CN112899397A

CN112899397A - Primer and probe for detecting dengue virus

Info

Publication number: CN112899397A
Application number: CN202011568700.2A
Authority: CN
Inventors: 黎孟枫; 李隽�; 朱勋; 何振健; 吴珏珩; 谭姹辉; 陈德林; 林翠姬; 谭泳谣; 曹开源; 袁洁; 蔡俊超
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2020-12-25
Filing date: 2020-12-25
Publication date: 2021-06-04

Abstract

The invention discloses a group of primers and probes for detecting dengue virus. The invention establishes a single-tube fluorescent PCR (polymerase chain reaction) and simultaneously detects 4 types of dengue viruses, and can be used for detecting clinical specimens. The invention combines multiple PCR and Tagman fluorescent probe technology, simultaneously detects a plurality of pathogens which are possibly caused in one detection process, achieves the purposes of rapid diagnosis and treatment guidance, overcomes the limitation of conventional PCR, solves the bottleneck problem of clinical detection flux, shortens the working time, reduces the consumption of raw materials, has stronger sensitivity and specificity, effectively solves the problems of PCR pollution and the like, and has the characteristics of higher automation degree and the like. The fluorescent probe quantitative PCR detection technology ingeniously utilizes the advantages of the PCR technology, such as high-efficiency DNA amplification, high specificity of the probe technology, sensitivity of the spectrum technology and quantitative analysis. Meanwhile, the defects of easy pollution, high false positive rate and incapability of quantification in the traditional PCR technology are overcome.

Description

Primer and probe for detecting dengue virus

Technical Field

The invention relates to the technical field of virus detection, in particular to a group of primers and probes for detecting dengue virus.

Background

Dengue virus (DENV) is a single-stranded positive-strand RNA virus of the flavivirus genus, approximately 11kb in length, and is classified into four serotypes, i, ii, iii and iv, depending on the antigenicity of the E protein. The dengue virus uses Aedes aegypti and Aedes albopictus as transmission vectors, the Aedes aegypti is an insect belonging to the genus Aedes of the subfamily Culex subfamily of the family Culex, and the mosquito belonging to the genus Aedes is commonly called the Aedes aegypti. Aedes is a medium and small black mosquito species with silvery white stripes. The median white longitudinal striation is arranged on the middle thoracic shield, and the anterior part of the small shield which extends backwards from the front end to reach the level of the wing base is bifurcated. There are white rings on 1-4 posttarsal nodes and white rings on the last nodes. The back of the abdomen has 2-6 sections with leucorrhea. Dengue Fever (DF), Dengue Hemorrhagic Fever (DHF) and Dengue Shock Syndrome (DSS) can be caused by infection with dengue virus. Among them, dengue fever is the most common and acute infectious disease caused by dengue virus, and is characterized by rapid transmission and high incidence. Severe dengue DHF/DSS, however, is one of the ten major causes of death in children in south east asian countries with high fever, severe hemorrhage, shock and high mortality as the major clinical manifestations. Dengue is widely popularized in tropical zone and subtropical zone, and is an infectious disease with the widest distribution, the most morbidity and great harm. A recent study published in the Nature journal showed that about 3.9 billion dengue virus infectors worldwide each year, 3 times more than the WHO original statistics. At the same time, the report also indicates that asia accounts for about 70% of 0.9 million infected persons with significant symptoms worldwide. Dengue fever in China mainly occurs in the delta area of the Zhujiang river and continuously spreads to the north, and the pandemic of thousands to hundreds of thousands of people occurs once. 26 provinces (prefecture city, autonomous region) such as Guangdong, Fujian, Guangxi and the like in China in 2014 have multi-point dengue fever outbreak epidemic, and the number of cases is the highest level of history since the dengue fever was reported in 1989 by inclusion law as infectious disease class B. Of particular concern are 46000 cumulative cases of dengue outbreaks in Guangdong province, hundreds of severe cases, and 6 cases of death. Among the four serotypes of dengue virus, the existence of distinct genotypes has been identified, suggesting a wide genetic variation of the dengue serotypes. Among these, "Asian" genotypes of DENV-2 and DENV-3 are often associated with severe disease with secondary dengue infections. In addition, severe diseases such as antibody-dependent enhanced reaction (ADE) are easily caused after infection of different serotypes of the dengue virus, so that typing of the dengue virus plays an important role in effectively and differentially diagnosing infection of the dengue virus of different serotypes, developing monoclonal antibodies aiming at specific serotypes, clarifying antiviral mechanisms of the monoclonal antibodies and developing novel vaccines.

The traditional separation culture and serological detection methods are time-consuming and tedious, so that the detection is not timely and the sensitivity is not enough, and therefore, a new technology for quickly and correctly detecting is urgently required to be developed to screen suspicious cases, control epidemic spread and timely give symptomatic treatment. The intervention of molecular biological detection means makes this need possible. The real-time fluorescent quantitative PCR has the advantages of rapid detection, pollution reduction, accurate quantification, high sensitivity and strong specificity, the multiple quantitative PCR can simultaneously detect a plurality of viruses, the combined multiple real-time quantitative PCR integrates the advantages of the two, and the cost is reduced because the use amount of enzyme and fluorescent dye or probe is reduced.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide a group of primers and probes for detecting dengue viruses.

The first purpose of the invention is to provide a group of primers for detecting dengue virus.

The second purpose of the invention is to provide a group of probes for detecting dengue virus.

The third purpose of the invention is to provide the application of one or more of the primers and/or one or more of the probes in the preparation of a dengue virus detection kit.

The fourth purpose of the invention is to provide a dengue virus detection kit.

In order to achieve the purpose, the invention is realized by the following scheme:

the invention uses a pair of specific primers and probes of the nucleic acid sequence of the virus pathogen to be detected to carry out reverse transcription and real-time fluorescence quantitative PCR reaction, and realizes the amplification of the target nucleic acid sequence fragment by the PCR technology. The probe is oligonucleotide with two ends respectively marked with a fluorescence reporter group and a fluorescence quenching group. When the probe is complete, the fluorescence emitted by the reporter group is absorbed by the quenching group, during the PCR amplification process, the 5' end exonuclease activity of the DNA polymerase enzyme degrades the fluorescent probe specifically combined on the target nucleotide fragment, so that the fluorescent signal of the reporter group can be detected, the change of the fluorescent signal quantity is in direct proportion to the quantity of the amplification product, and the existence of the target nucleotide sequence in the sample to be detected can be judged through the fluorescence intensity.

The invention claims a group of primers for detecting dengue virus, and the nucleotide sequence of the primers is shown as SEQ ID NO: 1 to 8.

The nucleotide sequence of the upstream primer for detecting and identifying dengue virus type 1 (DENV1) is shown as SEQ ID NO: 1, and the following components: CAAAAGGAAGTCGYGCAATA

The nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 1 (DENV1) is shown as SEQ ID NO: 2, as shown in the figure: CTGAGTGAATTCTCTCTGCTRAAC, respectively;

the nucleotide sequence of the upstream primer for detecting and identifying dengue virus type 2 (DENV2) is shown as SEQ ID NO: 3, showing: CAGGCTATGGCACYGTCACGAT the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 2 (DENV2) is shown as SEQ ID NO: 4, and (2) is as follows: CCATYTGCAGCARCACCATCTC, respectively;

the nucleotide sequence of the upstream primer for detecting and identifying the dengue virus type 3 (DENV3) is shown as SEQ ID NO: and 5, as follows: GGACTRGACACACGCACCCA the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying the dengue virus type 3 (DENV3) is shown as SEQ ID NO: 6, showing: CATGTCTCTACCTTCTCGACTTGYCT, respectively;

the nucleotide sequence of the upstream primer for detecting and identifying dengue virus type 4 (DENV4) is shown as SEQ ID NO: 7, and: TTGTCCTAATGATGCTRGTCG the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 4 (DENV4) is shown as SEQ ID NO: 8, showing: TCCACCYGAGACTCCTTCCA are provided.

In the invention, when a primer is designed, different gene segments are respectively selected from four serotypes to design the primer and the probe, the DENV-1 is specific to NS5 gene, the DENV-2 is specific to E gene, the DENV-3 is specific to prM gene, and the DENV-4 is specific to prM and E gene, so that the design method is more stable and specific in typing identification.

Also claimed is a set of probes for detecting dengue virus, the nucleotide sequence of which is as shown in SEQ ID NO: 9 to 12.

Preferably, each of the probes is labeled with a different fluorescent labeling group at the 5 'end and the 3' end.

More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 9, wherein the 5 'end of the probe is labeled with a fluorescent labeling group FAM, and the 3' end of the probe is labeled with a fluorescent labeling group BHQ 1.

More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 10, wherein the 5 'end of the probe is labeled with a fluorescent labeling group ROX, and the 3' end of the probe is labeled with a fluorescent labeling group BHQ 2.

More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 11, the 5 'end of the probe is labeled with a fluorescent labeling group Cy5, and the 3' end is labeled with a fluorescent labeling group BHQ 3.

More preferably, the nucleotide sequence is as set forth in SEQ ID NO: 12, wherein a fluorescent labeling group HEX is labeled at the 5 'end and a fluorescent labeling group MGB is labeled at the 3' end.

The nucleotide sequence of the probe for detecting and identifying dengue virus type 1 (DENV1) is shown in SEQ ID NO: 9, wherein the 5 'end of the compound is marked with a fluorescence labeling group FAM, and the 3' end of the compound is marked with a fluorescence labeling group BHQ 1: CATGTGGYTGGGAGCRCGC, respectively;

the nucleotide sequence of the probe for detecting and identifying dengue virus type 2 (DENV2) is shown in SEQ ID NO: 10, wherein the 5 'end of the compound is marked with a fluorescent marker group ROX, and the 3' end of the compound is marked with a fluorescent marker group BHQ 2: CTCYCCRAGAACGGGCCTCGACTTCAA, respectively;

the nucleotide sequence of the probe for detecting and identifying dengue virus type 3 (DENV3) is shown in SEQ ID NO: 11, the 5 'end of the fluorescent substance is marked with a fluorescent labeling group Cy5, and the 3' end of the fluorescent substance is marked with a fluorescent labeling group BHQ 3: ACCTGGATGTCGGCTGAAGGAGCTTG, respectively;

the nucleotide sequence of the probe for detecting and identifying dengue virus type 4 (DENV4) is shown in SEQ ID NO: 12, wherein the 5 'end of the fluorescent probe is marked with a fluorescent marker group HEX, and the 3' end of the fluorescent probe is marked with a fluorescent marker group MGB: TYCCTACYCCTACGCATCGCATTCCG are provided.

The application of one or more of the primers and/or one or more of the probes in the preparation of a dengue virus detection kit also belongs to the protection scope of the invention.

The invention also claims a dengue virus detection kit, which comprises one or more primers and/or one or more probes.

Preferably, the primer of claim 1 and the probe of claim 2 are included.

More preferably, the kit further comprises a reagent for reverse transcription reaction and/or a reagent for fluorescent quantitative PCR.

More preferably, the reagent for fluorescent quantitative PCR is Vazyme 2 × AceQ Mix.

More preferably, the system of the fluorescent quantitative PCR is as follows: vazyme 2 × AceQ Mix: 10. mu.l, 0.25. mu.l each of the primers and probe, cDNA: 2 μ l, ddH₂O: 5 μ l, 20 μ l overall.

More preferably, the reaction procedure of the fluorescent quantitative PCR is 95 ℃ for 10 min; 95 ℃, 10s, 55 ℃, 60s, 45 cycles and constant temperature of 16 ℃.

Most preferably, the invention claims a dengue virus detection kit comprising a nucleotide sequence as set forth in SEQ ID NO: 1 to 8, and the nucleotide sequence is shown as SEQ ID NO: 9 to 12, reagents for reverse transcription: (

II Q Select RT Supermix for qPCR: ) Fluorescent quantitative PCR reagent (Vazyme 2 × AceQ Mix)

Specifically, the primers and probes include:

the nucleotide sequence of the upstream primer for detecting and identifying dengue virus type 1 (DENV1) is shown as SEQ ID NO: 1, and the following components: CAAAAGGAAGTCGYGCAATA the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 1 (DENV1) is shown as SEQ ID NO: 2, as shown in the figure: CTGAGTGAATTCTCTCTGCTRAAC the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 2 (DENV2) is shown as SEQ ID NO: 4, and (2) is as follows: CCATYTGCAGCARCACCATCTC the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying the dengue virus type 3 (DENV3) is shown as SEQ ID NO: 6, showing: CATGTCTCTACCTTCTCGACTTGYCT the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer for detecting and identifying dengue virus type 4 (DENV4) is shown as SEQ ID NO: 8, showing: TCCACCYGAGACTCCTTCCA the flow of the air in the air conditioner,

the nucleotide sequence of the probe for detecting and identifying dengue virus type 4 (DENV4) is shown in SEQ ID NO: 12, wherein the 5 'end of the fluorescent probe is marked with a fluorescent marker group HEX, and the 3' end of the fluorescent probe is marked with a fluorescent marker group MGB:

TYCCTACYCCTACGCATCGCATTCCG。

second, use method

1. Extracting RNA of a sample, measuring and calculating the ratio of absorbance values A260 to A280 and the RNA concentration of the sample at wavelengths of 260nm and 280nm, wherein the purity is in accordance with the requirement when the ratio of A260/A280 is more than or equal to 1.8 and less than or equal to 2.0.

2. Carrying out a reverse transcription reaction

(1) System configuration: the Vazyme company was used

II Q Select RT Supermix for qPCR reaction solution, and the reaction components are prepared as follows:

(2) placing the reaction tube added with the reaction system in a PCR instrument for RT-PCR, wherein the reaction procedure is as follows:

3. reaction of fluorescent quantitative PCR

(1) System configuration: preparing a reaction system of real-time fluorescent quantitative PCR, which comprises the following components:

the reaction procedure of the fluorescent quantitative PCR is as follows:

5. selecting instrument detection channels: the fluorescence detection channel is selected to be consistent with the reporter fluorophore labeled by the probe, and is set according to the instruction of the instrument.

6. And (3) data analysis: after the program is run, the instrument automatically gives the Ct value.

Third, interpretation of results

When the Ct value is more than or equal to 38, the judgment is negative; when the Ct value is <38, the test piece is judged to be positive. If the sample to be detected contains virus, a positive amplification curve is displayed, and if the sample to be detected does not contain virus, a negative amplification curve is displayed, namely no amplification signal exists.

The invention combines multiple PCR and Tagman fluorescent probe technology, namely, in one detection process, can simultaneously detect a plurality of pathogens which are possibly caused, and achieves the purposes of rapid diagnosis and treatment guidance, thereby overcoming the limitation of the conventional PCR, solving the bottleneck problem of clinical detection flux, shortening the working time, reducing the consumption of raw materials, having the characteristics of stronger sensitivity and specificity, effectively solving the problems of PCR pollution and the like, having higher automation degree and the like. The fluorescent probe quantitative PCR detection technology ingeniously utilizes the advantages of the PCR technology, such as high-efficiency DNA amplification, high specificity of the probe technology, sensitivity of the spectrum technology and quantitative analysis. Meanwhile, the PCR detection method overcomes the defects of easy pollution, high false positive rate and incapability of quantification of the traditional PCR technology, and is called as the most advanced detection technology at present.

Compared with the prior art, the invention has the following beneficial effects:

1. the detection is rapid in delivery and high in efficiency, and can be used for simultaneously detecting multiple dengue virus serological types and single dengue virus according to the needs.

2. The sensitivity is high, the minimum concentration of the detectable virus is 10-11 pM, and the sensitivity is higher than that of a classical pathogen separation method.

3. Strong specificity, and ensures the specificity of pathogen detection again due to the dual functions of the primer in the amplification process and the probe in the detection process

Drawings

FIG. 1 fluorescence amplification plot of the detection of DENV1 by Real-time PCR using DENV1 type virus specific primers and probes, Ct value is 20.42; and negative control amplification curve.

FIG. 2 fluorescence amplification plot of the detection of DENV2 by Real-time PCR using DENV2 type virus specific primers and probes, Ct value is 19.13; and negative control amplification curve.

FIG. 3 fluorescence amplification plot of the detection of DENV3 by Real-time PCR using DENV3 type virus specific primers and probes, Ct value is 22.31; and negative control amplification curve.

FIG. 4 fluorescence amplification plot of the detection of DENV4 by Real-time PCR using DENV4 type virus specific primers and probes, Ct value is 16.30; and negative control amplification curve.

Detailed Description

The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

EXAMPLE 1 design of primers and probes

First, experiment method

By respectively carrying out alignment analysis on gene sequences of all known dengue viruses, selecting highly conserved segments, and designing a plurality of pairs of primers and probes, wherein the length of the primers is generally about 20 bases.

Analyzing the information of the specific genes of the virus, eliminating primer/primer dimer by using sequence analysis software DNASTAR, verifying the homology of the specificity of the primers and similar pathogens by using BLAST, and designing primers and probes for detecting the pathogens.

Second, experimental results

The optimal primer probe sequence combinations are as follows:

group 1 primers and probes for detection and identification of dengue virus type 1 (DENV1),

the nucleotide sequence of the upstream primer is shown as SEQ ID NO: 1, and the following components: CAAAAGGAAGTCGYGCAATA the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 2, as shown in the figure: CTGAGTGAATTCTCTCTGCTRAAC the flow of the air in the air conditioner,

the nucleotide sequence of the probe is shown as SEQ ID NO: 9, wherein the 5 'end of the compound is marked with a fluorescence labeling group FAM, and the 3' end of the compound is marked with a fluorescence labeling group BHQ 1: CATGTGGYTGGGAGCRCGC, respectively;

group 2 primers and probes for detection and identification of dengue virus type 2 (DENV2),

the nucleotide sequence of the upstream primer is shown as SEQ ID NO: 3, showing: CAGGCTATGGCACYGTCACGAT the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 4, and (2) is as follows: CCATYTGCAGCARCACCATCTC the flow of the air in the air conditioner,

the nucleotide sequence of the probe is shown as SEQ ID NO: 10, wherein the 5 'end of the compound is marked with a fluorescent marker group ROX, and the 3' end of the compound is marked with a fluorescent marker group BHQ 2: CTCYCCRAGAACGGGCCTCGACTTCAA, respectively;

group 3 primers and probes for detection and identification of dengue virus type 3 (DENV3),

the nucleotide sequence of the upstream primer is shown as SEQ ID NO: and 5, as follows: GGACTRGACACACGCACCCA the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 6, showing: CATGTCTCTACCTTCTCGACTTGYCT the flow of the air in the air conditioner,

the nucleotide sequence of the probe is shown as SEQ ID NO: 11, the 5 'end of the fluorescent substance is marked with a fluorescent labeling group Cy5, and the 3' end of the fluorescent substance is marked with a fluorescent labeling group BHQ 3: ACCTGGATGTCGGCTGAAGGAGCTTG, respectively;

group 4 primers and probes for detection and identification of dengue virus type 4 (DENV4),

the nucleotide sequence of the upstream primer is shown as SEQ ID NO: 7, and: TTGTCCTAATGATGCTRGTCG the flow of the air in the air conditioner,

the nucleotide sequence of the downstream primer is shown as SEQ ID NO: 8, showing: TCCACCYGAGACTCCTTCCA the flow of the air in the air conditioner,

the nucleotide sequence of the probe is shown as SEQ ID NO: 12, wherein the 5 'end of the fluorescent probe is marked with a fluorescent marker group HEX, and the 3' end of the fluorescent probe is marked with a fluorescent marker group MGB: TYCCTACYCCTACGCATCGCATTCCG are provided.

Example 2A detection kit for detecting dengue Virus

A, make up

The nucleotide sequence is shown as SEQ ID NO: 1 to 8, and the nucleotide sequence is shown as SEQ ID NO: 9 to 12, reagents for reverse transcription: (

Specifically, the primers and probes include:

Second, use method

1. Extracting RNA from a sample

(1) 200ul of RNAisso Plus or Triziol (the amount used to extract a whole Aedes RNA) was added to a 2ml RNase-free centrifuge tube at 30Hz and homogenized for 30 s. The liquid was transferred to a 1.5ml RNase-free centrifuge tube and allowed to stand for 15 min.

(2) 1/5 volumes (40ul) of chloroform was added to the lysate, the centrifuge tube cap was closed, and the mixture was vortexed and mixed. After the solution is fully emulsified (no phase separation phenomenon), standing for 10min at 4 ℃.

(3) Centrifuge at 12,000g for 10 minutes at 4 ℃.

(4) The centrifuge tube was carefully removed from the centrifuge, and the homogenate was divided into three layers at this time, i.e.: colorless supernatant, intermediate white protein layer and colored lower organic phase. The supernatant (40-70ul) was aspirated and transferred to another new centrifuge tube (without aspirating the white middle layer).

(5) Adding isopropanol 1 time (40ul) in volume into the supernatant, slowly inverting the centrifuge tube from top to bottom, mixing well, and standing at-20 deg.C for 10 min.

(6) Centrifuge at 12,000g for 10 minutes at 4 ℃.

(7) The supernatant was carefully discarded, and 75% ethanol (prepared in RNase-free dH 2O) l ml (without touching the pellet) was slowly added along the wall of the tube, the tube wall was washed gently upside down, and centrifuged at 12,000g at 4 ℃ for 5min, after which the ethanol was carefully discarded.

(8) The mixture was centrifuged at 12,000g and 4 ℃ for 5min, and the remaining liquid was aspirated.

(9) The precipitate was dried at room temperature for 2-5 minutes, and 40. mu.l of RNase-free dH2O was added to dissolve the precipitate (if necessary, it was blown with a gun) and immediately used for the first strand cDNA synthesis.

Taking 2 mul of RNA solution, respectively measuring and calculating the absorbance values A260 and A280 and the RNA concentration of the RNA solution at the wavelengths of 260nm and 280nm by using a nucleic acid protein quantifier (NanoDrop 1000, Thermo), wherein the purity is in accordance with the requirement when the ratio of A260 to A280 is more than or equal to 1.8 and is less than or equal to 2.0. The concentration and purity of each group of RNA are all in accordance with the requirements.

2. Carrying out a reverse transcription reaction

(1) System configuration: the Vazyme company was used

3. reaction of fluorescent quantitative PCR

the reaction procedure of the fluorescent quantitative PCR is as follows:

Third, interpretation of results

EXAMPLE 3 detection of Positive samples

First, experiment method

The kit of example 2 is used for detecting aedes albopictus infected by dengue virus type 1-4 strains, and the strains are provided by the laboratory. At the same time, virus titer titration (TCID50/ml) was carried out, TCID50 represents half of the infectious dose in tissue cell culture, and each group of virus strains infected Aedes albopictus with a virus amount of 1TCID 50/ml.

1 Aedes albopictus infected with dengue virus type 1-4 respectively is used as a sample to be detected, total RNA extraction is carried out, and according to the detected concentration, all RNA is diluted with RNase-free water to a final concentration of 1 mug/mul.

Using the kit of example 2, detection and result judgment were carried out in accordance with the method used in example 2.

Second, experimental results

The results are shown in FIGS. 1 to 4, suggesting that the primers and probes have good specificity.

Example 4 evaluation of sensitivity

First, experiment method

Dengue virus types 1-4 were detected at different concentrations using the kit of example 2. Virus titer titration (TCID50/ml) was performed on dengue virus types 1-4, and TCID50 was the half infectious dose in tissue cell culture. Viral reference strains were diluted 10-fold to 10^-2、10^-1、10⁰、10¹、10²、10³TCID50/ml was used for 6 sets of dilutions and each dilution was tested using the kit of example 2.

Second, experimental results

The minimum detection limit of dengue virus 1-4 respectively reaches 0.17TCID₅₀/ml、0.13TCID₅₀/ml、0.15TCID₅₀/ml、0.14TCID₅₀And/ml, which shows that the established multiplex real-time fluorescent quantitative PCR method has good sensitivity.

Example 5 stability analysis

First, experiment method

Dengue virus types 1-4 were detected using the kit of example 2, and virus titer Titration (TCID) was performed on dengue virus types 1-4₅₀/ml)，TCID₅₀I.e., half the infectious dose of the tissue cell culture. Viral reference strains were diluted 10-fold to 10^-2、10^-1、10⁰、10¹、10²、10³TCID50/ml for 6 sets of dilutions, and 6 dilutions were taken simultaneously (10)^-2、10^-1、10⁰、10¹、10²、10³TCID50/ml) were performed in parallel for detection comparison of single real-time fluorescent quantitative RT-PCR and multiplex real-time fluorescent quantitative RT-PCR reactions, with 4 replicates per sample.

Second, experimental results

The results show that: the CT values of the single real-time fluorescent quantitative RT-PCR of the viruses (dengue virus 1, dengue virus 2, dengue virus 3 and dengue virus 4) in each group are respectively less than 0.6, 0.3, 0.2 and 0.1 on average than the CT values detected by the multiplex real-time fluorescent RT-PCR method. The data show that the multiplex fluorescent RT-PCR method established by the research has better stability, and compared with respective single-multiplex fluorescent RT-PCR methods, the multiplex method has certain interference among primer probes, but has no obvious influence on the result, so that the multiplex method can be used for stably and reliably detecting each group of viruses.

It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Sequence listing

<110> Zhongshan university

<120> set of primers and probes for detecting dengue virus

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

caaaaggaag tcgygcaata 20

<210> 2

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ctgagtgaat tctctctgct raac 24

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caggctatgg cacygtcacg at 22

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ccatytgcag carcaccatc tc 22

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ggactrgaca cacgcaccca 20

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

catgtctcta ccttctcgac ttgyct 26

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttgtcctaat gatgctrgtc g 21

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tccaccygag actccttcca 20

<210> 9

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

catgtggytg ggagcrcgc 19

<210> 10

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcyccraga acgggcctcg acttcaa 27

<210> 11

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acctggatgt cggctgaagg agcttg 26

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tycctacycc tacgcatcgc attccg 26

Claims

1. A group of primers for detecting dengue virus is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1 to 8.

2. A group of probes for detecting dengue viruses is characterized in that the nucleotide sequence is shown as SEQ ID NO: 9 to 12.

3. The probe of claim 2, wherein each of the 5 'and 3' ends of the probe is labeled with a different fluorescent labeling group.

4. Use of one or more of the primers of claim 1 and/or one or more of the probes of claim 2 in the preparation of a dengue virus detection kit.

5. A dengue virus detection kit comprising one or more primers according to claim 1 and/or one or more probes according to claim 2.

6. The dengue virus detection kit of claim 5, which comprises the primer of claim 1 and the probe of claim 2.

7. The dengue virus detection kit of claim 5, further comprising reagents for reverse transcription reaction and/or reagents for fluorescent quantitative PCR.

8. The dengue virus detection kit of claim 5, wherein the reagent for fluorescent quantitative PCR is Vazyme 2 x AceQ Mix.

9. The dengue virus detection kit of claim 5, wherein the fluorescent quantitative PCR system is: vazyme 2 × AceQ Mix: 10. mu.l, 0.25. mu.l each of the primers described in claim 1, 0.25. mu.l each of the probes described in claim 2, cDNA: 2 μ l, ddH₂O: 5 μ l, 20 μ l overall.

10. The dengue virus detection kit according to claim 5, wherein the reaction procedure of the fluorescent quantitative PCR is 95 ℃ for 10 min; 95 ℃, 10s, 55 ℃, 60s, 45 cycles and constant temperature of 16 ℃.