CN112593010A - Primer and probe for detecting Zika virus - Google Patents

Primer and probe for detecting Zika virus Download PDF

Info

Publication number
CN112593010A
CN112593010A CN202011568702.1A CN202011568702A CN112593010A CN 112593010 A CN112593010 A CN 112593010A CN 202011568702 A CN202011568702 A CN 202011568702A CN 112593010 A CN112593010 A CN 112593010A
Authority
CN
China
Prior art keywords
zika virus
probe
primer
detection kit
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011568702.1A
Other languages
Chinese (zh)
Inventor
黎孟枫
李隽�
朱勋
何振健
吴珏珩
谭姹辉
陈德林
林翠姬
谭泳谣
曹开源
袁洁
蔡俊超
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sun Yat Sen University
Original Assignee
Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sun Yat Sen University filed Critical Sun Yat Sen University
Priority to CN202011568702.1A priority Critical patent/CN112593010A/en
Publication of CN112593010A publication Critical patent/CN112593010A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a primer and a probe for detecting Zika virus, wherein the primer and the probe are designed in a relatively conserved region, and the primer and the Taqman probe with high specificity are selected, so that the concentration of the primer and the probe in a reaction system is optimized, the Zika virus in the Aedes mosquitoes can be accurately detected, the Zika virus in the Aedes mosquitoes can be quickly, effectively and accurately detected, and the Zika virus can also be used for detecting clinical samples.

Description

Primer and probe for detecting Zika virus
Technical Field
The invention relates to the technical field of virus detection, in particular to a primer and a probe for detecting Zika virus.
Background
Zika Virus (ZIKV) is a mosquito-borne transmission Virus belonging to the flavivirus genus of the Flaviviridae family, and the main transmission vectors thereof are Aedes aegypti and Aedes albopictus. Aedes is an insect of the genus Aedes of the subfamily Culex of the family Culex, and is commonly called Aedes. Aedes is a medium and small black mosquito species with silvery white stripes. The median white longitudinal striation is arranged on the middle thoracic shield, and the anterior part of the small shield which extends backwards from the front end to reach the level of the wing base is bifurcated. There are white rings on 1-4 posttarsal nodes and white rings on the last nodes. The back of the abdomen has 2-6 sections with leucorrhea. The genomic RNA of Zika virus was about 10.8kb in length and had a single Open Reading Frame (ORF). The ORF encodes a polyprotein molecule of about 380kDa, which is cleaved into 3 structural proteins (C, prM, E) and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) by host enzymes and viral proteases. The ORF is flanked by a 5 'terminal noncoding region (UTR) and a 3' UTR, respectively. The two non-coding regions have highly conserved secondary structures that facilitate translation and replication of the genome. ZIKV was first discovered in 1947 in uda, and subsequently cases of human infection with ZIKV were reported in countries such as africa, asia, pacific, etc. 2015 + 2017, the prevalence of ZIKV outbreaks in central and south america has spread to 87 countries and regions throughout the world to date. After people are infected with ZIKV, the symptoms are mild, and mainly manifested as fever, rash, arthralgia, myalgia and the like. It is noted that ZIKV infection is closely related to the occurrence of nervous system diseases such as neonatal microcephaly, adult Guillain-barre Syndrome (GBS), and severe encephalitis. The outbreak of ZIKV in america led to a dramatic increase in the number of cases of infantile microcephaly, and as early as 1 month of 2018, over 3700 cases of congenital defects associated with ZIKV infection have been reported in america. Currently, 31 countries worldwide report ZIKV-related microcephaly or nervous system abnormalities.
The Aedes albopictus is a global aggressive mosquito, can transmit various flaviviruses such as dengue viruses, chikungunya viruses, Zika viruses and the like, is used as a medium for insect vector transmission, is distributed in partial areas of Hainan province, Guangdong province and Yunnan province of China and areas such as Taiwan southern China, has high local transmission risk of Zika viruses in the future, and establishes a method for quickly detecting the Zika viruses in the mosquitoes. Because no vaccine or specific medicine exists, the main measures for preventing and controlling the Zika virus disease are to control a transmission medium, eliminate mosquito breeding land carrying the Zika virus, use an insecticide and adopt new environmental-friendly and effective technical means, which are strategies for preventing and controlling the epidemic situation. Therefore, the detection of the virus in the Aedes mosquito is very important.
At present, many laboratory diagnostic methods for ZIKV are established at home and abroad, such as virus isolation culture, serology, nucleic acid detection and the like. The time required for virus isolation and culture is long, serological cross reaction exists among members of the flaviviridae family, patients are difficult to diagnose in a short time for partial infection of viruses, and the optimal treatment time is missed. Therefore, the development of new technologies for rapid and correct detection to screen suspicious cases, control epidemic spread and give symptomatic treatment in time is urgently needed. The real-time fluorescent quantitative PCR realizes the quantitative analysis of the virus RNA by inserting a specific fluorescent probe, has the characteristics of simple and convenient operation, high sensitivity and specificity and the like, does not need to carry out subsequent analysis on an amplification product, can effectively avoid pollution caused by manual operation, and can carry out rapid diagnosis on Zika virus infection in time when epidemic outbreak or input cases occur in China so as to effectively control the outbreak prevalence of the virus.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provide a primer and a probe for detecting Zika virus.
The first object of the present invention is to provide a set of primers for detecting Zika virus.
The second object of the present invention is to provide a set of probes for detecting Zika virus.
The third purpose of the invention is to provide the application of the primer and/or the probe in preparing the Zika virus detection kit.
The fourth object of the present invention is to provide a Zika virus detection kit.
In order to achieve the purpose, the invention is realized by the following scheme:
the invention claims a group of primers for detecting Zika virus, and the nucleotide sequence of the primers is shown as SEQ ID NO: 1 to 2.
SEQ ID NO：1：CCGCTGCCCAACACAAG，
SEQ ID NO：2：CCACTAACGTTCTTTTGCAGACAT。
The invention also claims a group of probes for detecting Zika virus, and the nucleotide sequence is shown as SEQ ID NO: 3, respectively.
SEQ ID NO：3：AGCCTACCTTGACAAGCAGTCAGACACTCAA。
Preferably, the 5 'end of the probe is marked with a fluorescent group FAM, and the 3' end of the probe is marked with a fluorescent group BHQ 1.
The E protein is the main protein responsible for the combination of virus and receptor, membrane fusion and host immune recognition, so the E gene is the main gene determining the antigenicity of the Zika virus, and the patent designs specific primers and probes aiming at the E gene of the Zika virus, and can better ensure the specificity and stability of the Zika virus in detection and identification.
The invention also claims application of the primer and/or the probe in preparation of the Zika virus detection kit.
Further, the invention claims a Zika virus detection kit, which comprises the primer and/or the probe.
Preferably, the primer of claim 1 and the probe of claim 2 are included.
More preferably, the kit further comprises a reagent for reverse transcription reaction and/or a reagent for fluorescent quantitative PCR.
More preferably, the reagent for fluorescent quantitative PCR is Vazyme 2 × AceQ Mix.
More preferably, the system of the fluorescent quantitative PCR is as follows: 10. mu.l of Vazyme 2 × AceQ Mix, 1. mu.l of each of the primers, 1. mu.l of the probe, ddH2O 5μl，cDNA 2μl。
More preferably, the reaction procedure of the fluorescent quantitative PCR is 95 ℃ for 10 min; 95 ℃, 15s, 55 ℃, 60s, 45 cycles and constant temperature of 16 ℃.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a detection primer and a probe of Zika virus nucleic acid based on a fluorescent PCR quantitative technology, wherein the primer probe is designed in a relatively conserved region, and a primer and a Taqman probe with high specificity are selected, so that the concentrations of the primer and the probe in a reaction system are optimized; meanwhile, the invention discloses a Zika virus infected aedes mosquito and a method for extracting and detecting viruses in the infected aedes mosquito tissue, so that the Zika virus in the aedes mosquito can be accurately detected, the Zika virus in the aedes mosquito can be quickly, effectively and accurately detected, and the method can also be used for detecting clinical specimens. The invention can detect and identify two types of Zika viruses, namely African type and Asia type, which can ensure the comprehensiveness of Zika virus detection.
Drawings
FIG. 1 is a graph showing the fluorescent amplification curve of Real-time PCR detection of Zika virus using the above primers and probes, and the Ct value is 18.66; and negative control amplification curve.
Detailed Description
The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
EXAMPLE 1 design of primers and probes
First, experiment method
By respectively carrying out comparison analysis on the gene sequences of known Zika viruses in all GenBank databases, selecting a highly conserved segment, verifying the homology of the specificity of the primer and similar pathogens through BLAST, and designing a primer and a probe for detecting the pathogens.
Second, experimental results
Primers and probes were designed for the Zika virus E gene.
Wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO: 1, or a nucleotide sequence shown in the specification,
the nucleotide sequence of the downstream primer is shown as SEQ ID NO: as shown in figure 2, the first and second,
the nucleotide sequence of the specific probe is shown as SEQ ID NO: 3, the 5 'end of the DNA fragment is fluorescently labeled with FAM, and the 3' end of the DNA fragment is fluorescently labeled with BHQ 1.
Example 2A kit for detecting Zika Virus
A, make up
The nucleotide sequence is shown as SEQ ID NO: 1-2;
the nucleotide sequence is shown as SEQ ID NO: 3, the 5 'end is fluorescently labeled with FAM, and the 3' end is fluorescently labeled with a probe of BHQ 1;
SEQ ID NO：1：CCGCTGCCCAACACAAG，
SEQ ID NO：2：CCACTAACGTTCTTTTGCAGACAT，
SEQ ID NO：3：AGCCTACCTTGACAAGCAGTCAGACACTCAA。
second, use method
1. Total RNA extraction
(1) 200ul of RNAisso Plus or Triziol (the amount used to extract a whole Aedes RNA) was added to a 2ml RNase-free centrifuge tube at 30Hz and homogenized for 30 s. The liquid was transferred to a 1.5ml RNase-free centrifuge tube and allowed to stand for 15 min.
(2) To the above lysate was added 1/5 volumes (40. mu.l) of chloroform, the centrifuge tube cap was closed, and the mixture was vortexed and vortexed. After the solution is fully emulsified (no phase separation phenomenon), standing for 10min at 4 ℃.
(3) Centrifuge at 12,000g for 10 minutes at 4 ℃.
(4) The centrifuge tube was carefully removed from the centrifuge, and the homogenate was divided into three layers at this time, i.e.: colorless supernatant, intermediate white protein layer and colored lower organic phase. The supernatant (40-70. mu.l) was pipetted into another new centrifuge tube (without aspirating the white middle layer).
(5) Isopropanol of 1 volume (40. mu.l) was added to the supernatant, the tubes were inverted slowly from top to bottom and mixed well, and then left to stand at-20 ℃ for 10 minutes.
(6) Centrifuge at 12,000g for 10 minutes at 4 ℃.
(7) The supernatant was carefully discarded, and 75% ethanol (prepared in RNase-free dH 2O) l ml (without touching the pellet) was slowly added along the wall of the tube, the tube wall was washed gently upside down, and centrifuged at 12,000g at 4 ℃ for 5min, after which the ethanol was carefully discarded.
(8) The mixture was centrifuged at 12,000g and 4 ℃ for 5min, and the remaining liquid was aspirated.
(9) The precipitate was dried at room temperature for 2-5 minutes, and 40. mu.l of RNase-free dH2O was added to dissolve the precipitate (if necessary, it was blown with a gun) and immediately used for the first strand cDNA synthesis.
2. RNA purity and concentration determination
Taking 2 mul of RNA solution, respectively measuring and calculating the absorbance values A260 and A280 and the RNA concentration of the RNA solution at the wavelengths of 260nm and 280nm by using a nucleic acid protein quantifier (NanoDrop 1000, Thermo), wherein the purity is in accordance with the requirement when the ratio of A260 to A280 is more than or equal to 1.8 and is less than or equal to 2.0. Based on the measured concentration, all RNAs were diluted with RNase-free water to a final concentration of 1. mu.g/. mu.l.
3. Carrying out a reverse transcription reaction
(1) System configuration: make itBy Vazyme Ltd
Figure BDA0002861814780000051
II Q Select RT Supermix for qPCR reaction solution, and the reaction components are prepared as follows:
Figure BDA0002861814780000052
(2) placing the reaction tube added with the reaction system in a PCR instrument for RT-PCR, wherein the reaction procedure is as follows:
Figure BDA0002861814780000053
3. reaction of fluorescent quantitative PCR
(1) System configuration: preparing a reaction system of real-time fluorescent quantitative PCR, which comprises the following components:
Figure BDA0002861814780000054
the reaction procedure of the fluorescent quantitative PCR is as follows:
Figure BDA0002861814780000061
5. selecting instrument detection channels: the fluorescence detection channel is selected to be consistent with the reporter fluorophore labeled by the probe, and is set according to the instruction of the instrument.
6. And (3) data analysis: after the program is run, the instrument automatically gives the Ct value.
Third, interpretation of results
When the Ct value is more than or equal to 38, the judgment is negative, and when the Ct value is less than 38, the judgment is positive. If the sample to be detected contains virus, a positive amplification curve is displayed, if the sample to be detected does not contain virus, a negative amplification curve is displayed, namely no amplification signal exists,
EXAMPLE 3 detection of Positive samples
First, experiment method
The kit of example 2 was used to detect aedes albopictus infected with zika virus. Simultaneously, a virus titer Titration (TCID) was performed50/ml)，TCID50That is, the tissue cell culture half of the infectious dose is 1TCID50Viral load per ml infected Aedes albopictus. The test was performed using the kit of example 2 using 1 aedes albopictus infected with zika virus as a test sample.
Second, experimental results
The detection results are shown in FIG. 1, and only one amplification curve indicates that the primers and the probes have good specificity.
Example 4 evaluation of sensitivity
First, experiment method
Zika viruses were detected at different concentrations using the kit of example 2, and virus titer Titration (TCID) was performed on the Zika viruses50/ml)，TCID50I.e., half the infectious dose of the tissue cell culture. Viral reference strains were diluted 10-fold to 10-2、 10-1、100、101、102、103TCID50/ml was used for 6 sets of dilutions and each dilution was tested using the kit of example 2.
Second, experimental results
The results showed that the minimum detection limit of the virus reached 0.1TCID50This shows that the real-time fluorescent quantitative PCR method of the kit of example 2 has good sensitivity.
Example 5 stability analysis
First, experiment method
Zika virus was detected using the kit of example 2, and virus titer Titration (TCID) was performed on Zika virus50/ml)，TCID50I.e., half the infectious dose of the tissue cell culture. Viral reference strains were diluted 10-fold to 10-2、10-1、100、101、 102、103TCID50/ml for 6 sets of dilutions, and 6 dilutions were taken simultaneously (10)-2、10-1、100、101、102、103TCID50/ml) were run in parallel with 4 replicates per sample.
Second, experimental results
The results show that the CT value variation coefficient obtained by 4 detections of each dilution sample is below 0.8%, which shows that the real-time fluorescence quantitative PCR method of the kit of example 2 has good stability.
Each embodiment is a complete technical solution.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> Zhongshan university
<120> primers and probes for detecting Zika virus
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccgctgccca acacaag 17
<210> 2
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccactaacgt tcttttgcag acat 24
<210> 3
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agcctacctt gacaagcagt cagacactca a 31

Claims (10)

1. A group of primers for detecting Zika virus is characterized in that the nucleotide sequence of the primers is shown as SEQ ID NO: 1 to 2.
2. A group of probes for detecting Zika virus, which is characterized in that the nucleotide sequence is shown as SEQ ID NO: 3, respectively.
3. The probe according to claim 2, wherein the probe is labeled with a fluorophore FAM at the 5 'end and a fluorophore BHQ1 at the 3' end.
4. Use of the primer according to claim 1 and/or the probe according to claim 2 for preparing a Zika virus detection kit.
5. A Zika virus detection kit comprising the primer according to claim 1 and/or the probe according to claim 2.
6. The Zika virus detection kit according to claim 5, comprising the primer according to claim 1 and the probe according to claim 2.
7. The Zika virus detection kit according to claim 5, further comprising reagents for reverse transcription reaction and/or reagents for fluorescent quantitative PCR.
8. The Zika virus detection kit according to claim 5, wherein the reagent for fluorescent quantitative PCR is Vazyme 2 x AceQ Mix.
9. The Zika virus detection kit according to claim 5,the system of the fluorescent quantitative PCR comprises: 10. mu.l of Vazyme 2 XaceQ Mix, 1. mu.l of each of the primers of claim 1, 1. mu.l of the probe of claim 2, ddH2O 5μl，cDNA 2μl。
10. The Zika virus detection kit according to claim 5, wherein the reaction program of the fluorescent quantitative PCR is 95 ℃ for 10 min; 95 ℃, 15s, 55 ℃, 60s, 45 cycles and constant temperature of 16 ℃.
CN202011568702.1A 2020-12-25 2020-12-25 Primer and probe for detecting Zika virus Pending CN112593010A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011568702.1A CN112593010A (en) 2020-12-25 2020-12-25 Primer and probe for detecting Zika virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011568702.1A CN112593010A (en) 2020-12-25 2020-12-25 Primer and probe for detecting Zika virus

Publications (1)

Publication Number Publication Date
CN112593010A true CN112593010A (en) 2021-04-02

Family

ID=75202377

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011568702.1A Pending CN112593010A (en) 2020-12-25 2020-12-25 Primer and probe for detecting Zika virus

Country Status (1)

Country Link
CN (1) CN112593010A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507753A (en) * 2022-02-16 2022-05-17 赵俊 Detection kit for entomophilous infectious disease pathogens and application

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106754900A (en) * 2016-11-30 2017-05-31 博奥生物集团有限公司 A kind of nucleic acid encapsulates reagent and its application
CN107987136A (en) * 2017-12-13 2018-05-04 清华大学 ZIKV-NS1 albumen and its application in zika virus transmission_blocking vaccine is prepared
US20190160028A1 (en) * 2016-06-23 2019-05-30 Health Research, Inc. Pharmaceutical compositions with antiflaviviral activity
US20190167670A1 (en) * 2017-10-31 2019-06-06 Nutech Ventures Methods of treating or preventing zika virus infection
WO2019152603A1 (en) * 2018-01-31 2019-08-08 The Wistar Institute Of Anatomy And Biology Nucleic acid antibody constructs for use against zika virus
CN110381993A (en) * 2017-02-14 2019-10-25 得克萨斯大学体系董事会 Attenuation zika virus living with 3 ' UTR missing, vaccine containing the virus and application thereof
CN110693907A (en) * 2019-11-07 2020-01-17 南通大学 Application of regulatory T cells in preparation of medicine for treating or preventing poor pregnancy caused by Zika virus infection

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20190160028A1 (en) * 2016-06-23 2019-05-30 Health Research, Inc. Pharmaceutical compositions with antiflaviviral activity
CN106754900A (en) * 2016-11-30 2017-05-31 博奥生物集团有限公司 A kind of nucleic acid encapsulates reagent and its application
CN110381993A (en) * 2017-02-14 2019-10-25 得克萨斯大学体系董事会 Attenuation zika virus living with 3 ' UTR missing, vaccine containing the virus and application thereof
US20190167670A1 (en) * 2017-10-31 2019-06-06 Nutech Ventures Methods of treating or preventing zika virus infection
CN107987136A (en) * 2017-12-13 2018-05-04 清华大学 ZIKV-NS1 albumen and its application in zika virus transmission_blocking vaccine is prepared
WO2019152603A1 (en) * 2018-01-31 2019-08-08 The Wistar Institute Of Anatomy And Biology Nucleic acid antibody constructs for use against zika virus
CN110693907A (en) * 2019-11-07 2020-01-17 南通大学 Application of regulatory T cells in preparation of medicine for treating or preventing poor pregnancy caused by Zika virus infection

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CARLOS FERNANDO ODIR RODRIGUES MELO ET AL.: "A Machine Learning Application Based in Random Forest for Integrating Mass Spectrometry-Based Metabolomic Data: A Simple Screening Method for Patients With Zika Virus", 《FRONTIERS IN BIOENGINEERING AND BIOTECHNOLOGY》 *
CONCEPCION GRAJALES-MUNIZ ET AL.: "Zika virus: Epidemiological surveillance of the Mexican Institute of Social Security", 《PLOS ONE》 *
RIANNE N. ESQUIVEL ET AL.: "In Vivo Delivery of a DNA-Encoded Monoclonal Antibody Protects Non-human Primates against Zika Virus", 《MOLECULAR THERAPY》 *
ROBERT S. LANCIOTTI ET AL.: "Genetic and Serologic Properties of Zika Virus Associated with an Epidemic, Yap State,Micronesia, 2007", 《EMERGING INFECTIOUS DISEASES》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114507753A (en) * 2022-02-16 2022-05-17 赵俊 Detection kit for entomophilous infectious disease pathogens and application

Similar Documents

Publication Publication Date Title
CN106367533B (en) For detecting the nucleic acid, real-time fluorescence RPA kit and method of zika virus
CN108330210B (en) Zika virus, dengue virus and chikungunya virus nucleic acid detection kit and application thereof
CN110305985B (en) Method for detecting Zika virus, chikungunya virus and Mayaro virus by utilizing triple real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction)
CN107151711B (en) Dual fluorescent quantitative RT-PCR kit for detecting dengue virus and Zika virus
CN105838713A (en) Method for detecting fluorogenic quantitative PCR of Zika virus, primers and kit
CN106244726A (en) A kind of zika virus loop-mediated isothermal amplification detection kit and using method
Wen et al. Complete genome characterization of the 2017 dengue outbreak in Xishuangbanna, a Border City of China, Burma and Laos
CN105936946A (en) One step method inverse transcription PCR kit for detecting and differentiating Zika viruses and detection method thereof
CN108265126A (en) The foundation of 3 type of pig circular ring virus and porcine circovirus 2 type duplex PCR detection method
Magalhaes et al. Induction of RNA interference to block Zika virus replication and transmission in the mosquito Aedes aegypti
CN108950086A (en) Primed probe group and detection kit based on RAA Fluorometric assay west nile virus
Li et al. Characterization of full-length hepatitis C virus sequences for subtypes 1e, 1h and 1l, and a novel variant revealed Cameroon as an area in origin for genotype 1
KR100942388B1 (en) A primer set, internal control rna and rt-pcr kit using said primer set and internal control rna and pcr method using said rt-pcr kit thereby
CN109182600A (en) It is a kind of it is synchronous detection hepatitis type B virus, Hepatitis C Virus, human immunodeficiency virus type 1 PCR kit for fluorescence quantitative
CN112899397A (en) Primer and probe for detecting dengue virus
CN112593010A (en) Primer and probe for detecting Zika virus
CN107164558A (en) A kind of recombinase normal temperature amplification of nucleic acid of Japanese Type-B encephalitis（RT‑RPA）ELISA test strip kit and application
CN102154519A (en) General TaqMan real-time fluorescent quantitative polymerase chain reaction (PCR) detection kit for dengue virus
CN109457054A (en) LAMP detection primer and its application, the detection reagent and method of specific detection porcine pseudorabies virus
CN110066889B (en) GeXP rapid detection primer group for simultaneously detecting four yellow fever viruses, kit and application thereof
CN109897914B (en) Primer for simultaneously detecting YFV, RVFV, WNV and DENV four viruses and detection method thereof
CN109609697A (en) A kind of primer, probe and detection kit quickly detecting ERC group virus based on RAA fluorescence method
Tang et al. Comparison of four molecular assays for the detection of Tembusu virus
CN112626278B (en) Primer and probe for identifying canine distemper virus wild strain and vaccine strain and application
CN109182596A (en) A kind of the reverse transcription polymerase spiral response isothermal detection reagent and detection method of Porcine epidemic diarrhea virus

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20210402

RJ01 Rejection of invention patent application after publication