CN112593015A

CN112593015A - Primer composition, sequencing kit and detection method

Info

Publication number: CN112593015A
Application number: CN202110024096.5A
Authority: CN
Inventors: 张樱; 何昆仑; 吴婷婷; 潘世让; 张思文; 韩悦; 王洋; 梁羽; 汪德鹏
Original assignee: Grandomics Biosciences Co ltd; First Medical Center of PLA General Hospital
Current assignee: Grandomics Biosciences Co ltd; First Medical Center of PLA General Hospital
Priority date: 2021-01-08
Filing date: 2021-01-08
Publication date: 2021-04-02
Anticipated expiration: 2041-01-08
Also published as: CN112593015B

Abstract

The scheme discloses a primer composition, which comprises one or more groups of primer compositions in the primer compositions shown as A), B) and C): A) a first set of primer compositions comprising a plurality of primer pairs for detecting a viral pathogen causing respiratory tract infections; B) a second set of primer compositions comprising a plurality of primer pairs for detecting a bacterial pathogen causing a respiratory tract infection; C) a 16S primer pair for simultaneous detection of a pathogen causing a respiratory infection with the first set of primer compositions and/or the second set of primer compositions. The kit is based on a third-generation high-throughput sequencing technology, can detect more than 30 respiratory pathogens, can simplify the screening process of respiratory infection pathogens, and improves the rapid and accurate judgment of the pathogens.

Description

Primer composition, sequencing kit and detection method

Technical Field

The invention relates to the technical field of biological detection, and particularly relates to a primer composition, a sequencing kit and a detection method.

Background

Respiratory tract infection is a common infectious disease in clinic, and especially in infants, the elderly and immunodeficiency patients, serious symptoms and even death often occur. Common respiratory infection pathogens include microorganisms such as viruses, bacteria, mycoplasma, chlamydia, and the like. These microorganisms can be parasitic on animals, plants and human bodies in nature, and pose a threat to human health. The viral pathogens mainly comprise influenza A virus, influenza B virus, parainfluenza virus, respiratory syncytial virus, rhinovirus, metapneumovirus, adenovirus and the like. Bacterial pathogens include Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, and the like. Most respiratory tract infections have similar clinical symptoms, pathogens are difficult to judge quickly and accurately through the clinical symptoms, and the quick and accurate identification of the pathogens of the respiratory tract infections has important significance for targeted medication. The traditional respiratory tract pathogen detection technology mainly comprises detection technical means such as bacteria and virus culture, antigen-antibody reaction, immunofluorescence, common PCR and the like, and the technologies have certain defects: the culture period of the bacteria is long, the requirement is high, and the requirement of short-time rapid detection cannot be met; the antigen-antibody reaction sensitivity and specificity are low, and false positive is easy to appear; the common gel electrophoresis has low sensitivity, sometimes has fuzzy bands, is not accurate enough in judgment, and is very easy to cause misdiagnosis.

Disclosure of Invention

One objective of the present disclosure is to provide a primer composition, which can detect more than 30 respiratory pathogens based on a third-generation high-throughput sequencing technology, simplify the screening process of respiratory pathogens, and improve the rapid and accurate determination of the pathogens.

Another object of this embodiment is to provide a sequencing kit comprising the above primer composition.

A third object of the present solution is to provide a method for detecting pathogens causing respiratory tract infections.

In order to achieve the purpose, the scheme is as follows:

a primer composition comprising one or more primer compositions of the primer compositions set forth in A), B) and C):

A) a first set of primer compositions comprising a plurality of primer pairs for detecting a viral pathogen causing respiratory tract infections;

B) a second set of primer compositions comprising a plurality of primer pairs for detecting a bacterial pathogen causing a respiratory tract infection;

C) a 16S primer pair for simultaneous detection of pathogens causing respiratory tract infections with the first set of primer compositions and/or the second set of primer compositions;

wherein the first group of primer compositions comprises one or more pairs of 18 pairs of primers, and the 18 pairs of primers respectively have upstream primer sequences shown as SEQ ID NO.1 to SEQ ID NO.18 and downstream primer sequences shown as SEQ ID NO.19 to SEQ ID NO. 36;

the second group of primer compositions comprises one or more pairs of 14 pairs of primers, wherein the 14 pairs of primers respectively have an upstream primer sequence shown as SEQ ID NO.37 to SEQ ID NO.50 and a downstream primer sequence shown as SEQ ID NO.51 to SEQ ID NO. 64;

the 16S primer pair comprises an upstream primer sequence shown as SEQ ID NO.65 and a downstream primer sequence shown as SEQ ID NO. 66.

Preferably, the first set of primer compositions in the composition have the same amount of each primer.

Preferably, the amount of each primer in the second set of primer compositions in the composition is the same.

Preferably, when the composition comprises 16S primer pairs and the first set of primer compositions and/or the second set of primer compositions, the content of all primer pairs in the primer compositions is the same.

In a second aspect, the present protocol provides a sequencing kit comprising a primer composition as described in any one of the above.

In a third aspect, the present invention provides a method of detecting a pathogen causing a respiratory infection, the method comprising:

inactivating the collected sample, and extracting pathogen DNA/RNA;

performing fragment amplification using one or more primer compositions comprising the primer compositions shown in A), B) and C) to form PCR reaction products;

sequencing the PCR reaction product;

Preferably, when the primer composition is used for fragment amplification reaction, the content of the 16S primer pair in the primer composition is the same as the content of each primer pair in the first set of primer composition and/or the content of each primer pair in the second set of primer composition.

Preferably, the method further comprises: when the pathogen genetic material is RNA, reverse transcription reaction is performed on the extracted RNA of the pathogen to obtain cDNA.

Preferably, based on the sequencing results, a pathogen is considered positive if the proportion of a pathogen sequence is greater than or equal to a first threshold and the coverage at 50 x depth is greater than or equal to a second threshold;

if the proportion of a certain pathogen sequence is more than or equal to a third threshold value and the coverage at 50 multiplied by depth is more than or equal to a fourth threshold value, the pathogen is considered to be suspected to be positive;

the remainder considered negative for the pathogen;

wherein the pathogen sequence ratio is the ratio of the total sequences of the pathogen to the total sequences of the sample; the coverage of the pathogen at 50 x depth was taken from the coverage of the subtype with the highest sequence proportion; the coverage is the sequencing coverage area ratio within the amplification area of the primer pair.

The scheme has the following beneficial effects:

by using the primer composition provided by the scheme, more than 30 respiratory pathogens can be detected simultaneously based on a third-generation high-throughput sequencing technology, a kit containing the primer composition provided by the scheme can be used as a sequencing-assisted diagnosis kit, the screening process of respiratory infection pathogens can be simplified by using the kit, and the rapid and accurate diagnosis capability of the clinic on respiratory infection is improved. The scheme actually detects more than 30 pathogens through the specific primers designed for the pathogens. Part of pathogens can be sub-typed according to the sequencing sequence.

Drawings

In order to illustrate the implementation of the solution more clearly, the drawings that are needed in the description of the embodiments will be briefly described below, it being obvious that the drawings in the following description are only some embodiments of the solution, and that other drawings may be derived from these drawings by a person skilled in the art without inventive effort.

FIG. 1 is an electrophoretogram of effect example 1;

FIG. 2 is an electrophoretogram of effect example 2;

FIG. 3 is an electrophoretogram of effect example 3;

FIG. 4 is a diagram showing an alignment of the sequenced sequences in effect example 4;

FIG. 5 is an electrophoretogram of comparative example 1;

FIG. 6 is an electrophoretogram of comparative example 2;

FIG. 7 is a sequencing result analysis of comparative example 3.

Detailed Description

Embodiments of the present solution will be described in further detail below with reference to the accompanying drawings. It is clear that the described embodiments are only a part of the embodiments of the present solution, and not an exhaustive list of all embodiments. It should be noted that, in the present embodiment, features of the embodiment and the embodiment may be combined with each other without conflict.

The terms "first," "second," and the like in the description and in the claims, and in the drawings described above, if any, are used for distinguishing between similar elements and not necessarily for describing a particular sequential or chronological order. It will be appreciated that the data so used may be interchanged under appropriate circumstances such that the embodiments described herein may be practiced otherwise than as specifically illustrated or described herein. Furthermore, the terms "comprises," "comprising," and "having," and any variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, system, article, or apparatus that comprises a list of steps or elements is not necessarily limited to those steps or elements expressly listed, but may include other steps or elements not expressly listed or inherent to such process, method, article, or apparatus.

The sequencing technology is used for searching pathogens causing respiratory tract infection, the basis is to enrich specific fragments reaching the sequencing starting amount, PCR amplification is the most extensive enrichment means, and whether the sequencing result is accurate and reliable depends on primers used in the PCR amplification. Therefore, the scheme carries out primer design according to the following primer design principle: in order to accurately identify and amplify microorganisms of the same genus/species, it is necessary to ensure that primers are designed to have genus/species consistency and genus/species specificity. The interior of the genus/species has high coverage, and most of the interior of the target genus/species can be effectively amplified; at the same time, efficient amplification in other genera/species is avoided. For species where it is desired to distinguish between different subtypes, it is desirable to deliberately select the portion of the conserved regions between subtypes that differ in sequence. For example, the distinction between influenza a and human rhinovirus is at the intergeneric level, between influenza a and b at the interspecific level, and between influenza a H1N1 and H3N2 at the subtype level.

16S rRNA is a subunit of ribosomal RNA, and 16S rDNA is a gene encoding the subunit. Bacterial rRNA (ribosomal RNA) was classified into 3 types by sedimentation coefficient, 5S, 16S and 23S rRNA, respectively. 16S rDNA is a DNA sequence encoding the small subunit rRNA of the ribosome of prokaryotes (16S rRNA), is about 1540bp in length, and is present in all bacterial chromosomal genomes. The 16S rDNA molecule sequence contains 9 variable and 10 constant regions, the conserved sequence region reflects the relativity between biological species, and the high variant sequence region can represent the difference between species, so that it is used as the basis for bacterial classification.

The detection of 16S allows for the assisted identification of bacterial pathogens detected among 30 respiratory pathogens. In addition, in extreme cases, a pathogen is mutated in the designed primer region, so that the pathogen cannot be detected well, and can still be detected through 16S detection. In addition, the 16S region is very conserved in the genus and cannot further distinguish pathogen subtypes, and the invention can effectively realize the fine subtype identification of the pathogen by combining with the pathogen specific primer. In addition, 16S can provide a basis for detecting non-detection pathogens, and the detection result of 16S can be used as an effective information prompt for pathogens not contained in more than 30 respiratory pathogens, and can be further confirmed by other means, so that missed detection of other potential pathogens is effectively avoided.

In the sequencing means, the second-generation sequencing is limited by the short read length technology, and the complete 16S rDNA sequence can be obtained only by splicing according to the overlapping relation between sequencing sequences, so that a constant region with high conservation cannot be really reduced. The third generation sequencing takes long read length as a remarkable characteristic, one read length can cover complete 16S rDNA, a subsequent splicing process is not needed, and real sequence information can be obtained.

At this stage, in the direction of pathogen identification, 16S rDNA detection preferentially samples pathological site samples, such as alveolar lavage samples directly from patients with pulmonary infections. The reason for this is that if the sample composition is complex, many kinds of bacteria contained in the sample will be detected, and when the pathogen content in the sample is low, the detection may not be possible due to the limited sequencing depth, and even if the detection is possible, a large amount of bioinformatics analysis is required to obtain the individual possible pathogens contained therein. Especially, the organs of the human body communicating with the outside are contacted with air and food, and the types of microorganisms are complicated.

How to mutually match the detection of 16S with the detection of a primer pool formed by a plurality of primers so as to accurately detect the primer without missing detection. The present application provides a beneficial solution to this problem. In the scheme, when each pair of primers is designed, secondary structures such as primer dimers and palindromic sequences are considered, and the evasive design can be carried out by utilizing known primer design software. In addition, tens of pairs of primer pairs designed by the method are mixed to form a primer pool, the subsequent PCR amplification is performed by using the primer pool, and the condition that more primer dimers or other uncertain factors influencing the amplification effect exist in an amplification product due to the fact that the primers of different primer pairs in the primer pool are inevitably influenced and interfered with each other is considered, and the condition cannot be avoided even if the primer design is performed by using known primer design software. For the possible situations, the scheme provides a plurality of pairs of high-quality primers, and the primers are designed on the premise that the basic principle of primer design is followed, the mutual interference is avoided when a plurality of primers are used simultaneously, the pathogen can be effectively detected, and the efficient amplification can be realized; the scheme also provides effective dosage selection of each primer.

The scheme designs a first group of primer composition consisting of 18 pairs of primers with an upstream primer sequence shown as SEQ ID NO.1 to SEQ ID NO.18 and a downstream primer sequence shown as SEQ ID NO.19 to SEQ ID NO. 36; a second group of primer compositions consisting of 14 pairs of primers having upstream primer sequences shown as SEQ ID NO.37 to SEQ ID NO.50 and downstream primer sequences shown as SEQ ID NO.51 to SEQ ID NO. 64;

the designed first group of primer composition, the second group of primer composition and the 16S primer pair are utilized to design primer pools with different compositions, including a first virus primer pool, a second virus primer pool, a first bacterium primer pool, a second bacterium primer pool, a first mixed primer pool and a second mixed primer pool.

The first viral primer pool comprises 18 pairs of primers in the first set of primer compositions; the second viral primer pool comprises 18 primer pairs and 16S primer pairs of the first set of primer compositions; the concentration of the single primers in the first viral primer pool and the second viral primer pool is preferably 0.2. mu.M.

The first bacterial primer pool comprises 14 pairs of primers in the second set of primer compositions; the second bacterial primer pool comprises 14 primer pairs and 16S primer pairs of the second set of primer compositions; the concentration of the single primers in both the first bacterial primer pool and the second bacterial primer pool is preferably 0.2. mu.M.

The first mixed primer pool comprises 18 primers in the first set of primer compositions and 14 primers in the second set of primer compositions; the second mixed primer pool comprises 18 pairs of primers in the first set of primer compositions, 14 pairs of primers and 16S pairs of primers in the second set of primer compositions; the concentration of the single primers in the first mixed primer pool and the second mixed primer pool is preferably 0.2. mu.M.

The primer sequences of the primer pairs in the first set of primer composition, the primer pairs in the second set of primer composition and the 16S primer pair designed in the scheme are shown as follows.

The primer sequences in the first set of primer compositions are shown in table a below:

TABLE a

The primer sequences in the second set of primer compositions are shown in table b below:

table b

The 16S primer pair has an upstream primer sequence shown as SEQ ID NO.65 and a downstream primer sequence shown as SEQ ID NO. 66;

SEQ ID NO.65：5'-AGAGTTTGATCCTGGCTCAG-3'；

SEQ ID NO.66：5'-GGTTACCTTGTTACGACTT-3'。

the scheme also provides a method for detecting a sample by using a sequencing kit containing the primer and various primer pools designed by the scheme, and the method comprises the following steps:

s1, inactivating the collected sample, and extracting virus DNA/RNA;

bacterial genomic DNA/RNA and/or viral genomic DNA/RNA were extracted from the samples using commercially available extraction kits that meet the requirements of the protocol.

S2, carrying out fragment amplification by using the kit of the scheme to obtain a PCR reaction product;

in one embodiment, for pathogens whose genome is RNA, a reverse transcription reaction is performed prior to performing the PCR reaction; performing PCR amplification on a mixture obtained by reverse transcription reaction;

in this case, the system for reverse transcription reaction comprises 50. mu.M random primers (random hexamers), 10mM dNTPs mix (2.5mM each), and bacterial genomic RNA and/or viral genomic RNA extracted from the sample as a Template (Template).

The scheme follows a primer design principle, designs a plurality of pairs of primers, and designs a primer pool formed by mutually matching 16S detection and primer composition detection designed by the scheme based on the knowledge of 16S primer pairs, thereby realizing accurate detection without missing detection.

S3, sequencing the product obtained by PCR amplification;

third generation sequencing can be performed using the ONT PromethION platform or using the PacBio sequal.

Based on the sequencing result, if the sequence proportion of a certain pathogen is more than or equal to a first threshold value and the coverage at 50 multiplied by depth is more than or equal to a second threshold value, the pathogen is considered to be positive;

if the sequence proportion of a certain pathogen is larger than or equal to a third threshold and the coverage at 50 multiplied by depth is larger than or equal to a fourth threshold, the pathogen is considered to be suspected to be positive; the remainder considered negative for the pathogen;

wherein the pathogen sequence ratio is the total number of sequences of the pathogen to the total number of sequences of the sample; the coverage of the pathogen at 50 x depth was taken from the coverage of the subtype with the highest sequence proportion; coverage as used herein is the ratio of sequencing coverage within the amplification region of the primer pair.

The following description of PCR amplification and sequencing of pathogens causing respiratory tract infections using the primer pool of the present protocol is given in conjunction with the specific examples.

Unless otherwise indicated, the biological materials, reagents, kits, and the like used in the following examples are available from conventional commercial sources, and the biological manipulation techniques involved, such as nucleic acid extraction, reverse transcription reaction, PCR amplification, sample end repair, barcode ligation, DNA library construction, DNA sequencing, and the like, are all routine in the art or are performed in accordance with the instructions of the corresponding products.

The kit used for nucleic acid extraction in example 1 comprises: TIANamp buccal swab genomic DNA extraction kit (DP 322); or TIANAmp Virus DNA/RNA Kit genomic DNA/RNA extraction Kit (DP 315).

Example 1 nucleic acid extraction and PCR amplification

1. Nucleic acid extraction

The kit provided by the scheme is used for extracting genomic DNA/RNA from a throat swab sample for subsequent detection; if the genome in the extracted sample is RNA, reacting at 65 ℃ for 5min according to the components shown in table 1, placing on ice for 1min, then preparing a reverse transcription system in a biological safety cabinet according to the components shown in table 2, complementing 20 microliters of deionized water, reacting at 42 ℃ for 50min, reacting at 70 ℃ for 10min, obtaining a product for PCR amplification, and storing the product at 5 ℃ for later use;

TABLE 1

Reagent composition	Volume (μ l)
		50μM random hexamers	1
10mM dNTPs mix(2.5mM each)	1
		Template (Total) RNA	11
Total volume	13

TABLE 2

Reagent composition	Volume (μ l)
		Preliminary mixture	13
5 XSSIV buffer	4
		100mM DTT	1
RNase inhibitors	1
		SSIV reverse transcriptase	1
Total volume	20

PCR amplification

Carrying out PCR amplification reaction on DNA obtained from collected throat swab samples or cDNA obtained through reverse transcription reaction, configuring a reaction system according to components shown in table 3, carrying out PCR amplification reaction according to conditions shown in table 4, and cooling reaction products to 4 ℃ for storage.

TABLE 3

Reagent composition	Volume (μ l)
		2×Phusion U Multiplex PCR Master Mix	12.5
Primer pool (10 mu M)	3.6
		Deionized water (clean-free water)	6.4
Genomic DNA/cDNA templates	2.5
		Total volume	25

TABLE 4

The PCR amplification product obtained by the PCR amplification reaction was electrophoresed for 25min under 150V using 1% agarose gel. If the result of gel electrophoresis shows that only one band of PCR product of a pair of primers is available and the length of the amplification product is matched with the designed amplification length of the corresponding primer, the pair of primers has good specificity and can be normally amplified, and at the moment, subsequent operations such as library building, sequencing and the like can be carried out.

Purification and sample mixing of PCR products

Adding 0.8 XAMPure beads magnetic beads into PCR amplification products, incubating at room temperature for 5min, adsorbing by a magnetic frame at room temperature for 2min, and removing the supernatant;

adding 200 μ l 70% ethanol, adsorbing with magnetic frame, discarding supernatant, repeating once, and air drying at room temperature;

adding 30 μ l of ultrapure Water (Ultra Pure Water), and blowing and eluting; standing for 5min on a magnetic frame, sucking supernatant, namely purified DNA, and determining the concentration of the purified product.

Mixing samples: and determining the sample mixing ratio of each sample product according to the concentration to obtain a sample mixing mixture.

4. Adding a bar code to the sample (Barcode)

4.1 sample end repair

The end repairing reaction system was prepared according to the components shown in Table 5, reacted at 20 ℃ for 10min, 65 ℃ for 5min, and placed on ice for 1min for end repairing reaction.

TABLE 5

Reagent composition	Volume (μ l)
		DNA	5
Deionized water (clean-free water)	7.5
		Ultra II End Prep Reaction Buffer	1.75
Ultra II End Prep Enzyme Mix	0.75
		Total volume	15

4.2 Bar code (Barcode) linking

A reaction system is configured according to the components shown in Table 6, the reaction is carried out for 15min at 20 ℃, 10min at 70 ℃, the reaction system is placed on ice for 1min, and bar codes are added to the end repairing products. The barcode used is a DNA sequence with an overhanging T at the end, represented by NNNNNNNNNNNNNNNNNNNNNNNNT, where N represents any of the four bases A, G, C, T.

TABLE 6

Reagent composition	Volume (μ l)
		End repair mixture	15
Bar code (NBXX barcode)	2.5
		Ultra II Ligation Master Mix	17.5
Ligation Enhancer	0.5
		Total volume	35.5

According to actual requirements, products added with different barcodes can be mixed to improve sequencing throughput. And the product was purified using 0.8 × AMPure beads magnetic beads.

Example 2 third Generation sequencing Using the ONT PromethION platform

1. Building a library by using a library building kit

1.1 Joint connection

The reaction system was prepared according to the composition shown in Table 7, and the final product obtained in example 1 was subjected to linker ligation reaction at 20 ℃ for 15 min.

TABLE 7

Reagent composition	Volume (μ l)
		The product of example 1	30
NEB Next Quick Ligation Reaction Buffer(5×)	10
		AMII adapter mix	5
Quick T4 DNA Ligase	5
		Total volume	50

1.2 DNA purification

Purification was performed using 0.8 × AMPure beads magnetic beads. Incubating at room temperature for 5min, adsorbing at room temperature for 2min by a magnetic frame, and removing the supernatant; adding into 200 μ l SFB centrifugal pump, blowing, mixing, adsorbing with magnetic frame, discarding supernatant, and repeating once; EB (electron beam bombardment) was added in an amount of 15. mu.l, and the mixture was eluted by pipetting; standing for 5min on a magnetic frame, and sucking supernatant to obtain a purified product.

2. Sample loading and sequencing

Third generation sequencing was performed using the ONT PromethION platform.

Example 3 three generations of sequencing Using PacBio sequal

1. Use and build storehouse kit and carry out storehouse

Sample end repair

A terminal repair reaction system was prepared according to the composition shown in Table 8, and the product obtained in example 1 was subjected to a terminal repair reaction at 37 ℃ for 30min and stored at 4 ℃.

TABLE 8

Reagent composition	Volume (μ l)
		The product of example 1	35
ATP high	1.5
		NAD+	1.5
dNTP	2
		Repair buffer	7
Repair enzymes	3
		Total volume	50

2. Purification of

The repair mixture containing the repair DNA was purified using PB beads in a volume of 0.45 times the sample volume of the mixture, and finally the beads were eluted using double distilled water and stored in a refrigerator at-20 ℃ until use.

3. Joint connection

The reaction system was prepared according to the composition shown in Table 9, and the purified product was subjected to linker ligation reaction at 25 ℃ for 15 hours and stored at 4 ℃.

TABLE 9

Reagent composition	Volume (μ l)
		Purified product of step 2	50
Linker linking buffer	30
		DNA ligase	10
Joint solution (20uM)	5
		Deionized water	5
Total volume	100

4. Purification of

And (3) purifying the reaction product in the step (3) by using PB magnetic beads with the volume of 0.45 time that of the sample, and finally eluting the magnetic beads by using double distilled water, and storing the magnetic beads in a refrigerator at the temperature of-20 ℃ for later use.

5. Primer annealing, Binding reaction and sequencing

Three generations of sequencing were performed using a PacBio sequal.

Example 4 bioinformatic analysis

1. Off-line data processing

Baselisting is performed using the Guppy _ baseholder sub-command of Guppy software, and sequence information in the fastq format is obtained. In the basecasting process, sequences with mass greater than 7 were retained as input sequences for subsequent analysis.

2. Sample splitting

The sample splitting step for a batch of data was performed using the Guppy _ barcode subcommand of the Guppy software, based on known barcode sequence information added during sequencing. And verifying whether the corresponding relation between the sample and the barcode is consistent with that in the experimental design.

3. Sequence alignment

Establishing a reference database, and collecting target reference genome information from the public database, wherein the target reference genome information comprises a 16S reference genome, a virus reference genome and/or a bacterial reference genome.

Sequence alignment and sequencing were performed using Minimap2 software. Filtering the comparison result to remove the comparison result which has not compared any reference genome, repeated comparison, secondary comparison and difference of the comparison position from the expected.

4. Result judgment

A pathogen is considered positive if the proportion of a pathogen sequence is greater than or equal to 10% (first threshold) and the coverage at 50X depth is greater than or equal to 30% (second threshold). A pathogen is considered to be suspected positive if the proportion of a pathogen sequence is greater than or equal to 1% (third threshold) and the coverage at 50X depth is greater than or equal to 10% (fourth threshold). The remainder considered negative for this species;

wherein the pathogen sequence ratio is the total number of sequences of the pathogen to the total number of sequences of the sample; the coverage of the pathogen at 50 x depth was taken from the coverage of the subtype with the highest sequence proportion; coverage is the ratio of sequencing coverage within the region amplified by the primer pair.

It should be noted that the specific values of the thresholds are only preferred embodiments, and do not limit the protection scope of the present invention.

Examples of effects

The following examples are intended to illustrate the PCR amplification or sequencing effect of the primer pools designed using this protocol, and therefore the following examples show only the PCR amplification results or the sequencing results.

Effect example 1

A throat swab sample of a patient infected by the novel coronavirus is collected, nucleic acid extraction and PCR amplification are carried out by using the steps described in example 1, and in the PCR amplification in the present effect example, all primer pairs in a second virus primer pool are selected, namely, a primer composition in which 18 primer pairs with the sequences shown as SEQ ID NO.1 to SEQ ID NO.18 as the upstream primer sequence, 18 primer pairs with the sequences shown as SEQ ID NO.19 to SEQ ID NO.36 as the downstream primer sequence, the 16S primer pairs with the sequences shown as SEQ ID NO.66 as the upstream primer sequence, and the 16S primer pairs with the sequences shown as SEQ ID NO.66 are mixed at an equal concentration of 0.2 mu M is adopted.

The result of detecting the PCR product by agarose gel electrophoresis is shown in figure 1, and the 16S primer pair, the primer pair which is designed by the scheme and has the upstream primer sequence shown in SEQ ID NO.10 and the downstream primer sequence shown in SEQ ID NO.28, and the primer pair which has the upstream primer sequence shown in SEQ ID NO.11 and the downstream primer sequence shown in SEQ ID NO.29 can realize high-efficiency and specific amplification, the size of the amplified product band is consistent with the expected size, and the primer dimer is less or none. Sequencing the PCR product according to the steps described in the embodiment 2, and performing biological information analysis on the sequencing result according to the steps described in the embodiment 4, wherein the sequencing result is judged to be positive to the novel coronavirus, and is consistent with the actual condition of the collected sample.

Effect example 2

A throat swab sample of a patient infected with parainfluenza virus is collected, nucleic acid extraction and PCR amplification are carried out by using the steps of example 1, and in the PCR amplification in the present effect example, all primer pairs in a second virus primer pool are selected, namely, a primer composition in which 18 primer pairs with the sequences shown as SEQ ID NO.1 to SEQ ID NO.18 as the upstream primer sequence, 18 primer pairs with the sequences shown as SEQ ID NO.19 to SEQ ID NO.36 as the downstream primer sequence, the 16S primer pair with the sequence shown as SEQ ID NO.66 as the downstream primer sequence are mixed at an equal concentration of 0.2 mu M is adopted.

The PCR product is detected by agarose gel electrophoresis, the result is shown in figure 2, the 16S primer pair, the parainfluenza virus primer pair designed by the scheme and having the upstream primer sequence shown in SEQ ID NO.4 and the downstream primer sequence shown in SEQ ID NO.22 can realize high-efficiency and specific amplification, the size of the amplified product band is consistent with the expected size, and the primer dimer is less or not. Sequencing the PCR product according to the steps described in example 3, and performing biological information analysis on the sequencing result according to the steps described in example 4, wherein the sequencing result is judged to be positive to parainfluenza virus and is consistent with the actual situation of the collected sample.

Effect example 3

A throat swab sample of a patient infected with coronavirus NL63 was collected, and nucleic acid extraction and PCR amplification were performed by the procedure described in example 1. in this effect example, all primer pairs in the second viral primer pool were selected for PCR amplification, i.e., a primer composition in which 18 primer pairs having the sequences of SEQ ID NO.1 to SEQ ID NO.18 as the upstream primer, 18 primer pairs having the sequences of SEQ ID NO.19 to SEQ ID NO.36 as the downstream primer, and 16S primer pairs having the sequences of SEQ ID NO.66 were mixed at an equal concentration of 0.2. mu.M as the upstream primer and the downstream primer, respectively.

The PCR product is detected by agarose gel electrophoresis, the result is shown in figure 3, the 16S primer pair, the coronavirus NL63 primer pair which is designed by the scheme and has the upstream primer sequence shown in SEQ ID NO.16 and the downstream primer sequence shown in SEQ ID NO.34, and the primer pair which has the upstream primer sequence shown in SEQ ID NO.17 and the downstream primer sequence shown in SEQ ID NO.35 realize high-efficiency and specific amplification, the band size of the amplified product is consistent with the expected band size, and the primer dimer is less or none. The PCR products were sequenced as described in example 2, and the sequencing results were analyzed for biological information as described in example 4, and were judged positive for coronavirus NL63, consistent with the actual sample collection.

Fig. 1 to 3 correspond to effect examples 1 to 3, respectively. As can be seen from the results in FIGS. 1 to 3, each primer pair in the primer pool designed in the present scheme can amplify the viral DNA with high specificity, the band size of the amplified product is identical to that expected from the primer design, and there are few or no primer dimers. If two pairs of primers are involved in the same pathogen, normal amplification is expected. The amplification efficiency of the primers was relatively uniform between samples. And (3) judging according to the sequencing sequence by sequencing reaction and bioinformatics analysis to be consistent with the actual infection condition of the sample. The sequencing results are all in line with expectations.

Effect example 4

A throat swab sample of an influenza A virus infected patient is collected, nucleic acid extraction and PCR amplification are carried out by using the steps described in example 1, and in the PCR amplification in the effective example, all primer pairs in a second virus primer pool designed by the scheme are selected, namely, 18 primer pairs with the sequences shown as SEQ ID NO.1 to SEQ ID NO.18 as upstream primer sequences, 18 primer pairs with the sequences shown as SEQ ID NO.19 to SEQ ID NO.36 as downstream primer sequences and 16S primer pairs with the sequences shown as SEQ ID NO.66 as downstream primer sequences are mixed at an equal concentration of 0.2 mu M.

The PCR products were sequenced using the procedure described in example 3, the sequencing results were analyzed for biological information using the procedure described in example 4, and the alignment of the sequences obtained by sequencing is shown in FIG. 4, where only a portion of the sequence alignment is shown in FIG. 4. As can be seen from FIG. 4, the sequencing results obtained by PCR amplification and then sequencing of the primer pool designed by the scheme are all matched with the region corresponding to the influenza A virus and are consistent with the actual situation of the collected sample; based on the sequence differences among the subtypes, sample 1 was judged as H1N1 subtype, sample 2 was H3N2 subtype, sample 3 was H5N1 subtype, and sample 4 was H7N9 subtype.

Comparative example

The following examples are intended to illustrate the difference in PCR amplification or sequencing effect between primers designed using this protocol and those using ordinary primers, and therefore the following examples show only PCR amplification results or sequencing results. For the positive samples of the following examples, the genus of the pathogen was subsequently determined by other means of detection.

When the scheme is used for PCR amplification, a pair of primers is not used singly, and because pathogens contained in a newly collected sample cannot be determined and the high efficiency and accuracy of detection are ensured, the primer pairs suitable for multiple pathogens are mixed to form a primer pool, so that multiple pathogens can be detected simultaneously in one-time detection. Therefore, in the comparative experiments, the primer pools containing a plurality of pairs of primers were used for PCR amplification, and in order to illustrate the effect of the primer pairs designed according to this embodiment, the primer pairs in the primer pools were the same except that the primer pairs used for comparison were divided into those designed according to this embodiment and those designed according to comparative examples, and the concentrations of the primers in the primer pools were the same and were 0.2. mu.M in each experiment.

Comparative example 1

The comparison example is the comparison of PCR amplification effect of human rhinovirus, and 5 pairs of primers are designed by using primer design software aiming at a selected target region of the human rhinovirus and strictly following the basic principle of primer design before PCR amplification comparison. The 5 pairs of primers have upstream primer sequences shown as SEQ ID NO.67 to SEQ ID NO.71 and downstream primer sequences shown as SEQ ID NO.72 to SEQ ID NO. 76.

The primer pool of the experiment comprises other primer pairs which form the primer pool besides the primers suitable for the human rhinovirus, and the conditions of the other primer pairs are as follows: has upstream primer sequences shown as SEQ ID NO.1 to SEQ ID NO.6 and SEQ ID NO.8 to SEQ ID NO.18, 17 pairs of downstream primer sequences shown as SEQ ID NO.19 to SEQ ID NO.24 and SEQ ID NO.26 to SEQ ID NO.36 and 16S primer sequences shown as SEQ ID NO.65 and 66, respectively.

A throat swab sample containing human rhinovirus was collected, and nucleic acid extraction and PCR amplification were performed according to the procedure in example 1.

1. The primer designed by the scheme is as follows:

the primer pair suitable for detecting the human rhinovirus designed by the scheme is a primer pair No.7 in the table a, and has an upstream sequence shown as SEQ ID NO.7 and a downstream sequence shown as SEQ ID NO. 25. The primer pair suitable for the human rhinovirus designed by the scheme and other primers forming the primer pool of the comparative example are mixed in equal concentration to form a second virus primer pool for PCR amplification.

2. Primer designed in comparative example 1:

the 5 pairs of primers designed in comparative example 1 had upstream primer sequences shown in SEQ ID NO.67 to SEQ ID NO.71 and downstream primer sequences shown in SEQ ID NO.72 to SEQ ID NO. 76;

primer set 1: SEQ ID NO. 67: GCTATTACAACCAGTAATA, respectively;

SEQ ID NO.72：TCCCATCCCGCAATTACTC；

and 2, primer pair: SEQ ID No. 68: CGGAGTATAGACGGCCAC, respectively;

SEQ ID NO.73：GTCACCATAAGCAAATAT；

primer set 3: SEQ ID NO. 69: CGTAACTTAGAAGAATTGAATAACC, respectively;

SEQ ID NO.74：ATGCACTAGCTGCAGGGTTA；

primer set 4: SEQ ID No. 70: AGCTCTTAACCGTTATCCG, respectively;

SEQ ID NO.75：TGTGCGCCCATGATGCCAAT；

primer set 5: SEQ ID NO. 71: ATAACCGCACAATAGGAGCTA, respectively;

SEQ ID NO.76：CCGCAATTACTCATTACGA。

5 pairs of primers suitable for human rhinovirus designed in the comparative example 1 are mixed with other primers forming the primer pool in the comparative example in equal concentration to form 5 primer pools of the comparative example 1, and the 5 primer pools are respectively used for PCR amplification.

The results of PCR amplification are shown in FIG. 5. Lane 1 shows the first primer pair for human rhinovirus designed in comparative example 1, with the upstream sequence shown in SEQ ID NO.67 and the downstream sequence shown in SEQ ID NO. 72. Lane 2 shows a second primer set suitable for human rhinovirus designed in comparative example 1, and the upstream sequence is shown in SEQ ID NO.68, and the downstream sequence is shown in SEQ ID NO. 73. Lane 3 shows a third primer set suitable for human rhinovirus designed in comparative example 1, and the upstream sequence is shown in SEQ ID NO.69 and the downstream sequence is shown in SEQ ID NO. 74. Lane 4 is a primer pair suitable for human rhinovirus designed by this protocol, and its upstream sequence is shown in SEQ ID NO.7 and its downstream sequence is shown in SEQ ID NO. 25. Lane 5 shows a fourth primer set suitable for human rhinovirus designed in comparative example 1, and the upstream sequence is shown in SEQ ID NO.70 and the downstream sequence is shown in SEQ ID NO. 75. Lane 6 shows a fifth primer set suitable for human rhinovirus designed in comparative example 1, and the upstream sequence is shown in SEQ ID NO.71 and the downstream sequence is shown in SEQ ID NO. 76.

The results of fig. 5 were analyzed: lane 1 shows non-specific amplification and a small amount of primer dimer in the PCR amplification; lane 2 shows a small amount of primer dimer in the PCR amplification; lane 3 shows non-specific amplification of the PCR amplification; the PCR amplification effect of the lane 4 is optimal, and the requirement of subsequent detection can be met; lane 5 shows no target band amplified; lane 6 shows non-specific amplification and significant primer dimer in the PCR amplification.

This comparative example shows that, after the same experimental procedure, only the primer pair No.7 in Table a designed by this scheme can work normally in the primer pool formed by the primers designed by this scheme for detecting other pathogens, i.e., the product satisfying the subsequent detection requirement is amplified during the PCR amplification reaction. However, the 5 pairs of primers designed in comparative example 1 can not play their own role in the primer pool designed in the present scheme. The reaction using 5 pairs of primers designed in comparative example 1 resulted in the presence of a small amount of primer dimer, or non-specific amplification, or no target band. This is because the present invention considers that the interaction between the primers occurs when there are a plurality of primers in the primer pool at the beginning of the design, and therefore, the present invention considers the synergistic effect when a plurality of primers coexist and minimizes the interaction between the primers when designing the primer pool and each primer sequence in the pool, so that even if the design rule of the primers is followed and an individual primer pair is designed by the design software, the function of the primers cannot necessarily be normally exerted in the primer pool where there are a plurality of primers, and the desired product is amplified with high quality. Therefore, the primer pair designed by the scheme and the primer pool formed by the primer pairs can efficiently and accurately amplify the result meeting the detection requirement.

Comparative example 2

The comparison example is a comparison of PCR amplification effects of Mycoplasma pneumoniae, and 1 pair of primers is designed by using primer design software aiming at a target region selected by Mycoplasma pneumoniae and strictly following the basic principle of primer design before PCR amplification comparison. The pair of primers has an upstream primer sequence shown as SEQ ID NO.77 and a downstream primer sequence shown as SEQ ID NO. 78.

The primer pool in this experiment includes, in addition to the primers suitable for mycoplasma pneumoniae, other primer pairs forming the primer pool, and the conditions of these other primer pairs are as follows: has an upstream primer sequence shown as SEQ ID NO.38 to SEQ ID NO.50, 13 pairs of primer pairs of a downstream primer sequence shown as SEQ ID NO.52 to SEQ ID NO.64, and a 16S primer pair with an upstream primer sequence shown as SEQ ID NO.65 and a downstream primer sequence shown as SEQ ID NO. 66.

Samples of different throat swabs containing mycoplasma pneumoniae were collected and subjected to nucleic acid extraction and PCR amplification as in example 1.

1. The primer designed by the scheme is as follows:

the primer pair suitable for mycoplasma pneumoniae designed by the scheme is a primer pair No.19 in a table b, and has an upstream sequence shown as SEQ ID NO.37 and a downstream sequence shown as SEQ ID NO. 51.

The primer pair suitable for mycoplasma pneumoniae designed by the scheme and other primers forming the primer pool in the comparative example are mixed in equal concentration to form a second bacterial primer pool for PCR amplification.

2. Primer designed in comparative example 2:

the 1 pair of primers designed in comparative example 2 has an upstream primer sequence shown as SEQ ID NO.77 and a downstream primer sequence shown as SEQ ID NO. 78;

SEQ ID NO.77：GGACTCGGAGGACAATGGT；

SEQ ID NO.78：CACATCAAACCCGGTCTTTTCG。

the 1 pair of primers designed for mycoplasma pneumoniae in comparative example 2 and the other plural pairs of primers forming the primer pool in this comparative example were mixed in equal concentrations to form the primer pool in comparative example 2 for PCR amplification.

The results of PCR amplification are shown in FIG. 6. Lanes 1 to 3 are primer pairs suitable for Mycoplasma pneumoniae designed by the present scheme, the upstream sequence of which is shown as SEQ ID NO.37, and the downstream sequence of which is shown as SEQ ID NO.51, and the primer pairs and other primer pairs of the present comparative example form a primer pool for amplification reaction. Lanes 4 to 5 show the primer pairs suitable for Mycoplasma pneumoniae designed in comparative example 2, the upstream sequence of which is shown in SEQ ID NO.77, and the downstream sequence of which is shown in SEQ ID NO.78, and the primer pairs and other primer pairs in this comparative example form a primer pool for amplification reaction.

The results of fig. 6 were analyzed: the results in lanes 1-3 indicate that the efficiency of PCR amplification is relatively uniform; the results in lanes 4-5 show the presence of non-specific amplification, primer dimer, and the amplification efficiency is significantly different from that in lanes 1-3.

This comparative example shows that, after the same experimental procedure, only the primer pair No.19 in Table b designed by this scheme can work normally in the primer pool formed by the primers designed by this scheme for detecting other pathogens, i.e., a product satisfying the subsequent detection requirement is amplified during the PCR amplification reaction. The 1 pair of primers designed in comparative example 2 can not play its own role in the primer pool designed in the scheme. The reaction using 1 pair of primers designed in comparative example 2 showed a small amount of primer dimer and non-specific amplification. This is because the present invention considers that the interaction between the primers occurs when there are a plurality of primers in the primer pool at the beginning of the design, and therefore, the present invention considers the synergistic effect when a plurality of primers coexist and minimizes the interaction between the primers when designing the primer pool and each primer sequence in the pool, so that even if the principle of designing the primers is followed, the individual primer pairs designed by the design software do not necessarily function normally as primers in the primer pool where a plurality of primers exist, and a desired product is amplified with high quality. Therefore, the primer pair designed by the scheme and the primer pool formed by the primer pairs can efficiently and accurately amplify the result meeting the detection requirement.

Comparative example 3

16S primer pairs are arranged in the second virus primer pool, the second bacterium primer pool and the second mixed primer pool, when the second virus primer pool, the second bacterium primer pool and the second mixed primer pool are used for PCR amplification, the amplification efficiency is extremely high because 16S exists in all bacterium chromosome genomes, and obvious competition can be formed with the primer pairs designed for a certain pathogen in the primer pools. If the amplification product of the pathogen specific primer is too little to be beneficial to the subsequent sequencing reaction, the corresponding sequencing data is too little to be judged accurately. Therefore, it needs to be adjusted by primer design to ensure that the amplification efficiency of the primer pair in the primer pool is equivalent to that of the 16S primer pair. Meanwhile, if the content of a certain pathogen in a sample is low in abundance, in order to ensure that detection is not missed, enrichment is carried out by relying on a PCR (polymerase chain reaction) method, so that efficient amplification of each primer pair is required to be ensured. Each primer pair designed in the scheme can meet the requirements, and can still efficiently amplify a required product under the condition that a 16S primer pair exists, and the sequencing comparison of the coronavirus 229E is illustrated below.

This comparative example is a comparison of the sequencing effect of coronavirus 229E, and 3 pairs of primers were designed using primer design software for the selected target region of coronavirus 229E and following the basic principle of primer design strictly before sequencing comparison. The 3 pairs of primers have an upstream primer sequence shown as SEQ ID NO.79 to SEQ ID NO.81 and a downstream primer sequence shown as SEQ ID NO.82 to SEQ ID NO. 84;

primer set 1: SEQ ID NO. 79: CACAAAAGGGTGATGCTGCAAT, respectively;

SEQ ID NO.82：ACGAATCATTGAGGGCATAGCT；

and 2, primer pair: SEQ ID No. 80: TCGTGCTCATCTTTGTGGTGAG, respectively;

SEQ ID NO.83：CCAACACTTACCTTGCACATAGC；

primer set 3: SEQ ID No. 81: TGGGCATGGAATCCTGAGGTTA, respectively;

SEQ ID NO.84：ACCCGTTTGCCCTTTCTAGTTC。

the primer pool of this experiment excludes the primer pair suitable for coronavirus 229E, and the other primer pairs forming the primer pool are: has upstream primer sequences shown as SEQ ID NO.1 to SEQ ID NO.14 and SEQ ID NO.16 to SEQ ID NO.18, 17 pairs of downstream primer sequences shown as SEQ ID NO.19 to SEQ ID NO.32 and SEQ ID NO.34 to SEQ ID NO.36 and 16S primer sequences shown as SEQ ID NO.65 and downstream primer sequences shown as SEQ ID NO. 66.

A throat swab sample containing coronavirus 229E was collected, subjected to nucleic acid extraction and PCR amplification according to the procedure in example 1, subjected to sequencing according to the procedure in example 2, and subjected to bioinformatics analysis according to the procedure in example 4.

1. The primer designed by the scheme is as follows:

the primer pair suitable for coronavirus 229E designed by the present scheme is primer pair No.15 in Table a, and has an upstream sequence shown as SEQ ID NO.15 and a downstream sequence shown as SEQ ID NO. 33.

The primer pair suitable for coronavirus 229E designed in this scheme and the other multiple primer pairs forming the primer pool of this example were mixed in concentration to form a second viral primer pool for PCR amplification.

2. Primer designed in comparative example 3:

the 3 pairs of primers designed in comparative example 3 had upstream primer sequences shown in SEQ ID NO.79 to SEQ ID NO.81 and downstream primer sequences shown in SEQ ID NO.82 to SEQ ID NO. 84.

The 3 primer pairs designed in comparative example 3 for coronavirus 229E were mixed with the other primer pairs forming the primer pool of this comparative example at equal concentrations to form the 3 primer pools of comparative example 3 for PCR amplification.

The results of the sequencing are shown in FIG. 7. The primer pool 1 refers to the first primer pair designed in the comparative example 3, the upstream sequence of the first primer pair is shown as SEQ ID NO.79, the downstream sequence of the first primer pair is shown as SEQ ID NO.82, the first primer pair and other primer pairs in the comparative example form a primer pool 1 for amplification reaction, and then library building and sequencing are carried out. The primer pool 2 refers to a second primer pair designed in the comparative example 3, the upstream sequence of the second primer pair is shown as SEQ ID No.80, the downstream sequence of the second primer pair is shown as SEQ ID No.83, the second primer pair and other primer pairs in the comparative example form a primer pool 2 for amplification reaction, and then library building and sequencing are carried out. The primer pool 3 refers to a third primer pair designed in the comparative example 3, the upstream sequence of the third primer pair is shown as SEQ ID NO.81, the downstream sequence of the third primer pair is shown as SEQ ID NO.84, the third primer pair and other primer pairs in the comparative example form a primer pool 3 for amplification reaction, and then library building and sequencing are carried out. The primer pool 4 refers to a primer pair designed by the scheme, the upstream sequence of the primer pair is shown as SEQ ID NO.15, the downstream sequence of the primer pair is shown as SEQ ID NO.33, the primer pair and other primer pairs of the comparative example form a second virus primer pool, namely the primer pool 4, the amplification reaction is carried out, and then the library building and the sequencing are carried out.

The working efficiency of the various primer pairs in FIG. 7 was analyzed: the ordinate of FIG. 7 is the sequence ratio (in%) and the larger the value, the higher the amplification efficiency. The result shows that the amplification efficiency of the primer pair designed by the scheme in the primer pool is obviously superior to that of other comparative examples.

It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention, and it will be obvious to those skilled in the art that other variations or modifications may be made on the basis of the above description, and all embodiments may not be exhaustive, and all obvious variations or modifications may be included within the scope of the present invention.

Claims

1. A primer composition comprising one or more primer compositions selected from the group consisting of primer compositions A), B) and C):

2. The primer composition of claim 1, wherein the first primer composition comprises the same amount of each primer.

3. The primer composition of claim 1, wherein the amount of each primer in the second primer composition is the same.

4. The primer composition of claim 1, wherein when the composition comprises a 16S primer pair and the first set of primer compositions and/or the second set of primer compositions, the amount of all primer pairs in the primer compositions is the same.

5. A sequencing kit comprising a primer composition according to any one of claims 1 to 4.

6. A method of detecting a pathogen that causes a respiratory infection, the method comprising:

inactivating the collected sample, and extracting pathogen DNA/RNA;

performing fragment amplification using one or more primer compositions comprising the primer compositions shown in A), B) and C) to obtain PCR reaction products;

sequencing the PCR reaction product;

the second group of primer compositions comprises one or more pairs of 14 pairs of primers, wherein the 14 pairs of primers respectively have upstream primer sequences shown as SEQ ID NO.37 to SEQ ID NO.50 and downstream primer sequences shown as SEQ ID NO.51 to SEQ ID NO. 64;

7. The method of claim 6, wherein the amount of the 16S primer pair in the primer composition is the same as the amount of each primer pair in the first primer composition and/or the amount of each primer pair in the second primer composition when the primer composition is used for fragment amplification reaction.

8. The method of claim 6, further comprising: and carrying out reverse transcription reaction on the extracted RNA of the pathogen to obtain cDNA.

9. The method of claim 6, wherein a pathogen is considered positive if the proportion of sequences of the pathogen is greater than or equal to a first threshold and the coverage at 50 x depth is greater than or equal to a second threshold based on the sequencing results;

the remainder considered negative for the pathogen;

wherein the pathogen sequence ratio is the total number of sequences of the pathogen to the total number of sequences of the sample;

the coverage of the pathogen at 50 x depth was taken from the coverage of the subtype with the highest sequence proportion;

the coverage is the sequencing coverage area ratio within the amplification area of the primer pair.