CN112641938A

CN112641938A - DNA recombinant stem cell vector new corona vaccine

Info

Publication number: CN112641938A
Application number: CN202011375242.0A
Authority: CN
Inventors: 翁炳焕
Original assignee: Individual
Current assignee: Individual
Priority date: 2020-11-22
Filing date: 2020-11-22
Publication date: 2021-04-13

Abstract

A DNA recombination stem cell carrier neocorona vaccine is characterized in that mesenchymal stem cells or amniotic fibroblasts are obtained from a stem cell sample bank or a sample remained after a daily experiment, lung stem cells are screened and induced, then a susceptibility gene ACE2 of a new corona virus is inserted into stem cell DNA transfected by an immortalized gene SV40LT and/or hTERT, and the susceptible stem cells which are easily infected by the new corona virus are prepared; inserting RNA interference sequence shRNA of the new coronavirus M, N, E and/or S gene into the susceptible stem cell DNA to prepare a DNA recombinant stem cell which can absorb the new coronavirus into the stem cell through ACE2 and can target and interfere the replication of the new coronavirus in the stem cell through shRNA; and finally inserting a new coronavirus antibody generation gene S1-RBD into the recombinant stem cell DNA to prepare the DNA recombinant stem cell vector new corona vaccine which is easy to absorb the new corona virus competition into the stem cell for RNA interference, can be industrially amplified in vitro and can generate a new corona virus neutralizing antibody.

Description

DNA recombinant stem cell vector new corona vaccine

Technical Field

The invention relates to a new corona vaccine of a DNA recombinant stem cell vector, belonging to the infectious disease prevention and treatment technology in the field of biomedicine.

Background

The novel coronavirus (SARS-CoV-2) has posed a serious threat to global public health. The main structure of SARS-CoV-2 comprises single-stranded positive-strand nucleic acid (ssRNA), spike protein (S), membrane protein (M), envelope protein (E), and nucleocapsid protein (N). Wherein the S protein is cleaved by host protease into an N-terminal S1 subunit and a C-terminal S2 subunit in the infection process, the S1 subunit is composed of an N-terminal structural domain (S1-NTD) and a receptor binding domain (S1-RBD), the S1-RBD is responsible for recognizing and binding a host cell surface receptor angiotensin converting enzyme 2(ACE2), and the S2 subunit mediates fusion between a virus envelope and a host cell membrane, so that the virus enters cells to cause infection. The N protein is essential for RNA synthesis, plays a crucial role in viral assembly and RNA transcription, and is also involved in host cell response to viral infection. The M and E proteins play an important role in viral assembly.

The existing novel coronavirus vaccine is mainly designed and developed by taking S protein or RBD thereof as a target. In the preparation of new coronavirus vector vaccines, human adenovirus type 5 (Ad5) is the most widely used viral vector. The human adenovirus contains 26-45kb double-stranded linear DNA genome, which contains 4 early transcription gene regions (E1-E4) and 1 late transcription gene region, and each end of the genome has 1 segment of Inverted Terminal Repeat (ITR) of about 100 bp. The E1 and E3 genes are deleted from the first generation of adenovirus vector, the E1-E4 genes are deleted from the second generation of adenovirus vector, and Ad5 is the third generation of adenovirus vector, all virus coding genes are deleted, only 5 'and 3' ITRs and packaging signals are reserved, and 36kb of exogenous genes can be accommodated. Although the cytotoxicity and immunogenicity of AdS are weakened, the expression time of exogenous genes is prolonged, infected cells are more and the application is wide, but the AdS is easy to cause nonspecific infection and is not suitable for targeted therapy, and side effects are easy to generate in clinical application. Ad5 is not integrated with host cell DNA, although it is safe, it makes target gene expression unstable, and after entering host cell, it is easy to be phagocytized by reticuloendothelial cell and loses its effect. Meanwhile, Ad5 cannot be replicated, so that the recombinant virus in vivo is fewer and fewer, and the method is not suitable for long-term treatment of clinical chronic diseases. Ad5 is essentially a virus and still has immunogenicity and cytotoxicity, the immune response of a host to a viral vector can interfere with the immune response to a target antigen, most normal people are infected by adenovirus, and the pre-existing immunity to the viral vector can also interfere with the immune effect of the vaccine.

At present, stem cells for clinical treatment mainly focus on Mesenchymal Stem Cells (MSCs) and natural killer cells (NK) at home and abroad, and the MSCs are most widely used. MSCs are derived from mesoderm in early development, belong to pluripotent stem cells, can migrate to the exact part of injury, can be directionally differentiated into various cell lines such as lung histiocyte and capillary endothelial cells, generate various cytokines, secrete a large amount of exosomes and vesicles containing miRNA, treat lung injury by influencing signal pathways such as PI3K/AKT and NF-kB, and repair damaged organs by mechanisms such as immunity regulation, fibrosis resistance, inflammatory factor storm inhibition and the like. The stem cells have very strong antiviral ability, can survive and play a role in local viral infection, preliminarily show the safety and effectiveness of the MSCs in the treatment of severe new coronary pneumonia, and have good clinical application prospect. However, no literature report on the preparation of a new coronavirus vector vaccine by replacing an adenovirus vector with a further modified stem cell is found.

Usually, the mesenchymal stem cells will age or die after in vitro passage to 15-30 generations, while the cell line transfected by the simian virus 40 large T antigen gene (SV40LT) can be cultured in vitro for more than 350 generations, and can basically keep the differentiation phenotype and biological characteristics of the original cells, and the mesenchymal stem cells are widely applied to the immortalization of human liver cells, vascular striation marginal cells, cartilage stem cells and the like. This provides the basis for the improvement of the culture life of the stem cells in vitro and the industrial expansion. The literature reports that SARS-CoV replicates in ACE2 transfected 293T cells but not in mock transfected 293T cells. It is now reported that SARS-CoV-2 also infects host cells via the ACE2 receptor. In the traditional concept, SARS-CoV-2 is not expected to infect body cells and therapeutic stem cells through ACE2 receptor, but the invention constructs a recombinant vector expressing ACE2 in a reverse method, transfects the stem cells to enhance the function of the stem cells expressing ACE2, thereby enhancing the susceptibility of the stem cells to SARS-CoV-2, enables the stem cells to compete with host cells for inhaling more new coronavirus in treatment so as to reduce the infection chance of normal tissues of the body, and then inhibits and kills the new coronavirus introduced into the stem cells by ACE2 through RNA interference genes artificially assembled on the DNA of the stem cells.

RNA interference (RNAi) refers to the antiviral effect of specifically silencing a foreign gene. When the exogenous target gene is integrated into the host cell genome, the exogenous target gene can utilize the host cell to transcribe dsRNA, the dsRNA is cut into a plurality of small-fragment siRNAs (about 21-23 bp) with specific length and structure by endonuclease (Dicer) in host cytoplasm, the siRNAs are melted into a sense strand and an antisense strand under the action of intracellular RNA helicase, and the antisense siRNAs are combined with the endonuclease, the exonuclease and the helicase in vivo to form an RNA-induced gene silencing complex (RISC). When the exogenous gene invades the host cell, the RISC is specifically combined with the homologous sequence of the mRNA expressed by the exogenous gene, the homologous mRNA is cut at the combination part, and the cut broken mRNA is immediately degraded, thereby inducing the degradation of the host cell aiming at the exogenous mRNA. The siRNA can not only guide RISC to cut homologous single-stranded mRNA, but also can be used as a primer to be combined with target RNA and synthesize new dsRNA under the action of RNA polymerase, the newly synthesized dsRNA is cut into a large amount of secondary siRNA by Dicer, and then RISC is formed to play a role, so that the function of RNAi is further amplified, and finally the exogenous target mRNA is completely degraded. However, no report is found for preparing a new coronavirus vaccine by taking artificially constructed stem cells with RNA interference function as vectors.

Disclosure of Invention

The present inventors have devised the present invention based on the above-mentioned problems of the present stem cells for treatment, the conventional concept and the conventional vaccine vectors.

The invention aims to prepare a DNA recombinant stem cell for artificially assembling an immortalized gene, a new coronavirus susceptibility gene and an RNA interference gene; another purpose is to replace adenovirus vector with DNA recombinant stem cell to prepare DNA recombinant stem cell vector vaccine.

The purpose of the invention is implemented by the following technical scheme:

first, mesenchymal stem cells are obtained. For example, mesenchymal stem cells or amniotic fluid fibroblasts are obtained from a stem cell bank or a sample remaining after prenatal diagnosis, and adult stem cells or lung stem cells are screened and induced.

Further, stem cells are assembled with immortalizing genes. For example, a recombinant vector carrying the hTERT and/or SV40LT is constructed, stem cells are transfected, and the hTERT and/or SV40LT genes are integrated into the DNA of the stem cells, so that new functions which can be permanently survived and can be infinitely passaged are obtained, and the stem cells or the lung stem cells can be obtained through identification and induction.

Further, stem cells are assembled with a new coronavirus susceptibility gene. For example, angiotensin converting enzyme II (ACE2) gene was ligated into lentiviral expression vector pHBLV-CMV-ACE2-EF1-ZsGreen-T2A-puro or pGC-FU, recombinant plasmid pHBLV-OE-ACE2 or pGC-FU-ACE2 was constructed, recombinant plasmid pHBLV-OE-ACE2 and packaging plasmids (psPAX2 and pMD2G) or recombinant plasmid pGC-FU-ACE2 and packaging plasmids (pHelper1.0 and pHelper2.0) were co-transfected into 293FT cells, recombinant lentivirus OE-ACE2 or FU-ACE2 carrying ACE2 was packaged, and recombinant lentivirus was transfected into stem cells to integrate ACE2 gene into stem cell DNA. Thereby enhancing the virus tropism of the stem cells, namely being more easy to compete with host cells to inhale nCoV and carry out RNA interference in the stem cells to kill the nCoV.

Further, stem cells are assembled with a novel coronavirus RNA interference gene. For example, the targeting interfering sequence siRNA of a new coronavirus (nCoV) is designed and preferred, an shRNA template is synthesized, the siRNA template is connected to a lentiviral vector pHBLV or LV3 to construct a recombinant plasmid pHBLV-nCoV-N-shRNA or LV3-nCoV-N-shRNA, the recombinant plasmid pHBLV-nCoV-N-shRNA and a packaging plasmid (pHBLV, a psPAX2 vector and a pMD2G vector) or the recombinant plasmid LV3-nCoV-N-shRNA and a packaging plasmid (pLV/helper-SL3, pLV/helper-SL4 and pLV/helper-SL5) are co-transfected into 293FT cells to package lentiviruses carrying the shRNA, the lentiviruses are transfected into stem cells, the shRNA gene is integrated into the stem cell DNA, and thereby obtaining a new function capable of interfering the replication of nCoV in the stem cells.

Further, a DNA recombinant stem cell which artificially assembles an immortalized gene hTERT and/or SV40LT, a new coronavirus RNA interference gene shRNA and a new coronavirus susceptibility gene ACE2 is prepared.

And further, the DNA recombinant stem cells replace adenovirus vectors in the prior art to prepare the stem cell vector new corona vaccine. For example, the amino acid sequence of S protein of SARS-CoV-2 (RBD amino acids are Gly319 to Asn541) is analyzed according to GenBank, the whole gene of nucleic acid corresponding to the RBD peptide segment is synthesized by synonymous substitution of amino acid codons, the enzyme cutting sites of EcoR and IXhoI are respectively inserted at the two ends of the RBD gene, the synthesized RBD gene is constructed into a recombinant plasmid pHBLV-RBD, or the enzyme cutting sites of HindIII and XhoI are respectively inserted at the two ends of the RBD gene, the synthesized RBD gene is constructed into a recombinant plasmid pGC-FU-RBD, lentiviruses carrying the RBD are respectively packaged, the lentiviruses are transfected into DNA recombinant stem cells, the RBD gene is integrated onto the DNA of the recombinant stem cells, and the RBD protein can stimulate the host to produce new coronavirus antibodies through the expression of the RBD gene.

Finally, preparing the DNA recombinant stem cell vector neocorona vaccine which has the functions of natural treatment of stem cells, artificially improved immortalization, susceptibility to new corona virus, RNA interference of new corona virus and generation of S1-RBD antibody.

The invention has the beneficial effects that:

the originally abandoned histiocyte is transformed into DNA recombinant stem cells with a plurality of new functions, and the DNA recombinant stem cells are used for replacing the traditional adenovirus carrier to prepare the DNA recombinant stem cell carrier new corona vaccine.

The DNA recombinant stem cell solves the problems of ultralow temperature permanent storage, renewable utilization and commercialization requiring infinite amplification due to the assembly of immortalized genes (SV40LT and/or hTERT).

The DNA recombinant stem cell is easy to inhibit the virus from replicating in the stem cell because of the assembly of the RNA interference gene of the new coronavirus, so that the stem cell which is easy to kill the virus originally is transformed into the DNA recombinant stem cell which is easy to kill the virus.

The DNA recombinant stem cell assembles an RNA interference gene on the basis of assembling a new coronavirus susceptibility gene (ACE2), so that the DNA recombinant stem cell is more likely to compete with a host cell to suck viruses into the stem cell and perform RNA interference in the stem cell, and the infection probability of the host cell is reduced. The application method of the ACE2 overcomes the traditional prejudice that therapeutic stem cells are generally worried about being infected by viruses, and the ACE2 gene assembled in DNA recombinant stem cells can express ACE2 protein, the protein can stimulate a host to produce ACE2 antibody, and the ACE2 antibody can prevent new coronavirus from infecting new host cells due to the fact that the new coronavirus can be prevented from being combined with ACE2 receptors.

The DNA recombinant stem cell assembled with ACE2 gene and RNA interference gene has the functions of sucking virus into stem cell and inhibiting virus copying in stem cell to introduce virus into cell and kill virus inside cell, so that the antiviral reaction with tissue damage effect is transferred from host tissue to stem cell to reduce the damage of host tissue caused by antiviral reaction.

When the DNA recombinant stem cell is used as a vaccine vector, the vaccine is safer to use due to the substitution of an adenovirus vector with immunogenicity, the homotypic selection, the non-entry of foreign genes into host cells and the like; and because the assembled S1-RBD gene can express RBD protein, the RBD protein can stimulate the host to produce RBD neutralizing antibodies, even if stem cells are phagocytized, the antigen information of the stem cells can be transmitted to immune cells by phagocytes to produce the RBD neutralizing antibodies, and therefore, the novel coronavirus can be prevented from being combined with ACE2 receptors of host cells through S1-RBD to infect the host cells.

Drawings

FIG. 1 is a clone of immortalized cells screened with G418 and puromycin according to the present invention.

FIG. 2 is a subculture map of a cell clone transfected with SV40LT and hTERT according to the present invention.

FIG. 3 is the cell growth status of stem cells of recombinant ACE2 co-cultured with isolated virus for 72 hours.

FIG. 4 is the cell growth status of stem cells of recombinant ACE2 and shRNA co-cultured with isolated virus for 72 hours.

In FIG. 1, since immortalized cells transfected with SV40LT and hTERT survived without being killed by G418 and puromycin, surviving single cells grew to form cell clones.

In FIG. 2, cells transfected with SV40LT and hTERT grew adherent in fusiform during passage and grew vigorously.

In FIG. 3, the cells are seen to be round, floating and dead, indicating that the expression of ACE2 gene in the cells is favorable for the virus to be absorbed into the cells and to multiply in the cells, resulting in faster cell death.

In FIG. 4, it can be seen that the cells are still growing fusiform adherent, indicating that the expression of shRNA interferes with intracellular replication of the virus, allowing stem cells that have recombined ACE2 and shRNA to take the virus into and kill it intracellularly.

Detailed Description

The following detailed description of the embodiments of the present invention is provided in conjunction with the accompanying drawings, but these exemplary descriptions should not be construed as limiting the scope of the present invention as defined in the appended claims.

EXAMPLE I preparation of recombinant DNA Stem cells

1. Collection of Mesenchymal Stem Cells (MSC)

1.1. Collection of amniotic fluid mesenchymal stem cells

Collecting amniotic fluid cells of the pregnant woman to be detected according to the prenatal diagnosis process, performing cell culture and prenatal diagnosis, and screening out fusiform amniotic fluid cells or mesenchymal stem cells growing adherently from the remaining amniotic fluid cells under an inverted microscope.

1.2. Collection of umbilical cord mesenchymal stem cells

Taking out the frozen umbilical cord from liquid nitrogen tank, thawing rapidly in 37 deg.C water bath, cleaning with sterile PBS, removing residual blood stain, and cutting into size of about 1mm³The tissue block (2) is placed in a culture dish paved with fetal calf serum, placed at 37 ℃ for 6 hours, added with 10% fetal calf serum DMEM medium, and 5% CO at 37 DEG C₂Culturing in an incubator, observing the growth condition of cells around adherent tissues, and digesting and passaging by pancreatin when the cells reach 80-90% fusion degree to obtain the mesenchymal stem cells.

1.3. Collection of mesenchymal Stem cells

Sterile tappingFetal lung tissue is mechanically dispersed, digested with 0.25% trypsin, filtered with gauze having a pore size of 100 μm, centrifuged at 1000 r/min for 5min, the supernatant is discarded, and DMEM (0.1umol beta-mercaptoethanol, 100UI/mL streptomycin, 10% fetal bovine serum) is added. At 37 deg.C, 5% CO₂Culturing under the condition. And changing the solution after 45min to remove the cells which are not attached to the wall, and changing the solution every 48 h. After 80% cell confluence, 0.25% trypsin digestion was used for passage.

2. Immortalization performance improvement of mesenchymal stem cells

2.1 construction of recombinant vectors for hTERT/pLPCX and SV40LT/pLXSN

Construction of SV40LT/pLXSN

Performing PCR amplification on SV40LT high-fidelity long fragments by using SV40 DNA (strain 766) as a template, an upstream primer of 5'-GCCCAGGATCCTTAACAACAACAACAAT-3' and a downstream primer of 5'-ACGCTGAATTCCCTCTGAGCTAT-3'; the PCR product of SV40LT and the pLXSN retrovirus vector are subjected to enzyme digestion, connection, transformation, screening and sequencing verification by EcoR I/BamH I to obtain the SV40 LT/pLXSN-containing recombinant retrovirus vector.

2.1.2. construction of hTERT/pLPCX

Cutting PIRES2-EGFP-hTERT plasmid with EcoR I to obtain hTERT cDNA fragment, dephosphorylating, subcloning to pLPCX retrovirus vector EcoR I site, connecting with T4DNA ligase at 22 deg.C, transforming to competent E.coli DHS-alpha E, culturing overnight at 37 deg.C, selecting colorless colony for inoculation, purifying recombinant plasmid, performing enzyme cutting and sequencing identification, expanding and culturing hTERT-containing E.coli, and purifying pLPCX-hTERT recombinant clone with Endotoxin-Free plasmid.

2.2. Combined transfection of SV40LT and hTERT into mesenchymal stem cells

Mesenchymal cells to be transfected were matched to approximately 8X 10⁵Inoculating in single cell concentration, and placing in 5% CO₂Culturing at 37 deg.C, infecting with recombinant retrovirus containing SV40LT gene (Polybrene concentration is 8ug/mL) after 24 hr, screening with 500ug/mL G418 for 4 weeks after 1 week, infecting with recombinant retrovirus containing hTERT gene (Polybrene concentration is 8ug/mL) after cell clone appears, and 1 week laterCell clones were obtained by screening with 2ug/mL puromycin (see FIG. 1).

2.3. Identification of immortalized mesenchymal stem cells

2.3.1. Biological characterization of immortalized stem cells

Includes that the cell is spindle-shaped and fibroid. ② white bands appear at the relative molecular mass of 120000 and 93000 respectively by Western detection. ③ the growth curve of the cell line is typical of the "S" growth characteristics. And fourthly, the chromosome karyotype of the cell line is diploid. The cell line can not grow in soft agar. Sixthly, the nude mouse has negative tumorigenicity test.

2.3.2. Surface molecule detection of immortalized stem cells

Detecting cell membrane surface molecules by using a flow cytometer, wherein positive molecules comprise CD73-APC, CD90-FITC, CD44-PE and CD 105-Cy5.5; negative molecules include CD11b-PE, CD19-PE, CD34-PE, CD45-PE, HLA-DR-PE. Through identification, the immortalized mesenchymal stem cells which can be permanently passaged in vitro are obtained. FIG. 2 shows stem cells passed to passage 35.

2.3.3. Identification of Lung Stem cell lines

The human lung stem cell line needs to meet the following requirements: observing with a phase contrast microscope: growing in shuttle shape and arranging in vortex or barrier shape. Detecting by a flow cytometer: cell surface markers CD45, CD11a, CD14, CD90, CD34, CD71, CD25, CD105, CD117, CD166 and CD44 were positive. And thirdly, confocal technology detection: keratin expression is negative, and four sternness related factors c-Myc, Oct4, Nanog and Nestin are positive. Fourthly, indirect immunofluorescence detection: vimentin (vimentin), collagen type III (collagen III), Fibronectin (FN) expression were positive, while Surfactant protein C precursor (pro-Surfactant protein C, proSP-C), von Willebrand factor (vWF), and alpha smooth muscle actin (alpha-SMA) expression were negative.

3. Assembly of a novel coronavirus susceptibility gene (ACE2) for immortalized stem cells

3.1. Construction and identification of lentiviral expression vector pHBLV-ACE2-OE or pGC-FU-ACE2

ACE2 in plasmid pc-DNA3.1-hygro (+) -mACE2 (or RNA extracted from lung tissue cells, transcribed as cDNA, and then ACE2 PCR-amplified) was amplified by PCR. Designing and synthesizing a PCR primer sequence according to the mRNA sequence of human ACE2 in GenBank, wherein an outer end primer amplified by human ACE 2: f1(F out) 5'-GAT GGA GTA CCG ACT GGA GTC-3', R1(Rout) 5'-CTA ATA TCG ATG GAG GCA TAA-3', product 547 bp. An inner end primer: f2(F in) 5'-GAG GAG GAT GTG CGA GTG GCT A-3', R2(R in) 5'-CCA ACC ACT ATC ACT CCC ATC A-3', and a product of 269 bp. The amplification primer sequence of the human beta-actin is as follows: F5'-GCT CGT CGT CGA CAA CGG CTC-3', R5'-CAA ACA TGA TCT GGGTCATCTTCT-3', product 353 bp. PCR conditions were as follows: 94 deg.C for 5min, then 94 deg.C for 30s denaturation, 55 deg.C for 30s annealing, 68 deg.C for 5min, circulating for 30 times, and finally extending at 68 deg.C for 10 min.

The vector pHBLV-CMV-ACE2-EF1-ZsGreen-T2A-puro and the PCR product are respectively cut by BamH I and EcoRI, or pGC-F and the PCR product are respectively cut by AgeI and EcoRI, agarose electrophoresis is used for purification, linearized vector DNA, the PCR product recovered by enzyme digestion, T4 phage DNA ligase and buffer thereof and ddH2O are placed at 16 ℃ for overnight connection, the connection liquid is transformed into competent cells, and positive clones are identified by PCR and sequencing. The transformed bacteria are amplified by LB culture solution, pHBLV-ACE2-OE or pGC-FU-ACE2 is extracted by a plasmid extraction kit, 293FT cells are transfected by Lipofectamine 2000, and expression of ACE2 genes is detected by Western-Blot after 72h of transfection.

3.2. Packages carrying ACE2 lentivirus and titer determination thereof

A lentivirus expression vector (pHBLV-OE-ACE2), a packaging plasmid (psPAX2 vector and pMD2G) or pGC-FU-ACE2 and the packaging plasmid (pHelper1.0 and pHelper2.0) are co-transfected into 293FT cells according to Invitmgen company upofectamine 2000 instructions to obtain a recombinant lentivirus (OE-ACE2) or Lentiviral-ACE carrying the ACE2 gene.

At the same time, another set of 293FT cells was co-transfected with pHBLV empty vector (containing GFP gene), packaging plasmids (psPAX2 vector and pMD2G), and the empty vector (NC-GFP) carrying only GFP gene was obtained as a control.

And 8h after transfection, replacing the medium with a complete medium, culturing for 48h, collecting cell supernatant rich in lentivirus, centrifuging for 10min at 4 ℃ at 4000g, filtering the supernatant by using a 0.45-micron filter, removing cell debris, and centrifuging to obtain the lentivirus with high titer.

Infecting 293T cells with the virus stock solution to be identified, extracting RNA after 4d, and determining the virus titer of the lentivirus to be detected by using a Real-Time PCR method.

3.3. Recombinant lentivirus transfection of immortalized stem cells

Taking immortalized stem cells at a rate of 1X 10 per well⁶Inoculating the cells at a density of 6-well plates, dividing into a target gene over-expression (OE-ACE2) group, an empty vector (NC-GFP) control group and a blank group, wherein each group has 2 wells, adding a lentiviral stock solution diluted by 5 times into a lentiviral group when the cells are converged to 30%, adding an empty vector stock solution diluted by 5 times into an empty vector group, culturing for 24h, replacing a 10% FBS DMEM solution, and adding puromycin (2.50 mu g. mL) with an optimal screening concentration^-1) Puromycin concentration was maintained and fluid changes were performed every other day until the blank cells were completely dead and selection was complete (Lentiviral-ACE transfected cells were selected with ampicillin). The cells which are not killed by puromycin are stem cell lines which are transfected by recombinant lentiviruses and have integrated ACE2 gene on DNA, and are called recombinant ACE2 stem cells.

3.4.ACE2 gene detection of recombinant ACE2 stem cells

RT-PCR detection of mRNA transcript levels of the ACE2 Gene

Taking ACE2 stem cells, and culturing at a ratio of 1 × 10⁶And inoculating the cells in a 6-well plate at a density, culturing for 4 days, observing the expression of fluorescence by using a fluorescence microscope, and detecting the transcription level of the ACE2 gene in ACE2 stem cells by using RT-PCR. The primer sequence of the RT-PCR amplification ACE2 is as follows: upstream of ACE 2: CMV-F: 5 '-CGCAAATGG 6 CGGTAGGCGTG-3'; downstream: EF 1-Rn: 5'-GCCAGTACACGACATCACTT-3', respectively; the upstream and downstream of beta-actin are respectively: 5'-TGGACTTCGAGCAAGAGATGG-3', 5'-ATCTCCTTCTGCATCCTGTCG-3'. The RT-PCR detected high level transcription of the ACE2 gene in the OE-ACE2 group, showing 1 additional 409bp mRNA band transcribed from ACE2 compared to the control group. And through comparison and statistical analysis of ACE2/B-actin integrated optical density value (IOD), the mRNA expression level of the DNA recombinant stem cell carrying the ACE2 gene is found to be obviously increased (p <)0.01) (0.234 ± 0.101 in the normal cell group, 0.247 ± 0.098 in the empty vector control group, and 0.682 ± 0.118 in the ACE2 stem cell group), suggesting that transcription of ACE2 is significantly increased.

Western-Blot detection of protein expression levels of ACE2 stem cells

Extracting proteins of cell lysates of each group, quantifying the proteins by a BAC method, and arranging 3 random multiple holes in each group. The sample proteins were separated by 10% SDS-PAGE, electroblotted onto nitrocellulose membranes, primary antibody was anti-VDR diluted 1: 400, visualized using ECL chemiluminescence kit, and the relative gray values of the protein bands determined using a gel image analysis system. Western-Blot detected that the ACE2 gene expression of ACE2 stem cell group is obviously increased, and shows 1 very obvious protein expression band (ACE2-90kDa) expressed by ACE2, while the normal cell group and the empty vector group only have 1 same beta-actin (42kDa) band.

4. Novel coronavirus RNA interference gene assembly of recombinant ACE2 stem cells

4.1. Design of siRNA Gene of novel coronavirus

By Ambion corporation (http：//www.ambion.com/techlib/misc/siRNAtools.html) The shRNA online design software of (2) screens a plurality of siRNA alternative sequences from the conserved sequences of SARS-CoV-2 (NC-045512.2 strain ORF1ab, 3' UTR, S, E, M, N).

Based on the database of human genome, Tm value of RNA binding and the result of specific alignment, 3 conservative siRNA sequences without homology with human genome are respectively preferred (Table 1A), and 1 irrelevant siRNA sequence is designed as negative control (NC: 5'-TTCTCCGAACGTGTCACGTAA-3').

TABLE 1A siRNA candidate sequence of the S, E, M, N gene of NC-045512.2 strain neocoronavirus

4.2. Synthesis of shRNA templates

After the target sequence is determined, an shRNA template is designed according to the polyclonal restriction enzyme cutting site of a lentivirus interference vector pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO,each template is composed of two mostly complementary single-stranded DNAs with the length of 52-60nt, the 3' end of each oligonucleotide single-stranded DNA has 2-5U-shaped protrusions, including the sense sequence of the target sequence, loop sequence, the antisense sequence of the target sequence, transcription termination signal and cleaved sticky end sequence, and after annealing and complementation, a DNA double-strand with sticky ends of BamH I and ECORI cleavage sites can be formed (for example, with pSilencer4.1.CMV. neo, BamH I and Hind III). As shown in Table 1B, "italics" indicates the cleavage site, "bold" indicates the stem-loop structure, ")"Underlining"denotes the sense strand.

Table 1B Synthesis of shRNA templates corresponding to S, E, M, N Gene with siRNA in Table 1A

4.3. Construction of Lentiviral interference vectors

Taking a targeting interference sequence (nCoV-N-siRNA-1/2/3) of a new coronavirus N gene as an example, a T4 ligase is used for connecting a synthesized shRNA template with a linearized lentiviral vector pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO to construct a lentiviral interference vector pHBLV-nCoV-N-shRNA1/2/3, and the transformation competence E.coli DH5 alpha.

4.4. Identification of lentiviral interference vectors

Transformation of lentiviral interference vectors to competent E.coli DH 5. alpha.10. mu.L, plated in solution containing 50. mu.g.mL^-1And (3) performing resistance culture on an LB (lysogeny broth) plate of puromycin, screening out positive clones, extracting plasmids, performing enzyme digestion or sequencing identification by using PCR (polymerase chain reaction), BamH I and ECORI (isocoryl chloride), culturing the positive clones with correct sequencing, and extracting the plasmids according to a plasmid extraction kit. And observing whether the 3 targeted nCoV-N-siRNA1/2/3 interference genes in the recombinant lentiviral interference vector are completely consistent with the designed interference sequence.

4.5. Packaging with shRNA lentivirus

293FT cells in logarithmic growth phase were taken at 5X 10⁶cell·mL^-1The density of (A) was inoculated into a culture flask, 4. mu.g each of the recombinant plasmid and the lentiviral packaging plasmid (consisting of three plasmids, pHBLV, psPAX2 vector and pMD2G vector) was added, andco-transfecting with Lipofectamine200 liposome, changing into complete culture medium after 8h, continuing culturing for 48h, collecting supernatant rich in lentivirus, centrifuging, filtering, packaging, and storing at-80 deg.C.

4.6. Detection of lentivirus titre

Wells dilution method for counting fluorescent cells: taking 10 μ L of lentivirus stock solution, diluting with 10 times of 10% FBS DMEM culture solution to obtain 3-5 gradients, and adding 293FT cells at a rate of 3 × 10 per well⁴The density of each cell was seeded in 96-well plates at 37 ℃ with 5% CO₂After 24 hours of incubation, 150. mu.L of DMEM medium was replaced with 10% FBS per well and incubation was continued for 48 hours, and the virus titer was calculated by counting the fluorescent cells using a fluorescence microscope. As a result, after 293FT cells were transfected with the recombinant plasmid pHBLV-nCoV-N-shRNA (LV3-nCoV-N-shRNA), the plasmid was packaged into lentiviral particles, and green fluorescence was observed in the 293FT cells under a fluorescence microscope. Second, Real time quantitative PCR method determination: 293FT cells were cultured in 10% FBS DMEM, infected with lentivirus stock to be assayed, RNA was extracted according to the TRIZOL protocol of Invitrogen, and the concentration of the extracted RNA was determined by RT-qPCR.

4.7. Lentiviral transfection of recombinant ACE2 stem cells

At a rate of 1X 10 per hole⁶According to the cell density, ACE2 stem cells with good growth state are inoculated to a 6-well plate, and when the cells are fused to 30%, the cells of a test group are respectively added with 5-fold diluted lentivirus stock solution and are respectively named as pHBLV-nCoV-N-shRNA1 group, pHBLV-nCoV-N-shRNA2 group and pHBLV-nCoV-N-shRNA3 group. A negative control group (a lung stem cell group transfected with only a lentiviral interference vector) and a blank control group (a normal lung stem cell group not transfected with a lentiviral interference vector) were set simultaneously.

4.8. Screening for transfection-positive ACE2 Stem cells

After the cells were cultured for 24 hours, 10% FBS-containing DMEM solution was replaced, and puromycin (2.00. mu.g.mL) was added at the optimum selection concentration^-1) And maintaining the puromycin concentration, changing the liquid every other day until the blank control group completely dies, and finishing screening. ACE2 stem cells not killed by puromycin were transfected with recombinant lentiviral interference vectors and had incorporated a novel coronavirus targeting interference sequence (nCoV-s) into the DNAhRNA). The ACE2 (lung) stem cell can express dsRNA, and the dsRNA can interfere nCoV gene, thereby generating antiviral effect in the stem cell, and is called as a gene silencing DNA recombinant stem cell.

The invention comprises selecting lentivirus vector pSilenccer 4.1.CMV. neo, carrying out enzyme digestion by EcoR I and Hind III, constructing recombinant vector LV3-nCoV-N-shRNA, co-transfecting the recombinant vector and packaging plasmids (pLV/helper-SL3, pLV/helper-SL4 and pLV/helper-SL5) into 293FT cells, packaging lentivirus, and screening positive clones by ampicillin.

4.9. Verification of shRNA expression of DNA recombinant Stem cells

4.9.1.RT-PCR detection of mRNA expression of shRNA

Total RNAs of nCoV-N-shRNA1, nCoV-N-shRNA2 and nCoV-N-shRNA3 groups of DNA recombinant stem cells are respectively extracted by using Trizol reagent, primers shown in Table 2 are designed, and mRNA of nCoV-N-shRNA1/2/3 is quantitatively analyzed by taking GAPDH as an internal reference, wherein PCR conditions are as follows: denaturation at 95 ℃ for 3min, 12s at 95 ℃, 40s at 62 ℃ and 30s at 72 ℃ for 40 cycles. Each group is provided with 3 random complex holes. After the reaction is finished, the Ct value in each sample tube is automatically recorded by the instrument, the relative content of the target gene is calculated by taking GAPDH as an internal reference, and 2 is used^-ΔCtAnd (4) showing. And observing the mRNA expression quantity of the blank control group and the negative control group pHBLV-nCoV-N and the mRNA expression quantity of the pHBLV-nCoV-N-shRNA1, pHBLV-nCoV-N-shRNA2 and pHBLV-nCoV-N-shRNA3 groups in the 3 interference groups, deducing whether 3 specific targets have silencing effect on nCoV-N genes or not, and screening a group (pHBLV-nCoV-N-shRNA2) with the best interference effect by having statistical difference with the negative and blank control groups.

TABLE 2 design of new coronavirus S, E, M, N gene targeted interfering sequence siRNA 1-siRNA 3 amplification primers

Western Blotting detection of protein expression of shRNA

Extracting proteins of cell lysates of each group, quantifying the proteins by a BAC method, and arranging 3 random multiple holes in each group. The sample proteins were separated by 10% SDS-PAGE, electroblotted onto nitrocellulose membranes, primary antibody was anti-VDR diluted 1: 400, visualized using ECL chemiluminescence kit, and the relative gray values of the protein bands determined using a gel image analysis system. Observing the expression quantity of pHBLV-nCoV-N proteins of the blank control group and the negative control group and the expression quantity of the recombinant lentivirus pHBLV-nCoV-N proteins in the 3 interference groups of pHBLV-nCoV-N-shRNA1, pHBLV-nCoV-N-shRNA2 and pHBLV-nCoV-N-shRNA3, wherein the expression quantity is not statistically different from that of the positive control group and the blank control group. And the result shows that the pHBLV-nCoV-N-shRNA2 group can effectively interfere the protein expression of the nCoV-N gene.

The vectors of the present invention also include overexpression vectors such as pHBLV-CMV-IRES-ZsGreen, pHBLV-CMV-EF1-RFP, pHBLV-CMV-IRES-Puro, pHBLV-IRES-ZsGreen-PGK-Puro, pHBLV-CMVIE-ZsGreen-T2A-Puro, pHBLV-CMVIE-RFP-T2A-Puro, pHBLV-CMVIE-Luc-T2A-Puro, pHBLV-CMVIE-ZsGreen-T2A-Luc, pGC-FU, interference vectors such as pHBLV-U6-ZSGGreen, pHBLV-U6-Green-Puro, pHBLV-U6-Puro, pHV-U7-sZ A-T2-Puro, pHBLV-U6-pHV-5393-pHV-U7-SLS-T2-rV-6 5-PRV-RFP 2-LSV-RT 3-RFP 3-PRV-TMV-RT 2-prro, pHBLV-RT 3-PRV-LR-T2-5-LR-rV-LR 2-LR, pHBLV-U6-ZsGreen-T2A-Luc, pHBLV-U6-RFP-T2A-Luc, interfere with the over-expression of double-frame vectors such as pHBAd-U6-CMV (for constructing recombinant vectors for simultaneous expression of two genes, e.g., pHBAd-U6/shRNA-CMV/ACE2 for shRNA and ACE2, pHBAd-U6/shRNA-CMV/RBD for shRNA and RBD).

Functional assay of DNA recombinant Stem cells

5.1 in vitro antiviral function assay of DNA recombinant Stem cells

5.1.1. Sample collection

The throat swab of the patient with COVID-19 confirmed diagnosis is taken, double antibodies (10000IU penicillin and 10000 mug streptomycin) are added according to the proportion of 100: 1, the final concentration of the penicillin and the streptomycin is 100IU and 100 mug respectively, and the mixture is kept at 4 ℃ for overnight use.

5.1.2. Virus culture and isolation

Vero-E6 was inoculated into 12.5cm of DMEM medium containing (10% fetal bovine serum)²Placing in a culture flask at 36 deg.C and 5% CO₂Culturing to 30% confluent monolayer cells in incubator, removing culture medium, washing cells with DMEM for 2 times, adding 0.5mL of double antibody-treated COVID-19 patient sample into culture flask, standing at 36 deg.C and 5% CO₂Adsorbing for 90min in an incubator, removing the sample, adding 3.5mL DMEM culture solution (10% fetal bovine serum), observing cytopathic effect (CPE) every day, culturing for 5-7 d, taking supernatant of pathological cells, performing sucrose gradient ultracentrifugation, separating new coronavirus, and preparing 10% culture solution into 10% of the new coronavirus³～10⁵ TCID₅₀Viral fluid/ml (used simultaneously in the animal experiments described below).

Co-culture of recombinant DNA Stem cells with viruses

Setting a mesenchymal stem cell group, an immortalized stem cell group, an ACE2 stem cell group and a DNA recombinant stem cell group (recombinant ACE2 and shRNA stem cell group), inoculating 12 pore plates into each group, and enabling each pore to contain 2 multiplied by 10⁵Individual cells, 2mL of DMEM medium (10% fetal bovine serum), at 36 ℃ with 5% CO₂When the mixture was cultured in an incubator to 30% confluency, 0.5mL of virus solution was added to each well, and the culture was continued. Then, after incubation for 1 hour, 6 hours, 24 hours and 72 hours, 3-well supernatants were collected from each group, mixed and diluted 1: 4, 1: 12, 1: 36, 1: 108, 1: 324, 1: 972, 1: 2916 and 1: 8748 times, and subjected to RT-PCR detection.

5.1.4. Real-time fluorescent RT-PCR detection of viral RNA

Nucleic acid extraction kit (batch No. 2019004), 2019 novel coronavirus (ORF1ab/N) nucleic acid detection kit (batch No. 20200123) and DA3200 nucleic acid extractor from Daan Gen-stocky Co., Ltd, Zhongshan university, and ABI 7500 type PCR analyzer from Thermo Fisher Scientific, USA. According to the operation of the kit specification, the amplification reaction conditions are as follows: 15min at 50 ℃; 15min at 95 ℃; 15s at 94 ℃; 45s at 55 ℃; for a total of 45 cycles, fluorescence signals were collected at 55 ℃.

According to the kit specification, the result judgment criteria are as follows: if the detected sample has no amplification curve in ORF1ab and N gene channel or Ct value is greater than 38, it is judged as SARS-CoV-2 negative; if the Ct value of the detected sample in ORF1ab and N gene channel is less than or equal to 38 and there is obvious amplification curve, it is determined as SARS-CoV-2 positive; and thirdly, if the Ct value of the detected sample in ORF1ab or N gene channel is less than or equal to 38, the other channel has no amplification curve, the retest result is consistent with the original result, and the SARS-CoV-2 is judged to be positive.

5.1.5. Results of viral RNA detection

In Table 3, the maximum dilutions of the culture medium that were positive for RNA detection in 1 hour of culture of 4 groups of stem cells were all 1: 4, and were considered as the detection results of exogenously added viruses. In tables 4-5, after 4 groups of stem cells were cultured for 6 hours, the detection results of only the culture solution of the DNA recombinant stem cell group and intracellular RNA were still 1: 4, while the intracellular RNA content of the ACE2 stem cell group was the highest; in tables 6-8, after 4 groups of stem cells are cultured for 24-72 hours, the RNA detection result of the DNA recombinant stem cell group is the lowest in positive titer (1: 12), and the intracellular RNA detection result of the ACE2 stem cell group is the highest in positive titer (> 1: 8748), which indicates that ACE2 can promote the virus to enter the stem cells and replicate intracellularly, and shRNA can interfere with intracellular virus replication.

TABLE 3 detection results of viral RNA in 1 hour coculture of Stem cells with isolated New coronavirus

TABLE 4 results of viral RNA detection in culture broth from co-culture of stem cells with isolated new coronavirus for 6 hours

TABLE 5 intracellular viral RNA assay results of Stem cells cocultured with isolated New coronavirus for 6 hours

TABLE 6 detection results of viral RNA of culture broth obtained by co-culturing stem cells and isolated new coronavirus for 24 hours

TABLE 7 detection results of viral RNA of culture broth obtained by co-culturing stem cells and isolated new coronavirus for 72 hours

TABLE 8 intracellular viral RNA assay results of Stem cells cocultured with isolated New coronavirus for 72 hours

5.1.6. Co-culture characteristics of recombinant DNA stem cells and viruses

The stem cell group of the recombinant ACE2 becomes round, floats and dies after being cultured for 72 hours, as shown in figure 3, the expression of an ACE2 gene in the cell is favorable for absorbing virus into the cell and propagating in the cell to cause the cell to die quickly, while the stem cell group of the recombinant ACE2 and shRNA still grows adherently after being cultured for 72 hours, as shown in figure 4, the expression of shRNA can interfere the virus to replicate in the cell, so that the stem cell of the recombinant ACE2 and shRNA can absorb the virus into the cell and kill the virus in the cell.

5.2 detection of antiviral function in animals by recombinant DNA Stem cells

Preparation of recombinant DNA Stem cells

Inoculating recombinant DNA stem cells to 10DMEM complete culture solution with% FBS is used for cell culture, and the culture solution is replaced for 1 time every two or three days; about 90% of cells are paved at the bottom of the bottle after about 5 days, 0.25% of pancreatin is digested for 2-3 min, 800r/min, the centrifugal radius is 12cm, the cells are centrifuged for 5min and inoculated to 75cm according to the ratio of 1: 2²In a culture flask, 5% CO at 37 ℃₂And carrying out amplification culture in a constant-temperature incubator for 4-5 d passage 1 time.

5.2.2. Grouping of laboratory animals

SPF-grade female BALB/c mice of about 40 g and 6-8 weeks old are selected and randomly divided into a DNA recombinant stem cell group (used for infecting NC-045512.2 strain and inoculating stem cells carrying ACE2 and shRNA), an ACE2 stem cell group (used for infecting NC-045512.2 strain and inoculating stem cells carrying ACE2), a stem cell group (used for infecting NC-045512.2 strain and inoculating stem cells not carrying ACE2 and shRNA), a positive control group (used for infecting NC-045512.2 strain and inoculating physiological saline) and a negative control group (only inoculating physiological saline).

5.2.3. Infection and inoculation of laboratory animals

The DNA recombinant stem cell group, the ACE2 stem cell group, the stem cell group and the positive control group are inoculated with 40 mul of NC-045512.2 strain virus solution through nasal spray respectively, and the titer is 10⁵/mlTCID₅₀The negative control group was inoculated with 40. mu.l of physiological saline by nasal spray. Then, 5% chloral hydrate solution (0.006mL/g or 0.6mg/g) is injected into the abdominal cavity of each group of mice, and the muscle is fixed on the plate after being relaxed; preparing skin of neck, wiping with iodophor, sterilizing, cutting neck skin to obtain 1cm small opening, separating tissue with forceps, and exposing air tube; will be 1 × 10⁶Injecting stem cells into mouse trachea slowly (injecting physiological saline into negative and positive control group), resetting tissue, and suturing skin; mice were observed daily for clinical symptoms and sacrificed on day 7 post infection for viral detection of lung tissue.

5.2.4. Detection of test results

RT-PCR detection

Taking 200 mul of a mouse lung tissue homogenate sample prepared by DMEM according to a Trizol method, adding 800 mul of Trizol, standing at room temperature for 5min to completely crack protein, adding 200 mul of chloroform, shaking vigorously by hand for 15sec, standing at room temperature for 3min, centrifuging at 4 ℃, 12,000g for 15min, taking the supernatant to a new Eppendorf tube, adding 0.5ml of isopropanol, standing at room temperature for 10min, centrifuging at 4 ℃, 12,000g for 10min, discarding the supernatant, adding 1ml of 75% ethanol, centrifuging at 4 ℃, 7,500g for 5min, discarding the supernatant, rinsing repeatedly for 1 time, and dissolving the precipitate treated by 30 mul of DEPC water. And (3) carrying out primer design, PCR amplification and product electrophoresis according to the kit, in order to compare different virus replication amounts of different experimental groups, simultaneously amplifying a host gene beta-actin as an internal reference, and taking the ratio of the expression level gray value of a target gene and the internal reference gene as the semi-quantitative analysis of each sample virus.

② observation of cytopathic Effect (CPE)

Thawing frozen lung tissue at-70 deg.C, homogenizing with DMEM to 10%, centrifuging at 3,000rpm for 20min, inoculating 100pl of supernatant onto 24-well culture plate with VeroE6 cell monolayer, inoculating 2 wells for each sample, adsorbing at 37 deg.C for 1 hr, sucking out sample solution, washing with PBS (2% double antibody) for 3 times, adding DMEM to 1.5ml, standing at 37 deg.C and 5% CO₂Culturing in an incubator, observing the pH of the culture solution, if the culture solution turns yellow or blue, adjusting the pH or replacing the culture solution in time, observing cytopathic effect (CPE) every day, recording whether the CPE appears, continuously observing for 7 days, and transmitting for 3-4 generations if the CPE does not appear, and observing the result. The inoculated cells generate pathological changes and are characterized in that the cells become round and fused, the light transmittance is weakened, and finally the cells die and fall off.

Indirect immunofluorescence detection

VeroE6 cells exhibiting a pathological Effect (CPE) were trypsinized and washed with PBS at 10. mu.l/well (10. mu.l)⁷And/ml) is dripped on an antigen slide glass, the antigen slide glass is dried and then fixed in cold acetone for 10min, washed by PBS (stored at 20 ℃ below zero after being dried), anti-S protein monoclonal antibody (1: 200, prepared by PBS) is dripped on the prepared antigen slide glass, incubated in a 37 ℃ wet box for 30-40min, after three times of washing by PBS, a FITC-labeled secondary antibody (prepared by 1: 500 and 0.02 percent Evans blue-PBS) is dripped, incubated in a 37 ℃ wet box for 20-30min, washed by PBS for 3 times, sealed by 50 percent glycerol-PBS, and fluorescence is observed under a fluorescence microscope. And (4) judging a result: under the condition that the negative control and the positive control are satisfied, the VeroE6 cells inoculated by the specimen show red fluorescence to judge that the mouse is not infectedInfecting with viruses; the green fluorescence in the cell membrane or cytoplasm of the VeroE6 cells inoculated with the standard sample is judged to be the infection of the mouse with the virus.

Fourthly, half infection quantity (TCID) of cell culture₅₀) Percentage of (2)

Taking 100 mu l of lung tissue homogenate supernatant of each killed mouse (10 mice in each group), diluting the lung tissue homogenate supernatant into different dilutions by a 10-fold progressive dilution method, respectively inoculating a tissue culture monolayer VeroE6 cell 96-well culture plate washed 3 times by Hank's solution, inoculating 30 mu l of cells in each well, inoculating 4 cell wells in each dilution, slightly oscillating to ensure that the homogenate is fully contacted with the cells, adsorbing for 1min at 37 ℃, washing 3 times by Hank's solution, adding cell maintenance solution, culturing in a 37 ℃ CO2 incubator, observing and recording cytopathic conditions under a common inverted microscope, continuously observing for 10-14 days, and respectively calculating the half infection amount (TCID) of VeroE6 cells in each group₅₀) Then comparing the TCIDs of the groups₅₀Percent difference, the greater the percent, the greater the viral content. From the results in tables 9-14, it can be seen that the DNA recombinant stem cell group has a lower VeroE6 cell half infection amount, while the ACE2 stem cell group has a higher VeroE6 cell half infection amount, indicating that ACE2 can absorb viruses into stem cells for replication, but can be interfered and killed by DNA recombinant stem cells with a targeted interference function.

TABLE 9 DNA recombinant Stem cell group 10 mice sacrificed lung homogenates resulting in a percentage of half the infected amount of VeroE6

TABLE 10 ACE2 Stem cell group 10 percentage of half the infected amount of VeroE6 by killing lung homogenate in mice

TABLE 11 Stem cell group 10 mice sacrificed lung homogenates resulting in a percentage of half the infected amount of VeroE6

TABLE 12 Positive control 10 mice sacrificed lung homogenates to give VeroE6 percent of half the infected amount

TABLE 13 negative control group 10 mice sacrificed lung homogenates to give VeroE6 percent of half the infected amount

TABLE 14 comparison of the percentage of VeroE6 infection in half the number of groups due to 10 mice sacrificed lung homogenates

Antiviral effects of ACE2-Ab produced by DNA recombinant Stem cells

5.3.1. detection principle of ACE2-Ab produced by DNA recombinant Stem cells

The human angiotensin converting enzyme 2 antibody (ACE2-Ab) was determined using a double antigen sandwich method. Coating a microporous plate with hACE2, adding ACE2-Ab, adding HRP-labeled hACE2 to form an antigen-antibody-enzyme-labeled antigen complex, washing, developing with a substrate TMB, converting into blue, positively correlating the shade of the color with ACE2-Ab in a sample, measuring absorbance (OD) at 450nm by using an enzyme standard instrument, and calculating the concentration of the ACE2-Ab by using a standard curve.

5.3.2. detection method of ACE2-Ab produced by DNA recombinant Stem cells

Standard substances of 100U/L, 50U/L, 25U/L, 12.5U/L and 6.25U/L are prepared according to the specification. Respectively arranging a blank hole, a standard hole, a sample hole to be detected (provided with 3 more holes) and a control hole (provided with 3 more holes), accurately adding 50 mu l of each standard sample into the standard hole, adding 40 mu l of sample diluent into the sample hole to be detected, adding 10 mu l of sample to be detected (lung tissue homogenate supernatant of a mouse inoculated with recombinant stem cells), adding the control sample (lung tissue homogenate supernatant of the mouse inoculated with the stem cells) into the control hole, gently shaking and uniformly mixing. The plates were sealed with a sealing plate and incubated at 37 ℃ for 30 minutes. Carefully uncovering the sealing plate film, discarding liquid, spin-drying, filling washing liquid into each hole, standing for 30 seconds, then discarding, repeating the steps for 5 times, and patting dry. 50 μ l of enzyme-labeled reagent was added to each well, except for blank wells. And repeating the operation after the plate is sealed by a sealing plate film, adding 50 mu l of the color developing agent A into each hole, adding 50 mu l of the color developing agent B into each hole, slightly mixing the mixture, and developing the mixture at 37 ℃ in a dark place for 15 minutes. The reaction was stopped and the OD of each well was measured at a wavelength of 450nm with blank zeroing. And drawing a standard curve by taking the concentration of the standard substance as an abscissa and the OD value as an ordinate, and finding out the corresponding concentration from the standard curve according to the OD value of the sample.

5.3.3. detection results of ACE2-Ab produced by DNA recombinant Stem cells

As can be seen from Table 15, the lung homogenate ACE2-Ab of mice in the group inoculated with DNA recombinant stem cells (carrying ACE2 gene) was significantly higher than that of mice in the group inoculated with stem cells (not carrying ACE2 gene). The ACE2 gene can express protein after inoculating DNA recombinant stem cells, and then mice are stimulated to produce ACE 2-Ab.

TABLE 15 comparison of ACE2-Ab assay results in mice vaccinated with DNA recombinant stem cells and mice vaccinated with stem cells

Antiviral detection of ACE2-Ab

Firstly, ACE2-Ab (rabbit anti-ACE 2 antibody) and ACE1-Ab (rabbit anti-ACE 1 antibody) are respectively prepared into 0.05, 0.5, 5, 50 and 100ug/ml, and then are respectively mixed with 1 × 10⁴The Vero E6 cells were mixed and washed 3 times in a 37 ℃ water bath for 1 h.

2 minuteThe cells were suspended in 2mL DMEM (10% FBS) medium and transferred to 12-well plates, and 20uL 10 was added to each well³/mLTCID₅₀Virus liquid, put at 37 ℃ and 5% CO₂The incubator is used for 3-5 days, and cytopathic effect (CPE) is observed every day.

(iii) count the number of live cells and dead cells in 1000 cells by trypan blue staining method, and calculate the cell survival rate (survival rate ═ number of unstained cells/total number of cells observed, and viral RNA content of culture solution or cells can also be detected by RT-PCR).

The results show that when the concentrations of ACE2-Ab of the test groups are 0.05, 0.5, 5, 50 and 100ug/ml, the corresponding cell survival rates are 55%, 60%, 75%, 85% and 85% respectively; when the concentrations of ACE1-Ab in the control group are 0.05, 0.5, 5, 50 and 100ug/ml, the corresponding cell survival rates are 10-15%.

The result shows that the ACE2 carried by the DNA recombinant stem cell can express ACE2 protein, so that an organism is stimulated to produce ACE2-Ab, and the ACE2-Ab has an antiviral effect.

Anti-inflammatory action of cytokines produced by recombinant stem cells of DNA

When an organism is infected with a virus or a bacterium, various cytokines are produced, some have an anti-inflammatory effect, and some have an inflammatory effect. In the experiment, bacterial endotoxin (LPS) is used for respectively treating cells of each test group for 8 hours (table 16), and then the human interleukin in the supernatant of the cultured cells is measured by adopting a double-antibody sandwich method according to the instruction of an enzyme-linked immunosorbent assay (ELISA) kit, and the result shows that IL-1 beta and IL-8 of the immortalized stem cell group are obviously increased after the LPS treatment, but IL-10 is not obviously increased; after the recombinant ACE2 stem cell group is treated by LPS, IL-1 beta and IL-8 of the recombinant ACE2 stem cell group are not obviously increased or decreased, and IL-10 is obviously increased.

Both IL-1. beta. and IL-8 are inflammatory cytokines reported in the literature. Wherein IL-1 beta is widely involved in pathological injury processes such as human tissue destruction, edema formation and the like, and although the generation of beta defensin-4 can be promoted, the destruction is larger than the defense in general. IL-8 achieves the purposes of killing bacteria and damaging cells by chemotaxis of neutrophil and activation of the activity and phagocytosis of neutrophil lysosome enzyme, and IL-8 mainly promotes cytotoxicity, local inflammation and tumor cell proliferation.

IL-10 has a different effect than IL-1. beta. and IL-8. IL-10 is an important anti-inflammatory factor, and exerts an anti-inflammatory action mainly by inhibiting the production of inflammatory factors and chemokines by monocytes, macrophages, and the like. The results in Table 16 show that the recombinant DNA stem cells (carrying ACE2) can suppress the inflammatory response by increasing IL-10 secretion under the action of LPS.

TABLE 16 anti-inflammatory cytokine assay results for recombinant DNA stem cells

Example two, application of DNA recombinant stem cell in preparation of novel corona vaccine

RBD Gene Assembly of DNA recombinant Stem cells

Synthesis of RBD Gene

The amino acid sequence of the S protein of SARS-CoV-2 is analyzed by referring to GenBank accession number (MN908947.3), the RBD amino acid is Gly 319-Asn 541, and the nucleic acid corresponding to the RBD peptide segment is subjected to whole gene combination by adopting synonymous substitution of amino acid codon. Before synthesis, codon optimization is carried out, so that the content of G + C% in a genome is improved, the stability of mRNA in a mammalian cell or the rate of inputting the mRNA into cytoplasm is increased, the loss of rare tRNAs is avoided, the protein expression is enhanced, and the immunogenicity is improved. The specific method comprises the following steps: statistical analysis of the frequency of use of NC _045512.2 strain virus codons and human codons (http:www.kazusa.or.jp/codon)the codon optimization of the S1-RBD gene of the NC045512.2 strain virus is carried out by using human preferred codons, so that the codon usage frequency is consistent with that of a human, meanwhile, the enzyme digestion recognition sequence GAATTC of EcoR I is added at the 5 'end of the gene, and the XhoI enzyme digestion recognition sequence CTCGAG is added at the 3' end. The G + C% of the optimized gene sequence is improved to 70% from 48%, and the G + C% of the third position of the codon is improved to 100% from 39%. The optimized RBD gene sequence is 765 bp: ATGAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCT CTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGAT TATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATT ACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAA TGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTA GTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCA ACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACAC TACTGATGCTGTCCGTGATCCACAGACACTTGAGTAA。

1.2. Construction of lentivirus expression vector carrying RBD gene

The synthesized S1-RBD gene was ligated with the linearized lentiviral expression vector using T4 ligase to construct a lentiviral expression vector (pGC-FU-RBD or pHBLV-RBD), and then competent E.coli DH 5. alpha. was transformed and spread in a medium containing 50. mu.g.mL^-1And (3) performing resistance culture on an LB (Luria Bertani) plate of ampicillin, screening out positive clones, extracting plasmids, performing PCR (polymerase chain reaction), enzyme digestion or sequencing identification, performing amplification culture on the positive clones with correct sequencing, and extracting recombinant plasmids according to a plasmid extraction kit. In the same way, other nucleic acid sequences capable of stimulating the host to generate the antibody are used for constructing a lentivirus expression vector, and the corresponding DNA recombinant stem cell vector new corona vaccine is prepared.

1.3. Lentiviral package carrying RBD gene

293FT cells in logarithmic growth phase were taken at 5X 10⁶cell·mL^-1The density of (2) is inoculated in a culture flask. The lentivirus expression vector (pGC-FU-RBD) and the packaging plasmids (pHelper1.0 and pHelper2.0) were subjected to high-purity endotoxin-free extraction, and 293FT cells were co-transfected according to the instructions of UpOFECTamine 2000, Invitmgen. At the same time, DGC-FU (containing GFP gene), packaging plasmids (pHelper1.0 and pHelper2.0) were co-transfected into another group of 293FT cells, and the obtained empty vector (Kntiviml. about. GFP) carrying only GFP gene was used as a control. After 8h of transfection, the medium was replaced with complete medium, culture was continued for 48h, and the lentivirus-rich supernatant was collectedCentrifuging the clear solution at 4 deg.C and 4000g for 10min, filtering with 0.45 μm filter to obtain high titer lentivirus, packaging, and storing at-80 deg.C.

1.4. Lentivirus titer detection with RBD gene

Wells dilution method for counting fluorescent cells: taking 10 μ L of lentivirus stock solution, diluting with 10 times of 10% FBS DMEM culture solution to obtain 3-5 gradients, and adding 293FT cells at a rate of 3 × 10 per well⁴The density of each cell was seeded in 96-well plates at 37 ℃ with 5% CO₂After 24 hours of incubation, 150. mu.L of DMEM medium was replaced with 10% FBS per well and incubation was continued for 48 hours, and the virus titer was calculated by counting the fluorescent cells using a fluorescence microscope. As a result, after 293FT cells are transfected by the recombinant plasmid pGC-FU-RBD, the recombinant plasmid is packaged into lentivirus particles, and green fluorescence is presented in the 293FT cells under a fluorescence microscope. Second, Real time quantitative PCR method determination: 293FT cells were cultured in 10% FBS DMEM, infected with lentivirus stock to be assayed, and then RNA was extracted according to the TRIZOL protocol of Invitrogen to determine the concentration of the extracted RNA by RT-qPCR.

1.5. Lentivirus transfection RNA interference stem cell carrying RBD gene

At a rate of 1X 10 per hole⁶The RNA interference stem cells with good growth state are inoculated in a 6-well plate at each cell density, when the cells are fused to 30%, the cells of the test group are respectively added with 5-fold diluted lentivirus stock solution, and a negative control group (only transfected with lentivirus vectors) and a blank control group (untransfected with lentivirus vectors) are simultaneously established. After 24 hours of culture, the cells were replaced with 10% FBS DMEM solution, and ampicillin (2.50. mu.g.mL) was added at the optimum selection concentration^-1) Maintaining ampicillin concentration (ampicillin screening pGC-FU-RBD, puromycin screening pHBLV-RBD), and changing liquid every other day until blank control group cells completely die. The non-killed cells are RNA interference stem cells which are transfected by the recombinant lentivirus and have integrated new coronavirus S1-RBD on DNA, namely the RNA interference stem cell vector vaccine.

RBD gene detection of DNA recombinant stem cell vector neocorona vaccine

RT-PCR detection of mRNA transcription of RBD genes

Weighing DNAStem cells in groups of 1X 10⁶And (3) inoculating the cells in a 6-well plate at a density, culturing for 4 days, and detecting the transcription level of the RBD gene in the DNA recombinant stem cells by using RT-PCR. The primer sequence of RT-PCR amplification RBD is as follows: upstream of RBD: 5'-GATTACTCATTCATTCGATATTAC-3', respectively; downstream: 5'-ATATGCAACAGATGATCGGAAC-3', respectively; beta-actin upstream: 5'-TGGACTTCGAGCAAGAGATGG-3', respectively; downstream: 5'-ATCTCCTTCTGCATCCTGTCG-3' are provided. RT-PCR detected high level transcription of RBD gene, compared with control group, showed 1 band of 409bp transcribed by RBD.

Western-Blot detection of protein expression of RBD genes

Extracting the protein of the DNA recombinant stem cell lysate, quantifying the protein by a BAC method, and arranging 3 random multiple holes in each group. The sample proteins were separated by 10% SDS-PAGE, electroblotted onto nitrocellulose membranes, primary antibody was anti-VDR diluted 1: 400, visualized using ECL chemiluminescence kit, and the relative gray values of the protein bands determined using a gel image analysis system. And Western-Blot detects that the protein expression of the RBD gene of the DNA recombinant stem cell group is obviously increased.

2.3. Immunofluorescence detection of protein expression of RBD gene

Preparing a DNA recombinant stem cell antigen tablet, taking a rabbit anti-SARS-COV-2 polyclonal specific antibody as a first antibody, taking FITC marked goat anti-rabbit IgG as a second antibody to carry out indirect Immunofluorescence (IFA) detection, and observing SARS-COV-2 specific fluorescent particles in the DNA recombinant stem cell, which indicates that the RBD gene is expressed in cells.

Immune function detection of DNA recombinant stem cell vector neocorona vaccine

Preparation of DNA recombinant Stem cell vector New crown vaccine

Inoculating the DNA recombinant stem cell vector neocorona vaccine carrying RBD into DMEM complete culture solution containing 10% FBS for cell culture, digesting with 0.25% pancreatin when the bottom of the bottle is about 90% full of cells, and performing passage and amplification culture.

3.2. Preparation of laboratory animals

SPF-grade female BALB/c mice of 6-8 weeks old and about 40 g are selected and randomly divided into a recombinant stem cell vaccine group (stem cells carrying ACE2, shRNA and RBD genes) and a recombinant stem cell control group (stem cells carrying ACE2 and shRNA genes), wherein each group comprises 10 mice.

3.3. Animal inoculation and specimen collection

5% chloral hydrate solution (0.006mL/g or 0.6mg/g) is injected into the abdominal cavity of each group of mice, and the muscle is fixed on the plate after relaxation; preparing skin of neck, wiping with iodophor, sterilizing, cutting neck skin to obtain 1cm small opening, separating muscle and connective tissue with tissue forceps, and exposing trachea; slowly injecting stem cells into mouse trachea, resetting tissue, and suturing skin; the clinical symptoms of the mice were observed daily, venous blood was collected at 1, 2, 4, 6 weeks after inoculation, centrifuged at 3,000 g for 10min, and the separated serum was stored at-20 ℃ for determination of SARS-CoV-2 specific antibodies IgG and IgM.

3.4. Detection method

(ii) ELISA for IgG detection

According to the kit operation: adding 100 μ l diluted 1: 10 into each well, incubating in 37 deg.C incubator for 30min, and washing with washing solution; adding 100 μ l HRP-labeled goat anti-mouse IgG (1: 500), incubating at 37 deg.C for 30min, and washing with washing solution; adding substrate solution, incubating at 37 deg.C for 10min, adding stop solution 50 μ l, and measuring OD value at 450nm wavelength.

② ELISA detection of IgM

According to the kit operation: adding 100 μ l diluted 1: 10 into each well, incubating in 37 deg.C incubator for 30min, and washing with washing solution; add 100. mu.l of HRP-labeled goat anti-mouse IgM (1: 500), incubate at 37 ℃ for 30min, wash thoroughly with wash: adding substrate solution, incubating at 37 deg.C for 10min, adding stop solution 50 μ l, and measuring OD value at 450nm wavelength.

Measurement of neutralizing antibody

Taking 100 mu l of antibody positive serum sample, and inactivating the antibody positive serum sample in water bath at 56 ℃ for 30min to eliminate non-specific reaction factors. The test serum was filtered through a 0.22 μm filter and diluted in multiple ratios to 1: 2, 1: 4, 1: 8 … …. The virus was then diluted to an inoculum of 100TCID per well 1/2₅₀(the formula for calculating the viral dilution factor is: TCID50/0.2ml of the PairThe log-minus neutralization test requires the log of the fold between the amount of cell inoculated per well at the time of virus drop and the amount of virus inoculated per well at the time of neutralization test, and the antilog of the obtained log is the fold by which the virus should be diluted). Adding equivalent diluted serum into the diluted virus according to 200 μ l per tube, mixing well, and performing water bath at 37 deg.C for 120 min. Duplicate wells of each sample were inoculated with VeroE6 cells, 100. mu.l of virus-serum mixture per well, except for negative cell control wells. Positive cell control: 50 μ l virus dilution +50 μ l virus +100 μ l cells. Negative cell control: add 100. mu.l of virus dilution. Cytopathic effect (CPE) was observed day by day at 37 ℃ in a 5% CO2 incubator.

3.5. The result of the detection

Specific antibody detection results: the results of IgG and IgM detection of the DNA recombinant stem cell vector neocorona vaccine at 1, 2, 4, and 6 weeks after vaccination are shown in Table 17. The detection results show that the positive cases of IgG and IgM in the peripheral blood of the mice inoculated with the DNA recombinant stem cell vaccine and the positive cases of the IgG and IgM are respectively 17, 19 and 9, and the positive cases of the control group are respectively 3, 4 and 1, which shows that the DNA recombinant stem cell vector new crown vaccine generates specific antibodies for more cases after inoculation compared with the control group.

TABLE 17 detection results of specific antibodies of recombinant DNA stem cell vector neocorona vaccine after mouse inoculation

Detection result of neutralizing antibody: 7 mouse sera which are IgG positive in sera at 4 weeks after inoculation are operated according to the detection method of the neutralizing antibody, and VeroE6 cells which are positive in result (a control group) are all subjected to Cell Pathogenic Effects (CPE) within 3 to 5 days of culture; while negative (control) cells grew adherent (+), and no CPE occurred; the serum of 7 cases of mice can still inhibit the attack of virus on VeroE6 cells after being diluted by 1: 16-128 times, but cannot inhibit the attack of virus on cells with the increase of the dilution times, so that the VeroE6 cells can generate CPE. The IgG in 7 mouse serum samples has the effect of neutralizing viruses, so that the DNA recombinant stem cell vector new corona vaccine can stimulate the mice to generate neutralizing antibodies, and the titer of the neutralizing antibodies is 1: 16-128.

TABLE 18 test results of VeroE6 cell infection in half number by neutralizing antibody of DNA recombinant stem cell vector neo-corona vaccine

Application of DNA recombinant stem cell vector neocorona vaccine

The DNA recombinant lung stem cell carrier new corona vaccine prepared by the remained amniotic fluid cells, newborn umbilical cord blood cells, umbilical cord tissues or placenta tissue cells after prenatal diagnosis can be frozen in a stem cell bank at the temperature of-196 ℃ for later use according to names, ABO blood types or HLA types. When new coronavirus is epidemic, various types of DNA recombinant lung stem cell vector vaccines can be taken for culture and amplification, then the DNA recombinant lung stem cell vector vaccines are selected according to the self or homotypic use principle for individual treatment, so that the effect of stem cell treatment or vaccination is improved, toxic and side effects such as immune rejection are reduced and eliminated, and the problem of lack of specific drugs of COVID-19 is solved.

Claims

1. A DNA recombination stem cell vector new corona vaccine is characterized in that mesenchymal stem cells are transformed into a DNA recombination stem cell vector vaccine which can compete with host cells to suck new corona viruses into the stem cells for RNA interference of the new corona viruses, can generate antibodies against the new corona viruses and can be infinitely cultured and amplified in vitro, and the DNA recombination stem cell vector vaccine comprises a susceptible gene ACE2 of the new corona viruses is inserted into stem cell DNA which is transfected by an immortalized gene SV40LT and/or hTERT to prepare the susceptible stem cells which are easily infected by the new corona viruses; inserting RNA interference sequence shRNA of the new coronavirus M, N, E and/or S gene into the susceptible stem cell DNA to construct a DNA recombinant stem cell which can absorb the new coronavirus into the stem cell through ACE2 and can target and interfere the replication of the new coronavirus in the stem cell through shRNA; inserting a new coronavirus antibody production gene S1-RBD into the recombinant stem cell DNA to prepare the vector vaccine.

2. The DNA recombinant stem cell vector neocorona vaccine as claimed in claim 1, wherein the stem cell includes embryonic stem cell, adult stem cell, mesenchymal stem cell, lung stem cell or induced lung stem cell.

3. The DNA recombinant stem cell vector neocorona vaccine as claimed in claim 1 or 2, wherein the mesenchymal stem cell includes amniotic fluid mesenchymal stem cell, immortalized amniotic fluid mesenchymal stem cell or lung stem cell left after experiment.

4. The DNA recombinant stem cell vector neocorona vaccine as claimed in claim 1, wherein the inserted gene includes recombinant lentivirus vector construction, co-transfection of 293FT cells with recombinant lentivirus vector and packaging plasmid for lentivirus packaging, lentivirus transfection of stem cells, and screening and identification of DNA recombinant stem cells.

5. The DNA recombinant stem cell vector neo-corona vaccine as claimed in claim 1 and 3, wherein the construction of the recombinant lentivirus vector comprises cloning of targeting interference sequence shRNA of neo-corona virus M, N, E and/or S gene and/or cloning of neo-corona virus susceptibility gene ACE2 into the polyclonal site of the lentivirus vector.

6. The DNA recombinant stem cell vector new corona vaccine as claimed in claim 1, wherein the siRNA sequence of the new corona virus M, N, E and/or S gene is shown in "candidate siRNA sequence of new corona virus S, E, M, N gene of NC _045512.2 strain".

7. The DNA recombinant stem cell vector neo-corona vaccine as claimed in claim 1, wherein the upstream primer for amplifying the hACE2 gene is: CMV-F: 5' -CGCAAATGGGCGGTAGGCGTG-3; the downstream primer is: EF 1-Rn: 5'-GCCAGTACACGACATCACTT-3', respectively; the upstream primer and the downstream primer of the beta-actin are respectively as follows: 5'-TGGACTTCGAGCAAGAGATGG-3', 5'-ATCTCCTTCTGCATCCTGTCG-3'.

8. The DNA recombinant stem cell vector neocorona vaccine as claimed in claim 1, which is prepared through the following steps:

(1) obtaining mesenchymal stem cells: and (3) separating and inducing amniotic fluid fibroblasts, mesenchymal stem cells or lung stem cells from a stem cell sample bank, remaining amniotic fluid cells after prenatal diagnosis, newborn umbilical cord blood cells, umbilical cord tissues or placenta tissue cells.

(2) Stem cells were assembled with immortalizing genes: constructing a recombinant vector carrying the hTERT and/or SV40LT, transfecting stem cells, integrating the hTERT and/or SV40LT into stem cell DNA, and preparing immortalized stem cells or lung stem cells capable of being infinitely passaged.

(3) Assembling stem cells with a new coronavirus susceptibility gene: angiotensin converting enzyme II gene is connected with lentivirus expression vector pHBLV-CMV-ACE2-EF1-ZsGreen-T2A-puro or pGC-FU, recombinant plasmid pHBLV-OE-ACE2 or pGC-FU-ACE2 is respectively constructed, recombinant plasmid pHBLV-OE-ACE2 and packaging plasmid (psPAX2 and pMD2G) or recombinant plasmid pGC-FU-ACE2 and packaging plasmid (pHelper1.0 and pHelper2.0) are respectively co-transfected into 293FT cells, recombinant lentivirus OE-ACE2 or FU-ACE2 carrying ACE2 is packaged, and the recombinant lentivirus is transfected into stem cells, so that the ACE2 gene is integrated into the DNA of the stem cells.

(4) Assembling stem cells with a novel coronavirus RNA interference gene: preferably, the targeting interference sequence siRNA of the new coronavirus (nCoV), synthesizing shRNA template, connecting to a lentiviral vector pHBLV or LV3, constructing a recombinant plasmid pHBLV-nCoV-N-shRNA or LV3-nCoV-N-shRNA, co-transfecting the recombinant plasmid pHBLV-nCoV-N-shRNA and a packaging plasmid (pHBLV, psPAX2 vector and pMD2G vector) or the recombinant plasmid LV3-nCoV-N-shRNA and a packaging plasmid (pLV/helper-SL3, pLV/helper-SL4 and pLV/helper-SL5) into 293FT cells, packaging the slow virus carrying the shRNA, transfecting the slow virus into stem cells, integrating shRNA gene into stem cell DNA, and enabling the stem cells to obtain new functions of interfering nCoV replication in cells.

(5) The DNA recombinant stem cell which is artificially assembled with the immortalized gene, the new coronavirus susceptibility gene and the RNA interference gene and has the inherent treatment function, the artificial immortalization function, the new coronavirus RNA interference function and the susceptibility characteristic of the stem cell is prepared.

(6) Preparing vaccine by replacing adenovirus vector of the prior art with DNA recombinant stem cell: analyzing an S protein amino acid sequence (RBD amino acid is Gly319 to Asn541) of SARS-CoV-2 according to GenBank, adopting synonymous replacement of amino acid codons to synthesize a whole gene of nucleic acid corresponding to the RBD peptide segment, respectively inserting enzyme cutting sites of EcoR and IXhoI at two ends of the RBD gene, constructing a recombinant plasmid pHBLV-RBD by the synthesized RBD gene, or respectively inserting enzyme cutting sites of HindIII and XhoI at two ends of the RBD gene, constructing a recombinant plasmid pGC-FU-RBD by the synthesized RBD gene, respectively packaging lentiviruses carrying the RBD, transfecting the lentiviruses into DNA recombinant stem cells, integrating the RBD gene onto the DNA of the stem cells, and obtaining the DNA recombinant stem cell vector vaccine capable of stimulating a host to generate corresponding antibodies by expressing the RBD protein.