CN112592994A - Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer - Google Patents
Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer Download PDFInfo
- Publication number
- CN112592994A CN112592994A CN202011493578.7A CN202011493578A CN112592994A CN 112592994 A CN112592994 A CN 112592994A CN 202011493578 A CN202011493578 A CN 202011493578A CN 112592994 A CN112592994 A CN 112592994A
- Authority
- CN
- China
- Prior art keywords
- larvae
- cryptocaryon irritans
- quantitative
- quantitative detection
- cryptocaryon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241001663423 Cryptocaryon irritans Species 0.000 title claims abstract description 74
- 238000001514 detection method Methods 0.000 title claims abstract description 48
- 238000003753 real-time PCR Methods 0.000 claims abstract description 28
- 230000003321 amplification Effects 0.000 claims abstract description 12
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 12
- 238000004458 analytical method Methods 0.000 claims abstract description 6
- 239000002773 nucleotide Substances 0.000 claims abstract description 4
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 4
- 238000000034 method Methods 0.000 claims description 17
- 239000003153 chemical reaction reagent Substances 0.000 claims description 6
- 238000004925 denaturation Methods 0.000 claims description 5
- 230000036425 denaturation Effects 0.000 claims description 5
- 238000002844 melting Methods 0.000 claims description 5
- 230000008018 melting Effects 0.000 claims description 5
- 238000004445 quantitative analysis Methods 0.000 claims description 5
- 239000012154 double-distilled water Substances 0.000 claims description 3
- 238000011529 RT qPCR Methods 0.000 claims 2
- 238000003556 assay Methods 0.000 claims 1
- 238000012207 quantitative assay Methods 0.000 claims 1
- 239000013535 sea water Substances 0.000 abstract description 22
- 238000009360 aquaculture Methods 0.000 abstract description 8
- 244000144974 aquaculture Species 0.000 abstract description 8
- 239000000203 mixture Substances 0.000 abstract description 6
- 230000002265 prevention Effects 0.000 abstract description 5
- 238000009472 formulation Methods 0.000 abstract description 2
- 241000251468 Actinopterygii Species 0.000 description 14
- 241000238631 Hexapoda Species 0.000 description 11
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 8
- 208000015181 infectious disease Diseases 0.000 description 6
- 239000007788 liquid Substances 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 230000001418 larval effect Effects 0.000 description 5
- 238000002156 mixing Methods 0.000 description 5
- 208000031513 cyst Diseases 0.000 description 4
- 239000012528 membrane Substances 0.000 description 4
- 230000004936 stimulating effect Effects 0.000 description 4
- 238000000967 suction filtration Methods 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 3
- WSFSSNUMVMOOMR-UHFFFAOYSA-N Formaldehyde Chemical compound O=C WSFSSNUMVMOOMR-UHFFFAOYSA-N 0.000 description 3
- 241000519995 Stachys sylvatica Species 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 239000011259 mixed solution Substances 0.000 description 3
- 238000002360 preparation method Methods 0.000 description 3
- 239000013049 sediment Substances 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- 210000003812 trophozoite Anatomy 0.000 description 3
- 241000269335 Ambystoma laterale x Ambystoma jeffersonianum Species 0.000 description 2
- 230000004544 DNA amplification Effects 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 201000010099 disease Diseases 0.000 description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 238000001914 filtration Methods 0.000 description 2
- 239000011521 glass Substances 0.000 description 2
- 238000011534 incubation Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000012544 monitoring process Methods 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000004576 sand Substances 0.000 description 2
- 239000000126 substance Substances 0.000 description 2
- 241001596950 Larimichthys crocea Species 0.000 description 1
- 206010027982 Morphoea Diseases 0.000 description 1
- 238000012339 Real-time fluorescence quantitative polymerase chain reaction Methods 0.000 description 1
- 239000002775 capsule Substances 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 230000006866 deterioration Effects 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000003085 diluting agent Substances 0.000 description 1
- 238000010790 dilution Methods 0.000 description 1
- 239000012895 dilution Substances 0.000 description 1
- 238000009313 farming Methods 0.000 description 1
- 208000010824 fish disease Diseases 0.000 description 1
- 210000002816 gill Anatomy 0.000 description 1
- 230000001900 immune effect Effects 0.000 description 1
- 239000006166 lysate Substances 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 238000009364 mariculture Methods 0.000 description 1
- 150000007523 nucleic acids Chemical class 0.000 description 1
- 102000039446 nucleic acids Human genes 0.000 description 1
- 108020004707 nucleic acids Proteins 0.000 description 1
- 230000010355 oscillation Effects 0.000 description 1
- 244000045947 parasite Species 0.000 description 1
- 230000024241 parasitism Effects 0.000 description 1
- 239000002245 particle Substances 0.000 description 1
- 238000003752 polymerase chain reaction Methods 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 230000003449 preventive effect Effects 0.000 description 1
- 230000000630 rising effect Effects 0.000 description 1
- 238000010008 shearing Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 239000011534 wash buffer Substances 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a quantitative detection primer for cryptocaryon irritans larvae, which has a nucleotide sequence shown as SEQ ID NO: 1-2; also discloses a quantitative detection method of cryptocaryon irritans larvae, which comprises the steps of extracting DNA of the cryptocaryon irritans larvae in a sample; and (3) taking the extracted larva DNA as a template, and carrying out real-time fluorescent quantitative PCR amplification by using the quantitative detection primer to detect the number of the larva in the original sample. The quantitative detection primer and the quantitative detection method are simple to operate and time-saving, can be used for qualitatively detecting the cryptocaryon irritans, can also be used for accurately detecting the number of the cryptocaryon irritans in the aquaculture seawater, and provide a sensitive and reliable analysis means for the time-space distribution and the formulation of prevention and control measures of the cryptocaryon irritans in the aquaculture seawater.
Description
Technical Field
The invention relates to the field of fish disease control, and particularly relates to a quantitative detection primer for cryptocaryon irritans larvae and application thereof.
Background
Cryptocaryon irritans is an ectoparasitosis caused by Cryptocaryon irritans (Cryptocaryon irritans) parasitizing on the body surface of marine sclerostinal fish, and a large number of macroscopic 'small white spots' can be formed on the skin, gills, fin lines and the like of diseased fish, and is commonly called as 'white spot disease'. Cryptocaryon irritans require no intermediate hosts and the entire life cycle includes 4 stages of trophozoites, cystozoites, cysts and larvae, where trophozoites are the stages of parasitism to fish, cystozoites and cysts are the stages of division and reproduction, and larvae are the stages of infection. With the rising of the culture yield of marine fishes, the increase of the culture density, the deterioration of the culture environment and the increasing of the cryptocaryon irritans, the damage of cryptocaryon irritans is more and more serious, and the great economic loss is caused to the marine fishery.
At present, a large amount of research works on the prevention and treatment of cryptocaryon irritans are carried out by scholars at home and abroad, and the research works comprise three aspects of physical, chemical and immunological prevention and treatment. These methods work well in a relatively closed environment such as factory farming, aquariums, etc., but they are difficult or not very effective in an open system such as natural mariculture. Furthermore, given their potential for negative effects on fish, humans, other organisms and the natural environment (especially using chemical methods), it is important to find a means of preventing this disease.
The size of the larvae of the cryptocaryon irritans is about (20 multiplied by 50-30 multiplied by 70 mu m), and the larvae cannot be observed in seawater of natural aquaculture; the capsules (94.5X 170-252X 441 μm) are also difficult to distinguish from other particles in the bottom sediment; the trophozoite appears as white spots (34X 66-360X 452 mu m) on the host fish and can be identified by naked eyes, however, once the white spots appear, the disease is usually difficult to cure. Therefore, it is imperative to reveal the distribution and abundance of parasites in the natural environment and thus to make effective preventive measures. Patent CN102443652A discloses an LAMP detection kit and a detection method for cryptocaryon irritans in large yellow croakers, and patent CN110999825A discloses a method for determining the infection rate of cryptocaryon irritans to fish bodies, but both methods are not directed to the detection of cryptocaryon irritans larvae in seawater, and are only directed to the detection of the infection rate of cryptocaryon irritans in fish bodies, but cannot perform early monitoring on the cryptocaryon irritans larvae in cultured seawater, thereby effectively controlling the early infection risk of cryptocaryon irritans. At present, a method for accurately and quantitatively detecting or calculating the cryptocaryon irritans larvae in the water body does not exist.
Disclosure of Invention
The invention aims to solve the problem that the number of cryptocaryon irritans larvae in seawater is difficult to accurately determine in the prior art, and provides a quantitative detection primer and a quantitative detection method for the cryptocaryon irritans larvae.
The first purpose of the invention is to provide a quantitative detection primer for cryptocaryon irritans larvae.
The second purpose of the invention is to provide the application of the quantitative detection primer in the detection of the cryptocaryon irritans larvae or the preparation of the detection kit for the cryptocaryon irritans larvae.
The third purpose of the invention is to provide a detection kit for the larvae of the cryptocaryon irritans.
The fourth purpose of the invention is to provide a quantitative detection method for cryptocaryon irritans larvae.
In order to achieve the purpose, the invention is realized by the following scheme:
a quantitative detection primer for stimulating cryptocaryon irritans larvae has a nucleotide sequence shown as SEQ ID NO: 1-2;
SEQ ID NO.1：ACGATGAAGAACGCAGCGAA；
SEQ ID NO.2：TATCCCCTCGGCGCAATTT。
the invention further claims the application of the primers in the detection of the larvae of the cryptocaryon irritans or the preparation of a detection kit for the larvae of the cryptocaryon irritans.
Preferably, the detection is a quantitative detection.
The invention also claims a detection kit for the cryptocaryon irritans larvae, which comprises the quantitative detection primer.
Preferably, PCR reaction reagents are also included.
Preferably, the PCR reaction reagents include qPCR premix, DNA template and ddH2O。
More preferably, the reaction system of the detection kit and the PCR is as follows: the qPCR solution is 5 mu L, 10 mu M of two primers with the sequences shown in SEQ ID NO. 1-2 are 0.4 mu L respectively, the DNA template is 2.0 mu L, the ddH2O2.2 mu L, and the total amount is 10 mu L.
Preferably, the PCR amplification procedure of the detection kit is as follows: denaturation at 95 ℃ for 30 s; quantitative analysis: 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; melting: keeping the temperature at 95 ℃ for 5s, 60 ℃ for 1min and 95 ℃; the temperature is reduced by 50 ℃ for 30 s.
Most preferably, the detection kit for stimulating the larvae of the cryptocaryon irritans comprises the quantitative detection primers, the qPCR premixed solution, the DNA template and the ddH2O。
The invention also claims a quantitative detection method of cryptocaryon irritans larvae, which comprises the following steps:
s1, extracting DNA of cryptocaryon irritans larvae in a sample;
s2, using the extracted larva DNA as a template, and utilizing the primer in claim 1 to perform real-time fluorescence quantitative PCR amplification to detect the number of the larva in the original sample.
Preferably, the reaction system of the fluorescent quantitative PCR is as follows: the qPCR premix solution is 5 mu L, 10 mu M of two primers with the sequences shown in SEQ ID NO. 1-2 are 0.4 mu L respectively, the DNA template is 2.0 mu L, the ddH2O2.2 is 2.2 mu L, and the total amount is 10 mu L.
Preferably, the amplification procedure of the fluorescent quantitative PCR is: denaturation at 95 ℃ for 30 s; quantitative analysis: 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; melting: keeping the temperature at 95 ℃ for 5s, 60 ℃ for 1min and 95 ℃; the temperature is reduced by 50 ℃ for 30 s.
Preferably, the CT value of the amplified fluorescence threshold cycle number of each known larva concentration is measured by fluorescence quantitative PCR, and linear analysis is carried out according to the corresponding relation between the known logarithmic log of the added larva number and the CT value, and R is used2Evaluating the fitting degree of the curve to draw a standard curve; comparing with standard curve, obtaining logarithm of number of larvae of Cryptocaryon irritans in the sample according to CT value of larvae of Cryptocaryon irritans in the sample, and substituting into the established logarithmThe number of larvae of Cryptocaryon irritans in the sample was calculated using a standard curve.
More preferably, the linear relationship between the logarithm of the number of larvae added and the CT value is known, with the linear equation y-2.8826 x +24.395 and R2 0.9969.
More preferably, the number of larvae of Cryptocaryon irritans used to obtain the standard curve is 20, 50, 100, 250, 500, 1000, respectively.
Compared with the prior art, the invention has the following technical effects:
according to the method, the CT value of the amplified fluorescence threshold cycle number of each known larva concentration is measured by stimulating the quantitative detection primer of the cryptocaryon irritans larva through fluorescence quantitative PCR, a standard curve is drawn according to the linear relation between the logarithm log of the number of the added larvae and the CT value, and the linear equation between the logarithm log of the number of the added larvae and the CT value is that the larvae and the CT value are in good linear relation within the range of 20-1000 larvae. The number of larvae actually contained in the unknown water sample can be accurately and rapidly calculated by utilizing the linear relation, and the method can be effectively used for detecting the number of larvae of the cryptocaryon irritans in the sea area and evaluating risks, so that effective prevention and control measures can be made as early as possible. The quantitative detection method of the quantitative detection primer is simple to operate and time-saving, can be used for qualitatively detecting the cryptocaryon irritans, can accurately detect the number of the cryptocaryon irritans in the aquaculture seawater, and can be used for early-stage monitoring of the cryptocaryon irritans in the aquaculture seawater, so that the early-stage infection risk of the cryptocaryon irritans can be effectively controlled, and sensitive and reliable analysis means are provided for the time-space distribution and the prevention and control measure formulation of the cryptocaryon irritans in the aquaculture seawater.
Drawings
FIG. 1 is a standard curve between the log of the number of larvae of Cryptocaryon irritans and the number of fluorescence threshold cycles for larval 18S r DNA amplification (CT values).
Detailed Description
The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
Example 1 mapping of a Standard Curve for stimulating Cryptocaryon irritans larvae
1. Preparation of concentrated larval product
(1) Larva incubation: collecting white cysts dropped from the body surface of the diseased fish, placing a small amount of cysts in a 12-hole plate, and placing in a thermostat at 28 ℃ until larvae are hatched.
(2) Counting larvae: adding a certain amount of hatched insects into a 50mL EP tube, repeatedly reversing and uniformly mixing, taking 10 mu l of uniformly mixed insect liquid to a glass slide, adding 1ul of formaldehyde into each insect liquid to fix the insects, placing the glass slide under a microscope for observation, counting the insects in each insect liquid, and calculating the average value. This operation was repeated three times.
(3) Larva dilution: and (3) calculating the quantity of insects per milliliter, uniformly mixing 20mL of the counted insect liquid in 1L of seawater, diluting the insect liquid by 20 times, and then respectively taking the volumes corresponding to the insect liquid numbers of 20, 50, 100, 250, 500 and 1000 to perform the next suction filtration process.
(4) And (3) filtering larvae by suction: adding the diluent corresponding to the known number of the worms into a beaker filled with 1L of seawater respectively, slightly shaking up, performing suction filtration on a suction filtration pump, filtering the worms to a 5-micron microporous filter membrane, folding the filter membrane after suction filtration for 2 times, and then shearing the filter membrane into a 15mL centrifuge tube by using scissors. Samples of each insect concentration were replicated 3 times.
2. Extraction of DNA from larvae
(1) Adding 3mL of larva nucleic acid lysate into a centrifuge tube with a cut filter membrane, carrying out vortex oscillation for 5min, and then placing the mixture in a 58 ℃ water bath for incubation for 15 min.
(2) Centrifuging the sample at 4 ℃ for 10min at 4000g, taking the supernatant, adding pre-cooled isopropanol with the volume of 0.7 times of that of the supernatant, turning the mixture upside down, mixing the mixture uniformly, and centrifuging the mixture.
(3) Centrifuging, removing supernatant, adding 400 μ L sterile enzyme-free water into the precipitate, shaking, mixing, and incubating in 65 deg.C water bath for 10 min.
(4) Transferring the mixed solution into a centrifuge tube filled with 200 mu L of absolute ethyl alcohol to obtain a sterile enzyme-free water/sediment/absolute ethyl alcohol mixed solution, and uniformly mixing for 20s by vortex.
(5) Adding about 600 mu l of sterile enzyme-free water/sediment/absolute ethyl alcohol mixed solution into a centrifugal column, centrifuging for 1min at 13000g, discarding the centrifugate, adding 750uL of DNA wash buffer into the column, centrifuging for 1min at 13000g, discarding the centrifugate, and idling for 2 min; and finally, adding 20 mu L of sterile enzyme-free water, standing for 2min, and centrifuging 13000g for 1min to obtain larva DNA.
3. qPCR amplification
(1) The sequence of the amplification primer is shown as SEQ ID NO: 1-2:
SEQ ID NO：1：ACGATGAAGAACGCAGCGAA；
SEQ ID NO：2：TATCCCCTCGGCGCAATTT。
(2) the amplification conditions for qPCR were: denaturation at 95 ℃ for 30 s; quantitative analysis: 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; melting: keeping the temperature at 95 ℃ for 5s, 60 ℃ for 1min and 95 ℃; the temperature is reduced by 50 ℃ for 30 s.
(3) The qPCR reaction system was as follows:
4. drawing a standard curve
And (3) amplifying a partial sequence of the cryptocaryon irritans larva 18Sr DNA by using the extracted DNA as a template and adopting a real-time fluorescent quantitative polymerase chain reaction (qPCR), obtaining a corresponding relation between the logarithm (lg) of the number of the added larvae and the 18S r DNA amplification fluorescence threshold cycle number (CT value), and drawing a standard curve.
5. Data statistics
The corresponding CT values (mean. + -. standard deviation) obtained by real-time fluorescence quantitative polymerase chain reaction of each larva concentration were counted and subjected to linear analysis using R2The degree of fit of the curve is evaluated.
The statistical and computational results are shown in table 1 and fig. 1:
TABLE 1 corresponding CT values obtained by qPCR for different larval numbers
From the above results, it was found that there is a good linear relationship between logarithm of added larvae and CT value, and the linear equation is-2.8826 x +24.395, R2＝0.9969。
The results show that the logarithm (lg) of the number of the added larvae and the threshold cycle number (CT value) of the fluorescence amplification of the 18S r DNA are in good linear relation in the range of 0-2000 larvae/L seawater. The method is used for calculating the number of cryptocaryon irritans larvae in unknown seawater, and effectively evaluating the infection risk degree of the cryptocaryon irritans on the sea area of the marine fish culture.
Example 2 Cryptocaryon irritans larva quantitative determination kit
A, make up
Consists of a nucleotide sequence shown as SEQ ID NO: 1-2, qPCR premix solution, DNA template and ddH2And (C) O.
Second, use method
1. Extraction of DNA from Cryptocaryon irritans larvae
The extraction of DNA was carried out as in example 1.
2. qPCR detection
(1) The sequence of the amplification primer is as follows:
SEQ ID NO.1：ACGATGAAGAACGCAGCGAA；
SEQ ID NO.2：TATCCCCTCGGCGCAATTT。
(2) the amplification conditions for qPCR were: denaturation at 95 ℃ for 30 s; quantitative analysis: 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; melting: keeping the temperature at 95 ℃ for 5s, 60 ℃ for 1min and 95 ℃; the temperature is reduced by 50 ℃ for 30 s.
(3) The qPCR reaction system was as follows:
3. drawing standard curves and statistics
Measuring the CT value of the amplified fluorescence threshold cycle number of each known larva concentration by fluorescence quantitative PCR, performing linear analysis, and using R2Evaluating the fitting degree of the curve, and drawing a standard curve according to the corresponding relation between the known added larva number log and the CT value; and (4) comparing the standard curve, obtaining the logarithm of the number of the cryptocaryon irritans larvae contained in the sample according to the CT value of the cryptocaryon irritans larvae in the detected sample, and substituting the logarithm into the established standard curve to calculate the number of the cryptocaryon irritans larvae in the sample.
Example 3 concentration and quantitative detection of Cryptocaryon irritans larvae in aquaculture seawater
1. Detection of seawater sample in the seawater fish culture sea area of Dapeng Shenzhen, Guangdong province
(1) Taking seawater samples from the seawater fish culture sea area of Roc in Shenzhen, Guangdong province, taking 1L each time, and adding 20, 100, 500 and 1000 larvae into the seawater fish culture sea area.
(2) CT values were obtained for each larval concentration as in example 1.
(3) And (3) data statistics: and (4) counting corresponding CT values (average value +/-standard deviation) obtained by real-time fluorescent quantitative polymerase chain reaction of each larva concentration, and substituting the CT values into the established standard curve to calculate the number of the larva.
The result shows that the actually added 20, 100, 500 and 1000 larvae can respectively detect 28.76-30.17, 52.77-70.35, 486.20-702.08 and 1021.96-1845.65 larvae by the method, and the error is in a controllable range. The statistical and computational results are shown in table 2:
TABLE 2 corresponding CT values obtained by qPCR of different numbers of larvae in the sea area of marine fish culture
2. Detection of seawater sample in yellow sand aquatic product market in Guangdong province, Guangzhou city
(1) Samples of seawater were taken from the yellow sand aquaculture market in Guangzhou, Guangdong province. 80, 200, 600 and 800 larvae are respectively added into 1L of seawater.
(2) CT values were obtained for each larval concentration as in example 1.
(3) And (3) data statistics: and (4) counting corresponding CT values (average value +/-standard deviation) obtained by real-time fluorescent quantitative polymerase chain reaction of each larva concentration, and substituting the CT values into the established standard curve to calculate the number of the larva.
The result shows that 73.81-90.85, 102.41-391.87, 358.91-526.62 and 510.06-669.22 larvae can be respectively detected by the method, and the error is still in a controllable range. The statistical and computational results are shown in table 3:
each of the above embodiments is a complete technical solution.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> Zhongshan university
<120> quantitative detection primer for cryptocaryon irritans larvae and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
acgatgaaga acgcagcgaa 20
<210> 2
<211> 19
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
tatcccctcg gcgcaattt 19
Claims (10)
1. A quantitative detection primer for cryptocaryon irritans larvae is characterized in that the nucleotide sequence is shown as SEQ ID No. 1-2.
2. Use of the primer of claim 1 for detecting larvae of cryptocaryon irritans or for preparing a test kit for larvae of cryptocaryon irritans.
3. The use of claim 2, wherein the assay is a quantitative assay.
4. A kit for detecting larvae of Cryptocaryon irritans, comprising the quantitative detection primer of claim 1.
5. The Cryptocaryon irritans larva detection kit of claim 4, further comprising reagents for PCR reaction.
6. The Cryptocaryon irritans larva detection kit of claim 5, wherein the reagents for the PCR reaction comprise qPCR premix, DNA template and ddH2O。
7. A quantitative detection method for cryptocaryon irritans larvae is characterized by comprising the following steps:
s1, extracting DNA of cryptocaryon irritans larvae in a sample;
s2, using the extracted larva DNA as a template, and utilizing the primer in claim 1 to perform real-time fluorescence quantitative PCR amplification to detect the number of the larva in the original sample.
8. The method for quantitatively detecting larvae of Cryptocaryon irritans according to claim 7, wherein the reaction system of the fluorescent quantitative PCR is: qPCR premix 5. mu.L, 10. mu.M of two primers with the sequences shown in SEQ ID No. 1-2 of claim 1, each 0.4. mu.L, DNA template 2.0. mu.L, ddH2O2.2. mu.L, 10. mu.L total.
9. The method for the quantitative detection of larvae of Cryptocaryon irritans according to claim 7 or 8, wherein the amplification procedure of the fluorescent quantitative PCR is: denaturation at 95 ℃ for 30 s; quantitative analysis: 5s at 95 ℃, 30s at 60 ℃ and 40 cycles; melting: keeping the temperature at 95 ℃ for 5s, 60 ℃ for 1min and 95 ℃; the temperature is reduced by 50 ℃ for 30 s.
10. The method of claim 9, wherein the PCR-based quantitative PCR is used to determine the CT value of the fluorescence threshold cycle of amplification for each known concentration of larvae, and the linear analysis is performed according to the log of the number of larvae added as known to correspond to the CT value, using R2Evaluating the fitting degree of the curve to draw a standard curve; and (4) comparing the standard curve, obtaining the logarithm of the number of the cryptocaryon irritans larvae contained in the sample according to the CT value of the cryptocaryon irritans larvae in the detected sample, and substituting the logarithm into the established standard curve to calculate the number of the cryptocaryon irritans larvae in the sample.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011493578.7A CN112592994A (en) | 2020-12-16 | 2020-12-16 | Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011493578.7A CN112592994A (en) | 2020-12-16 | 2020-12-16 | Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112592994A true CN112592994A (en) | 2021-04-02 |
Family
ID=75196708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011493578.7A Pending CN112592994A (en) | 2020-12-16 | 2020-12-16 | Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112592994A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009225771A (en) * | 2008-03-25 | 2009-10-08 | Nippon Suisan Kaisha Ltd | Aggregated/immobilized antigen protein of cryptocaryon irritans, dna of the same and use of the same |
| WO2010125991A1 (en) * | 2009-04-27 | 2010-11-04 | 日本水産株式会社 | Method for control of fish parasites |
| CN102443652A (en) * | 2011-12-28 | 2012-05-09 | 宁波大学 | LAMP (Lysosomal Associated Membrane Protein) detection kit for cryptocaryon irritans of large yellow croaker and detection method of LAMP detection kit |
| CN107349422A (en) * | 2017-06-20 | 2017-11-17 | 华南农业大学 | A kind of preparation method and applications for stimulating cryptonucleus insect subunit vaccine |
| CN110999825A (en) * | 2019-11-20 | 2020-04-14 | 中山大学 | Method for measuring infection rate of cryptocaryon irritans on fish bodies |
| CN111183935A (en) * | 2018-11-15 | 2020-05-22 | 中山大学 | Method for controlling cryptocaryon irritans disease of fish by using ozone |
-
2020
- 2020-12-16 CN CN202011493578.7A patent/CN112592994A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2009225771A (en) * | 2008-03-25 | 2009-10-08 | Nippon Suisan Kaisha Ltd | Aggregated/immobilized antigen protein of cryptocaryon irritans, dna of the same and use of the same |
| WO2010125991A1 (en) * | 2009-04-27 | 2010-11-04 | 日本水産株式会社 | Method for control of fish parasites |
| CN102443652A (en) * | 2011-12-28 | 2012-05-09 | 宁波大学 | LAMP (Lysosomal Associated Membrane Protein) detection kit for cryptocaryon irritans of large yellow croaker and detection method of LAMP detection kit |
| CN107349422A (en) * | 2017-06-20 | 2017-11-17 | 华南农业大学 | A kind of preparation method and applications for stimulating cryptonucleus insect subunit vaccine |
| CN111183935A (en) * | 2018-11-15 | 2020-05-22 | 中山大学 | Method for controlling cryptocaryon irritans disease of fish by using ozone |
| CN110999825A (en) * | 2019-11-20 | 2020-04-14 | 中山大学 | Method for measuring infection rate of cryptocaryon irritans on fish bodies |
Non-Patent Citations (4)
| Title |
|---|
| AKITO TANIGUCHI ET AL.: "Quantitative PCR assay for the detection of the parasitic ciliate Cryptocaryon irritans", 《FISH SCI》 * |
| IMAJOH, M ET AL.: "TaqMan real-time pcr detection and phylogenetic analysis of Cryptocaryon irritans in Nomi bay, Kochi，Japan", 《FISH PATHOLOGY》 * |
| 张新艳 等: "刺激隐核虫PCR检测方法的建立", 《福建水产》 * |
| 胡静平: "《生物医学常用实验方法》", 31 December 2019, 苏州大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Walker et al. | Environmental detection of Batrachochytrium dendrobatidis in a temperate climate | |
| CN107287354B (en) | Method for detecting white spot syndrome virus of prawn by loop-mediated isothermal amplification method | |
| Atkinson et al. | Genotyping of individual Ceratonova shasta (Cnidaria: Myxosporea) myxospores reveals intra-spore ITS-1 variation and invalidates the distinction of genotypes II and III | |
| CN111850134A (en) | Specific forward and reverse primers and probe for rainbow trout, detection kit and application of specific forward and reverse primers and probe | |
| CN103436628B (en) | Method for rapidly detecting moderately-resistant strain in fusarium graminearum to carbendazim | |
| Le Port et al. | A Valuable Tool for Ecological Inference and Management of Sharks and Their Relatives | |
| CN103468806A (en) | Quick detection method for scallop pathogenic vibrio splendidus | |
| CN112592994A (en) | Quantitative detection primer for cryptocaryon irritans larvae and application of quantitative detection primer | |
| CN104313177A (en) | Molecular detection method for rapidly identifying carbendazim-resistant genotype-F200Y botrytis cinerea strain | |
| CN104962660A (en) | Ruditapes philippinarum species real-time fluorescent PCR (polymerase chain reaction) specific detection system and application thereof | |
| CN1169968C (en) | Nucleic acid molecular hybridization detection method for silkworm nosema disease | |
| CN115181803A (en) | Taqman probe qPCR detection primer group for detecting chaulmoogra and application | |
| CN1837364A (en) | Real-time fluorescence PCR immobilization kit of wheat dwarf bunt germ (Tilletia controversa kuhn) and its detection method | |
| CN110184385B (en) | Freshwater crayfish thrum virus PCV-87R specific sequence and application | |
| CN109735606B (en) | Rapid detection method for imidacloprid water pollution by fluorescent quantitative PCR | |
| CN109504783B (en) | Application of mussel GST mu subtype gene in detection of deltamethrin-polluted water product | |
| CN109517905B (en) | Application of mussel GST alpha subtype gene in detection of malachite green polluted water product | |
| CN107254527B (en) | Visual rapid detection kit and method for macrobrachium rosenbergii spiroplasma | |
| Mackie et al. | Experimental parameters affecting quantitative PCR of Artemia franciscana: a model for a marine zooplanktonic target in natural plankton samples | |
| CN112342317A (en) | Nucleic acid sequence combination, kit and detection method for LAMP-CRISPR (loop-mediated isothermal amplification-CRISPR) isothermal detection of IHHNV (infectious bronchitis Virus) | |
| CN112458186B (en) | Primer group and kit for quantitatively detecting toxoplasma gondii and application of primer group and kit | |
| CN110578018B (en) | LAMP (loop-mediated isothermal amplification) method for rapidly detecting nuclear polyhedrosis virus | |
| KR20190136647A (en) | Methode for detecting and absolute quantification of Alexandrium spp. using digital PCR | |
| CN1277124C (en) | PCR rapid detection kit for pathogenic Vibrio anguillarum and method for detection thereof | |
| Sokołowska et al. | Amoebiosis (Neoparamoeba perurans). |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210402 |