when the reaction starts, if the RNA base on the 1s-5a can be matched with the DNA mutation site of the gene to be detected, the RNase H2 enzyme can be activated to generate a cutting effect, so that the blocking group C3-Spacer at the 3' end of the primer loses the blocking effect, and the subsequent reaction is initiated. When the RNA base on 1s-5a is not matched with the DNA mutation site of the gene to be detected, the blocking group C3-Spacer at the 3' end of the primer is still effective, and the reaction is terminated. 2a is a verification probe, modified with an RNA base, and also modified with a fluorescence emitting group (including FAM) and a fluorescence quenching group (including Eclipse). When the RNA base on the verification probe can be mutually complemented with the DNA mutation site of the gene to be detected, the RNase H2 enzyme can be activated to generate a cutting action, so that the fluorescent luminescent group and the fluorescent quenching group on the verification probe are separated to generate a fluorescent signal. And when the RNA base on the verification probe is not complementary with the DNA mutation site of the gene to be detected, the fluorescence luminescent group and the fluorescence quenching group on the verification probe are still in the same sequence, and a fluorescence signal cannot be generated. The products of the

primers

3a, 4s, 5a, 6a and 7a during the reaction can be combined with the primer 1s-5a to accelerate the reaction rate. With the progress of the reaction, byproducts (hydrogen ions) and fluorescent signals generated by the reaction are accumulated continuously, and the color and fluorescence dual visual detection of the SNP sites can be realized by introducing cresol red as an indicator and starting the dual specific recognition functions of a primer and a verification probe.

Further, the SNP detection method comprises the following steps:

amplifying a sample to be detected by using the primer, and observing a color reaction and a fluorescence reaction;

if color reaction and fluorescence reaction are generated, the sample to be detected contains SNP;

and if the color reaction and/or the fluorescence reaction are not generated, the sample to be detected does not contain SNP.

Furthermore, the amplification system of the SNP detection method is as follows:

wherein the Mix premix contains (NH)₄)₂SO₄KCl, Tween-20, cresol red solution, KOH, dNTP, betaine and MgSO₄Bst DNA polymerizationEnzymes and RNase H₂One or more of enzymes.

Further, the reaction procedure of the above-mentioned SNP detection method is: keeping the temperature at 60-65 ℃ and reacting for 55-65 min.

Further, the reaction procedure of the above-mentioned SNP detection method is: the reaction is carried out for 60min at the constant temperature of 62 ℃.

Furthermore, the detection object of the SNP detection method comprises Salmonella pullorum.

Of course, according to the above detection principle, those skilled in the art can reasonably adjust the primers, probes, reaction procedures or reaction systems according to the actual situation, and the adjustment is also within the protection scope of the present invention.

In a fourth aspect of the present invention, there is provided:

the primer group or the probe is applied to detection of salmonella pullorum.

In a fifth aspect of the present invention, there is provided:

the SNP detection method is applied to SNP locus screening of salmonella pullorum.

The invention has the beneficial effects that:

1. the SNP detection method has strong specificity and high sensitivity, can realize visual double verification of SNP through color and fluorescent products, and can directly obtain the result through observation without the assistance of electrophoresis or other instruments.

2. The specific primer group and the probe of the salmonella pullorum can be designed based on the SNP detection method, the salmonella pullorum can be efficiently and accurately detected by using the specific primer group and the probe, and the detection limit can reach 1500 copies/mu L.

Drawings

FIG. 1 is a schematic diagram of the double visualization SNP detection method in an embodiment;

FIG. 2 is a graph showing the amplification curve of the reaction system in the example, wherein a: standard plasmid of salmonella pullorum, b: salmonella gallinarum standard plasmid, c: negative control;

fig. 3 is a schematic diagram of the visual effect of the reaction system in the example, in which a: standard plasmid of salmonella pullorum, b: salmonella gallinarum standard plasmid, c: negative control;

FIG. 4 is a graph of amplification curves for different reaction temperatures, a: 62.0 ℃, b: 61.0 ℃, c: 63.2 ℃, d: 60.3 ℃, e: 60.0 ℃, f: 64.2 ℃, g: 64.7 ℃, h: 65.0 ℃, i: negative control;

FIG. 5 shows the results of the sensitivity test, wherein a: 1.5X 10⁸Copy/. mu.L, b: 1.5X 10⁷Copy/. mu.L, c: 1.5X 10⁶Copy/. mu.L, d: 1.5X 10⁵Copy/. mu.L, e: 1.5X 10⁴Copy/. mu.L, f: 1.5X 10³Copy/. mu.L, g: 1.5X 10²Copy/. mu.L, h: negative control;

FIG. 6 is an electrophoretogram of PCR comparison, in which 1: 1.5X 10⁶Copy/. mu.L, 2: 1.5X 10⁵Copy/. mu.L, 3: 1.5X 10⁴Copy/. mu.L, 4: 1.5X 10³Copy/. mu.L, 5: 1.5X 10²Copy/. mu.L, 6: 1.5X 10¹Copy/. mu.L, 7: 1.5 copies/. mu.L 8: negative control;

FIG. 7 shows the results of the specificity test, in which 1-15: salmonella pullorum, 16-47: other salmonella serotypes and species, 48: negative control;

fig. 8 is a detection limit test result, in which a: 100%, b: 10%, c: 1%, d: 0.1%, e: 0.01%, f: 0.

Detailed Description

In order to make the objects, technical solutions and technical effects of the present invention more clear, the present invention will be described in further detail with reference to specific embodiments. It should be understood that the detailed description and specific examples, while indicating the preferred embodiment of the invention, are intended for purposes of illustration only and are not intended to limit the scope of the invention.

The experimental materials and reagents used are, unless otherwise specified, all consumables and reagents which are conventionally available from commercial sources.

Double visual Single Nucleotide Polymorphism (SNP) detection method

The double visualization SNP detection method in this embodiment is a cross amplification method that enables double visualization of color and fluorescence for detection of Single Nucleotide Polymorphisms (SNPs).

The schematic diagram of the double visualization SNP detection method in this embodiment is shown in FIG. 1. The principle is that the target of the gene to be detected containing the SNP locus is realized through a novel cross amplification method so as to realize the detection purpose. As shown in FIG. 1 and Table 1, 1a-2a and 1s-2s, 3a and 3s, and 5a and 5s are complementary nucleotide fragments, respectively, wherein 1s-5a, 2a, 3a, 4s, 5a, 6a and 7a are primers or probes which are designed according to the gene to be detected and participate in the reaction. 1s-5a is a primer modified with RNA base and C3-Spacer blocking group. When the reaction starts, if the RNA base on the 1s-5a can be matched with the DNA mutation site of the gene to be detected, the RNase H2 enzyme can be activated to generate a cutting effect, so that the blocking group C3-Spacer at the 3' end of the primer loses the blocking effect, and the subsequent reaction is initiated. When the RNA base on 1s-5a is not matched with the DNA mutation site of the gene to be detected, the blocking group C3-Spacer at the 3' end of the primer is still effective, and the reaction is terminated. 2a is a verification probe, modified with an RNA base, and also modified with a fluorescence emitting group (including FAM) and a fluorescence quenching group (including Eclipse). When the RNA base on the verification probe can be mutually complemented with the DNA mutation site of the gene to be detected, the RNase H2 enzyme can be activated to generate a cutting action, so that the fluorescent luminescent group and the fluorescent quenching group on the verification probe are separated to generate a fluorescent signal. And when the RNA base on the verification probe is not complementary with the DNA mutation site of the gene to be detected, the fluorescence luminescent group and the fluorescence quenching group on the verification probe are still in the same sequence, and a fluorescence signal cannot be generated. The products of the

primers

The reaction system of the double visualization Single Nucleotide Polymorphism (SNP) detection method in this embodiment is:

TABLE 1 reaction System for the Dual visualization Single Nucleotide Polymorphism (SNP) detection method

Reagent	Amount of addition
		Mix premix	12.5μL
Primer 4s and primer 7a (10. mu. mol/L)	0.5. mu.L each
		Primer 5a and primer 6a (10. mu. mol/L)	Each 1 mu L
Primer
	3a and primer 2a (10. mu. mol/L)	Each 1 mu L
Primer
	1s-5a	2 μ L each
DNA template			2.5μL
	Ultrapure water	Make up to 25 mu L

Wherein the Mix premix liquid contains (NH4)₂SO₄KCl, Tween-20, cresol red solution, KOH, dNTP, betaine and MgSO₄Bst DNA polymerase，Rnase H₂Enzymes, etc. Of course, other pre-mixes conventional in the art may be used to achieve the same detection results.

The specific detection method comprises the following steps:

a reaction system is prepared according to the table 1, DNA in a detection object is extracted by using a kit or other conventional methods (such as RNA reverse transcription) in the field as a DNA template, the DNA template is added into the reaction system, the reaction is carried out for 55-65min at a constant temperature of 60-65 ℃, and then the detection result is verified through color change and fluorescence products.

Application of double visual SNP detection method in detection of Salmonella Pullorum (Salmonella Pullorum)

In the implementation, the dual visualization SNP detection method in the embodiment is used for detecting salmonella pullorum so as to verify the feasibility of the salmonella pullorum. Of course, the present embodiment only selects salmonella pullorum as an example, and the detection object to which the dual visualization SNP detection method in the above embodiments is applicable includes, but is not limited to, salmonella pullorum.

1. Test materials.

The detection objects in this example include 15 Salmonella pullorum, 3 Salmonella typhimurium, 3 Salmonella enteritidis, 1 Salmonella london, 1 Debya salmonella, 1 Rosensors, 1 Panama salmonella, 1 Weber leiden, 1 Havana salmonella, 1 Albania salmonella, 1 Salmonella typhimurium, 1 Serratia sella, 1 Kenta salmonella, 1 Huo Salmonella, 1 Indiana Salmonella, 1 infant Salmonella, 1 Huangjincoast Salmonella, 1 Argonna Salmonella, 1 Correa, 1 hog cholera, 1 Escherichia coli, 1 Listeria monocytogenes, 1 Staphylococcus aureus, 1 Pseudomonas aeruginosa, 1 sheep, 1 Shigella pestis, 1 Bryomyces reesei, 1 Campylobacter jejuni, and 1 Campylobacter jejuni, 1 campylobacter coli and the like, and the identification and preservation strains in key laboratories of prevention and treatment of diseases of people and animals of the college of veterinary medicine of southern China university are included (all verified), and the specific source information of the strains is shown in table 2.

Table 2 strain information used in this example

In use, the above bacterial stocks were recovered by overnight culture at 37 ℃ on XLT-4 agar plates or Brain Heart Infusion (BHI) agar plates, and the colonies were transferred to LB broth or BHI broth and cultured for 16 hours at 37 ℃ with constant shaking at 180 rpm. Resuscitated bacterial genomic DNA was extracted using the TIANAmp bacterial DNA kit (TIANGEN) or boiling and stored at-20 ℃ until use.

2. And (3) designing a primer.

By referring to the sequence of the rfbS gene of salmonella pullorum (GenBank: LK931482.1), the 237 th site of the rfbS gene is targeted, and primers and probes are designed. The designed primer and probe are synthesized by Shanghai biological engineering Co. Specific sequences of the primers and probes are shown below.

Among them, the 25 th base G (bold and underlined) from the 5' end of the verification probe 2a in Table 3 is an RNA base.

Wherein, the 49 th base C (bold and underlined) from the 5' end of the primer 1s-5a in Table 3 is RNA base.

TABLE 3 primer and Probe sequences

3. A standard plasmid (positive control) was constructed.

PCR primers were designed on both sides of rfbS gene based on the rfbS gene of pullorum disease (accession number: GenBank: LK931482.1) and the rfbS gene of fowl typhoid (accession number: AF 442573).

The specific primer sequences are as follows:

an upstream primer rfbS-F: 5'-AATATCACCATGTACAAACTCAAAG-3' (SEQ ID NO. 9);

the downstream primer rfbS-R: 5'-ATCGTGTAGTGGGTGAGT-3' (SEQ ID NO. 10).

Amplifying sequences of rfbS genes of salmonella pullorum and salmonella gallinarum by using the primers through a PCR method, carrying out gel recovery on amplification products through a kit (Omega) after gel electrophoresis verification, connecting a PUC57 vector overnight at 16 ℃, then transforming DH5 alpha cells (transfecting the ligation products (PUC57 vector) into DH5 alpha competent cells), carrying out gel electrophoresis and sequencing verification after amplification culture, extracting plasmids (operation is according to instructions) through a conventional kit in the field after verification of no errors, measuring the plasmid concentration by using a spectrophotometer, calculating the copy number, and storing at-20 ℃ for later use.

4. And (5) constructing a reaction system.

The salmonella pullorum standard plasmid and the salmonella gallinarum standard plasmid constructed in the embodiment are used as detection objects, cresol red is introduced as an indicator, and visualized monitoring reaction systems are established for detection respectively, wherein when the reaction is negative, the solution is red, and the reaction is yellow when the reaction is positive. The fluorescence curves were also used for characterization (Bio-rad CFX96), setting the fluorescence acquisition to 1 cycle/min for 60 cycles.

The reaction system is shown in table 1 in the above example.

Wherein the Mix premix liquid contains (NH)₄)₂SO₄KCl, Tween-20, cresol red solution, KOH, dNTP, betaine and MgSO₄Bst DNA polymerase, RNase H₂Enzymes, etc. Of course, other pre-mixed solutions conventional in the art may be used to achieve the same detection effect.

The reaction procedure is as follows: the reaction is carried out for 60min at the constant temperature of 62 ℃.

And (3) detection results:

the amplification curve is shown in FIGS. 2-3, only the Salmonella pullorum standard plasmid is positive (yellow), and a fluorescent product can be observed under 495nm excitation light. The result of the salmonella gallinarum standard plasmid is negative (red) and has no fluorescent product. And (3) performing characterization by using a fluorescence curve, wherein only the fluorescence curve of the salmonella pullorum standard plasmid is obviously amplified. The salmonella gallinarum standard plasmid has no fluorescence curve, because when the DNA template is mismatched with the primer and the recognition probe, the RNase H2 enzyme cannot be activated to effectively cut RNA basic groups, so that the primer-mediated reaction is blocked, the whole reaction cannot be circularly amplified, and the verification probe cannot be cut to generate a fluorescence signal. The detection result shows that the detection method is feasible.

5. And (5) optimizing a reaction system.

The standard plasmid of Salmonella pullorum was used as a test target, and the reaction system and the reaction procedure in the above examples were used to optimize the optimal reaction temperature by adjusting the reaction temperatures (set to 60.0 deg.C, 60.3 deg.C, 61.0 deg.C, 62.0 deg.C, 63.2 deg.C, 64.2 deg.C, 64.7 deg.C, and 65.0 deg.C, respectively) to explore the effect of the reaction temperature on the results.

As shown in FIG. 4, the optimal reaction temperature of the detection method in the above example is 62 ℃ and the ct value is the smallest at 62 ℃ under the same reaction conditions.

In summary, the optimal reaction procedure for salmonella pullorum is as follows: the reaction is carried out for 60min at the constant temperature of 62 ℃.

Sensitivity detection test

The salmonella pullorum standard plasmid constructed in the above embodiment is used as a detection object, and the sensitivity evaluation is performed by using the reaction system and the optimal reaction program in the above embodiment.

Wherein the copy number of the salmonella pullorum plasmid stock solution is 1.5 multiplied by 10⁹Copy/. mu.L, using 10^-2～10^-8Dilution of plasmid, i.e. Salmonella pullorum plasmid dilution of 1.5X 10⁷～1.5×10¹Copies/. mu.L (1.5X 10, respectively)⁸Copy/. mu.L, 1.5X 10⁷Copy/. mu.L, 1.5X 10⁶Copy/. mu.L, 1.5X 10⁵Copy/. mu.L, 1.5X 10⁴Copy/. mu.L, 1.5X 10³Copy/. mu.L, 1.5X 10²Copy/. mu.L).

The results are shown in FIG. 5, when the concentration of plasmid template used is 1.5X 10⁷～1.5×10³When copying/muL, cresol red can become positive yellow, and simultaneously generates a fluorescent product, the representation result of a fluorescent curve accords with a double visualization result, the sensitivity evaluation result shows that the detection lower limit of the kit is 1500 copies/muL, and the experimental result accords with the glue running result of the conventional PCR method (no false positive, as shown in figure 6), which shows that the method has good sensitivity.

Specificity detection assay

The genomic DNA of different serotypes of Salmonella and other species of bacteria extracted in the above examples was used as a test object for specificity evaluation. The reaction system and the optimum reaction procedure are shown in the above examples.

The results of the detection are shown in FIG. 7. The specificity evaluation result shows that except 15 salmonella pullorum (numbered 1-15), other serotype salmonella and other strains are not amplified (negative), and the specificity test result accords with the actual situation, so that the method can detect the salmonella pullorum very specifically.

Detection limit detection experiment

Since the ratio of SNP is small in the case of a wild-type gene existing in a large amount under normal conditions, in order to examine the selectivity of the detection method in the above examples for a mutant-type gene (SNP) among a large amount of wild-type genes, the Salmonella pullorum standard plasmid and the Salmonella typhimurium standard plasmid were mixed at different ratios (wherein the Salmonella pullorum standard plasmid accounts for 0, 0.01%, 0.1%, 1%, 10%, and 100%, respectively), and the total bacterial concentration in the sample was 1.5X 10⁷Copies/. mu.L.

As shown in FIG. 8, when the ratio of the Salmonella pullorum plasmid template in the mixed template is 100%, 10%, 1% and 0.1%, fluorescence and color reaction can be detected, so that the lower limit of the selectivity of the method is 0.1%.

In-situ effect verification of the detection method

30 samples are collected from a commercial chicken farm in Guangzhou China, and the reaction system and the optimal reaction program in the embodiment are adopted for detection so as to evaluate the application performance of the method in the actual salmonella pullorum separation sample. Meanwhile, the traditional method (GB4789.4-2016) and the prior PCR technology (CN106755362B) are taken as comparative examples, and the effects are compared.

As a result:

the results are shown in Table 4, the number of positive samples detected by the traditional separation and identification method (GB4789.4-2016), the prior art (CN106755362B) and the method is 4, the number of negative samples is 26, and the results of the three methods are consistent, which indicates that the method has good practical application effect.

Test results of 430 clinical samples in Table

Wherein "+" indicates detection, and "-" indicates non-detection.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

SEQUENCE LISTING

<110> southern China university of agriculture

<120> double visual single nucleotide polymorphism detection method and application thereof

<130>

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 24

<212> DNA

<213> Artificial sequence

<400> 1

ggaagaggaa caatgaagct acca 24

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

cacgacagaa aataattgga tcg 23

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence

<400> 3

actattgctt gctatggaag ac 22

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence

<400> 4

taacgaacct gcaacagctt taat 24

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

ggcagtgatg ttccacaat 19

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence

<400> 6

tcttatgcct atcagagtat t 21

<210> 7

<211> 9

<212> DNA

<213> Artificial sequence

<400> 7

agagtctat 9

<210> 8

<211> 54

<212> DNA

<213> Artificial sequence

<400> 8

actattgctt gctatggaag acaatactgc atcaagtgat gagatagact ctac 54

<210> 9

<211> 25

<212> DNA

<213> Artificial sequence

<400> 9

aatatcacca tgtacaaact caaag 25

<210> 10

<211> 18

<212> DNA

<213> Artificial sequence

<400> 10

atcgtgtagt gggtgagt 18

Claims

1. The primer group is characterized in that the primer group targets the 237 th site of the rfbS gene of salmonella pullorum, and the sequence of the primer group is as follows:

primer 7 a: 5'-GGAAGAGGAACAATGAAGCTACCA-3' (SEQ ID NO. 1);

primer 6 a: 5'-CACGACAGAAAATAATTGGATCG-3' (SEQ ID NO. 2);

primer 5 a: 5'-ACTATTGCTTGCTATGGAAGAC-3' (SEQ ID NO. 3);

primer 3 a: 5'-TAACGAACCTGCAACAGCTTTAAT-3' (SEQ ID NO. 4);

and (3) primer 4 s: 5'-GGCAGTGATGTTCCACAAT-3' (SEQ ID NO. 5);

primer 1s-5 a: 5 '-ACTATTGCTTGCTATGGAAGACAATACTGCATCAAGTGATGAGATAGACTCTAC (SEQ ID NO.8) -C3 spacer-3';

wherein, the 49 th base C of the primer 1s-5a from the 5' end is RNA base.

2. The probe is characterized by targeting to the 237 th site of the rfbS gene of salmonella pullorum, and the probe contains a fluorescent group and a quenching group, wherein the fluorescent group is preferably FAM, and the quenching group is preferably Eclipse.

3. The probe of claim 2, wherein the sequence of the probe is:

the probe 2 a: 5 '-TCTTATGCCTATCAGAGTATT (SEQ ID NO.6) [ FAM ] AGAGTCTAT (SEQ ID NO.7) -3';

wherein the 25 th base G of the probe 2a from the 5' end is an RNA base.

4. An SNP detection method comprising:

the visual effect preferably comprises a color reaction and a fluorescence reaction.

5. The SNP detection method according to claim 4, comprising the steps of:

amplifying a sample to be tested by using the primer of claim 1, and observing a color reaction and a fluorescence reaction;

6. The SNP detection method according to claim 5, wherein the amplification system is:

wherein the Mix premix contains (NH)₄)₂SO₄KCl, Tween-20, cresol red solution, KOH, dNTP, betaine and MgSO₄Bst DNA polymerase and RNase H₂One or more of enzymes.

7. The SNP detection method according to claim 5, wherein the reaction sequence of the SNP detection method is: keeping the temperature at 60-65 ℃ and reacting for 55-60 min.

8. The SNP detection method according to claim 5, wherein the target of SNP detection comprises Salmonella pullorum.

9. The primer set of claim 1 or the probe of any one of claims 2 to 3, for use in detecting Salmonella pullorum.

10. The use of the SNP detection method according to any one of claims 4 to 8 for screening SNP loci of Salmonella pullorum.