CN112430589A

CN112430589A - Chondroitin sulfate ABC lyase mutant with high thermal stability and application thereof

Info

Publication number: CN112430589A
Application number: CN202011350745.2A
Authority: CN
Inventors: 康振; 堵国成; 陈坚; 王浩; 张琳; 刘平
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-11-26
Filing date: 2020-11-26
Publication date: 2021-03-02
Anticipated expiration: 2040-11-26
Also published as: CN112430589B

Abstract

The invention discloses a chondroitin sulfate ABC lyase mutant with high thermal stability and application thereof, belonging to the technical field of biological engineering. According to the invention, chondroitin sulfate ABC lyase from common proteus vulgaris is subjected to truncation mutation, and site-directed mutation is performed on the basis of the truncation mutant, so that the mutant with obviously improved thermal stability is obtained, the half-life period of the obtained mutant at 37 ℃ is improved by 247 times compared with that of a wild type, the recombinant bacteria for expressing the mutant are subjected to batch protein fermentation in a 3-L tank, and the protein expression amount can reach 1.7 g/L. Provides a new method for industrially producing chondroitin sulfate and dermatan sulfate, and can be used for eliminating mixed chondroitin sulfate in heparin preparation.

Description

Chondroitin sulfate ABC lyase mutant with high thermal stability and application thereof

Technical Field

The invention relates to a chondroitin sulfate ABC lyase mutant with high thermal stability and application thereof, belonging to the technical field of biological engineering.

Background

Chondroitin sulfate, a class of glycosaminoglycans that is covalently linked to proteins to form proteoglycans. Chondroitin sulfate is widely distributed on the extracellular matrix and cell surface of animal tissues, and sugar chains consisting of alternating glucuronate and N-acetylgalactosamine (also called N-acetylgalactosamine) disaccharide units are linked to serine residues of core protein by a sugar chain-like domain.

Chondroitin sulfate shows high biological activity, such as anti-cancer, anti-atherosclerosis, anti-inflammatory, immunoregulation, antioxidation and the like, plays an important role in biological processes of cell transfer, differentiation, proliferation, recognition, tissue formation and the like, and is also applied to medicine and clinic. Because the chondroitin sulfate has a large molecular weight and low bioavailability, many effects of the chondroitin sulfate cannot be effectively exerted when the chondroitin sulfate is used for treating spinal injuries and axon regeneration and inhibiting tumorigenesis.

Experiments in recent years prove that the chondroitin sulfate with the molecular weight of 3500-5300Da has the strongest pharmacological activity and better curative effects on preventing and treating rheumatic inflammation, healing wounds and the like. Therefore, it is very necessary to prepare low molecular weight chondroitin sulfate.

At present, the method for preparing low molecular weight chondroitin sulfate mainly comprises the following steps: (1) acid degradation, namely dissolving chondroitin sulfate in an acid solution (such as acid and hydrochloric acid) and degrading the chondroitin sulfate at a certain temperature, wherein the acid degradation can cause the reduction of sulfate radical content due to severe reaction and the reduction of the capacity of removing free radicals of oligosaccharide; (2) the oxidation degradation method is the most common method in the oxidation degradation method, and the oxidation degradation method has the advantages that the product is non-toxic, special post-treatment is not needed, and the damage to the structure of the disaccharide is small; (3) the enzymolysis method is to carry out enzymolysis on chondroitin sulfate by using chondroitin sulfate degrading enzymes such as chondroitinase or hyaluronidase to obtain oligosaccharide. Among them, the enzymolysis method is the most commonly used method for degrading chondroitin sulfate at present because of mild conditions and strong specificity.

Chondroitin sulfate lyase (ChSase) is a kind of lyase capable of degrading glycosaminoglycan such as chondroitin sulfate, chondroitin, hyaluronic acid, etc. into unsaturated disaccharide (and oligosaccharide). The chondroitin sulfate ABC lyase is a chondroitin sulfate lyase with the most extensive specificity, and has wide application prospects in the fields of industry, medicine and the like, for example, the chondroitin sulfate ABC lyase can be used for producing chondroitin sulfate oligosaccharides, and can be used for treating spinal injuries and the like in medicine. However, the low stability limits their use in industrial and medical fields.

In addition, in the current commercial heparin, because heparin is mostly extracted from the small intestine of the pig, chondroitin sulfate impurities are inevitably mixed in the separation and purification process, and the clinical application and the efficacy of the heparin as an anticoagulant are greatly influenced. The chondroitin sulfate ABC lyase has the function of specifically degrading chondroitin sulfate without causing the change and loss of the heparin structure, so that the chondroitin sulfate ABC lyase can be used for specifically eliminating the mixed chondroitin sulfate in the preparation of heparin to improve the purity and the quality of the heparin.

Disclosure of Invention

In order to solve the problems, the invention provides a chondroitin sulfate ABC lyase mutant with improved thermal stability and a recombinant expression method thereof.

The invention provides a mutant of chondroitin sulfate ABC lyase, which takes chondroitin sulfate ABC lyase derived from Proteus vulgaris (Proteus vulgaris) as a parent and truncates the amino acid of the parent, wherein the truncation comprises any one of (a) to (l):

(a) truncating the 166-170 th amino acid to obtain a mutant N delta 5, wherein the amino acid sequence is shown as SEQ ID NO. 2;

(b) truncating the amino acid at the position 166-175 to obtain a mutant N delta 10, wherein the amino acid sequence is shown as SEQ ID NO. 3;

(c) truncating the 166-180 th amino acid to obtain a mutant N delta 15;

(d) truncating the 166-186 amino acid to obtain a mutant N delta 21;

(e) truncating the 187-191 amino acid to obtain a mutant C delta 5;

(f) truncating the 182 th-191 th amino acid to obtain a mutant C delta 10;

(g) truncating the 177-191 amino acid to obtain a mutant C delta 15;

(h) truncating the amino acid at the 171-191 position to obtain a mutant C delta 21;

(i) truncating the amino acid at the 166-170 th site of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the glutamic acid (E) at the 689 th site of the truncated mutant into proline (P);

(j) truncating the amino acid at the 166-175 th site of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate alanine (A) at the 45 th site of the truncated mutant into glutamic acid (E);

(k) truncating the amino acid at the 166-th and 180-th positions of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the isoleucine (I) at the 897-th position of the truncated mutant into the valine (V);

(l) Truncating the amino acid 166-186 of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the lysine (K) at the 209 th position of the truncated mutant into the proline (P).

The present invention provides a gene encoding the mutant.

The invention provides an expression vector carrying the gene.

In one embodiment of the present invention, the expression vector is a pET series or pUC series vector.

In one embodiment of the invention, the expression vector is pET-28 a.

The invention provides a microbial cell expressing the mutant, or containing the gene.

In one embodiment of the invention, the microbial cell is a prokaryotic cell or a eukaryotic cell.

The invention provides a method for expressing chondroitin sulfate ABC lyase mutant, which is characterized in that the gene is connected with an expression vector to obtain a recombinant plasmid, the recombinant plasmid is transformed into a host cell to obtain a recombinant microbial cell, and the recombinant microbial cell is cultured to produce enzyme.

In one embodiment of the invention, the recombinant microorganism cell is cultured to the middle logarithmic phase, the bacterial liquid in the middle logarithmic phase is inoculated into the reaction system, after the culture is carried out at 25-30 ℃ and 250rpm for 2-3h, IPTG with the final concentration of 0.1-0.2mM and 5-10% arabinose are added for induction, and the culture is carried out at 20-25 ℃ and 600rpm of 500-.

In one embodiment of the invention, IPTG and arabinose are added and then cultured for 16-20 h.

In one embodiment of the present invention, the expression vector is a pET series, pUC, pHT series vector.

In one embodiment of the invention, the host cell is Escherichia coli or Bacillus subtilis.

The invention provides a method for preparing chondroitin sulfate with molecular weight, which hydrolyzes the chondroitin sulfate by using the mutant.

In one embodiment of the present invention, the amount of the enzyme added to the reaction system is 1.5X 10²-6×10³U/g substrate.

In one embodiment of the present invention, the concentration of chondroitin sulfate in the reaction system is 10 to 20 g/L.

In one embodiment of the present invention, the amount of enzyme added is 3.0X 10³-1.2×10⁵U/L。

In one embodiment of the invention, the reaction time is from 0 to 2 h.

In one embodiment of the invention, the reaction time is from 0.5 to 1.5 h.

In one embodiment of the invention, the reaction temperature is from 25 to 35 ℃.

The invention provides application of the chondroitin sulfate ABC lyase mutant in preparation of low-molecular-weight chondroitin sulfate or oligosaccharide or removal of chondroitin sulfate.

In one embodiment of the invention, said cleaving chondroitin sulfate comprises eliminating chondroitin sulfate confounded in heparin production.

The invention has the beneficial effects that: compared with wild enzyme before mutation, the chondroitin sulfate ABC lyase truncated mutant N delta 5 provided by the invention has the advantage that the half-life of the mutant at 37 ℃ is improved to 18min from 4.6min of the wild enzyme. The invention also provides a chondroitin sulfate ABC lyase truncated mutant combined site-directed mutant N delta 5/E689P, N delta 10/A45E, N delta 15/I897V and N delta 21/K209P, wherein the half-lives of the mutants at 37 ℃ are respectively 19h, 17.3h, 14.8h and 13.2h, and are respectively improved by 247 times, 225 times, 193 times and 172 times compared with the wild type. The mutant N delta 5/E689P is subjected to 3-L tank batch fermentation, and the final protein expression level reaches 1.7 g/L. The obtained mutant N delta 5/E689P is used for preparing low molecular weight chondroitin sulfate, good effect is found, and the chondroitin sulfate with different molecular weights can be obtained by controlling the amount of the added enzyme and the acting time.

Drawings

FIG. 1 is a graph of the stability of each truncation mutant at 30 ℃.

FIG. 2 is a graph of the stability of the truncation mutants at 37 ℃.

FIG. 3 shows the enzyme activities of crude enzymes of various site-directed mutants of truncated mutant N.DELTA.5.

FIG. 4 shows the stability of crude enzyme of each site-directed mutant of the truncated mutant N.DELTA.5.

FIG. 5 shows the stability of mutant N.DELTA.5/E689P at 37 ℃.

FIG. 6 shows the stability of site-directed mutants of truncation mutants at 37 ℃.

FIG. 7 shows the stability of crude enzyme of saturation mutant of truncated mutant N.DELTA.5.

FIG. 8 is a 3-L tank batch fermentation of mutant N.DELTA.5/E689P.

FIG. 9 shows the preparation of chondroitin sulfates having different molecular weights.

Detailed Description

The sequence table is related nucleotide sequence information:

SEQ ID NO.1 is an amino acid sequence encoding chondroitin sulfate ABC lyase, and SEQ ID NO.4 is a nucleotide sequence encoding chondroitin sulfate ABC lyase.

The method for measuring the enzyme activity of the chondroitinase ABC lyase comprises the following steps:

chondroitin sulfate was used as a substrate, and the substrate concentration was 5g/L, and the substrate was dissolved with Tris-HCl buffer (pH 7.4). The reaction system for enzyme activity determination is 1mL, and contains 40 mu L of enzyme solution and 960 mu L of chondroitin sulfate substrate solution. The reaction was carried out at 30 ℃ for 1min, and the change in absorbance at 232nm was measured by a spectrophotometer. Enzyme activity definition unit: the amount of enzyme required to convert 1. mu. mol of substrate per minute was 1U.

The method for determining the thermal stability of the chondroitin sulfate ABC lyase comprises the following steps: and (3) carrying out water bath on the chondroitin sulfate ABC lyase pure enzyme for a certain time at different temperatures, rapidly cooling to room temperature, and measuring the residual enzyme activity.

TABLE 1 primers used in example 1

Primer name	Primer sequence (5 '-3')
		CΔ5-F	GTCGATAGTATTCGTTTTAAAGCGCC
CΔ5-R	TAAGGTCATCTCTCGATTTTCAAGATCG
		CΔ10-F	GTCGATAGTATTCGTTTTAAAGCGCC
CΔ10-R	GGTATTGGTTGCATTTAAGGTCATCTC
		CΔ15-F	GTCGATAGTATTCGTTTTAAAGCGCC
CΔ15-R	AGTACCATCAGAGGAGGTATTGGT
		CΔ21-F	GTCGATAGTATTCGTTTTAAAGCGCC
CΔ21-R	ACGCCCAATGCTGTCTTG
		NΔ21-F	CAAGACAGCATTGGGCGTT
NΔ21-R	ATTTTCAAGATCGTTATTTAAAGAGACTCCCA
		NΔ15-F	TCCTCTGATGGTACTCAAGACAGC
NΔ15-R	ATTTTCAAGATCGTTATTTAAAGAGACTCCCA
		NΔ10-F	AATGCAACCAATACCTCCTCTG
NΔ10-R	ATTTTCAAGATCGTTATTTAAAGAGACTCCCA
		NΔ5-F	TCTTTAGGTGCTAAAGTCGATAGTATTCG
NΔ5-R	ATTTTCAAGATCGTTATTTAAAGAGACTCCCA

TABLE 2 primers used in example 2

TABLE 3 primers used in example 3

TABLE 4 primers used in example 4

Example 1: preparation method of chondroitin sulfate ABC lyase truncated mutant

Synthesizing chondroitin sulfate ABC lyase derived from common proteus, wherein the original amino acid sequence of the chondroitin sulfate ABC lyase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO. 4. PCR was performed using the primers shown in Table 1. Connecting the gene obtained after truncation to the restriction sites of plasmid XhoI and NdeI of pET-28a, introducing the gene into Escherichia coli BL21(DE3), culturing at 37 ℃ until a single clone grows out, selecting the single clone for sequencing, and verifying that the correct transformant is a positive transformant, namely the recombinant Escherichia coli strain for expressing the chondroitin sulfate ABC lyase mutant.

The obtained recombinant strain is inoculated in an LB culture medium, cultured overnight at 37 ℃, then transferred into a 250mL triangular shake flask filled with the LB culture medium, cultured for 1h at 30 ℃, added with IPTG with the final concentration of 0.5mM for induction, and cultured for 20h at 27 ℃.

Process for obtaining the enzyme from recombinant E.coli: and after the culture is finished, centrifuging the fermentation liquor at 4 ℃ and 6800rpm for 10min, discarding the supernatant, resuspending the thallus with 20mM Tris-HCl for 2-3 times, crushing the thallus with an ultrasonic cell crusher, centrifuging the thallus at 12000rpm for 20min at a high speed to obtain crude intracellular enzyme, and eluting the crude intracellular enzyme solution with 100mM imidazole after the crude intracellular enzyme solution passes through a membrane to obtain the pure enzyme of the chondroitinase ABC mutant.

Respectively treating the original chondroitin sulfate ABC lyase and the truncated mutant of the chondroitin sulfate ABC lyase in water baths at 30 ℃ and 37 ℃ for different times, quickly cooling to room temperature, and determining the residual enzyme activity. As shown in FIG. 1 (the broken lines are N.DELTA.5, N.DELTA.15, N.DELTA.10, N.DELTA.21, C.DELTA.5, WT, C.DELTA.10, C.DELTA.15, and C.DELTA.21 in this order from top to bottom), the mutant N.DELTA.5 still maintained the enzyme activity at about 80% after 8 hours of treatment at 30 ℃ and was the strain with the highest stability. As shown in FIG. 2, at 37 ℃, the half-life of the mutant N delta 5 is 18min, the half-life of the wild type is 4.6min, and the stability of N delta 5 is improved by 291%.

Example 2: preparation of chondroitin sulfate ABC lyase site-directed mutant

(1) Preparation of N delta 5 site-directed mutants of truncated mutants

Site-directed mutagenesis is carried out on the truncated mutant N delta 5 by taking a recombinant plasmid containing an amino acid sequence shown in SEQ ID NO.2 as a template, and the sequence of a site-directed primer is shown in Table 2; obtaining a circular plasmid with a cross gap by whole plasmid amplification, digesting a template plasmid by Dpn I fast cutting enzyme, directly transforming E.coli BL21(DE3) competent cells by digestion liquid, and verifying sequencing of the monoclonal plasmid.

Inoculating the recombinant escherichia coli strain with correct sequencing into an LB culture medium, culturing overnight at 37 ℃, transferring into a 250mL triangular shake flask filled with the LB culture medium, culturing for 1h at 30 ℃, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.5mM for induction, and culturing for 20h at 27 ℃.

Process for obtaining the enzyme from recombinant E.coli: and after the culture is finished, centrifuging the fermentation liquor at 4 ℃ and 6800rpm for 10min, discarding the supernatant, resuspending the thallus with 20mM Tris-HCl for 2-3 times, crushing the thallus with an ultrasonic cell crusher, centrifuging the thallus at 12000rpm for 20min at a high speed to obtain crude intracellular enzyme, and eluting the crude intracellular enzyme liquid with 100mM imidazole after passing through a membrane to obtain the pure enzyme of the original chondroitinase ABC or the chondroitinase ABC mutant.

Procedure for screening mutants with improved thermostability: firstly, analyzing the influence of point mutation on enzyme activity, and performing coarse screening by using crude enzyme to determine the enzyme activity, wherein the results are shown in figure 3, the crude enzyme activities of mutants N delta 5/E689P and N delta 5/A45E are higher than that of a control N delta 5, the enzyme activities are 788U/g cell dry weight and 484U/g cell dry weight respectively, and the N delta 5 enzyme activity is 415U/g cell dry weight; the crude enzyme activities of the remaining mutants all showed a different degree of reduction.

Further analysis of the heat tolerance of mutants N delta 5/E689P and N delta 5/A45E, crude enzyme solution was treated in a metal bath at 37 ℃ for 30min, as shown in FIG. 4, the residual enzyme activity of mutant N delta 5/E689P still remained 99.2%, while the residual enzyme activity of mutant N delta 5/A45E and control N delta 5 was only 50% -60%. On the basis of the results, the N delta 5/E689P mutant was purified and tested for stability at 37 ℃, and the results are shown in FIG. 5, wherein the stability of the mutant N delta 5/E689P is obviously higher than that of the control N delta 5. T of mutant N.DELTA.5/E689P_1/2 ^37℃19h, compared to control N.DELTA.5 (t)_1/2 ^37℃18min) was increased 62-fold and 247-fold compared to the wild type.

(2) Preparation of site-directed mutants of truncated mutants N delta 10, N delta 15 and N delta 21

Using recombinant plasmids containing amino acid sequences of mutants N delta 10, N delta 15 and N delta 21 as templates, and mutating corresponding sequences by using site-specific mutagenesis primers respectively, wherein the site-specific mutagenesis primer sequences corresponding to different templates are shown in Table 3; obtaining circular plasmid with crossed nicks through whole plasmid amplification, digesting template plasmid with Dpn I fast cutting enzyme, directly transforming E.coli BL21(DE3) competent cells with digestive juice, smearing the transformed transformation liquid on an LB flat plate, culturing at 37 ℃ until monoclone grows out, and carrying out plasmid sequencing verification on the monoclone.

Process for obtaining the enzyme from recombinant E.coli: after the culture is finished, the fermentation liquor is centrifuged for 10min at the temperature of 4 ℃ and the speed of 6800rpm, the supernatant is discarded, the thalli are resuspended for 2 to 3 times by 20mM Tris-HCl, and the thalli are centrifuged for 20min at the high speed of 12000rpm after being crushed by an ultrasonic cell crusher, so as to obtain crude enzyme in cells. And (3) eluting the crude intracellular enzyme solution with 100mM imidazole after passing through a membrane to obtain the pure enzyme of the original chondroitinase ABC or the chondroitinase ABC mutant.

The three pure enzymes obtained were treated at 37 ℃ for 30min together with the mutant N.DELTA.5/E689P obtained in example 2, rapidly cooled to room temperature, and the residual enzyme activity was measured, and the results are shown in FIG. 6, in which the stability of all four mutants was greatly improved as compared with the wild type. Wherein, point mutants N delta 5/E689P, N delta 10/A45E, N delta 15/I897V and N delta 21/K209P have half-lives of 19h, 17.3h, 14.8h and 13.2h at 37 ℃, respectively, and are improved by 247 times, 225 times, 193 times and 172 times compared with the wild type.

Example 3: preparation of chondroitin sulfate ABC lyase saturated mutant

Saturation mutagenesis was performed on N Δ 5: the method comprises the steps of taking contained recombinant plasmids as templates, carrying out full plasmid amplification on a target sequence by using a saturation mutation primer (the sequence of the saturation mutation primer is shown in table 4), obtaining circular plasmids with crossed gaps, digesting the template plasmids by using Dpn I fast-cutting enzyme, directly transforming E.coli BL21(DE3) competent cells by using digestion liquid, and carrying out sequencing verification on the monoclonal anti-plasmid.

Inoculating the recombinant escherichia coli strain with correct sequencing into an LB culture medium, culturing overnight at 37 ℃, transferring into a 250mL triangular shake flask filled with the LB culture medium, culturing for 1h at 30 ℃, adding IPTG (isopropyl thiogalactoside) with the final concentration of 0.5mM for induction, and culturing for 20h at 27 ℃. After the culture is finished, the fermentation liquor is centrifuged for 10min at the temperature of 4 ℃ and the speed of 6800rpm, the supernatant is discarded, the thalli are resuspended for 2 to 3 times by 20mM Tris-HCl, and the thalli are centrifuged for 20min at the high speed of 12000rpm after being crushed by an ultrasonic cell crusher, so as to obtain crude enzyme in cells.

And (3) performing a stability coarse screening by using the crude enzyme, treating the crude enzyme at 37 ℃ for 30min, rapidly cooling to room temperature, and determining the residual enzyme activity of the crude enzyme, wherein the result is shown in FIG. 7, and after the saturated mutant is subjected to the same heat treatment, only the residual enzyme activities of the mutants E689G and E689W are slightly higher than that of a control mutant, but still far lower than that of the mutant E689P. The stability of the remaining mutants was shown to be reduced to a different extent compared to the control, indicating that the substitution of glutamic acid (E) at position 689 to proline (P) contributes to the increased stability of chondroitin sulfate ABC lyase at 37 ℃.

Example 4: batch fermentation of chondroitin sulfate ABC lyase

Recombinant E.coli containing the chondroitin sulfate ABC lyase mutant N.DELTA.5/E689P obtained in example 2 was subjected to 3-L tank batch fermentation: sucking 100 μ L of the bacterial liquid from the frozen glycerin tube, inoculating into 100mL of fresh LB culture medium containing 50 μ g/mL kanamycin, culturing at 37 ℃ and 220rpm to logarithmic phase, transferring the seed liquid into a 3-L fermentation tank with the liquid loading capacity of 900mL according to the inoculum size of 10mL/100mL, culturing at 30 ℃ and 250rpm for 3h, adding IPTG with the final concentration of 0.2mM and 10% arabinose for induction, and continuing culturing at 25 ℃ and 600 rpm. The aeration rate was 1.5vvm, and 2M NaOH was automatically added to maintain the pH of the fermentation broth at 7.0. The results are shown in FIG. 8, 3h after induction, the intracellular enzyme activity of the recombinant bacterium reaches 2.4X 10⁴U/L, biomass is 17, and the activity of the intracellular enzyme is increased continuously. After 16h of induction, intracellular enzyme activity reached 9.3X 10⁴U/L, biomass is 38, and the protein expression amount reaches 1.6 g/L. After 20h of induction, intracellular enzyme activity reached 1.0X 10⁵U/L, biomass is 39, then the thalli enter a stationary phase, the enzyme activity is not increased basically, and the protein expression reaches 1.7 g/L.

Example 5: preparation of chondroitin sulfates of different molecular weights

The chondroitin sulfate ABC lyase mutant N.DELTA.5/E689P obtained in example 2 was used for the preparation of low molecular weight chondroitin sulfate. The substrate is commercial sulfuric acid softOssein, purchased from Shanghai, was dissolved in 20mM Tris-HCl to a concentration of 20g/L, and different amounts of enzymes were added to react at 30 ℃ for different periods of time, and then the reaction solution was heated in a water bath with boiling water for 3min to terminate the reaction, and its molecular weight was measured by HPLC-GPC. As a result, as shown in FIG. 9, the amounts of the enzymes added from top to bottom were 3.0X 10³U/L、6.0×10³U/L、1.2×10⁴U/L、3.0×10⁴U/L、6.0×10⁴U/L、1.2×10⁵U/L, the initial reaction rate of depolymerization is faster, the molecular weight is rapidly reduced, the higher the enzyme activity is, the faster the molecular weight reduction rate is, and then the reaction rate is gradually reduced until the molecular weight is hardly changed. The final molecular weight from top to bottom is about 20.4kDa, 12.3kDa, 5.4kDa, 2.1kDa, 1.8kDa, 1.7 kDa. Therefore, by controlling the enzyme adding amount, the low molecular weight chondroitin sulfate with different molecular weights can be prepared.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of south of the Yangtze river

<120> chondroitin sulfate ABC lyase mutant with high thermal stability and application thereof

<130> BAA200952A

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 1021

<212> PRT

<213> Proteus vulgaris

<400> 1

Met Pro Ile Phe Arg Phe Thr Ala Leu Ala Met Thr Leu Gly Leu Leu

1 5 10 15

Ser Ala Pro Tyr Asn Ala Met Ala Ala Thr Ser Asn Pro Ala Phe Asp

20 25 30

Pro Lys Asn Leu Met Gln Ser Glu Ile Tyr His Phe Ala Gln Asn Asn

35 40 45

Pro Leu Ala Asp Phe Ser Ser Asp Lys Asn Ser Ile Leu Thr Leu Ser

50 55 60

Asp Lys Arg Ser Ile Met Gly Asn Gln Ser Leu Leu Trp Lys Trp Lys

65 70 75 80

Gly Gly Ser Ser Phe Thr Leu His Lys Lys Leu Ile Val Pro Thr Asp

85 90 95

Lys Glu Ala Ser Lys Ala Trp Gly Arg Ser Ser Thr Pro Val Phe Ser

100 105 110

Phe Trp Leu Tyr Asn Glu Lys Pro Ile Asp Gly Tyr Leu Thr Ile Asp

115 120 125

Phe Gly Glu Lys Leu Ile Ser Thr Ser Glu Ala Gln Ala Gly Phe Lys

130 135 140

Val Lys Leu Asp Phe Thr Gly Trp Arg Ala Val Gly Val Ser Leu Asn

145 150 155 160

Asn Asp Leu Glu Asn Arg Glu Met Thr Leu Asn Ala Thr Asn Thr Ser

165 170 175

Ser Asp Gly Thr Gln Asp Ser Ile Gly Arg Ser Leu Gly Ala Lys Val

180 185 190

Asp Ser Ile Arg Phe Lys Ala Pro Ser Asn Val Ser Gln Gly Glu Ile

195 200 205

Tyr Ile Asp Arg Ile Met Phe Ser Val Asp Asp Ala Arg Tyr Gln Trp

210 215 220

Ser Asp Tyr Gln Val Lys Thr Arg Leu Ser Glu Pro Glu Ile Gln Phe

225 230 235 240

His Asn Val Lys Pro Gln Leu Pro Val Thr Pro Glu Asn Leu Ala Ala

245 250 255

Ile Asp Leu Ile Arg Gln Arg Leu Ile Asn Glu Phe Val Gly Gly Glu

260 265 270

Lys Glu Thr Asn Leu Ala Leu Glu Glu Asn Ile Ser Lys Leu Lys Ser

275 280 285

Asp Phe Asp Ala Leu Asn Ile His Thr Leu Ala Asn Gly Gly Thr Gln

290 295 300

Gly Arg His Leu Ile Thr Asp Lys Gln Ile Ile Ile Tyr Gln Pro Glu

305 310 315 320

Asn Leu Asn Ser Gln Asp Lys Gln Leu Phe Asp Asn Tyr Val Ile Leu

325 330 335

Gly Asn Tyr Thr Thr Leu Met Phe Asn Ile Ser Arg Ala Tyr Val Leu

340 345 350

Glu Lys Asp Pro Thr Gln Lys Ala Gln Leu Lys Gln Met Tyr Leu Leu

355 360 365

Met Thr Lys His Leu Leu Asp Gln Gly Phe Val Lys Gly Ser Ala Leu

370 375 380

Val Thr Thr His His Trp Gly Tyr Ser Ser Arg Trp Trp Tyr Ile Ser

385 390 395 400

Thr Leu Leu Met Ser Asp Ala Leu Lys Glu Ala Asn Leu Gln Thr Gln

405 410 415

Val Tyr Asp Ser Leu Leu Trp Tyr Ser Arg Glu Phe Lys Ser Ser Phe

420 425 430

Asp Met Lys Val Ser Ala Asp Ser Ser Asp Leu Asp Tyr Phe Asn Thr

435 440 445

Leu Ser Arg Gln His Leu Ala Leu Leu Leu Leu Glu Pro Asp Asp Gln

450 455 460

Lys Arg Ile Asn Leu Val Asn Thr Phe Ser His Tyr Ile Thr Gly Ala

465 470 475 480

Leu Thr Gln Val Pro Pro Gly Gly Lys Asp Gly Leu Arg Pro Asp Gly

485 490 495

Thr Ala Trp Arg His Glu Gly Asn Tyr Pro Gly Tyr Ser Phe Pro Ala

500 505 510

Phe Lys Asn Ala Ser Gln Leu Ile Tyr Leu Leu Arg Asp Thr Pro Phe

515 520 525

Ser Val Gly Glu Ser Gly Trp Asn Asn Leu Lys Lys Ala Met Val Ser

530 535 540

Ala Trp Ile Tyr Ser Asn Pro Glu Val Gly Leu Pro Leu Ala Gly Arg

545 550 555 560

His Pro Phe Asn Ser Pro Ser Leu Lys Ser Val Ala Gln Gly Tyr Tyr

565 570 575

Trp Leu Ala Met Ser Ala Lys Ser Ser Pro Asp Lys Thr Leu Ala Ser

580 585 590

Ile Tyr Leu Ala Ile Ser Asp Lys Thr Gln Asn Glu Ser Thr Ala Ile

595 600 605

Phe Gly Glu Thr Ile Thr Pro Ala Ser Leu Pro Gln Gly Phe Tyr Ala

610 615 620

Phe Asn Gly Gly Ala Phe Gly Ile His Arg Trp Gln Asp Lys Met Val

625 630 635 640

Thr Leu Lys Ala Tyr Asn Thr Asn Val Trp Ser Ser Glu Ile Tyr Asn

645 650 655

Lys Asp Asn Arg Tyr Gly Arg Tyr Gln Ser His Gly Val Ala Gln Ile

660 665 670

Val Ser Asn Gly Ser Gln Leu Ser Gln Gly Tyr Gln Gln Glu Gly Trp

675 680 685

Asp Trp Asn Arg Met Glu Gly Ala Thr Thr Ile His Leu Pro Leu Lys

690 695 700

Asp Leu Asp Ser Pro Lys Pro His Thr Leu Met Gln Arg Gly Glu Arg

705 710 715 720

Gly Phe Ser Gly Thr Ser Ser Leu Glu Gly Gln Tyr Gly Met Met Ala

725 730 735

Phe Asn Leu Ile Tyr Pro Ala Asn Leu Glu Arg Phe Asp Pro Asn Phe

740 745 750

Thr Ala Lys Lys Ser Val Leu Ala Ala Asp Asn His Leu Ile Phe Ile

755 760 765

Gly Ser Asn Ile Asn Ser Ser Asp Lys Asn Lys Asn Val Glu Thr Thr

770 775 780

Leu Phe Gln His Ala Ile Thr Pro Thr Leu Asn Thr Leu Trp Ile Asn

785 790 795 800

Gly Gln Lys Ile Glu Asn Met Pro Tyr Gln Thr Thr Leu Gln Gln Gly

805 810 815

Asp Trp Leu Ile Asp Ser Asn Gly Asn Gly Tyr Leu Ile Thr Gln Ala

820 825 830

Glu Lys Val Asn Val Ser Arg Gln His Gln Val Ser Ala Glu Asn Lys

835 840 845

Asn Arg Gln Pro Thr Glu Gly Asn Phe Ser Ser Ala Trp Ile Asp His

850 855 860

Ser Thr Arg Pro Lys Asp Ala Ser Tyr Glu Tyr Met Val Phe Leu Asp

865 870 875 880

Ala Thr Pro Glu Lys Met Gly Glu Met Ala Gln Lys Phe Arg Glu Asn

885 890 895

Asn Gly Leu Tyr Gln Val Leu Arg Lys Asp Lys Asp Val His Ile Ile

900 905 910

Leu Asp Lys Leu Ser Asn Val Thr Gly Tyr Ala Phe Tyr Gln Pro Ala

915 920 925

Ser Ile Glu Asp Lys Trp Ile Lys Lys Val Asn Lys Pro Ala Ile Val

930 935 940

Met Thr His Arg Gln Lys Asp Thr Leu Ile Val Ser Ala Val Thr Pro

945 950 955 960

Asp Leu Asn Met Thr Arg Gln Lys Ala Ala Thr Pro Val Thr Ile Asn

965 970 975

Val Thr Ile Asn Gly Lys Trp Gln Ser Ala Asp Lys Asn Ser Glu Val

980 985 990

Lys Tyr Gln Val Ser Gly Asp Asn Thr Glu Leu Thr Phe Thr Ser Tyr

995 1000 1005

Phe Gly Ile Pro Gln Glu Ile Lys Leu Ser Pro Leu Pro

1010 1015 1020

<210> 2

<211> 1016

<212> PRT

<213> Artificial sequence

<400> 2

Met Pro Ile Phe Arg Phe Thr Ala Leu Ala Met Thr Leu Gly Leu Leu

1 5 10 15

Ser Ala Pro Tyr Asn Ala Met Ala Ala Thr Ser Asn Pro Ala Phe Asp

20 25 30

Pro Lys Asn Leu Met Gln Ser Glu Ile Tyr His Phe Ala Gln Asn Asn

35 40 45

Pro Leu Ala Asp Phe Ser Ser Asp Lys Asn Ser Ile Leu Thr Leu Ser

50 55 60

Asp Lys Arg Ser Ile Met Gly Asn Gln Ser Leu Leu Trp Lys Trp Lys

65 70 75 80

Gly Gly Ser Ser Phe Thr Leu His Lys Lys Leu Ile Val Pro Thr Asp

85 90 95

Lys Glu Ala Ser Lys Ala Trp Gly Arg Ser Ser Thr Pro Val Phe Ser

100 105 110

Phe Trp Leu Tyr Asn Glu Lys Pro Ile Asp Gly Tyr Leu Thr Ile Asp

115 120 125

Phe Gly Glu Lys Leu Ile Ser Thr Ser Glu Ala Gln Ala Gly Phe Lys

130 135 140

Val Lys Leu Asp Phe Thr Gly Trp Arg Ala Val Gly Val Ser Leu Asn

145 150 155 160

Asn Asp Leu Glu Asn Asn Ala Thr Asn Thr Ser Ser Asp Gly Thr Gln

165 170 175

Asp Ser Ile Gly Arg Ser Leu Gly Ala Lys Val Asp Ser Ile Arg Phe

180 185 190

Lys Ala Pro Ser Asn Val Ser Gln Gly Glu Ile Tyr Ile Asp Arg Ile

195 200 205

Met Phe Ser Val Asp Asp Ala Arg Tyr Gln Trp Ser Asp Tyr Gln Val

210 215 220

Lys Thr Arg Leu Ser Glu Pro Glu Ile Gln Phe His Asn Val Lys Pro

225 230 235 240

Gln Leu Pro Val Thr Pro Glu Asn Leu Ala Ala Ile Asp Leu Ile Arg

245 250 255

Gln Arg Leu Ile Asn Glu Phe Val Gly Gly Glu Lys Glu Thr Asn Leu

260 265 270

Ala Leu Glu Glu Asn Ile Ser Lys Leu Lys Ser Asp Phe Asp Ala Leu

275 280 285

Asn Ile His Thr Leu Ala Asn Gly Gly Thr Gln Gly Arg His Leu Ile

290 295 300

Thr Asp Lys Gln Ile Ile Ile Tyr Gln Pro Glu Asn Leu Asn Ser Gln

305 310 315 320

Asp Lys Gln Leu Phe Asp Asn Tyr Val Ile Leu Gly Asn Tyr Thr Thr

325 330 335

Leu Met Phe Asn Ile Ser Arg Ala Tyr Val Leu Glu Lys Asp Pro Thr

340 345 350

Gln Lys Ala Gln Leu Lys Gln Met Tyr Leu Leu Met Thr Lys His Leu

355 360 365

Leu Asp Gln Gly Phe Val Lys Gly Ser Ala Leu Val Thr Thr His His

370 375 380

Trp Gly Tyr Ser Ser Arg Trp Trp Tyr Ile Ser Thr Leu Leu Met Ser

385 390 395 400

Asp Ala Leu Lys Glu Ala Asn Leu Gln Thr Gln Val Tyr Asp Ser Leu

405 410 415

Leu Trp Tyr Ser Arg Glu Phe Lys Ser Ser Phe Asp Met Lys Val Ser

420 425 430

Ala Asp Ser Ser Asp Leu Asp Tyr Phe Asn Thr Leu Ser Arg Gln His

435 440 445

Leu Ala Leu Leu Leu Leu Glu Pro Asp Asp Gln Lys Arg Ile Asn Leu

450 455 460

Val Asn Thr Phe Ser His Tyr Ile Thr Gly Ala Leu Thr Gln Val Pro

465 470 475 480

Pro Gly Gly Lys Asp Gly Leu Arg Pro Asp Gly Thr Ala Trp Arg His

485 490 495

Glu Gly Asn Tyr Pro Gly Tyr Ser Phe Pro Ala Phe Lys Asn Ala Ser

500 505 510

Gln Leu Ile Tyr Leu Leu Arg Asp Thr Pro Phe Ser Val Gly Glu Ser

515 520 525

Gly Trp Asn Asn Leu Lys Lys Ala Met Val Ser Ala Trp Ile Tyr Ser

530 535 540

Asn Pro Glu Val Gly Leu Pro Leu Ala Gly Arg His Pro Phe Asn Ser

545 550 555 560

Pro Ser Leu Lys Ser Val Ala Gln Gly Tyr Tyr Trp Leu Ala Met Ser

565 570 575

Ala Lys Ser Ser Pro Asp Lys Thr Leu Ala Ser Ile Tyr Leu Ala Ile

580 585 590

Ser Asp Lys Thr Gln Asn Glu Ser Thr Ala Ile Phe Gly Glu Thr Ile

595 600 605

Thr Pro Ala Ser Leu Pro Gln Gly Phe Tyr Ala Phe Asn Gly Gly Ala

610 615 620

Phe Gly Ile His Arg Trp Gln Asp Lys Met Val Thr Leu Lys Ala Tyr

625 630 635 640

Asn Thr Asn Val Trp Ser Ser Glu Ile Tyr Asn Lys Asp Asn Arg Tyr

645 650 655

Gly Arg Tyr Gln Ser His Gly Val Ala Gln Ile Val Ser Asn Gly Ser

660 665 670

Gln Leu Ser Gln Gly Tyr Gln Gln Glu Gly Trp Asp Trp Asn Arg Met

675 680 685

Glu Gly Ala Thr Thr Ile His Leu Pro Leu Lys Asp Leu Asp Ser Pro

690 695 700

Lys Pro His Thr Leu Met Gln Arg Gly Glu Arg Gly Phe Ser Gly Thr

705 710 715 720

Ser Ser Leu Glu Gly Gln Tyr Gly Met Met Ala Phe Asn Leu Ile Tyr

725 730 735

Pro Ala Asn Leu Glu Arg Phe Asp Pro Asn Phe Thr Ala Lys Lys Ser

740 745 750

Val Leu Ala Ala Asp Asn His Leu Ile Phe Ile Gly Ser Asn Ile Asn

755 760 765

Ser Ser Asp Lys Asn Lys Asn Val Glu Thr Thr Leu Phe Gln His Ala

770 775 780

Ile Thr Pro Thr Leu Asn Thr Leu Trp Ile Asn Gly Gln Lys Ile Glu

785 790 795 800

Asn Met Pro Tyr Gln Thr Thr Leu Gln Gln Gly Asp Trp Leu Ile Asp

805 810 815

Ser Asn Gly Asn Gly Tyr Leu Ile Thr Gln Ala Glu Lys Val Asn Val

820 825 830

Ser Arg Gln His Gln Val Ser Ala Glu Asn Lys Asn Arg Gln Pro Thr

835 840 845

Glu Gly Asn Phe Ser Ser Ala Trp Ile Asp His Ser Thr Arg Pro Lys

850 855 860

Asp Ala Ser Tyr Glu Tyr Met Val Phe Leu Asp Ala Thr Pro Glu Lys

865 870 875 880

Met Gly Glu Met Ala Gln Lys Phe Arg Glu Asn Asn Gly Leu Tyr Gln

885 890 895

Val Leu Arg Lys Asp Lys Asp Val His Ile Ile Leu Asp Lys Leu Ser

900 905 910

Asn Val Thr Gly Tyr Ala Phe Tyr Gln Pro Ala Ser Ile Glu Asp Lys

915 920 925

Trp Ile Lys Lys Val Asn Lys Pro Ala Ile Val Met Thr His Arg Gln

930 935 940

Lys Asp Thr Leu Ile Val Ser Ala Val Thr Pro Asp Leu Asn Met Thr

945 950 955 960

Arg Gln Lys Ala Ala Thr Pro Val Thr Ile Asn Val Thr Ile Asn Gly

965 970 975

Lys Trp Gln Ser Ala Asp Lys Asn Ser Glu Val Lys Tyr Gln Val Ser

980 985 990

Gly Asp Asn Thr Glu Leu Thr Phe Thr Ser Tyr Phe Gly Ile Pro Gln

995 1000 1005

Glu Ile Lys Leu Ser Pro Leu Pro

1010 1015

<210> 3

<211> 1011

<212> PRT

<213> Artificial sequence

<400> 3

Met Pro Ile Phe Arg Phe Thr Ala Leu Ala Met Thr Leu Gly Leu Leu

1 5 10 15

Ser Ala Pro Tyr Asn Ala Met Ala Ala Thr Ser Asn Pro Ala Phe Asp

20 25 30

Pro Lys Asn Leu Met Gln Ser Glu Ile Tyr His Phe Ala Gln Asn Asn

35 40 45

Pro Leu Ala Asp Phe Ser Ser Asp Lys Asn Ser Ile Leu Thr Leu Ser

50 55 60

Asp Lys Arg Ser Ile Met Gly Asn Gln Ser Leu Leu Trp Lys Trp Lys

65 70 75 80

Gly Gly Ser Ser Phe Thr Leu His Lys Lys Leu Ile Val Pro Thr Asp

85 90 95

Lys Glu Ala Ser Lys Ala Trp Gly Arg Ser Ser Thr Pro Val Phe Ser

100 105 110

Phe Trp Leu Tyr Asn Glu Lys Pro Ile Asp Gly Tyr Leu Thr Ile Asp

115 120 125

Phe Gly Glu Lys Leu Ile Ser Thr Ser Glu Ala Gln Ala Gly Phe Lys

130 135 140

Val Lys Leu Asp Phe Thr Gly Trp Arg Ala Val Gly Val Ser Leu Asn

145 150 155 160

Asn Asp Leu Glu Asn Ser Ser Asp Gly Thr Gln Asp Ser Ile Gly Arg

165 170 175

Ser Leu Gly Ala Lys Val Asp Ser Ile Arg Phe Lys Ala Pro Ser Asn

180 185 190

Val Ser Gln Gly Glu Ile Tyr Ile Asp Arg Ile Met Phe Ser Val Asp

195 200 205

Asp Ala Arg Tyr Gln Trp Ser Asp Tyr Gln Val Lys Thr Arg Leu Ser

210 215 220

Glu Pro Glu Ile Gln Phe His Asn Val Lys Pro Gln Leu Pro Val Thr

225 230 235 240

Pro Glu Asn Leu Ala Ala Ile Asp Leu Ile Arg Gln Arg Leu Ile Asn

245 250 255

Glu Phe Val Gly Gly Glu Lys Glu Thr Asn Leu Ala Leu Glu Glu Asn

260 265 270

Ile Ser Lys Leu Lys Ser Asp Phe Asp Ala Leu Asn Ile His Thr Leu

275 280 285

Ala Asn Gly Gly Thr Gln Gly Arg His Leu Ile Thr Asp Lys Gln Ile

290 295 300

Ile Ile Tyr Gln Pro Glu Asn Leu Asn Ser Gln Asp Lys Gln Leu Phe

305 310 315 320

Asp Asn Tyr Val Ile Leu Gly Asn Tyr Thr Thr Leu Met Phe Asn Ile

325 330 335

Ser Arg Ala Tyr Val Leu Glu Lys Asp Pro Thr Gln Lys Ala Gln Leu

340 345 350

Lys Gln Met Tyr Leu Leu Met Thr Lys His Leu Leu Asp Gln Gly Phe

355 360 365

Val Lys Gly Ser Ala Leu Val Thr Thr His His Trp Gly Tyr Ser Ser

370 375 380

Arg Trp Trp Tyr Ile Ser Thr Leu Leu Met Ser Asp Ala Leu Lys Glu

385 390 395 400

Ala Asn Leu Gln Thr Gln Val Tyr Asp Ser Leu Leu Trp Tyr Ser Arg

405 410 415

Glu Phe Lys Ser Ser Phe Asp Met Lys Val Ser Ala Asp Ser Ser Asp

420 425 430

Leu Asp Tyr Phe Asn Thr Leu Ser Arg Gln His Leu Ala Leu Leu Leu

435 440 445

Leu Glu Pro Asp Asp Gln Lys Arg Ile Asn Leu Val Asn Thr Phe Ser

450 455 460

His Tyr Ile Thr Gly Ala Leu Thr Gln Val Pro Pro Gly Gly Lys Asp

465 470 475 480

Gly Leu Arg Pro Asp Gly Thr Ala Trp Arg His Glu Gly Asn Tyr Pro

485 490 495

Gly Tyr Ser Phe Pro Ala Phe Lys Asn Ala Ser Gln Leu Ile Tyr Leu

500 505 510

Leu Arg Asp Thr Pro Phe Ser Val Gly Glu Ser Gly Trp Asn Asn Leu

515 520 525

Lys Lys Ala Met Val Ser Ala Trp Ile Tyr Ser Asn Pro Glu Val Gly

530 535 540

Leu Pro Leu Ala Gly Arg His Pro Phe Asn Ser Pro Ser Leu Lys Ser

545 550 555 560

Val Ala Gln Gly Tyr Tyr Trp Leu Ala Met Ser Ala Lys Ser Ser Pro

565 570 575

Asp Lys Thr Leu Ala Ser Ile Tyr Leu Ala Ile Ser Asp Lys Thr Gln

580 585 590

Asn Glu Ser Thr Ala Ile Phe Gly Glu Thr Ile Thr Pro Ala Ser Leu

595 600 605

Pro Gln Gly Phe Tyr Ala Phe Asn Gly Gly Ala Phe Gly Ile His Arg

610 615 620

Trp Gln Asp Lys Met Val Thr Leu Lys Ala Tyr Asn Thr Asn Val Trp

625 630 635 640

Ser Ser Glu Ile Tyr Asn Lys Asp Asn Arg Tyr Gly Arg Tyr Gln Ser

645 650 655

His Gly Val Ala Gln Ile Val Ser Asn Gly Ser Gln Leu Ser Gln Gly

660 665 670

Tyr Gln Gln Glu Gly Trp Asp Trp Asn Arg Met Glu Gly Ala Thr Thr

675 680 685

Ile His Leu Pro Leu Lys Asp Leu Asp Ser Pro Lys Pro His Thr Leu

690 695 700

Met Gln Arg Gly Glu Arg Gly Phe Ser Gly Thr Ser Ser Leu Glu Gly

705 710 715 720

Gln Tyr Gly Met Met Ala Phe Asn Leu Ile Tyr Pro Ala Asn Leu Glu

725 730 735

Arg Phe Asp Pro Asn Phe Thr Ala Lys Lys Ser Val Leu Ala Ala Asp

740 745 750

Asn His Leu Ile Phe Ile Gly Ser Asn Ile Asn Ser Ser Asp Lys Asn

755 760 765

Lys Asn Val Glu Thr Thr Leu Phe Gln His Ala Ile Thr Pro Thr Leu

770 775 780

Asn Thr Leu Trp Ile Asn Gly Gln Lys Ile Glu Asn Met Pro Tyr Gln

785 790 795 800

Thr Thr Leu Gln Gln Gly Asp Trp Leu Ile Asp Ser Asn Gly Asn Gly

805 810 815

Tyr Leu Ile Thr Gln Ala Glu Lys Val Asn Val Ser Arg Gln His Gln

820 825 830

Val Ser Ala Glu Asn Lys Asn Arg Gln Pro Thr Glu Gly Asn Phe Ser

835 840 845

Ser Ala Trp Ile Asp His Ser Thr Arg Pro Lys Asp Ala Ser Tyr Glu

850 855 860

Tyr Met Val Phe Leu Asp Ala Thr Pro Glu Lys Met Gly Glu Met Ala

865 870 875 880

Gln Lys Phe Arg Glu Asn Asn Gly Leu Tyr Gln Val Leu Arg Lys Asp

885 890 895

Lys Asp Val His Ile Ile Leu Asp Lys Leu Ser Asn Val Thr Gly Tyr

900 905 910

Ala Phe Tyr Gln Pro Ala Ser Ile Glu Asp Lys Trp Ile Lys Lys Val

915 920 925

Asn Lys Pro Ala Ile Val Met Thr His Arg Gln Lys Asp Thr Leu Ile

930 935 940

Val Ser Ala Val Thr Pro Asp Leu Asn Met Thr Arg Gln Lys Ala Ala

945 950 955 960

Thr Pro Val Thr Ile Asn Val Thr Ile Asn Gly Lys Trp Gln Ser Ala

965 970 975

Asp Lys Asn Ser Glu Val Lys Tyr Gln Val Ser Gly Asp Asn Thr Glu

980 985 990

Leu Thr Phe Thr Ser Tyr Phe Gly Ile Pro Gln Glu Ile Lys Leu Ser

995 1000 1005

Pro Leu Pro

1010

<210> 4

<211> 3063

<212> DNA

<213> Proteus vulgaris

<400> 4

atgccgatat ttcgttttac tgcacttgca atgacattgg ggctattatc agccccttat 60

aacgcgatgg cagccaccag caatcctgca tttgatccta aaaatctgat gcagtcagaa 120

atttaccatt ttgcacaaaa taacccatta gcagacttct catcagataa aaactcaata 180

ctaacgttat ctgataaacg tagcattatg ggaaaccaat ctcttttatg gaaatggaaa 240

ggtggtagta gctttacttt acataaaaaa ctgattgtcc ccaccgataa agaagcatct 300

aaagcatggg gacgctcatc tacccccgtt ttctcatttt ggctttacaa tgaaaaaccg 360

attgatggtt atcttactat cgatttcgga gaaaaactca tttcaaccag tgaggctcag 420

gcaggcttta aagtaaaatt agatttcact ggctggcgtg cagtgggagt ctctttaaat 480

aacgatcttg aaaatcgaga gatgacctta aatgcaacca atacctcctc tgatggtact 540

caagacagca ttgggcgttc tttaggtgct aaagtcgata gtattcgttt taaagcgcct 600

tctaatgtga gtcagggtga aatctatatc gaccgtatta tgttttctgt cgatgatgct 660

cgctaccaat ggtctgatta tcaagtaaaa actcgcttat cagaacctga aattcaattt 720

cacaacgtaa agccacaact acctgtaaca cctgaaaatt tagcggccat tgatcttatt 780

cgccaacgtc taattaatga atttgtcgga ggtgaaaaag agacaaacct cgcattagaa 840

gagaatatca gcaaattaaa aagtgatttc gatgctctta atattcacac tttagcaaat 900

ggtggaacgc aaggcagaca tctgatcact gataaacaaa tcattattta tcaaccagag 960

aatcttaact ctcaagataa acaactattt gataattatg ttattttagg taattacacg 1020

acattaatgt ttaatattag ccgtgcttat gtgctggaaa aagatcccac acaaaaggcg 1080

caactaaagc agatgtactt attaatgaca aagcatttat tagatcaagg ctttgttaaa 1140

gggagtgctt tagtgacaac ccatcactgg ggatacagtt ctcgttggtg gtatatttcc 1200

acgttattaa tgtctgatgc actaaaagaa gcgaacctac aaactcaagt ttatgattca 1260

ttactgtggt attcacgtga gtttaaaagt agttttgata tgaaagtaag tgctgatagc 1320

tctgatctag attatttcaa taccttatct cgccaacatt tagccttatt actactagag 1380

cctgatgatc aaaagcgtat caacttagtt aatactttca gccattatat cactggcgca 1440

ttaacgcaag tgccaccggg tggtaaagat ggtttacgcc ctgatggtac agcatggcga 1500

catgaaggca actatccggg ctactctttc ccagccttta aaaatgcctc tcagcttatt 1560

tatttattac gcgatacacc attttcagtg ggtgaaagtg gttggaataa cctgaaaaaa 1620

gcgatggttt cagcgtggat ctacagtaat ccagaagttg gattaccgct tgcaggaaga 1680

caccctttta actcaccttc gttaaaatca gtcgctcaag gctattactg gcttgccatg 1740

tctgcaaaat catcgcctga taaaacactt gcatctattt atcttgcgat tagtgataaa 1800

acacaaaatg aatcaactgc tatttttgga gaaactatta caccagcgtc tttacctcaa 1860

ggtttctatg cctttaatgg cggtgctttt ggtattcatc gttggcaaga taaaatggtg 1920

acactgaaag cttataacac caatgtttgg tcatctgaaa tttataacaa agataaccgt 1980

tatggccgtt accaaagtca tggtgtcgct caaatagtga gtaatggctc gcagctttca 2040

cagggctatc agcaagaagg ttgggattgg aatagaatgg aaggggcaac cactattcac 2100

cttcctctta aagacttaga cagtcctaaa cctcatacct taatgcaacg tggagagcgt 2160

ggatttagcg gaacatcatc ccttgaaggt caatatggca tgatggcatt caatcttatt 2220

tatcccgcca atcttgagcg ttttgatcct aatttcactg cgaaaaagag tgtattagcc 2280

gctgataatc acttaatttt tattggtagc aatataaata gtagtgataa aaataaaaat 2340

gttgaaacga ccttattcca acatgccatt actccaacat taaataccct ttggattaat 2400

ggacaaaaga tagaaaacat gccttatcaa acaacacttc aacaaggtga ttggttaatt 2460

gatagcaatg gcaatggtta cttaattact caagcagaaa aagtaaatgt aagtcgccaa 2520

catcaggttt cagcggaaaa taaaaatcgc caaccgacag aaggaaactt tagctcggca 2580

tggatcgatc acagcactcg ccccaaagat gccagttatg agtatatggt ctttttagat 2640

gcgacacctg aaaaaatggg agagatggca caaaaattcc gtgaaaataa tgggttatat 2700

caggttcttc gtaaggataa agacgttcat attattctcg ataaactcag caatgtaacg 2760

ggatatgcct tttatcagcc agcatcaatt gaagacaaat ggatcaaaaa ggttaataaa 2820

cctgcaattg tgatgactca tcgacaaaaa gacactctta ttgtcagtgc agttacacct 2880

gatttaaata tgactcgcca aaaagcagca actcctgtca ccatcaatgt cacgattaat 2940

ggcaaatggc aatctgctga taaaaatagt gaagtgaaat atcaggtttc tggtgataac 3000

actgaactga cgtttacgag ttactttggt attccacaag aaatcaaact ctcgccactc 3060

cct 3063

Claims

1. The mutant of the chondroitin sulfate ABC lyase is characterized in that the chondroitin sulfate ABC lyase with an amino acid sequence shown as SEQ ID NO.1 is used as a parent, and the amino acid of the parent is truncated, wherein the truncation comprises any one of (a) to (l):

(a) truncating the 166-170 amino acid;

(b) truncating the amino acid at position 166-175;

(c) truncating the 166-180 amino acid;

(d) truncating the amino acid at the position 166-186;

(e) truncating the 187-191 amino acid;

(f) truncating the 182-191 amino acid;

(g) truncating the 177-191 amino acid;

(h) truncating the amino acid at position 171 and 191.

(i) Truncating the 166-170 th amino acid of the parent amino acid to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the 689 th glutamic acid of the truncated mutant into proline;

(j) truncating the amino acid at the 166-175 th amino acid position of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate alanine at the 45 th amino acid position of the truncated mutant into glutamic acid;

(k) truncating the amino acid at the 166-th and 180-th amino acids of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the 897-th isoleucine of the truncated mutant into valine;

(l) Truncating the amino acid 166-186 of the parent to obtain a truncated mutant, and mutating the truncated mutant, wherein the mutation is to mutate the lysine 209 of the truncated mutant into proline.

2. A gene encoding the mutant of claim 1.

3. An expression vector carrying the gene of claim 2.

4. A microbial cell expressing the mutant of claim 1 or containing the gene of claim 3.

5. A method for producing a low molecular weight chondroitin sulfate, comprising cleaving chondroitin sulfate using the mutant of claim 1.

6. The method according to claim 5, wherein the amount of the enzyme added to the reaction system is 0 to 6X 10³U/g substrate; the reaction is carried out at 25-35 ℃.

7. A method for expressing the chondroitin sulfate ABC lyase mutant as described in claim 1, wherein the gene as described in claim 3 is ligated to an expression vector to obtain a recombinant plasmid, the recombinant plasmid is transformed into a host cell to obtain a recombinant microbial cell, and the recombinant microbial cell is cultured to produce the enzyme.

8. The method as claimed in claim 7, wherein the recombinant microorganism cells are cultured to the middle logarithmic phase, the bacterial liquid in the middle logarithmic phase is inoculated into the reaction system, and after culturing at 25-30 ℃ and 200-250rpm for 2-3h, the inducer is added, and the culturing is performed at 20-25 ℃ and 500-600rpm for 6-20 h.

9. The method of claim 8, wherein the inducer is IPTG and arabinose, the final concentration of IPTG in the reaction system is 0.1-0.2mM, and the arabinose is 5% -10% of the reaction system.

10. Use of the chondroitin sulfate ABC lyase mutant as defined in claim 1 for removing chondroitin sulfate from heparin or for preparing low molecular weight chondroitin sulfate or oligosaccharides.