CN110846426A - Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum - Google Patents
Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum Download PDFInfo
- Publication number
- CN110846426A CN110846426A CN201911282829.4A CN201911282829A CN110846426A CN 110846426 A CN110846426 A CN 110846426A CN 201911282829 A CN201911282829 A CN 201911282829A CN 110846426 A CN110846426 A CN 110846426A
- Authority
- CN
- China
- Prior art keywords
- salmonella
- qpcr
- primer group
- salmonella pullorum
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorescent PCR primer group for rapidly detecting salmonella pullorum, which comprises the following components: qpcr-F: 5'-CGAACCTGCAACAGCTTTAATAGAAAGC-3', respectively; qpcr-R: 5'-CTCGTATTTGGTGGCAGTGATGTTC-3', respectively; and (3) Probe: 5 '-TATTAGAGTCTAG-Eclipse-3'; the primer group aims at the rfbs gene of the salmonella pullorum. Correspondingly, the invention also provides a kit based on the primer group. The primer group and the kit have the advantages of strong specificity and high sensitivity.
Description
Technical Field
The invention relates to the technical field of gene detection, in particular to a fluorescent PCR primer group and a kit for rapidly detecting salmonella pullorum.
Background
Pullorum Disease (PD) is a serious systemic disease caused by salmonella pullorum, can be vertically transmitted, mainly infects chickens, affects reproductive capacity and causes high mortality, and infected hens have seriously reduced egg yield and great economic loss.
The early rapid detection and identification of salmonella pullorum is the basis for the prevention, control and purification of the disease. The traditional separation and identification method is complex and tedious, and meanwhile, salmonella pullorum, salmonella typhi and salmonella enteritidis all belong to salmonella D serogroup and are often similar and difficult to distinguish on clinical symptoms, and a slide agglutination test is easy to generate nonspecific reaction and lack sensitivity and often causes misjudgment, so that the invention of a convenient, quick and specifically sensitive salmonella pullorum rapid detection kit is urgently needed for one-line use.
Disclosure of Invention
The invention aims to provide a fluorescent PCR primer group and a kit for rapidly detecting salmonella pullorum, which have the characteristic of accurately and rapidly detecting salmonella pullorum.
In order to achieve the purpose, the invention adopts the following technical scheme:
a fluorescence PCR primer group for rapidly detecting salmonella pullorum comprises:
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
Probe：5′-TATTAGAGTCTAG-Eclipse-3′；
the primer group aims at the rfbs gene of the salmonella pullorum.
A fluorescence PCR kit for rapidly detecting salmonella pullorum comprises a reaction solution, wherein the reaction solution comprises qpcr-F, qpcr-R and Probe;
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
Probe：5′-TATTAGAGTCTAG-Eclipse-3′；
the primer group aims at the rfbs gene of the salmonella pullorum.
Further, the reaction solution includes:
5U/μl Ex Taq HS 0.125μl；
10×Ex Taq Buffer 1.5μl；
dNTP Mixture 2μl；
0.1 mul of RNase HII enzyme (1: 10);
DNA 2.5μl；
qpcr-F 0.5μl；
qpcr-R 0.5μl；
Probe 0.25μl；
H2O 17.525μl。
further, the reaction solution comprises the following reagents in the following amounts: 10 XEx Taq Buffer (Mg)2+plus)20mM；
dNTP Mixture 2.5mM；
DNA 2.5μl；
qpcr-F 10μM；
qpcr-R 10μM；
Probe 10μM。
The invention has the beneficial effects that:
1. the salmonella pullorum rfbs gene is a specific DNA sequence with Single Nucleotide Polymorphism (SNP). At the 237 th site, the salmonella pullorum is guanine, the salmonella gallinarum, the salmonella enteritidis and the like are adenine, and other strains of serotypes and other species do not contain the gene or have larger changes. The invention relates to a primer group designed by targeting salmonella pullorum rfbs gene, wherein an RNA base complementary with a 237 site DNA base is designed on a probe, and when the two are combined complementarily, RNase H II enzyme can be activated to cut, and a report fluorescent group is separated from a quenching fluorescent group to generate fluorescence; when the two are not complementary, no fluorescence is emitted. Thereby realizing the specific detection of the salmonella pullorum. Compared with the traditional PCR method, the method saves the operations such as glue running and the like, can realize real-time quantitative monitoring, and is very suitable for accurate and trace detection in a laboratory.
2. The fluorescent PCR primer group and the kit for rapidly detecting the salmonella pullorum have the characteristic of high reaction efficiency, and can be detected within 30 min.
3. The fluorescent PCR primer group for rapidly detecting salmonella pullorum is high in specificity, can be well and accurately detected from 22 salmonella and 9 other pathogenic bacteria, has the lower detection limit of 21 copy numbers, is high in sensitivity, and is superior to the detection result of the traditional PCR method.
Drawings
FIG. 1 is a graph showing the amplification results of a basic reaction system;
FIG. 2 is a graph showing the results of a specificity evaluation experiment;
FIG. 3 is a graph showing the results of a sensitivity evaluation experiment;
FIG. 4 is a graph showing the results of identification of a clinically isolated sample.
Detailed Description
The technical solution of the present invention is further described below with reference to the accompanying drawings and the detailed description.
Example 1 fluorescent PCR primer set for rapidly detecting Salmonella pullorum
The primer set of this example comprises:
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
and (3) Probe: 5 '-TATT (FAM) AGAG (RNA base) TCTAG-Eclipse-3';
the primer group aims at the rfbs gene of the salmonella pullorum.
Where Eclipse represents a fluorescence quenching group and FAM represents a fluorescent label.
Example 2 fluorescent PCR kit for rapidly detecting Salmonella pullorum
The kit comprises a reaction liquid, wherein the reaction liquid comprises qpcr-F, qpcr-R and Probe;
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
Probe：5′-TATTAGAGTCTAG-Eclipse-3′；
the primer group aims at the rfbs gene of the salmonella pullorum.
The reaction solution comprises:
5U/μl Ex Taq HS 0.125μl；
10×Ex Taq Buffer 1.5μl；
dNTP Mixture 2μl；
0.1. mu.l of RNase III enzyme (1: 10 dilution);
DNA 2.5μl；
qpcr-F 0.5μl；
qpcr-R 0.5μl；
Probe 0.25μl；
H2O 17.525μl。
the reaction solution comprises the following reagents in the following dosage: 10 XEx Taq Buffer (Mg)2+plus)20mM；dNTPMixture 2.5mM；DNA 2.5μl；qpcr-F 10μM；qpcr-R 10μM；Probe 10μM。
Taking the detection of salmonella pullorum as an example, the invention proves that the fluorescent PCR primer group and the kit for rapidly detecting salmonella pullorum are provided by the inventionReliability of。
1. Materials and methods
1.1 strains
Salmonella pullorum, Salmonella gallinarum, Salmonella enteritidis, Salmonella kovasica, Salmonella debbyi, Salmonella rosensoni, Salmonella london, Salmonella walleriden, Salmonella typhimurium, Salmonella albanii, Salmonella bananas, Salmonella kecata, Salmonella lavana, Salmonella mulessential, Salmonella infantis, Salmonella costata, Salmonella turkey, Salmonella allomonellae, Salmonella indiana, Salmonella parvula, Salmonella choleraesuis, Pseudomonas aeruginosa, Escherichia coli, Listeria monocytogenes, Staphylococcus aureus, Listeria ovis, Shigella, Salmonella anatipestifolia, Campylobacter jejuni, Campylobacter coli, etc., including standard bacteria and identification and conservation strains identified by the laboratory of common control of the human and veterinary college of south China university.
1.2 Primary reagents
LB broth, LB agar, XLT4 agar base, buffered peptone water solution (BPW), tetrasulfosulfonate Brilliant Green enrichment broth base (TTB), brain Heart leach liquor Broth (BHI) were purchased from Guangdong ring Kai microbial science Co., Ltd; TaKaRa Ex Taq HS, 10 XEx Taq Buffer, dNTP mix from Boehringer Biotech (Dalong) Ltd; RNaseH II enzyme was purchased from Integrated DNA Technologies; the primers are synthesized by Biotechnology engineering (Shanghai) GmbH; ultrapure water was prepared by Elix100 purified water unit (Millipore corporation, usa).
1.3 experiment
1.3.1 extraction of bacterial genomic DNA
Each bacterial genome DNA template was prepared by a thermal cracking method and used for the following specificity evaluation experiment and sensitivity experiment evaluation.
The DNA template includes 32 strains of Salmonella pullorum (strain 2), Salmonella typhimurium, Salmonella enteritidis, Salmonella kovasica, Salmonella debarkii, Salmonella rosensoni, Salmonella london, Salmonella wallerian, Salmonella typhimurium, Salmonella albania, Salmonella bananas, Salmonella Kentaki, Salmonella Havana, Salmonella mobada, Salmonella infantis, Salmonella coast, Salmonella huyaensis, Salmonella arvensis, Salmonella allochra, Salmonella indiana, Salmonella saint paulosa, Salmonella cholerasuis, Pseudomonas aeruginosa, Escherichia coli, Listeria monocytogenes, Staphylococcus aureus, sheep listeria, Shigella, Rehma anatipestifer, Campylobacter jejuni, and Campylobacter coli.
1.3.2 construction of Standard plasmids
According to the accession number of the rfbs gene of the salmonella pullorum: LK931482.1, Salmonella gallinarum rfbs gene accession number: AF442573 PCR primers were designed on both sides of the rfbs gene of both bacteria. rfbs F: AATATCACCATGTACAAACTCAAAG, and rfbs R: ATCGTGTAGTGGGTGAGT. The full length of the rfbS genes of the salmonella pullorum and the salmonella gallinarum are amplified by a PCR method.
And (3) verifying the amplified product through an electrophoresis experiment, performing gel recovery by using a commercial kit (brand Omega), connecting a T carrier overnight, transforming the connection product into DH5 α competent cells, performing amplification culture on the competent cells, extracting DNA, performing electrophoresis test and sequencing verification, extracting plasmids according to the instruction of the commercial kit, measuring the concentration of the plasmids by using a spectrophotometer, converting the concentrations into copy numbers, and storing at-20 ℃ for later use.
1.3.3 primer design
Aiming at the salmonella pullorum rfbs gene, a reaction primer is designed as follows:
| primer and method for producing the same | Nucleotide sequence |
| qpcr-F | CGAACCTGCAACAGCTTTAATAGAAAGC |
| qpcr-R | CTCGTATTTGGTGGCAGTGATGTTC |
| Probe | TATT (FAM) AGAG (RNA base) TCTAG-Eclipse |
1.3.4 establishing a basic reaction System
The constructed standard plasmids of the salmonella pullorum and the salmonella gallinarum are used, the proportion of each component of the reagent is adjusted, and a basic reaction system is established. The fluorescent PCR reaction procedure was as follows: pre-denaturation at 95 ℃ for 30s, further cycles of 95 ℃ for 5sec, 55 ℃ for 10sec, 72 ℃ for 30sec, 40 cycles, and finally extension at 72 ℃ for 10 min.
The basic reaction system was a 25. mu.l system, as shown in the following Table:
the amplification result of the basic reaction system is shown in figure 1, only the fluorescence curve of the salmonella pullorum standard plasmid is obviously amplified, but the salmonella gallinarum standard plasmid is not amplified, because the mismatch of the cross primers cannot activate RNase HII enzyme to effectively cut RNA base, so that the reaction is blocked and cannot be circularly amplified. The experimental result verifies that the method is feasible, and the basic reaction system is successfully established. In FIG. 1, line A shows the amplification curve of the Salmonella pullorum standard plasmid, line B shows the amplification curve of the Salmonella typhimurium standard plasmid, and line C shows the amplification curve of the negative control.
1.3.5 specificity evaluation test
A specificity evaluation experiment is carried out by using a 32-strain bacterial genome DNA template extracted by 1.3.1 and adopting a reaction system and a reaction temperature which are established by 1.3.4, and a basic reaction system is established by adopting the experimental conditions of 1.3.4. The results are shown in FIG. 2, in which line A and line B are fluorescence detection results of Salmonella pullorum, and line C and line D are fluorescence detection results of other Salmonella serotypes and other species of bacteria and a negative control. As can be seen from FIG. 2, the primer set and the kit of the present invention can specifically detect Salmonella pullorum.
1.3.6 sensitivity evaluation test
Through calculation, the copy number of the salmonella pullorum plasmid stock solution constructed by 1.3.2 is 2.1 multiplied by 1010Copying by using 10-4—10-10The diluted plasmid was used for amplification experiments, and the experimental conditions used 1.3.4 to establish the basic reaction system. The results of the sensitivity evaluation are shown in FIG. 3. In FIG. 3, line A is 2.1X 106Copy number amplification Curve, line B2.1X 105Copy number amplification curve, C line 2.10X 104Copy number amplification curve, line D is 2100 copy number amplification curve, line E is 210 copy number amplification curve, line F is 21 copy number amplification curve, line G is 2.1 copy number and negative control amplification curve. As can be seen, the sensitivity evaluation result shows that the detection lower limit of the kit is 21 copies, and the sensitivity is strong.
1.3.7 clinical isolation sample identification
Clinically, 30 salmonella pullorum are separated, DNA templates are respectively extracted for amplification experiments, a basic reaction system and reaction temperature are established under the experimental conditions of 1.3.4, and the result is shown in figure 4, which shows that all the salmonella pullorum are rapidly detected within 30 min.
The technical principle of the present invention is described above in connection with specific embodiments. The description is made for the purpose of illustrating the principles of the invention and should not be construed in any way as limiting the scope of the invention. Based on the explanations herein, those skilled in the art will be able to conceive of other embodiments of the present invention without inventive effort, which would fall within the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> fluorescent PCR primer group and kit for rapidly detecting salmonella pullorum
<160>3
<210>1
<211>28
<212>DNA
<213> Artificial sequence
<400>1
cgaacctgca acagctttaa tagaaagc 28
<210>2
<211>25
<212>DNA
<213> Artificial sequence
<400>2
ctcgtatttg gtggcagtga tgttc 25
<210>3
<211>13
<212>DNA
<213> Artificial sequence
<400>3
TATTAGAGTC TAG 13
Claims (4)
1. A fluorescence PCR primer group for rapidly detecting salmonella pullorum is characterized by comprising:
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
Probe：5′-TATTAGAGTCTAG-Eclipse-3′；
the primer group aims at the rfbs gene of the salmonella pullorum.
2. A fluorescence PCR kit for rapidly detecting salmonella pullorum is characterized by comprising reaction liquid, wherein the reaction liquid comprises qpcr-F, qpcr-R and Probe;
qpcr-F：5′-CGAACCTGCAACAGCTTTAATAGAAAGC-3′；
qpcr-R：5′-CTCGTATTTGGTGGCAGTGATGTTC-3′；
Probe：5′-TATTAGAGTCTAG-Eclipse-3′；
the primer group aims at the rfbs gene of the salmonella pullorum.
3. The kit according to claim 2, wherein the reaction solution comprises:
5U/μl Ex Taq HS 0.125μl；
10×Ex Taq Buffer 1.5μl；
dNTP Mixture 2μl；
0.1 mul of RNase III enzyme;
DNA 2.5μl；
qpcr-F 0.5μl；
qpcr-R 0.5μl；
Probe 0.25μl；
H2O 17.525μl。
4. the kit according to claim 3, wherein the reaction solution comprises reagents in amounts of: 10 XEx Taq Buffer (Mg)2+plus)20mM；
dNTP Mixture 2.5mM；
DNA 2.5μl；
qpcr-F 10μM；
qpcr-R 10μM；
Probe 10μM。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911282829.4A CN110846426A (en) | 2019-12-13 | 2019-12-13 | Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911282829.4A CN110846426A (en) | 2019-12-13 | 2019-12-13 | Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110846426A true CN110846426A (en) | 2020-02-28 |
Family
ID=69609763
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911282829.4A Pending CN110846426A (en) | 2019-12-13 | 2019-12-13 | Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110846426A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112646905A (en) * | 2020-12-30 | 2021-04-13 | 华南农业大学 | Double visual single nucleotide polymorphism detection method and application thereof |
| CN117987579A (en) * | 2024-04-07 | 2024-05-07 | 华南农业大学 | Primer and probe for detecting salmonella pullorum, detection system and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1732272A (en) * | 2002-12-23 | 2006-02-08 | 惠氏公司 | Assay for rnase h activity |
| CN108291253A (en) * | 2015-11-25 | 2018-07-17 | 综合基因技术公司 | Method for variant detection |
| CN109161588A (en) * | 2018-09-29 | 2019-01-08 | 武汉千麦医学检验所有限公司 | For detecting primer sets, probe, kit and the detection method of hepatitis B virus YMDD motif area medicament-resistant mutation |
| CN109750091A (en) * | 2019-03-13 | 2019-05-14 | 江苏宏微特斯医药科技有限公司 | Single tube detects the method and its kit of one or more object to be measured nucleic acid sequences |
-
2019
- 2019-12-13 CN CN201911282829.4A patent/CN110846426A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1732272A (en) * | 2002-12-23 | 2006-02-08 | 惠氏公司 | Assay for rnase h activity |
| CN108291253A (en) * | 2015-11-25 | 2018-07-17 | 综合基因技术公司 | Method for variant detection |
| US20190218611A1 (en) * | 2015-11-25 | 2019-07-18 | Integrated Dna Technologies, Inc. | Methods for variant detection |
| CN109161588A (en) * | 2018-09-29 | 2019-01-08 | 武汉千麦医学检验所有限公司 | For detecting primer sets, probe, kit and the detection method of hepatitis B virus YMDD motif area medicament-resistant mutation |
| CN109750091A (en) * | 2019-03-13 | 2019-05-14 | 江苏宏微特斯医药科技有限公司 | Single tube detects the method and its kit of one or more object to be measured nucleic acid sequences |
Non-Patent Citations (4)
| Title |
|---|
| JOSEPH R DOBOSY等: "RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers", 《BMC BIOTECHNOLOGY》 * |
| JUNPING WEN等: "A one-step closed-tube enzyme-activated blocked probe assay base on single nucleotide polymorphism for rapid detection of Salmonella Pullorum", 《POULTRY SCIENCE》 * |
| XINGXING REN等: "High resolution melting (HRM) analysis as a new tool for rapid identification of Salmonella enterica serovar Gallinarum biovars Pullorum and Gallinarum", 《POULTRY SCIENCE》 * |
| 钱明等: "反应激活型酶荧光探针的研究进展", 《化 工 学 报》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112646905A (en) * | 2020-12-30 | 2021-04-13 | 华南农业大学 | Double visual single nucleotide polymorphism detection method and application thereof |
| CN117987579A (en) * | 2024-04-07 | 2024-05-07 | 华南农业大学 | Primer and probe for detecting salmonella pullorum, detection system and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Khan et al. | Development of a rapid quantitative PCR assay for direct detection and quantification of culturable and non-culturable Escherichia coli from agriculture watersheds | |
| CN110923343A (en) | Isothermal amplification primer group and kit for rapidly detecting salmonella pullorum | |
| CN110878368A (en) | Novel LAMP method, primer group and kit capable of detecting SNP | |
| CN113234814B (en) | Multiplex RPA primer and probe composition for simultaneously detecting acute hepatopancreatic necrosis and hepatoenterosporidium of shrimp and detection method | |
| CN110616272B (en) | Primer group for detecting prawn liver enterocytozoon and kit containing primer group | |
| CN110564881A (en) | Method for detecting vibrio parahaemolyticus by recombinase isothermal amplification technology | |
| CN102134590A (en) | Fast detection method for clostridium perfringens, detection primer group and detection kit | |
| CN110846426A (en) | Fluorescent PCR (polymerase chain reaction) primer group and kit for rapidly detecting salmonella pullorum | |
| CN108315483A (en) | A kind of combination for distinguishing the primer and probe of duck tembusu virus street strain and vaccine strain | |
| CN102154497B (en) | M-PCR (Multiplex Polymerase Chain Reaction) primers, probes and detection methods for vibrio cholerae, vibrio parahaemolyticus and salmonella | |
| CN102304573B (en) | Nucleotide sequence for bacterium diagnosis and application | |
| CN110734993A (en) | nucleic acid detection test paper strip for distinguishing Brucella vaccine strain S19 from naturally infected strain | |
| CN116219041A (en) | Duplex fluorescent PCR detection primer probe group for salmonella enteritidis and salmonella typhimurium, kit and application thereof | |
| KR102231338B1 (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
| AU2020101818A4 (en) | A novel LAMP method, primer set and kit for SNP detection | |
| CN111926113B (en) | Primer group, probe, kit and method for rapidly detecting avian reovirus | |
| CN106801103B (en) | Detection primer group, detection kit and multiplex PCR detection method for streptococcus agalactiae | |
| CN113604588A (en) | Method, primer group, colloidal gold test strip and kit for rapidly detecting vibrio cholerae based on MIRA technology | |
| Lei et al. | Duplex detection of Vibrio cholerae and Vibrio parahaemolyticus by real-time recombinase polymerase amplification | |
| Tang et al. | Real-time recombinase polymerase amplification assay for the detection of Vibrio cholerae in seafood | |
| KR101999070B1 (en) | multiplex PCR primer set and methods for diagnosing White spot syndrome virus and Early mortality syndrome | |
| CN108998575B (en) | Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus | |
| CN110699470A (en) | Dual PCR primer, kit, application and method for detecting salmonella and identifying pullorum disease/gallinarum serotype | |
| CN110878367A (en) | Novel CPA method, primer group and kit capable of detecting SNP | |
| CN106755553B (en) | Complete set of reagents for GeXP multiplex PCR method for identifying or assisting in identifying food-borne pathogenic bacteria and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200228 |
|
| RJ01 | Rejection of invention patent application after publication |