CN105802859A - Trichoderoma koningii TG-102 and application of trichoderoma koningii TG-102 to prevention and control of corn aflatoxin pollution - Google Patents
Trichoderoma koningii TG-102 and application of trichoderoma koningii TG-102 to prevention and control of corn aflatoxin pollution Download PDFInfo
- Publication number
- CN105802859A CN105802859A CN201610282971.9A CN201610282971A CN105802859A CN 105802859 A CN105802859 A CN 105802859A CN 201610282971 A CN201610282971 A CN 201610282971A CN 105802859 A CN105802859 A CN 105802859A
- Authority
- CN
- China
- Prior art keywords
- culture
- strain
- fermentation
- trichoderoma
- medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/885—Trichoderma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05F—ORGANIC FERTILISERS NOT COVERED BY SUBCLASSES C05B, C05C, e.g. FERTILISERS FROM WASTE OR REFUSE
- C05F3/00—Fertilisers from human or animal excrements, e.g. manure
-
- C—CHEMISTRY; METALLURGY
- C05—FERTILISERS; MANUFACTURE THEREOF
- C05G—MIXTURES OF FERTILISERS COVERED INDIVIDUALLY BY DIFFERENT SUBCLASSES OF CLASS C05; MIXTURES OF ONE OR MORE FERTILISERS WITH MATERIALS NOT HAVING A SPECIFIC FERTILISING ACTIVITY, e.g. PESTICIDES, SOIL-CONDITIONERS, WETTING AGENTS; FERTILISERS CHARACTERISED BY THEIR FORM
- C05G3/00—Mixtures of one or more fertilisers with additives not having a specially fertilising activity
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Medicinal Chemistry (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Pest Control & Pesticides (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Fertilizers (AREA)
Abstract
The invention relates to the technical field of microbial fertilizers, and concretely discloses a trichoderoma koningii strain and application of the trichoderoma koningii strain to prevention and control of corn aflatoxin pollution. The trichoderoma koningii strain disclosed by the invention is collected by CCTCC (China Center for Type Culture Collection); the collection number is CCTCC NO: M2016146. The trichoderoma koningii strain disclosed by the invention has an obvious effect on preventing and controlling corn and peanut infecting aflatoxin and toxin pollution; the strain has good anti-bacterium and detoxication effects. The invention also provides organic fertilizer containing the strain. After the organic fertilizer is applied into the soil, the strain can breed fast and survive for a long time at the rhizosphere of the crops to form a predominant flora; after the microbial organic fertilizer is used, the pollution of the aflatoxin on farm products can be prevented and controlled; meanwhile, the chemical pesticide residue can be reduced; the prospects in the modern agricultural cultivation and agricultural product quality safety application are wide.
Description
Technical field
The present invention relates to microbial manure technical field, specifically disclose a kind of trichoderma pseudokiningii bacterial strain, containing bacterium fertilizer and the application in prevention and control maize aspergillosis toadstool pollutes thereof.
Background technology
Semen Maydis is cereal crops important in the world, is also important feedstuff raw material.At present, inevitably producing mycotoxin in the storage of Semen Maydis, solving mycotoxin, particularly aflatoxin is a global problem to the pollution of the grains such as Semen Maydis and feedstuff.Aflatoxin (AF) is by the mycetogenetic secondary metabolite such as Aspergillus flavus and aspergillus parasiticus, is the class physicochemical property mycotoxin similar with structure.Aflatoxin contamination brings heavy losses to the production of the crops such as Semen Maydis, Semen arachidis hypogaeae, and the economic loss caused every year is up to tens billion of dollars.Aflatoxin is a class carcinogenic, the hypertoxicity mycotoxin by force extensively polluting agricultural product, wherein B1 is the most general and toxicity is the strongest, human or animal eats by causing after the agricultural product of endotoxin contamination that body disease is even dead, serious threat consumer health and life security.Therefore, the prevention and control of aflatoxin contamination in the agricultural product such as Semen Maydis, Semen arachidis hypogaeae are strengthened very urgent.
Semen Maydis is infected the field growing period of occurring mainly in by Aspergillus flavus, and toxin produces and pollutes main at Storage Stages, and therefore, how prevention and control good field Aspergillus flavus is most important to infecting of Semen Maydis.At present, the corn growth prevention and control that Aspergillus flavus is infected period do not had desirable measure, generally based on chemical prevention.Due to the relatively costly and easy contaminated environment of chemical prevention, and antibacterial is easily produced drug resistance even Drug resistance by pathogen, so, find one health, environment amenable prevention and control measure is imperative.Research both at home and abroad finds to have in nature multiple-microorganism perhaps can suppress and degrade the aflatoxin in trophophase and shelf time Semen Maydis or feedstuff, and these microorganisms include antibacterial, yeast, mycete, actinomycetes and algae etc..Adopt the antibacterial toxicity reduction of enzyme of microorganism formulation or its generation, ecological environment will not be destroyed, do not reduce quality of agricultural product, and some kind can also increase the nutritive value of product.
With Aspergillus flavus and toxin for object of study, from healthy corn kernel, separate endogenetic bacteria, and adopt intravital method screening antagonistic bacterium, study its antibacterial activity, be desired for the prevention and control bottleneck problem of Semen Maydis aflatoxin contamination solve explore new approach.
Summary of the invention
It is an object of the invention to provide a kind of trichoderma pseudokiningii bacterium TG-102(TrichoderomakoningiiTG-102 with stronger antibacterial and detoxicating activity).
It is a further object of the invention to provide the application in Semen Maydis is polluted by prevention and control Aspergillus flavus of this bacterial strain, and microbial organic fertilizer and the fermentation preparation thereof that Semen Maydis is polluted by prevention and control Aspergillus flavus is prepared in fermentation.
It is an object of the invention to be achieved through the following technical solutions:
The trichoderma pseudokiningii bacterium TG-102 of a kind of antibacterial and detoxicating, deposit number is CCTCCNO:M2016146, by China typical culture collection center preservation, preservation date: on March 28th, 2016.
Choose the province health corn kernels such as Hebei, Shandong, Shanxi and Jilin, the corn kernel after weighing is soaked 10 minutes with 3% liquor natrii hypochloritis in aseptic triangular flask, last aseptic water washing 5 times, drain away the water.Corn kernel is clamped with tweezers, seed sterile scissors is divided into 3 equal portions, it is placed in slant medium, in 28 DEG C of constant temperature culture, observe colony growth situation every day, picking form is transferred on inclined-plane flat board is purified cultivation like single bacterium colony of trichoderma, and mirror mirror is numbered after tentatively regarding as trichoderma, and is saved on ramps.
Slant medium: Rhizoma Solani tuber osi 200g, glucose 15g, agar 20g, distilled water 1000ml.After 121 DEG C of sterilizing 20min standby.
Morphological feature:
20 DEG C of 5 days colony diameter 9.0cm on slant medium, quickly, spider's thread shape is to ulotrichy, white, and owing to producing spore surface in green under scattered light, the back side is colourless for the speed of growth, and the later stage is owing to sporulation quantity ambassador's bacterium colony is in slightly green；The tree-shaped conidiophore of multi-branched forms quite loose flora；Major branch width 4-5 μm, side shoot is many, forms pyramid；The raw bottle in side obstructs up to 5, becomes to intend colyliform arrangement or single along little side shoot irregular alignment；Slightly hanging contracting in raw bottle metulae portion, side, middle part is expanded, and upwards gradually narrow one-tenth bottle obstructs, 5-7 × 3-3.5 μm；Push up the relatively long and very thin with atypical bottle of stalk of life, 13-18 × 2.5-3.5 μm；Bottle stalk mostly with wide-angle on its carrier raw, sometimes slightly curved to top；Phialospore is spheric conidium head, and conidium is subsphaeroidal or obovate, and wall is smooth, light green, 2.8-3.2 × 2.5-2.8 μm.Result is as depicted in figs. 1 and 2.
Identify that strain is trichoderma pseudokiningii TG-102 by 16SrDNA method (its 16SrDNA is such as shown in SEQIDN0:1).
The present invention also provides for bacterial strain the answering in Semen Maydis is polluted by prevention and control Aspergillus flavus that a kind of deposit number is CCTCCNO:M2016146.
The present invention also provides for the application in the microbial organic fertilizer that Semen Maydis is polluted by preparation prevention and control Aspergillus flavus of bacterial strain that a kind of deposit number is CCTCCNO:M2016146.
The strain fermentation adopting deposit number to be CCTCCNO:M2016146 prepares the microbial organic fertilizer that Semen Maydis is polluted by prevention and control Aspergillus flavus.
The present invention also provides for a kind of microbial organic fertilizer, and in described fertilizer, deposit number is that the bacterial strain content of CCTCCNO:M2016146 is 1.5 × 108More than cfu/g, the content of organic matter is 38-45%.
Present invention also offers the method that the strain fermentation adopting deposit number to be CCTCCNO:M2016146 prepares microbial organic fertilizer, comprise the following steps that
(1) slant culture: by inoculation that deposit number is CCTCCNO:M2016146 in slant medium, cultivates 5-7 days for 25-28 DEG C；
(2) eggplant bottle liquid culture: be inoculated in body fluid culture medium by the trichoderma pseudokiningii bacterium after slant culture, cultivates 3-5 days under 25-28 DEG C of condition in incubator.
(3) medium-sized fermentation tank amplifies liquid culture: swept away by the trichoderma pseudokiningii bacterium sterilized water in step (2), being inoculated in medium-sized fermentation tank, sweat keeps dissolved oxygen concentration about 20%, temperature 28-30 DEG C, mixing speed 200-250r/min, ventilation is 10-15L/min.
(4) solid culture: by the liquid spawn in step (3) by volume 10% inoculum concentration be inoculated in solid medium, cultivation indoor cultivation is transferred to after inoculation, culturing room's temperature controls at 28-31 DEG C, culture medium temperature controls at 25-29 DEG C, relative air humidity controls at 95-98%, culture medium thickness is 5-7cm, and incubation time is 5-7 days.
(5) dry: after solid fermentation, by fertilizer natural air drying to water content control at 7-10%, trichoderma pseudokiningii bacterium TG-102 solid culture can be obtained.
(6) trichoderma pseudokiningii bacterium is carried out solid fermentation with the manioc waste become thoroughly decomposed in advance and feces of livestock and poultry mixture, regulate water content, SOLID ORGANIC material per ton adds trichoderma pseudokiningii bacterium TG-102 solid culture 20 kilograms, fermentation carries out stirring two days later, later every day carries out turning, within 5-7 days, gets final product fermentation ends；≤ 60 DEG C are dried so that it is water content≤30% gets final product packed products.
The optimal technical scheme of the fermentation process of microbial organic fertilizer provided by the invention is as follows:
Slant culture based formulas in step (1) is: Rhizoma Solani tuber osi 200g, glucose 15g, agar 20g, distilled water 1000ml.
In step (2), liquid culture based formulas is: Testa Tritici 2.2%(is by weight), glucose 1.0%(is by weight), magnesium sulfate 0.45%(is by weight), potassium dihydrogen phosphate 0.35%(is by weight), calcium chloride 0.3%(is by weight), surplus is water, PH6.5-6.8.
Described in step (2), fluid medium is at 115-125 DEG C of sterilizing 25-35min, it is preferable that sterilizing 30min under 121 DEG C of wet heat conditions.
Solid culture based formulas described in step (4) is: Testa Tritici and wheat straw powder weight ratio are 8:2, and water content is 70%, pH6.5,121 DEG C of sterilizing 30min.
The present invention also provides for the application in Aspergillus flavus on preventing and treating Semen Maydis of a kind of described microbial organic fertilizer.
Adopting the present invention of technique scheme compared with prior art, Advantageous Effects is as follows:
1. deposit number is CCTCCNO:M2016146 trichoderma pseudokiningii bacterium TG-102 is separate to obtain from the corn kernel of rice field town, Tangshan, find through indoor face-off antagonistic experiment, the antibacterial removing toxic substances experiment of live body and field controling test, this bacterial strain bacteriostasis is stronger, antibacterial detoxifying effect is good and stable, it is easy to cultivate.
2. the present invention also provides for a kind of fertilizer containing this bacterial strain, after this fertilizer is manured into soil, this bacterial strain can at crop rhizosphere Fast-propagation long term survival, form dominant microflora, use this microbial organic fertilizer and can prevent and treat the aflatoxin pollution to agricultural product, the residual of chemical pesticide can be reduced simultaneously, have a extensive future in modern agriculture plantation and agricultural product quality and safety application.
Bacterial strain preservation situation: being preserved in China typical culture collection center (being called for short CCTCC), preservation address is: China. Wuhan. Wuhan University.Deposit number is CCTCCNO:M2016146, and Classification And Nomenclature is trichoderma pseudokiningii bacterium TG-102, Latin title: TrichoderomakoningiiTG-102.Preservation date is on March 28th, 2016.
Accompanying drawing explanation
Fig. 1 is the inclined-plane slat chain conveyor aspect graph of trichoderma pseudokiningii bacterium TG-102.
Fig. 2 is conidiophore and the conidium figure of trichoderma pseudokiningii bacterium TG-102.
Fig. 3 is trichoderma pseudokiningii bacterium TG-102 to Aspergillus flavus inhibitory action figure on Semen Maydis.
Fig. 4 is trichoderma pseudokiningii bacterium TG-102 metabolite to Aspergillus flavus inhibitory action figure on flat board.
Fig. 5 is that soil microflora is affected figure by trichoderma pseudokiningii bacterium TG-102.
Detailed description of the invention
It is that the present invention conducts further description below in conjunction with specific embodiment, but method involved in scheme and technical parameter can not be interpreted as limitation of the present invention.
Embodiment 1
Deposit number is separation and the qualification of the bacterial strain of CCTCCNO:M2016146
Choose the province health corn kernels such as Hebei, Shandong, Shanxi and Jilin, the corn kernel after weighing is soaked 10 minutes with 3% liquor natrii hypochloritis in aseptic triangular flask, last aseptic water washing 5 times, drain away the water.Corn kernel is clamped with tweezers, seed sterile scissors is divided into 3 equal portions, it is placed in slant medium, in 28 DEG C of constant temperature culture, observe colony growth situation every day, picking form is transferred on inclined-plane flat board is purified cultivation like single bacterium colony of trichoderma, and mirror mirror is numbered after tentatively regarding as trichoderma, and is saved on ramps.
Slant medium: Rhizoma Solani tuber osi 200g, glucose 15g, agar 20g, distilled water 1000ml.After 121 DEG C of sterilizing 20min standby.
Morphological feature:
20 DEG C of 5 days colony diameter 9.0cm on slant medium, quickly, spider's thread shape is to ulotrichy, white, and owing to producing spore surface in green under scattered light, the back side is colourless for the speed of growth, and the later stage is owing to sporulation quantity ambassador's bacterium colony is in slightly green；The tree-shaped conidiophore of multi-branched forms quite loose flora；Major branch width 4-5 μm, side shoot is many, forms pyramid；The raw bottle in side obstructs up to 5, becomes to intend colyliform arrangement or single along little side shoot irregular alignment；Slightly hanging contracting in raw bottle metulae portion, side, middle part is expanded, and upwards gradually narrow one-tenth bottle obstructs, 5-7 × 3-3.5 μm；Push up the relatively long and very thin with atypical bottle of stalk of life, 13-18 × 2.5-3.5 μm；Bottle stalk mostly with wide-angle on its carrier raw, sometimes slightly curved to top；Phialospore is spheric conidium head, and conidium is subsphaeroidal or obovate, and wall is smooth, light green, 2.8-3.2 × 2.5-2.8 μm.Result is as depicted in figs. 1 and 2.
Identify that strain is trichoderma pseudokiningii TG-102 by 16SrDNA method (its 16SrDNA is such as shown in SEQIDN0:1).
This bacterial strain has been preserved in China typical culture collection center, and deposit number is CCTCCNO:M2016146, and Classification And Nomenclature is trichoderma pseudokiningii bacterium TG-102, and preservation date is on March 28th, 2016.
Embodiment 2
The inhibition of maize aspergillosis is tested by the bacterial strain that deposit number is CCTCCNO:M2016146
(1) the trichoderma pseudokiningii bacterium TG-102 inhibitory action to pathogen: be respectively connected to, at a distance of 3cm place, the trichoderma pseudokiningii bacterium TG-102 cake for preparing on inclined-plane plating medium and opposite culture made by pathogen cake, individually to inoculate each bacterium cake for examination bacterium for comparison, it is placed in 25 DEG C of dark culturing of incubator.Often process and set 3 repetitions.Measure colony diameter after 3d, calculate the strains tested suppression ratio to growth of pathogenic bacteria.In the 350 strain bacterial strains tested, bacterial strain TG-102 bacterial strain is the strongest to the inhibitory action of Aspergillus flavus, and table 1 indicates the effect the applied better 10 strain biocontrol microorganisms suppression ratio to Aspergillus flavus.
10 bacterial strains suppression ratio (%) to maize aspergillosis such as table 1 trichoderma pseudokiningii bacterium TG-102
Note: the experimental data in table is three meansigma methodss repeated.
(2) the indoor living biocontrol effect experiment of trichoderma pseudokiningii bacterium TG-102 bacterial strain
The preparation of Antagonistic Fungi inoculum: be inoculated in eggplant bottle on slant medium by the trichoderma pseudokiningii bacterium TG-102 in test tube slant culture medium, under 25-28 DEG C of condition, cultivates 3-4 days in incubator.
Reesei spores sterilized water in eggplant bottle is swept away, is inoculated in medium-sized fermentation tank.Sweat keeps dissolved oxygen concentration about 20%, and temperature 28-30 DEG C, mixing speed 200-250r/min, ventilation is 10-15L/min.
By volume fermentation liquid is inoculated in solid medium by the inoculum concentration of 10%, transfers to cultivation indoor cultivation after inoculation.Culturing room's temperature controls at 28-31 DEG C, and culture medium temperature controls at 25-29 DEG C, and relative air humidity controls at 90-95%, and culture medium thickness is 5-7cm, and incubation time is 5-7 days.
After cultivation, by culture natural air drying, it is thus achieved that the fermenting agent of antagonistic strain.
The Vivo Studies on Screening of Antagonistic Fungi: it is 1.5 × 10 that above-mentioned Antagonistic Fungi is diluted to spore ultimate density6Spore g-1Spore suspension and cultivate 7 days eugonic Aspergillus flavus bacteria suspensions (spore ultimate density is 1.5 × 106Spore mL-1) difference soaked corn kernel 30min, shady and cool place puts into aseptic flat board, 30 Semen Maydiss of every plate after being done, and puts into illumination box and cultivates 7d.
Incubator condition of culture is: temperature 28 DEG C, humidity 70-80%, and illumination is 12h dark/12h illumination.Not soak bacterium solution for blank, often process and set 3 repetitions.Calculate biocontrol microorganisms and to Aspergillus flavus prevention effect and press down poison rate, in Table 2, Fig. 3.
It is shown that the biocontrol microorganisms obtained shows better protection effect on corn kernel, aspergillus flavus toxin Pollution restraint rate is higher.Secondly the protection effect of Aspergillus flavus is reached 44.2%-87.0% by antagonistic strain respectively, and wherein, bacterial strain TG-102 is the highest to the preventive effect of Aspergillus flavus, reaches 87.0%, is bacterial strain T12-1 and T40-3, preventive effect respectively 69.5% and 68.8%.
Press down toxic effect fruit preferably bacterial strain respectively TG-102, T21-2 and T40-3, it is suppressed that rate respectively 85.0%, 75.2% and 68.5%, have the value of research further.
Table 2 Antagonistic Fungi is to the prevention effect of Aspergillus flavus and presses down poison rate
Note: data are three meansigma methodss repeated
Embodiment 3
The strain fermentation that deposit number is CCTCCNO:M2016146 prepares microbial organic fertilizer and preparation method thereof
The strain fermentation adopting deposit number to be CCTCCNO:M2016146 prepares the microbial organic fertilizer that Semen Maydis is polluted by prevention and control field Aspergillus flavus, and in this fertilizer, deposit number is that the bacterial strain content of CCTCCNO:M2016146 is 1.5 × 108More than cfu/g, the content of organic matter is 38-45%.
The method that the strain fermentation that the present embodiment adopts deposit number to be CCTCCNO:M2016146 prepares microbial organic fertilizer, step is as follows:
(1) slant culture: by inoculation that deposit number is CCTCCNO:M2016146 in slant medium, cultivates 6 days for 25-28 DEG C.
This slant culture based formulas is: Rhizoma Solani tuber osi 200g, glucose 15g, agar 20g, distilled water 1000ml.
(2) eggplant bottle liquid culture: be inoculated in body fluid culture medium by the trichoderma pseudokiningii bacterium after slant culture, cultivates 4 days under 25-28 DEG C of condition in incubator.
This liquid culture based formulas is: Testa Tritici 2.2%, glucose 1.0%, magnesium sulfate 0.45%, potassium dihydrogen phosphate 0.35%, calcium chloride 0.3%, and surplus is water, PH6.7.
By fluid medium sterilizing 30min under 121 DEG C of wet heat conditions.
(3) medium-sized fermentation tank amplifies liquid culture: swept away by the trichoderma pseudokiningii bacterium sterilized water in step (2), being inoculated in medium-sized fermentation tank, sweat keeps dissolved oxygen concentration about 20%, temperature 28-30 DEG C, mixing speed 200-250r/min, ventilation is 10-15L/min；
(4) solid culture: by the liquid spawn in step (3) by volume 10% inoculum concentration be inoculated in solid medium, cultivation indoor cultivation is transferred to after inoculation, culturing room's temperature controls at 28-31 DEG C, culture medium temperature controls at 25-29 DEG C, relative air humidity controls at 95-98%, culture medium thickness is 5-7cm, and incubation time is 6 days.
This solid culture based formulas is: Testa Tritici and wheat straw powder weight ratio are 8:2, and water content is 70%, pH6.5,121 DEG C of sterilizing 30min.
(5) dry: after solid fermentation, by fertilizer natural air drying to water content control at 7-10%, trichoderma pseudokiningii bacterium TG-102 solid culture can be obtained.
(6) trichoderma pseudokiningii bacterium TG-102 is carried out solid fermentation with the manioc waste become thoroughly decomposed in advance and feces of livestock and poultry mixture, regulate water content, SOLID ORGANIC material per ton adds trichoderma pseudokiningii bacterium TG-102 solid culture 20 kilograms, fermentation carries out stirring two days later, later every day carries out turning, within 6 days, gets final product fermentation ends；In solid fermentation microbial organic fertilizer, trichoderma pseudokiningii bacterium TG-102 content reaches 5 × 108More than cfu/g, the content of organic matter is 38-45%.≤ 60 DEG C are dried so that it is water content≤30% gets final product packed products.
Embodiment 4
Deposit number is that the strain fermentation of CCTCCNO:M2016146 is prepared the microbial organic fertilizer inhibition to maize aspergillosis and tested
Field test community Random Design, 3 repetitions, the area of each community is 15m × 3m.By biological prevention and control agent with 4 kilograms every mu (1.5 × 106Spore g-1), apply with fertilizer when corn seeding, chemical prevention and control method (70% thiophanate methyl wettable powder 0.5g/) and comparison, the same biological prevention and control agent of application process of pesticide are set.5 points of random searching, every 10 strains are often processed after harvest corn.Calculating Antagonistic Fungi and press down poison rate and to Semen Maydis growth-promoting effect, result is in Table 3.
Result shows that corn growth is shown certain growth-promoting effect by the Bio-control Trichoderma obtained, and aspergillus flavus toxin Pollution restraint rate is higher.Secondly the growth-promoting effect of Aspergillus flavus is 0.8%-10.5% by good a few strain Antagonistic Fungi, and wherein, bacterial strain TG-102 growth-promoting effect is the highest, is 10.5%, is bacterial strain T95-2 and T40-3, growth-promoting effect respectively 5.5% and 4.5%.Press down toxic effect fruit preferably bacterial strain respectively TG-102, T40-3 and T85-5, it is suppressed that rate respectively 90.5%, 60.5% and 58.3%.
Aspergillus flavus is produced poison suppression ratio and to Semen Maydis growth-promoting effect by table 3 Antagonistic Fungi
| Investigation index | TG-102 | T95-2 | T85-5 | T12-1 | T21-2 | T40-3 | T100 | T22-1 |
| Growth-promoting rate % | 10.5 | 5.5 | 0.0 | 2.5 | 2.7 | 4.5 | 0.0 | 0.8 |
| Press down poison rate/% | 90.5 | 50.5 | 58.3 | 50.8 | 53.2 | 60.5 | 23.5 | 45.0 |
The mensuration of trichoderma pseudokiningii bacterium TG-102 metabolite bacteriostasis rate
The preparation of biocontrol microorganisms metabolite
After biocontrol microorganisms trichoderma pseudokiningii bacterium TG-102 activates on ramps, take a ring in slant culture liquid, 100mL/300mL liquid amount, 30 DEG C, after 160r/min shaken cultivation 72h, prepare into following treatment fluid: supernatant: culture fluid is centrifugal 15min under 12000r/min, takes supernatant, obtains aseptic supernatant after filtering with 0.22 μm of biofilter.
Bacteria suspension: culture fluid is centrifugal 15min under 12000r/min, abandons supernatant, is centrifuged for 3 times by sterile water wash again, adds sterilized water.
Protein crude extract: culture fluid 12000r/min at 4 DEG C abandons precipitation from 15min, in supernatant, reinforcing body ammonium sulfate is to 70% saturation, 4 DEG C stand overnight, the centrifugal 20min of 10000r/min at 4 DEG C, abandon supernatant, precipitate and suspend with 1/25 volume 10mmol/L, pH7.0 phosphate buffer, be then removed by filtration antibacterial that may be present with 0.22 μm of biofilter.
The impact on Aspergillus flavus mycelial growth of the biocontrol microorganisms metabolite
Assay method: take Aspergillus flavus bacteria suspension 1.5 × 1065mL, puts into temperature and drops in about 45 DEG C inclined-plane triangular flasks (100mL/350mL), after rocking 2min, pour into uniformly in culture dish.3 holes are made a call to card punch is equidistant around inclined-plane flat board, it is separately added into 3mL supernatant, filtrate, freezing supernatant, freezing and filtering liquid and protein crude extract with liquid-transfering gun, cultivate the radius detecting each process inhibition zone for 5 days when CK covers with flat board, each process three repetition for 30 DEG C.Experimental result is table 4 and Fig. 4 such as.
The inhibitory action of Aspergillus flavus mycelial growth is 100% by result display biocontrol microorganisms culture fluid；The inhibitory action of protein crude extract is also very strong, reaches more than 95%；Biocontrol microorganisms filtrate filters bacteriostasis rate all more than 30% with freezing, and wherein TG-102 bacteriostasis rate is the strongest, respectively reaches 60.5% and 58.5%, next to that T85-5, reaches 57.3% and 55.5%；The supernatant of biocontrol microorganisms and freeze clear bacteriostasis rate more than 45%, wherein TG-102 bacteriostasis rate is the strongest, respectively reaches 65.0% and 68.0%, next to that T85-5, reaches 58.5% and 63.2%, in Table 4.
The table 4 biocontrol microorganisms metabolite inhibitory action to Aspergillus flavus mycelial growth
The root colonization experiment of trichoderma pseudokiningii bacterium TG-102
Corn seed, through indoor accelerating germination, is selected the germination kind sowing that growing way is consistent, 10, every basin, is repeated five times.Start to connect bacterium after emergence of corn.The spore suspension concentration of trichoderma pseudokiningii bacterium TG-102 is 1.5 × 106/ mL, injects rhizosphere soil by spore suspension syringe, and every cave 15mL, clear water is as comparison.Gather primary sample after watering 1 day, within later every 7 days, collect once, continuous detecting 4 weeks.Accurately weigh soil sample to be measured 1 gram, put in the test tube equipped with 9ml sterilized water, vortex oscillation 3min, make the microorganism in soil fully dispersed, stand 1min, be 10-1Diluent, with 10-3With 10-4Diluent be coated with TSM culture medium, cultivate 72h for 28 DEG C, measure the trichoderma pseudokiningii bacterium TG-102 in milpa rhizosphere soil, in this, as the index of Trichoderma spp. Growth of Rhizosphere Fungi colonization ability.Not inoculate the milpa rhizosphere soil of trichoderma as comparison during counting.Result is in Table 5.
Trichoderma semi-selection culture medium (TSM culture medium): MgSO4(7H20) 0.2g, K2HPO40.9g, KCl0.15g, NH4NO31.0g, glucose 3.0g, rose-red 0.15g, 60% fenaminosulf wettable powder 0.3 gram, PCNB0.2g, agar 20g, distilled water 950ml.121min sterilizing 20 DEG C is standby.
Table 5 Trichoderma spp. TG-102 is at peanut plant rhizospere competition (× 10x/g)
| Process | 7 days | 14 days | 28 days |
| TG-102 | 2×105 | 4×104 | 5×103 |
| TG-102- A. flavus | 3×105 | 2.8×104 | 2×103 |
Note: the experimental data in table is three meansigma methodss repeated.
Biocontrol microorganisms is on the microbiotic impact of Rhizosphere of Crops
PCR-DGGE technology is mainly used in microorganisms multiformity and group difference, and this method discloses DNA sequence genetic polymorphism based on 16SrDNA gene order, for inferring the Phylogenetic Relationships of microorganism.The biocontrol bacterial strain TG-102 impact on Rhizosphere of Crops diversity of soil microorganism of this experimentation, is shown in Fig. 5.
Those skilled in the art are without departing from the essence of the present invention and spirit, kinds of schemes can be had to realize the present invention, the foregoing is only the embodiment that the present invention is preferably feasible, not thereby the interest field of the present invention is limited to, the equivalence change that all utilizations description of the present invention and accompanying drawing content are made, is both contained within the interest field of the present invention.
SEQUENCELISTING
<110>Tangshan City's animal husbandry and fishery quality monitoring center
<120>trichoderma pseudokiningii bacterium TG-102 and the application in prevention and control Semen Maydis aflatoxin contamination thereof
<130>1
<160>1
<170>PatentInversion3.3
<210>1
<211>574
<212>DNA
<213>TrichoderomakoningiiTG-102
<400>1
ccaaacccaatgtgaacgttaccaaactgttgcctcggcgggatctctgccccgggtgcg60
tcgcagccccggaccaaggcgcccgccggaggaccaaccaaaactcttattgtatacccc120
ctcgcgggttttttttataatctgagccttctcggcgcctctcgtaggcgtttcgaaaat180
gaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaa240
tgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattg300
cgcccgccagtattctggcgggcatgcctgtccgagcgtcatttcaaccctcgaacccct360
ccggggggtcggcgttggggatcggccctgccttggcggtggccgtctccgaaatacagt420
ggcggtctcgccgcagcctctcctgcgcagtagtttgcacactcgcatcgggagcgcggc480
gcgtccacagccgttaaacacccaacttctgaaatgttgacctcggatcaggtaggaata540
cccgctgaacttaagcatatcaataagcggagga574
Claims (10)
1. the trichoderma pseudokiningii bacterium TG-102(TrichoderomakoningiiTG-102 of an antibacterial and detoxicating), it is characterised in that deposit number is CCTCCNO:M2016146, by China typical culture collection center preservation, preservation date: on March 28th, 2016.
2. deposit number as claimed in claim 1 is the application in Semen Maydis is polluted by prevention and control Aspergillus flavus of the bacterial strain of CCTCCNO:M2016146.
3. deposit number as claimed in claim 1 is the application in the microbial organic fertilizer that Semen Maydis is polluted by preparation prevention and control Aspergillus flavus of the bacterial strain of CCTCCNO:M2016146.
4. a microbial organic fertilizer, it is characterised in that in described fertilizer, deposit number is that the bacterial strain content of CCTCCNO:M2016146 is 1.5 × 108More than cfu/g, the content of organic matter is 38-45%.
5. the fermentation process of the microbial organic fertilizer as described in claim 3 or 4, comprises the following steps that
(1) slant culture: by inoculation that deposit number is CCTCCNO:M2016146 in slant medium, cultivates 5-7 days for 25-28 DEG C；
(2) eggplant bottle liquid culture: be inoculated in body fluid culture medium by the trichoderma pseudokiningii bacterium after slant culture, cultivates 3-5 days under 25-28 DEG C of condition in incubator；
(3) medium-sized fermentation tank amplifies liquid culture: is swept away by the trichoderma pseudokiningii bacterium sterilized water in step (2), is inoculated in medium-sized fermentation tank, and sweat keeps dissolved oxygen concentration to be 18-22%, preferably 20%, temperature 28-30 DEG C, mixing speed 200-250r/min, ventilation is 10-15L/min；
(4) solid culture: by the liquid spawn in step (3) by volume 10% inoculum concentration be inoculated in solid medium, cultivation indoor cultivation is transferred to after inoculation, culturing room's temperature controls at 28-31 DEG C, culture medium temperature controls at 25-29 DEG C, relative air humidity controls at 95-98%, culture medium thickness is 5-7cm, and incubation time is 5-7 days；
(5) dry: after solid fermentation, by fertilizer natural air drying to water content control at 7-10%, trichoderma pseudokiningii bacterium TG-102 solid culture can be obtained；
(6) trichoderma pseudokiningii bacterium is carried out solid fermentation with the manioc waste become thoroughly decomposed in advance and feces of livestock and poultry mixture, regulate water content, SOLID ORGANIC material per ton adds trichoderma pseudokiningii bacterium TG-102 solid culture 20 kilograms, fermentation carries out stirring two days later, later every day carries out turning, within 5-7 days, gets final product fermentation ends；≤ 60 DEG C are dried so that it is water content≤30% i.e. packed products.
6. fermentation process as claimed in claim 5, it is characterised in that the slant culture based formulas in step (1) is: Rhizoma Solani tuber osi 200g, glucose 15g, agar 20g, distilled water 1000ml.
7. fermentation process as claimed in claim 5, it is characterised in that in step (2), liquid culture based formulas is: Testa Tritici 2.2%, glucose 1.0%, magnesium sulfate 0.45%, potassium dihydrogen phosphate 0.35%, calcium chloride 0.3%, and surplus is water, PH6.5-6.8.
8. the fermentation process as described in claim 5 or 7, it is characterised in that described in step (2), fluid medium is at 115-125 DEG C of sterilizing 25-35min, it is preferable that sterilizing 30min under 121 DEG C of wet heat conditions.
9. fermentation process as claimed in claim 5, it is characterised in that solid culture based formulas described in step (4) is: Testa Tritici and wheat straw powder weight ratio are 8:2, and water content is 70%, pH6.5,121 DEG C of sterilizing 30min.
10. microbial organic fertilizer application in Aspergillus flavus on preventing and treating Semen Maydis as described in any one of claim 3 to 9.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610282971.9A CN105802859B (en) | 2016-05-03 | 2016-05-03 | Trichoderma pseudokoningii TG-102 and application thereof in prevention and control of Aspergillus flavus bacterial contamination |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610282971.9A CN105802859B (en) | 2016-05-03 | 2016-05-03 | Trichoderma pseudokoningii TG-102 and application thereof in prevention and control of Aspergillus flavus bacterial contamination |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802859A true CN105802859A (en) | 2016-07-27 |
| CN105802859B CN105802859B (en) | 2020-06-02 |
Family
ID=56458940
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610282971.9A Active CN105802859B (en) | 2016-05-03 | 2016-05-03 | Trichoderma pseudokoningii TG-102 and application thereof in prevention and control of Aspergillus flavus bacterial contamination |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802859B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113004095A (en) * | 2021-01-15 | 2021-06-22 | 农业农村部环境保护科研监测所 | Composite microbial fertilizer for preventing and controlling aflatoxin pollution and preparation method thereof |
| CN113005050A (en) * | 2021-01-15 | 2021-06-22 | 农业农村部环境保护科研监测所 | Composite microbial agent for reducing aspergillus flavus infection and pollution of grain and oil crops as well as preparation method and application of composite microbial agent |
| CN114933974A (en) * | 2022-05-11 | 2022-08-23 | 华北理工大学 | Trichoderma pseudokoningii C5-9 and application thereof in antagonism of botrytis cinerea |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789230A (en) * | 2013-12-31 | 2014-05-14 | 浙江大学 | Biocontrol strain BS71 and application thereof to preventing crops from being polluted by aflatoxin |
-
2016
- 2016-05-03 CN CN201610282971.9A patent/CN105802859B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789230A (en) * | 2013-12-31 | 2014-05-14 | 浙江大学 | Biocontrol strain BS71 and application thereof to preventing crops from being polluted by aflatoxin |
Non-Patent Citations (1)
| Title |
|---|
| 郝林华等: "拟康氏木霉液态发酵条件的研究", 《菌物学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113004095A (en) * | 2021-01-15 | 2021-06-22 | 农业农村部环境保护科研监测所 | Composite microbial fertilizer for preventing and controlling aflatoxin pollution and preparation method thereof |
| CN113005050A (en) * | 2021-01-15 | 2021-06-22 | 农业农村部环境保护科研监测所 | Composite microbial agent for reducing aspergillus flavus infection and pollution of grain and oil crops as well as preparation method and application of composite microbial agent |
| CN114933974A (en) * | 2022-05-11 | 2022-08-23 | 华北理工大学 | Trichoderma pseudokoningii C5-9 and application thereof in antagonism of botrytis cinerea |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802859B (en) | 2020-06-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109266586B (en) | Bacillus belgii BMF03 and application and fermentation method thereof | |
| CN109055281B (en) | Bacillus belgii ZF2 and application thereof in plant disease control | |
| CN102433282B (en) | Bacillus subtilis NB12, as well as culture method and application thereof | |
| CN102212485B (en) | Trichoderma longibrachiatum and application thereof in preventing and treating vegetable diseases | |
| CN105586300B (en) | Ludwig enterobacteria BG10-1 and its application in Aspergillus flavus biological control | |
| CN101967455B (en) | Bacillus amyloliquefaciens EA19 for controlling wheat root diseases and preparation thereof | |
| CN110734871B (en) | Bacillus amyloliquefaciens and application thereof in agricultural production | |
| CN112006035B (en) | Microbial source bactericide for preventing and treating plant diseases and preparation method thereof | |
| CN108410757B (en) | One plant of streptomycete NBF715 separated and its application in control of crop disease | |
| CN110951645A (en) | Streptomyces hygroscopicus angustmycin subspecies and application thereof in preventing and treating plant oomycetes and fungal diseases and promoting plant growth | |
| CN101381685A (en) | Preparation method of tobacco black shank inoculum | |
| CN117136968A (en) | Composite microbial composition and application thereof | |
| CN113862160B (en) | Trichoderma pseudokoningii Tk905 strain with biocontrol and induced disease resistance effects and application thereof | |
| CN105802859A (en) | Trichoderoma koningii TG-102 and application of trichoderoma koningii TG-102 to prevention and control of corn aflatoxin pollution | |
| CN109880764A (en) | One plant of Bei Laisi bacillus and its application in prevention and treatment apple disease | |
| CN111808778B (en) | Bacillus wegener for preventing and treating verticillium wilt and culture method thereof, microbial inoculum and preparation method and application thereof | |
| CN113943670A (en) | Pseudomonas toralis for preventing diseases and promoting growth and application thereof | |
| CN105695342B (en) | Koning trichoderma bacterium TG-72 and its application in Aspergillus flavus biological control | |
| CN105838643B (en) | Bacillus subtilis JTFM1001 and its application in prevention and control corn aflatoxin contamination | |
| CN111909863B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN111642520A (en) | Paecilomyces lilacinus wettable powder and application thereof | |
| CN106399165B (en) | One plant of atrophy bacillus for preventing and treating plant root-knot nematode and its application | |
| CN114231467B (en) | Streptomyces aureoverticillatus DF06, microbial inoculum, preparation method and application thereof | |
| CN116590199B (en) | Paenibacillus piri and application thereof in prevention and treatment of corn ear rot | |
| CN113925064B (en) | Application of B-lysine-resistant bacillus in inhibition of growth of pitaya soft rot germs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |