CN112501033B - Trichoderma for preventing and treating wheat powdery mildew and application thereof - Google Patents
Trichoderma for preventing and treating wheat powdery mildew and application thereof Download PDFInfo
- Publication number
- CN112501033B CN112501033B CN202011440348.4A CN202011440348A CN112501033B CN 112501033 B CN112501033 B CN 112501033B CN 202011440348 A CN202011440348 A CN 202011440348A CN 112501033 B CN112501033 B CN 112501033B
- Authority
- CN
- China
- Prior art keywords
- trichoderma
- trichoderma harzianum
- powdery mildew
- parts
- wheat powdery
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
- A01N63/38—Trichoderma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/02—Separating microorganisms from their culture media
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N3/00—Spore forming or isolating processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Mycology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Agronomy & Crop Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides trichoderma harzianum for preventing and treating wheat powdery mildew and application thereof, wherein the trichoderma harzianum is trichoderma harzianum 124D, is preserved in China general microbiological culture Collection center (CGMCC) in 11 months and 18 days in 2020, and the preservation unit is CGMCC for short, and the address is as follows: xilu No. 1 Hospital, Beijing, Chaoyang, North Chen, with a deposit number: CGMCC No. 21030. The trichoderma harzianum is applied to the prevention and treatment of wheat powdery mildew. The microbial inoculum prepared from trichoderma harzianum 124D can effectively prevent wheat powdery mildew, and simultaneously improves the content of amino acid and protein in wheat, thereby improving the resistance of the wheat.
Description
Technical Field
The invention relates to the technical field of biological application, in particular to trichoderma for preventing and treating wheat powdery mildew and application thereof.
Background
Wheat is a major food source, and the yield and quality of wheat have a significant impact on food safety. Wheat powdery mildew is mainly caused by Blumeragramis f.sp.tritici, and the spore of the pathogenic bacterium spreads along with airflow, so that the powdery mildew has the characteristics of high prevalence speed, wide damage range and high control difficulty.
In the prior art, the prevention and treatment of wheat powdery mildew are mainly carried out by chemical prevention and treatment and disease-resistant wheat variety application, and the prevention and treatment are carried out by means of cultivation management. Although the effect of the chemical agent is obvious, the chemical agent is easy to generate drug-resistant germs, and the bactericide is easy to cause environmental pollution after being used for a long time in a large amount and does not meet the requirement of green environmental protection; however, although the disease-resistant wheat variety is effective in a short time, the resistance of the variety is lost with the passage of time, thereby increasing the difficulty of breeding again for disease resistance.
With the improvement of ecological environmental awareness, biological control has become one of the important means for controlling crop diseases as a new research field. While the bio-control trichoderma is proved to be a bio-control antagonistic bacterium with broad-spectrum adaptability in the currently found antagonistic microorganisms, researches show that the trichoderma has antagonistic action on at least 18 pathogenic fungi of 29 genera in vitro or in vivo, however, the trichoderma has poor control effect on wheat powdery mildew and influences the yield of wheat after wheat infection, and therefore, the trichoderma with high control effect and wheat resistance improvement is of great significance.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides trichoderma harzianum for preventing and treating wheat powdery mildew and application thereof, wherein the trichoderma harzianum is trichoderma harzianum (trichoderma harzianum)124D, is preserved in China general microbiological culture collection center (CGMCC) in 11-18 months in 2020, the preservation unit is CGMCC for short, and the address is as follows: xilu No. 1 Hospital, Beijing, Chaoyang, North Chen, with a deposit number: CGMCC No. 21030. The application of the trichoderma is particularly the application of the trichoderma in the aspect of wheat powdery mildew prevention and control. The microbial inoculum prepared from trichoderma harzianum 124D can effectively prevent wheat powdery mildew, and simultaneously improves the content of amino acid and protein in wheat, thereby improving the resistance of the wheat.
The technical scheme of the invention is as follows:
trichoderma harzianum 124D, which is preserved in China general microbiological culture Collection center (CGMCC) at 11/18 th 2020, wherein the preservation unit is CGMCC for short, and the address is as follows: xilu No. 1 Hospital, Beijing, Chaoyang, North Chen, with a deposit number: CGMCC No. 21030.
Furthermore, the trichoderma can grow faster on a PDA flat plate, the growth temperature range is 24-28 ℃, the initial growth color is white, the mycelium layer is thick, the flat plate shows green due to generation of conidium along with the extension of the growth time, and the hypha bunch is thick and close like a tapestry; the front of the colony appears dark green, and the back is colorless.
Further, the separation and identification process of the trichoderma comprises the following steps:
(1) separation and purification: weighing 10g of soil sample, pouring the soil sample into sterilized normal saline with the volume of 90ml and the mass concentration of 0.85%, shaking the soil sample by a shaker at 25 ℃, and shaking the soil sample for 1h at 120rpm/min to obtain a solution I; diluting the solution I in a gradient manner, putting 1ml of each gradient into a flat plate, pouring into a trichoderma selective culture medium at the temperature of 35-45 ℃, uniformly mixing, culturing at 25 ℃ for 7-10 days, transferring to a new PDA flat plate for culturing after a strain grows out until a single spore colony is selected, and storing;
(2) and (3) identification: identifying the purified strain in the step (1), extracting DNA of the trichoderma strain by adopting an SDS method, amplifying an rDNA-ITS region by using primer sequences of universal primers ITS1/ITS4 and tef1, sending a PCR product to sequence, analyzing a sequencing result by using DNASTAR software, and performing homology comparison on the sequencing result and an ITS sequence existing in a GenBank database by using NCBI Blast software; selecting a model trichoderma strain, and constructing a phylogenetic tree based on an ITS gene sequence and a tef1 gene sequence by adopting an adjacent joining method (NJ), wherein the strain 124D and the model strain trichoderma harzianum are both arranged on one branch, so that the trichoderma is considered to be trichoderma harzianum (T.harzianum), and the trichoderma harzianum strain is named as trichoderma harzianum 124D;
the general primer is as follows:
ITS1：TCCGTAGGTGAACCTGCGG；ITS4：TCCTCCGCTTATTGATATGC；
tef1 primer sequence:
tef1-f：CATCGAGAAGTTCGAGAAGG；tef1-r：AACTTGCAGGCAATGTGG。
further, the trichoderma harzianum is applied to the prevention and treatment of wheat powdery mildew.
Preferably, in the application, the trichoderma harzianum 124D spores are particularly applied to preventing and treating wheat powdery mildew.
Further, in the application, the application is specifically the application of the microbial inoculum prepared by using the trichoderma harzianum 124D spores in the aspect of preventing and treating wheat powdery mildew.
Preferably, the preparation process of the trichoderma harzianum 124D spores is as follows:
(1) activating strains: inoculating the preserved trichoderma 124D into a solid PDA culture medium, and carrying out dark culture in an incubator at 25 ℃ for 7D;
(2) preparing a spore suspension: cleaning solid PDA culture medium with sterilized clear water, filtering bacterial liquid with gauze, taking 10 μ l filtered bacterial liquid with pipette gun, dropping into blood count plate, observing spore amount with microscope, and adjusting spore amount to 1.0 × 108CFU to obtain Trichoderma harzianum 124D spore suspension;
(3) the preparation method of the spore comprises the following steps: using wheat seeds as a culture medium, weighing the wheat seeds, putting the wheat seeds into a tissue culture bottle, and sterilizing at the high temperature of 121 ℃ for later use; placing the Trichoderma 124D spore suspension obtained in step (2) into sterilized seed culture medium, culturing in biochemical incubator for 3-4D, washing with clear water, centrifuging, and making into 1 × 1010-2×1010CFU/g of spore.
Preferably, the microbial inoculum comprises Trichoderma harzianum 124D spores, a carrier and a protective agent, and in the microbial inoculum, the spore number of the Trichoderma harzianum 124D is 2 multiplied by 107-2×109CFU/g。
Preferably, the microbial inoculum comprises the following components in parts by weight:
0.1-10 parts of trichoderma harzianum 124D spores, 2-3 parts of sodium dodecyl sulfate, 2-3 parts of xanthan gum, 3-5 parts of glucose and 79-92.9 parts of diatomite.
Preferably, the microbial inoculum is powder, and the spore number of trichoderma harzianum 124D in the bacterial powder is 1 multiplied by 109CFU/g, the microbial inoculum comprises the following components in parts by weight:
5 parts of trichoderma harzianum 124D spores, 2.5 parts of sodium dodecyl sulfate, 2.5 parts of xanthan gum, 4 parts of glucose and 86 parts of diatomite.
Compared with the prior art, the invention has the beneficial effects that:
1. the microbial inoculum prepared from trichoderma harzianum 124D provided by the invention has a control effect on wheat powdery mildew as high as 82.51% in laboratory experiments; in a field experiment, after the microbial inoculum is diluted by 100 times, the prevention and treatment effect on wheat powdery mildew is up to 76.17%; the bacterial agent provided by the invention has good control effect on powdery mildew and obvious effect.
2. In a field experiment, the microbial inoculum provided by the invention has a control effect of 72.14% after being diluted by 1000 times, and shows that the microbial inoculum prepared by using the trichoderma harzianum 124D has the advantages of low consumption and cost reduction.
3. The microbial inoculum provided by the invention can increase the content of protein and amino acid in wheat, improve the quality of wheat, and further improve the resistance of wheat by improving the content of protein and amino acid.
4. The trichoderma harzianum 124D provided by the invention has a good prevention effect on wheat powdery mildew, can fundamentally improve soil-borne diseases and the spreading problem thereof, is environment-friendly and food-friendly, and has a wide application prospect.
Drawings
In order to more clearly illustrate the embodiments or technical solutions in the prior art of the present invention, the drawings used in the description of the embodiments or prior art will be briefly described below, and it is obvious for those skilled in the art that other drawings can be obtained based on these drawings without creative efforts.
FIG. 1 is a phylogenetic tree based on the ITS gene sequence (left panel) and the tef1 gene sequence (right panel).
Detailed Description
In order to make those skilled in the art better understand the technical solution of the present invention, the technical solution in the embodiment of the present invention will be clearly and completely described below with reference to the embodiment of the present invention, and it is obvious that the described embodiment is only a part of the embodiment of the present invention, and not a whole embodiment. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 Strain screening and identification
The separation and identification process of trichoderma comprises the following steps:
(1) separation and purification: weighing 10g of soil sample, pouring the soil sample into sterilized normal saline with the volume of 90ml and the mass concentration of 0.85%, shaking the soil sample by a shaker at 25 ℃, and shaking the soil sample for 1h at 120rpm/min to obtain a solution I; diluting the solution I in a gradient manner, putting 1ml of each gradient into a flat plate, pouring into a PDA culture medium at the temperature of 40 ℃, uniformly mixing, culturing at the temperature of 25 ℃ for 8 days, transferring to a new flat plate for culturing after a strain grows out until a single spore colony is selected, and storing;
the color of the initial growth is white, the mycelium layer is thick and solid, the flat plate shows green due to the generation of conidium along with the extension of the growth time, and the mycelium cluster is dense and similar to a tapestry; the front side of the bacterial colony is dark green, and the back side of the bacterial colony is colorless;
(2) and (3) identification: identifying the purified strain in the step (1), extracting DNA of the trichoderma strain by adopting an SDS method, amplifying an rDNA-ITS region by using primer sequences of universal primers ITS1/ITS4 and tef1, sending a PCR product to sequence, analyzing a sequencing result by using DNASTAR software, and performing homology comparison on the sequencing result and an ITS sequence existing in a GenBank database by using NCBI Blast software; selecting a model trichoderma strain, and constructing a phylogenetic tree based on an ITS gene sequence and a tef1 gene sequence by adopting an adjacent joining method (NJ), wherein the strain 124D and the model strain trichoderma harzianum are on the same branch, so that the trichoderma is considered to be trichoderma harzianum (T.harzianum), and the trichoderma harzianum strain is named as trichoderma harzianum 124D;
the general primer is as follows:
ITS1：TCCGTAGGTGAACCTGCGG；ITS4：TCCTCCGCTTATTGATATGC；
tef1 primer sequence:
tef1-f：CATCGAGAAGTTCGAGAAGG；tef1-r：AACTTGCAGGCAATGTGG；
the composition of the trichoderma selective medium is as follows: 200g of potato, 20g of glucose, 0.1g of streptomycin, 0.3g of chloramphenicol, 0.02g of rose bengal, 10g of agar and Triton X-10050 mul of agar, sterilizing at 121 ℃ for 30min, and cooling to room temperature;
the trichoderma harzianum is trichoderma harzianum (trichoderma harzianum)124D, which is preserved in China general microbiological culture Collection center (CGMCC) at 11/18 th 2020, wherein the preservation unit is CGMCC, and the address is as follows: xilu No. 1 Hospital, Beijing, Chaoyang, North Chen, with a deposit number: CGMCC No. 21030.
Example 2 preparation of Trichoderma 124D spores
The procedure for the preparation of trichoderma harzianum 124D spores was as follows:
(1) activating strains: inoculating the preserved trichoderma 124D into a solid PDA culture medium, and carrying out dark culture in an incubator at 25 ℃ for 7D;
(2) preparing a spore suspension: cleaning solid PDA culture medium with sterilized clear water, filtering bacterial liquid with gauze, taking 10 μ l filtered bacterial liquid with pipette gun, dropping into blood count plate, observing spore amount with microscope, and adjusting spore amount to 1.0 × 108CFU to obtain Trichoderma harzianum 124D spore suspension;
(3) the preparation method of the spore comprises the following steps: taking wheat seeds as a culture medium, weighing a proper amount of wheat seeds, putting the wheat seeds into a tissue culture bottle, and sterilizing at the high temperature of 121 ℃ for later use; placing the Trichoderma 124D spore suspension obtained in step (2) into sterilized seed culture medium, culturing in biochemical incubator for 3-4D, washing with clear water, centrifuging, and making into 1 × 1010-2×1010CFU/g of spore.
Example 3 preparation of microbial inoculum 1
The powder is prepared by using Trichoderma harzianum 124D spores with the spore content of 1 × 109CFU/g, the microbial inoculum comprises the following components in parts by weight:
5 parts of trichoderma harzianum 124D spores, 2.5 parts of sodium dodecyl sulfate, 2.5 parts of xanthan gum, 4 parts of glucose and 86 parts of diatomite; mixing the above materials, and making into powder.
Example 4 preparation of microbial inoculum 2
Preparation of microbial inoculum from Trichoderma harzianum 124D spore with spore content of 2 × 107CFU/g, the microbial inoculum comprises the following components in parts by weight:
0.1 part of trichoderma harzianum 124D spores, 2 parts of sodium dodecyl sulfate, 2 parts of xanthan gum, 3 parts of glucose and 92.9 parts of diatomite; mixing the above materials, and making into powder.
Example 5 preparation of microbial inoculum 3
Preparation of microbial inoculum with spore content of 2 × 10 from Trichoderma harzianum 124D9CFU/g, the microbial inoculum comprises the following components in parts by weight:
10 parts of trichoderma harzianum 124D spores, 3 parts of sodium dodecyl sulfate, 3 parts of xanthan gum, 5 parts of glucose and 79 parts of kieselguhr; mixing the above materials, and making into powder.
In the following tests (a) and (b), the microbial agents used were the microbial agents prepared in example 3.
Experiment (I) laboratory experiment
1. Control effect of trichoderma harzianum 124D microbial inoculum on powdery mildew of greenhouse potted wheat
The powdery mildew investigation records analysis test data according to agricultural standard NY-T613-2002 'wheat powdery mildew survey specification'.
The disease was classified according to the ratio of the leaf area covered by the lesion hypha layer on the diseased leaves to the total leaf area, 8 grades were set, and expressed as 1%, 5%, 10%, 20%, 40%, 60%, 80%, and 100%, respectively, and the disease between grades was taken as a value close to the disease, and the disease was recorded as 1% with the severity of less than 1% although it had already developed. For the group of leaves, the average severity of a certain point is calculated according to the following formula:
mean severity of diseased leaves ═ Σ (each severity grade value × number of diseased leaves at each level)/total number of diseased leaves investigated × 100%;
the disease index and the prevention and treatment effect are calculated according to the following formula: the disease index is disease leaf rate multiplied by the average severity of disease leaves multiplied by 100 percent, wherein the disease leaf rate refers to the percentage of the number of the investigated disease leaves in the total number of the investigated leaves;
the control effect is (average severity of control diseased leaves-average severity of treated diseased leaves)/severity of control diseased leaves x 100%.
(1) Experimental methods
In the pot culture test, wheat variety Jimai 44 is selected and quantitatively and uniformly sown in a flowerpot with the caliber of 10cm, and the cultivation and management are meticulously carried out, wherein the temperature of an illumination incubator is 18 ℃, so that the growth vigor of the wheat is consistent. When wheat seedlings grow to have two leaves and one heart, spraying 1000 times diluted trichoderma harzianum 124D microbial inoculum, wherein the ratio of the trichoderma harzianum 124D microbial inoculum to water is clear water: the microbial inoculum is 1000:1, the contrast is water, and 20% triazolone missible oil (the mass concentration is 200mg/L) is used as a contrast medicament. 10 pots of each treatment, 10 plants per pot, were covered with plastic film overnight and repeated three times. Inoculating the bred fresh powdery mildew spores after 2 days, investigating the morbidity after 7 days, and calculating the control effect.
(2) Results of the experiment
The results of the pot experiment for preventing and treating wheat powdery mildew of the trichoderma harzianum 124D microbial inoculum of the invention are counted, and are shown in Table 1,
TABLE 1 preventive and therapeutic effects of Trichoderma harzianum 124D on wheat powdery mildew in greenhouse
| Different treatment | Mean severity of diseased leaves after application (%) | Disease index after administration (%) | Control effect (%) |
| Microbial inoculum | 7.73 | 7.66 | 82.51 |
| 20% triazolone | 4.78 | 3.87 | 89.17 |
| Clear water control | 44.15 | 44.15 | - |
The trichoderma harzianum 124D microbial inoculum has a good prevention and control effect on wheat powdery mildew, the average severity of diseased leaves is 44.15%, after the trichoderma harzianum 124D microbial inoculum is sprayed, the average severity of the diseased leaves is 7.73%, and the prevention and control effect reaches 82.51%.
2. Chlorophyll content determination
Chlorophyll influences the photosynthesis of crops, and the content of chlorophyll directly influences the yield and the quality of the crops, so that the chlorophyll content of wheat leaves is measured by the following method: the chlorophyll content is measured by a 95% ethanol method; the malondialdehyde content was determined by the thiobarbituric acid method, and the results are shown in Table 2, as follows:
TABLE 2 Effect of Trichoderma harzianum 124D agents on chlorophyll and malondialdehyde in wheat leaves
| Different treatment | Chlorophyll content (mg/g) | Malondialdehyde content (μmol/g) |
| Clear water control | 0.39±0.03 | 3.09±0.20 |
| 20% triazolone | 0.52±0.01 | 2.41±0.10 |
| Microbial inoculum | 0.58±0.02 | 2.35±0.26 |
The combination of table 2 shows that the chlorophyll content in the wheat leaves is obviously increased compared with the control after the microbial inoculum is sprayed, which indicates that the trichoderma harzianum 124D microbial inoculum provided by the invention can promote the synthesis of chlorophyll in the wheat leaves, improve the chlorophyll content of the wheat leaves, is beneficial to the accumulation and the transportation of a wheat photosynthetic product, and ensures the high and stable yield of wheat. In addition, as can be seen from table 2, the content of MDA (malondialdehyde) in wheat leaves is reduced when the trichoderma harzianum 124D microbial inoculum of the present invention is used for treatment compared with a control, which indicates that the spraying of the microbial inoculum is helpful for reducing plant cell membranous peroxidation caused by powdery mildew of wheat tissues, and provides a more suitable condition for wheat growth.
Test II field test
1. Statistics of control effect of field
The test site is located in Dongping of Taian city of Shandong, the previous crop of the test site is corn and sandy loam, powdery mildew occurs in the test site all the year round, and the control group and the test group are respectively set to 667m2. Spraying Trichoderma harzianum 124D microbial inoculum in natural onset period, respectively spraying 100/1000 times (clear water: microbial inoculum 100:1, clear water: microbial inoculum 1000:1) Trichoderma harzianum 124D diluted bacterial solution, and spraying at 20The prevention and treatment effects were counted by five-point sampling survey on 20 years, 4 months and 27 days, as shown in table 3 below,
TABLE 3 preventive and therapeutic effects of Trichoderma harzianum 124D on wheat powdery mildew in field
The combination of the table 3 shows that the control effects of the trichoderma harzianum 124D microbial inoculum provided by the invention reach 76.17% and 72.14% respectively, and are slightly reduced compared with a laboratory, but the control effects are obviously improved compared with those in the prior art (the maximum control effect is 60%); therefore, the trichoderma harzianum 124D microbial inoculum is applied to the field, and the prevention and control efficiency of wheat powdery mildew in the field is greatly improved.
2. Amino acid and protein assays
Harvesting in the middle ten days of 6 months, collecting wheat ears by adopting a five-point sampling method, taking 10 ears at each point, and taking 50 ears in total for each treatment. Fine threshing and air drying and measuring the thousand seed weight. In order to ensure the uniformity and hydrolysis effect of the sample, the harvested wheat seeds are crushed and sieved by a 80-mesh sieve, and 17 amino acids are hydrolyzed by hydrochloric acid, refer to GB7649-87(1987), amino acid analyzer: british Baikang amino acid Analyzer Biochrom 30; tryptophan is determined using an alkaline hydrolysis method, referred to GB7650-87(1987), using a uv spectrophotometer 722; the protein content is measured by Kjeldahl method, and the apparatus is SKD-1000 Kjeldahl apparatus according to GB/T5511-2008. Three replicates and data were statistically analyzed by EXCEL2007, see table 4, below,
TABLE 4 thousand kernel weight, amino acid and protein content changes of wheat seeds using Trichoderma harzianum 124D inoculum
| Thousand Kernel weight (g) | Total amount of amino acids (g/100g) | Total protein (g/100g) | |
| Control | 42.84±0.12 | 7.87±0.07 | 11.9±0.28 |
| 20% triazolone | 45.47±0.12 | 8.13±0.11 | 13.4±0.53 |
| Bacterial agent dilution 1000 times | 45.45±0.15 | 10.07±0.23 | 14.1±0.20 |
| Microbial inoculum is diluted by 100 times | 45.38±0.14 | 11.1±0.31 | 14.3±0.41 |
The biocontrol trichoderma related by the invention is a fungus strain with a good shape screened from soil rhizosphere fungi, is identified as trichoderma harzianum 124D, and has an obvious inhibiting effect on wheat powdery mildew. The biocontrol bacterium is applied to control wheat diseases, the wheat yield per mu is increased, and the protein and amino acid content of grains is increased, so that the trichoderma harzianum 124D is applied to wheat crops, the diseases can be prevented, the yield per mu and the protein and amino acid content of caryopsis can be increased, and the nutritional quality of the crops is improved.
Although the present invention has been described in detail by referring to the preferred embodiments, the present invention is not limited thereto. Various equivalent modifications or substitutions can be made on the embodiments of the present invention by those skilled in the art without departing from the spirit and scope of the present invention, and these modifications or substitutions are within the scope of the present invention/any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the claims.
Claims (9)
1. A trichoderma viride for preventing and treating wheat powdery mildew is characterized in that the trichoderma harzianum 124D is preserved in China general microbiological culture collection center (CGMCC) at 11 months and 18 days of 2020, and the preservation unit is CGMCC, and the address is as follows: xilu No. 1 Hospital, Beijing, Chaoyang, North Chen, with a deposit number: CGMCC No. 21030;
the trichoderma is applied to the prevention and treatment of wheat powdery mildew.
2. The trichoderma reesei for controlling wheat powdery mildew as claimed in claim 1, wherein the trichoderma reesei grows fast on a PDA plate, the growth temperature range is 24-28 ℃, the initial growth color is white, the mycelium layer is thicker and more solid, the plate shows green due to conidium generation along with the extension of the growth time, and the hypha cluster is thick and resembles a tapestry; the front of the colony appears dark green, and the back is colorless.
3. The trichoderma reesei fungus for controlling wheat powdery mildew as claimed in claim 1, wherein the isolation and identification process is as follows:
(1) separation and purification: weighing 10g of soil sample, pouring the soil sample into sterilized normal saline with the volume of 90ml and the mass concentration of 0.85%, shaking the soil sample by a shaker at 25 ℃, and shaking the soil sample for 1h at 120rpm/min to obtain a solution I; diluting the solution I in a gradient manner, putting 1ml of each gradient into a flat plate, pouring into a trichoderma selective culture medium at the temperature of 35-45 ℃, uniformly mixing, culturing at 25 ℃ for 7-10 days, transferring to a new PDA flat plate for culturing after a strain grows out until a single spore colony is selected, and storing;
(2) and (3) identification: identifying the purified strain in the step (1), extracting DNA of the trichoderma strain by adopting an SDS method, amplifying an rDNA-ITS region by using primer sequences of universal primers ITS1/ITS4 and tef1, sending a PCR product to sequence, analyzing a sequencing result by using DNASTAR software, and performing homology comparison on the sequencing result and an ITS sequence existing in a GenBank database by using NCBI Blast software; a model trichoderma strain is selected, and a phylogenetic tree based on an ITS gene sequence and a tef1 gene sequence is constructed by an adjacent joining method (NJ), so that the strain 124D and the model strain trichoderma harzianum are both on one branch, and therefore the trichoderma is considered to be trichoderma harzianum (t. harzianum), and the trichoderma harzianum strain is named as trichoderma harzianum 124D.
4. The trichoderma reesei of claim 1, wherein the trichoderma reesei is trichoderma harzianum 124D spores for controlling wheat powdery mildew.
5. Trichoderma harzianum for controlling wheat powdery mildew according to claim 4, wherein the application of Trichoderma harzianum is in particular to the application of the microbial inoculum prepared by Trichoderma harzianum 124D spores in controlling wheat powdery mildew.
6. Trichoderma reesei controlling wheat powdery mildew as claimed in claim 4, wherein Trichoderma harzianum 124D spores are prepared by the following process:
(1) activating strains: inoculating the preserved trichoderma 124D into a solid PDA culture medium, and carrying out dark culture in an incubator at 25 ℃ for 7D;
(2) preparing a spore suspension: cleaning solid PDA culture medium with sterilized clear waterFiltering with gauze, taking 10 μ l of the filtered bacterial solution with pipette, dropping into blood counting plate, observing spore amount with microscope, and adjusting spore amount to 1.0 × 108CFU to obtain Trichoderma harzianum 124D spore suspension;
(3) the preparation method of the spore comprises the following steps: using wheat seeds as a culture medium, weighing the wheat seeds, putting the wheat seeds into a tissue culture bottle, and sterilizing at the high temperature of 121 ℃ for later use; placing the Trichoderma 124D spore suspension obtained in step (2) into sterilized seed culture medium, culturing in biochemical incubator for 3-4D, washing with clear water, centrifuging, and making into 1 × 1010-2×1010CFU/g of spore.
7. The Trichoderma reesei for controlling wheat powdery mildew as claimed in claim 5, wherein the bacterial agent comprises Trichoderma harzianum 124D spores, a carrier and a protective agent, and in the bacterial agent, the spore number of Trichoderma harzianum 124D is 2 x 107-2×109CFU/g。
8. The trichoderma reesei for preventing and treating wheat powdery mildew as claimed in claim 5, wherein the microbial inoculum comprises the following components in parts by weight:
0.1-10 parts of trichoderma harzianum 124D spores, 2-3 parts of sodium dodecyl sulfate, 2-3 parts of xanthan gum, 3-5 parts of glucose and 79-92.9 parts of diatomite.
9. The Trichoderma reesei for controlling wheat powdery mildew as claimed in claim 8, wherein the microbial inoculum is powder, and the number of spores of Trichoderma harzianum 124D in the powder is 1X 109CFU/g, the microbial inoculum comprises the following components in parts by weight:
5 parts of trichoderma harzianum 124D spores, 2.5 parts of sodium dodecyl sulfate, 2.5 parts of xanthan gum, 4 parts of glucose and 86 parts of diatomite.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011440348.4A CN112501033B (en) | 2020-12-11 | 2020-12-11 | Trichoderma for preventing and treating wheat powdery mildew and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011440348.4A CN112501033B (en) | 2020-12-11 | 2020-12-11 | Trichoderma for preventing and treating wheat powdery mildew and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112501033A CN112501033A (en) | 2021-03-16 |
| CN112501033B true CN112501033B (en) | 2022-02-15 |
Family
ID=74970805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011440348.4A Active CN112501033B (en) | 2020-12-11 | 2020-12-11 | Trichoderma for preventing and treating wheat powdery mildew and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112501033B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114907986B (en) * | 2022-04-28 | 2022-11-18 | 云南省农业科学院生物技术与种质资源研究所 | Trichoderma harzianum and application thereof in preparation for preventing and treating root rot of panax notoginseng |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575574A (en) * | 2009-06-11 | 2009-11-11 | 刘和现 | Trichoderma harzianum composite bacteria culture and application of trichoderma harzianum composite bacteria culture in aspect of plant protection |
| CN105802863A (en) * | 2016-06-01 | 2016-07-27 | 东北农业大学 | Trichoderma harzianum fermentation process, wettable powder and application thereof |
| CN109402159A (en) * | 2018-11-01 | 2019-03-01 | 上海交通大学 | One kind turning the building of Sm1-chit42 trichoderma engineering bacteria and its application |
-
2020
- 2020-12-11 CN CN202011440348.4A patent/CN112501033B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101575574A (en) * | 2009-06-11 | 2009-11-11 | 刘和现 | Trichoderma harzianum composite bacteria culture and application of trichoderma harzianum composite bacteria culture in aspect of plant protection |
| CN105802863A (en) * | 2016-06-01 | 2016-07-27 | 东北农业大学 | Trichoderma harzianum fermentation process, wettable powder and application thereof |
| CN109402159A (en) * | 2018-11-01 | 2019-03-01 | 上海交通大学 | One kind turning the building of Sm1-chit42 trichoderma engineering bacteria and its application |
Non-Patent Citations (1)
| Title |
|---|
| 哈茨木霉T-h-30对几种蔬菜的促进作用及病害防治初探;杨春林，等;《西南农业学报》;20081228;第21卷(第6期);1603-1607 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112501033A (en) | 2021-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101481668B (en) | Bacillus thuringiensis suspending agent for killing cotton spider mites, preparation and use | |
| CN105733982B (en) | Bacillus amyloliquefaciens, microbial inoculum and preparation method thereof for preventing and treating two born of the same parents' branch-rot of blueberry hair color | |
| CN102382791A (en) | Fermentation process of trichoderma | |
| CN107779408B (en) | Beauveria bassiana for preventing and treating scarab beetles and microbial agent thereof | |
| CN108018242A (en) | A kind of serratia marcescens and its separation method and application | |
| CN112931534A (en) | Application of streptomycete in biological control | |
| CN111778173B (en) | Bacillus subtilis Pro1A2, microbial inoculum and preparation method thereof, and application of bacillus subtilis Pro1A2 in cultivation of melons | |
| CN115058358B (en) | Salt-tolerant bacillus and application thereof | |
| CN111040976A (en) | Bacillus amyloliquefaciens and application thereof | |
| CN108641989A (en) | One plant of Methylotrophic bacillus and its application | |
| CN112501033B (en) | Trichoderma for preventing and treating wheat powdery mildew and application thereof | |
| CN110317747A (en) | A kind of bacillus amyloliquefaciens JT68 and its application in prevention and treatment tea anthracnose | |
| CN115873770B (en) | Bacillus bailii and application thereof in preventing and controlling tomato diseases | |
| CN105349457B (en) | A kind of bacillus amyloliquefaciens and its application in leaf blight of corn biological and ecological methods to prevent plant disease, pests, and erosion | |
| CN115505541B (en) | Biocontrol bacterium Burkholderia pyrrocinia suitable for wheat fungal diseases and application thereof | |
| CN102533564A (en) | Method for screening bio-control trichoderma in corn seedling stage root rot period | |
| CN105802859A (en) | Trichoderoma koningii TG-102 and application of trichoderoma koningii TG-102 to prevention and control of corn aflatoxin pollution | |
| CN111548951B (en) | Bacillus subtilis Pro6A5, microbial inoculum and preparation method thereof, and application of bacillus subtilis Pro6A5 in cultivation of melons | |
| CN113773992B (en) | Application of bacillus altitudinis Ba1449 and microbial inoculum in preventing and treating plant mycosis | |
| CN112195135B (en) | Bacillus belgii and application thereof in preventing and treating plant downy mildew disease | |
| CN111979151B (en) | Biocontrol strain and application thereof | |
| CN113416679A (en) | Bacillus methylotrophicus, microbial inoculum comprising bacillus methylotrophicus and application of bacillus methylotrophicus | |
| CN109337822B (en) | Beauveria bassiana BRNS50206 and application thereof | |
| CN105838643A (en) | Bacillus subtilis JTFM1001 and application thereof to prevention and control of corn aflatoxin contamination | |
| CN117165495B (en) | Streptomyces virginiae Sv1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |