CN111500566A

CN111500566A - Trehalose synthetase mutant and preparation method and application thereof

Info

Publication number: CN111500566A
Application number: CN202010337983.3A
Authority: CN
Inventors: 饶志明; 吴傲; 张显; 徐美娟; 杨套伟; 邵明龙
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-01-28
Filing date: 2019-01-28
Publication date: 2020-08-07
Anticipated expiration: 2039-01-28
Also published as: CN109609530B; CN111378631B; CN111378631A; CN109609530A; CN111500566B

Abstract

The invention discloses a trehalose synthase mutant and a preparation method and application thereof, belonging to the technical field of enzyme engineering. The enzyme activity of the trehalose synthase is high, the specific enzyme activity of the trehalose synthase in a crude enzyme solution can be up to 35.2U/mg by inducing and culturing escherichia coli carrying the trehalose synthase for 12 hours, and the specific enzyme activity of the trehalose synthase in the crude enzyme solution can be up to 33.5U/mg by inducing and culturing corynebacterium glutamicum carrying the trehalose synthase for 12 hours; compared with wild-type trehalose synthase, the specific enzyme activity and the trehalose conversion rate of the trehalose synthase mutant are obviously improved, wherein the specific enzyme activity of the trehalose synthase mutant K246A is improved by 1.43 times compared with the wild-type enzyme, and the trehalose conversion rate is improved by about 15% compared with the wild-type enzyme.

Description

Trehalose synthetase mutant and preparation method and application thereof

Technical Field

The invention relates to a trehalose synthase mutant and a preparation method and application thereof, belonging to the technical field of enzyme engineering.

Background

Trehalose (trehalase), a disaccharide widely found in nature, is formed by the linkage of two glucoses through α -1, 1-glycosidic bonds, was originally isolated from ergot cerebellum by Wiggers and is widely found in bacteria, fungi, yeasts, lower ferns, algae, insects, and invertebrates.

In addition to being used as a structural component and providing energy, trehalose plays an important role as a typical stress metabolite in organisms to protect components such as proteins, lipids, saccharides and nucleic acids in organism cells from being damaged under many environmental conditions such as dryness, low temperature, high permeability and the like, so that the cells are protected from being damaged, and therefore, the trehalose is an important protective agent for biological activity preservation of vaccines, enzymes, living tissues and cells; meanwhile, trehalose has high stability to acid and heat, can prevent starch aging and protein denaturation, can inhibit fat rancidity, has the functions of correcting taste and odor, has high glass transition temperature, low hygroscopicity and low sweetness, and has the characteristics of wide application in the food processing industry, the pharmaceutical industry, the agricultural industry, the biochemical product industry and the cosmetic industry, thereby becoming an additive of more than ten thousand products.

It can be said that trehalose has become one of the most important oligosaccharide resources in the world.

There are various methods for producing trehalose, including direct extraction, fermentation, gene recombination, chemical synthesis and enzymatic conversion. Among them, the enzymatic conversion method is considered to be the most promising industrial production method due to its advantages of high conversion rate, strong specificity, mild action, no pollution, etc.

At present, three main enzymes are used in the enzymatic conversion method, including trehalose phosphorylase, maltooligosyl trehalose synthase and trehalose synthase. Wherein, the trehalose phosphorylase needs to consume expensive high-energy phosphate compounds UDP-glucose and 6-glucose phosphate, and has little competitive advantage on the production cost; the maltooligosyl trehalose synthase and trehalose synthase can respectively produce trehalose by taking hydrolysate maltodextrin and maltose of starch as substrates, and have strong competitive advantages.

However, trehalose produced by using maltooligosyl trehalose synthase will eventually accumulate a large amount of oligosaccharides such as maltotriose, which in turn will affect the purity of trehalose; trehalose synthase is difficult to carry out large-scale industrial production due to low enzyme activity and trehalose conversion rate.

Therefore, there is an urgent need to find trehalose synthase with high enzyme activity and high trehalose conversion rate to solve the problem that it is difficult to perform large-scale industrial production.

Disclosure of Invention

[ problem ] to

The technical problem to be solved by the invention is to improve the enzyme activity of the trehalose synthetase and the yield of trehalose.

[ solution ]

In order to solve the problems, the invention provides trehalose synthetase, and the nucleotide sequence of the trehalose synthetase is shown as SEQ ID No. 1.

In one embodiment of the invention, the trehalose synthase is derived from Streptomyces coelicolor.

The invention also provides a mutant of the trehalose synthase, which is obtained by mutating lysine 246 and/or alanine 165 and/or phenylalanine 178 of the trehalose synthase.

In one embodiment of the present invention, the mutant is obtained by mutating lysine 246 to alanine of the above trehalose synthase, and the mutant is named as K246A;

or the mutant is obtained by mutating alanine at position 165 of the trehalose synthetase into threonine, and the mutant is named as A165T;

or the mutant is obtained by mutating phenylalanine at position 178 of the trehalose synthetase into tyrosine, and the mutant is named as F178Y.

In one embodiment of the invention, the amino acid sequence of the mutant is SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4.

The invention also provides a gene for coding the trehalose synthetase or the trehalose synthetase mutant.

The invention also provides a recombinant plasmid carrying the gene.

In one embodiment of the invention, the recombinant plasmid vector is a pET-28a plasmid, pET-22b plasmid, pET-Duet plasmid or pXMJ19 plasmid.

The invention also provides a host cell carrying the gene or the recombinant plasmid.

In one embodiment of the invention, the host cell is Corynebacterium glutamicum or Escherichia coli.

The invention also provides a preparation method of the trehalose synthase, which comprises the steps of using the host cell, inoculating the host cell into a fermentation culture medium for fermentation, then centrifuging the fermentation liquor to collect thalli, and finally crushing the thalli to obtain the trehalose synthase.

In one embodiment of the invention, the fermentation medium may be L B medium, TY medium or TB medium.

The invention also provides a preparation method of the trehalose synthase mutant, which comprises the steps of inoculating the host cell into a fermentation culture medium for fermentation, then centrifuging the fermentation liquid to collect thalli, and finally crushing the thalli to obtain the trehalose synthase mutant.

The present invention also provides a process for producing trehalose, which comprises reacting a trehalose synthase or a mutant of the trehalose synthase or a host cell with maltose in a reaction system using the trehalose synthase or the mutant of the trehalose synthase or the host cell.

In one embodiment of the present invention, the method comprises using the host cell, streaking the host cell on L B plate containing 50. mu.g/m L kanamycin, culturing at 37 ℃ for 10-12 hours to obtain an activated single host cell colony, inoculating the single host cell colony into L B liquid medium, culturing at 37 ℃ and 180rpm for 10 hours to obtain a primary seed solution, transferring the primary seed solution to L B liquid medium in an inoculation amount of 1-2%, and culturing at 37 ℃ and 180rpm to OD₆₀₀1.0-1.5 to obtain a secondary seed solution; transferring the obtained secondary seed liquid into TY culture medium, culturing at 37 deg.C and 200-400 rpm to thallus concentration OD₆₀₀Obtaining a culture solution when the concentration reaches 18-20, adding 0.2 mmol/L IPTG into the obtained culture solution, continuously culturing for 12-14 h at 28 ℃ and 600rpm to obtain a fermentation liquid, centrifuging the obtained fermentation liquid for 20min at 6000r/min, removing supernatant, collecting thalli, washing the obtained thalli with a buffer solution with pH7.0 for 2-3 times, suspending with 100-800 g/L maltose reaction liquid prepared by the buffer solution, and carrying out whole cell conversion reaction for 24h at 35 ℃ and 200rpm to obtain trehalose.

The invention also provides a preparation for producing trehalose, and the components of the preparation comprise the trehalose synthetase or the trehalose synthetase mutant or the host cell.

[ advantageous effects ]

(1) The enzyme activity of the trehalose synthase is high, and the specific enzyme activity of the trehalose synthase in the crude enzyme solution can reach 35.2U/mg by inducing and culturing escherichia coli carrying the trehalose synthase for 12 hours; carrying the trehalose synthetase of the invention Corynebacterium glutamicum induced culture for 12 hours, can make the specific enzyme activity of trehalose synthetase in the crude enzyme liquid reach 33.5U/mg;

(2) the optimum reaction temperature of the trehalose synthetase is 35 ℃, and the adaptive temperature is higher, so that the trehalose synthetase has the advantages of low production cost and low requirement on production conditions in industrial production;

(3) compared with wild-type trehalose synthase, the specific enzyme activity and the trehalose conversion rate of the trehalose synthase mutant are obviously improved, wherein the specific enzyme activity of the trehalose synthase mutant K246A is improved by 1.43 times, and the trehalose conversion rate is improved by about 15% compared with the wild-type enzyme; the specific enzyme activity of the trehalose synthase mutant A165T is improved by 1.39 times compared with that of wild enzyme, and the trehalose conversion rate is improved by about 10% compared with that of the wild enzyme; the specific enzyme activity of the trehalose synthase mutant F178Y is improved by 1.18 times compared with that of wild enzyme, and the trehalose conversion rate is improved by about 5% compared with that of the wild enzyme;

(4) the recombinant Escherichia coli whole cell carrying the trehalose synthase mutant of the present invention is added to a reaction system containing maltose as a catalyst, and maltose with a concentration of 800 g/L in the reaction system can be converted into trehalose with a concentration of 560 g/L within 24 hours.

Detailed Description

The invention will be further illustrated with reference to specific examples.

Escherichia coli B L21 (DE3) referred to in the following examples was purchased from Beinan organisms, Corynebacterium glutamicum ATCC13032 referred to in the following examples was purchased from American type culture Collection (American type culture Collection) with the deposit number of ATCC13032, Streptomyces _ coelicolor (GDM4.65) referred to in the following examples was purchased from Guangdong province microorganism culture Collection with the deposit number of GDM4.65, pET28a, pXMJ19, pET-Duet, pET-22B plasmids were purchased from Purpurent Biotechnology (Beijing) Co., Ltd., maltose monohydrate, glucose, trehalose dihydrate referred to in the following examples were purchased from national drug group chemical Co., Ltd., and BHI liquid culture medium referred to in the following examples was purchased from Qingdao Haibao organism (the above-mentioned strain Escherichia coli B L21 (DE3), Escherichia coli B13032 (ATCC 3565) without the need not be purchased from Streptomyces _ coelicolor 13032).

The media involved in the following examples are as follows:

l B liquid culture medium, peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L.

L B solid medium (L B plate) peptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, 2% agar powder (v/v).

20 g/L g of soluble starch and KNO₃1 g/L、K₂HPO₄0.5 g/L、MgSO₄·7H₂O0.5g/L、NaCl 0.5g/L、FeSO₄0.01 g/L，pH 7.2～7.4。

TY culture medium comprising yeast powder 8.0 g/L, glycerol 10.0 g/L, tryptone 12.0 g/L, and K₃PO₄4.02 g/L, NaCl3 g/L, citric acid monohydrate 2.1 g/L, ferric ammonium citrate 0.3 g/L, (NH)₄)₂SO₄2.5 g/L，MgSO4·7H2O 0.5g/L，pH 7.2。

BHI solid medium: 1.5 to 2 percent of agar powder (v/v) is added into BHI liquid culture medium.

The detection methods referred to in the following examples are as follows:

the method for determining the specific enzyme activity of the trehalose synthase comprises the following steps:

1. determination of enzyme Activity of trehalose synthetase

Filtering the crude enzyme solution by a filter membrane of 0.2 mu m, performing Ni-NTA affinity chromatography, eluting by using imidazole to obtain purified enzyme, reacting the reaction system containing 100 g/L maltose, 50 mmol/L sodium phosphate buffer solution with pH of 7.0 and 30 mu g of purified enzyme in a water bath at 35 ℃ for 1h, stopping the reaction in a boiling water bath for 10min, and detecting the enzyme activity by using an HP L C method;

HP L C analysis, namely, the concentrations of the substrate and the product are determined by adopting an HP L C differential method, wherein the chromatographic conditions comprise a chromatographic column, an NH2 column (5 mu m, 250mm × 4.6.6 mm), a mobile phase, acetonitrile-water (V/V is 75:25), a Detector, an RID Detector, the column temperature is 40 ℃, the sample injection amount is 10 mu L, and the flow rate is 1.0m L/min;

the enzyme activity is defined as: the enzyme amount for generating 1 mu mol of trehalose every 1min is 1 enzyme activity unit;

2. determination of trehalose synthetase specific activity

Trehalose synthase specific enzyme activity (U)/enzyme concentration (μ g/m L).

The determination method of the trehalose conversion rate comprises the following steps:

trehalose conversion rate-trehalose concentration (g/L)/maltose substrate concentration (g/L) × 100%.

Example 1: extraction of gene encoding trehalose synthase and construction of recombinant bacteria containing gene encoding trehalose synthase

The method comprises the following specific steps:

(1) extraction of Streptomyces coelicolor (GDM4.65) genomic DNA

Extracting Streptomyces _ coelicolor (GDM4.65) genome DNA by using a bacterial DNA genome extraction kit purchased from Shanghai Czeri bioengineering GmbH;

selecting single colony of Streptomyces _ coelicolor (GDM4.65) and inoculating the single colony into a high-temperature synthesis I liquid culture medium, carrying out shaking culture for 5 days at 30 ℃ and 180rpm, centrifuging for 2 minutes at 8000rpm, collecting thalli, washing the thalli with deionized water, centrifuging again, collecting the thalli, suspending the collected thalli in a 150 mu L TE Buffer to obtain a resuspension, adding 20 mu L lysozyme into the resuspension, carrying out heat preservation for 30 minutes at 37 ℃, adding 300 mu L Digestion Solution, mixing uniformly, adding 4 mu L RnaseA, carrying out heat preservation for 10 minutes at 55 ℃, adding 4 mu L protease K, carrying out heat preservation for 30 minutes at 55 ℃ to obtain a lysis Solution, directly adding 300 mu L PB Solution into the lysis Solution, shaking uniformly, mixing uniformly, carrying out room temperature 5 minutes at 12000rpm to obtain a supernatant, transferring the supernatant into a 2 mu gel column, discarding the lysis Solution after removing residual genome in a gel column 351 minute, centrifuging the gel column, centrifuging the supernatant into a gel collection tube at room temperature of a 2 micron column 3565, centrifuging tube, and centrifuging the supernatant for 2 minutes, namely centrifuging the supernatant, adding the supernatant into a gel column at 12000-351-30 minutes, and centrifuging the gel column, and centrifuging the supernatant at room temperature, namely centrifuging a centrifugation step of a centrifugation tube, namely centrifuging step of a collection tube at room temperature of a centrifugation tube, and a centrifugation step of a centrifugation tube of a sample column, namely centrifuging step of a sample tube of a sample column, and a sample tube of a sample column, and a sample column, namely a sample column, and centrifuging step of a sample column, and centrifuging step of a sample column, and a sample tube;

(2) extraction of Gene encoding trehalose synthase

The following primers were designed:

ScT-F：5’-tgggtcgcggatccgaattcATGATCGTCAACGAGCCCGT-3’(SEQ ID No.5)，

ScT-R：5’-tcgagtgcggccgcaagcttTCAGGCGGCGTCCTTGCGCA-3’(SEQ ID No.6)，

19/ScT-F：5’-aaacagaattaattaagcttAAAGGAGGGAAATCATGATCGTCAACGAGCCCGTGC-3’(SEQ ID No.7)，

19/ScT-R：5’-acctgcaggcatgcaagcttTTAGTGGTGGTGGTGGTGGTGGGCGGCGTCCTTGCGCAGG-3’(SEQ ID No.8)；

taking genome of Streptomyces _ coelicolor (GDM4.65) as a template, carrying out PCR amplification according to a pre-designed primer, and then recovering an amplification product to obtain a gene for coding trehalose synthase;

(3) construction of recombinant bacterium containing gene encoding trehalose synthase

Carrying out double enzyme digestion on the vector pET28a by using EcoR I and Hind III in water bath for 1h at 37 ℃, carrying out single enzyme digestion on the vector pXMJ19 by using Hind III in water bath for 1h at 37 ℃, and respectively recovering enzyme digestion products; uniformly mixing the enzyme digestion product obtained by recycling and the amplification product obtained by recycling in the step (2), and keeping the mixture at 37 ℃ for 30min for connection to obtain a connection product;

transforming E.coli B L21 competent cells with the ligation product, then carrying out cold shock and heat shock, adding the transformation product into 800 mu L L B liquid culture medium, culturing for 1-1.5 h at 37 ℃ and 180r/min, centrifuging, removing supernatant, coating the precipitate on a plate containing 50 mu g/m L kanamycin, culturing for 12h in a 37 ℃ culture box, respectively selecting positive clones, adding 10m L into L B liquid culture medium containing 50 mu g/m L kanamycin and 10 mu g/m L chloramphenicol, placing in the 37 ℃ culture box for shaking culture for 10h, extracting plasmids for enzyme digestion verification, and obtaining successfully verified recombinant plasmids pET28a-ScTreS and pXMJ19-ScTreS and recombinant strains E.coli B L21 pET28 a-ScTreS;

the preparation method comprises the steps of gently mixing 5 mu L pXMJ19-ScTreS plasmid and 90 mu L C. glutamicum ATCC13032 competent cells in a clean bench, transferring the mixture into a precooled sterile electrode cup, placing the electrode cup into an electroshock instrument for electroshock, wherein the voltage is 1850V, and the Tc is 5ms, adding 800 mu L BHI liquid culture medium into the electrode cup in the clean bench, gently blowing and sucking the bacterial liquid in gaps in the electrode cup for several times, transferring the bacterial liquid in the electrode cup into a sterile 1.5m L EP tube, carrying out water bath at 46 ℃ for 6min, placing the electrode cup into an incubator at 30 ℃ for shaking culture for 1-2 h, centrifuging for 1min at 8000rpm, sucking 700 mu L supernatant by using a pipette gun, discarding, gently mixing the remaining liquid by using a pipette gun, sucking the mixed bacterial liquid into BHI solid culture medium containing 10 mu g/m L chloramphenicol, uniformly distributing the BHI solid culture medium containing 10 mu g/m 567 chloramphenicol, inverting the BHI solid culture medium in the incubator at 30 ℃ for 16-24 h, adding 10 mu g/m tremi in the phagomycin strain in the pipette gun, and carrying out shake culture for successful verification, and obtaining recombinant strain culture, and placing the recombinant strain 3526-L g/3526J culture medium for shaking culture.

Comparative example 1: construction of recombinant bacteria containing genes encoding trehalose synthase from other sources

The method comprises the following specific steps:

obtaining nucleotide sequences of trehalose synthetases (respectively, the nucleotide sequence is shown as SEQ ID No.9 and is derived from Corynebacterium glutamicum ATCC13032, and the nucleotide sequence is shown as SEQ ID No.10 and is derived from Pseudomonas stutzeri) from NCBI, obtaining the sequences through artificial synthesis, then respectively connecting the obtained sequences to pET28a carriers and transforming host cells E.coliB L21 to obtain recombinant bacteria B L21/pET 28a-CgTreS and B L21/pET 28 a-TreS;

wherein, the trehalose synthase gene from Corynebacterium glutamicum ATCC13032 and pET28a vector are connected after being cut by Nde I and HindIII, and the trehalose synthase gene from Pseudomonas stutzeri and pET28a vector are connected after being cut by BamH I and HindIII.

Example 2: expression of trehalose synthase in E.coli hosts

The recombinant bacterium E.coli B L21 pET28a-ScTreS obtained in example 1 and the recombinant bacterium B L21/pET 28a-CgTreS and B L21/pET 28a-PsTreS obtained in comparative example 1 are respectively added into a 10m L L B culture medium, cultured for 10h at 37 ℃ and 180rpm, transferred into a 50m L L B liquid culture medium by 1% of inoculum size, cultured for 2-3 h at 37 ℃ and 180rpm, and then added with IPTG (isopropyl thiogalactoside) with the final concentration of 0.5mM and cultured for 12h under the condition of 16 ℃ to obtain fermentation broth.

And centrifuging the fermentation liquor, collecting thalli, washing the thalli by using a sodium phosphate buffer solution with the pH value of 7.050mM, suspending, ultrasonically crushing, centrifuging, taking supernatant to obtain a crude enzyme solution, and detecting the enzyme activity of the trehalose synthase in the crude enzyme solution.

The detection result shows that the trehalose synthase specific enzyme in the crude enzyme solution obtained by fermenting the recombinant bacterium E.coli B L21 pET28a-ScTreS is 35.2U/mg, the trehalose synthase specific enzyme in the crude enzyme solution obtained by fermenting the recombinant bacterium B L21/pET 28a-CgTreS is 31.3U/mg, and the trehalose synthase specific enzyme in the crude enzyme solution obtained by fermenting the recombinant bacterium B L21/pET 28a-PsTreS is 28.1U/mg.

Example 3: expression of trehalose synthase in a Corynebacterium glutamicum host

The recombinant bacterium C.glutamicum pXMJ19-ScTreS obtained in example 1 was added to 10m L BHI liquid medium, cultured at 30 ℃ and 180rpm for 16 hours, then inoculated into 50m L BHI liquid medium containing 10. mu.g/m L chloramphenicol at an inoculum size of 1%, cultured at 30 ℃ and 180rpm for 5-8 hours, and then added with IPTG (isopropyl thiogalactoside) with a final concentration of 0.5mM and cultured at 16 ℃ for 12 hours to obtain fermentation broth.

And centrifuging the fermentation liquor, collecting thalli, washing the thalli by using pH7.050 mM sodium phosphate buffer solution, suspending, adding 20 mu L0.2 mg/m L lysozyme, standing for 2 hours on ice, carrying out ultrasonic crushing and centrifugation, taking supernatant to obtain a crude enzyme solution, and detecting the enzyme activity of the trehalose synthase in the crude enzyme solution.

The detection result is as follows: the trehalose synthetase specific enzyme activity in the crude enzyme solution obtained by fermenting the recombinant strain C.glutamicum pXMJ19-ScTreS is 33.5U/mg. As can be seen, the trehalose synthase of example 1 can be expressed in a Corynebacterium glutamicum host.

Example 4: effect of temperature on trehalose synthase

The method comprises the following specific steps:

a suitable amount of B L21/pET 28a-ScTreS cells were suspended in 200 g/L maltose solution prepared from 100m L pH7.050 mM sodium phosphate buffer solution to obtain OD₆₀₀15, the shaking table rotation speed was controlled at 150rpm, and the trehalose was synthesized by whole-cell transformation at 25 ℃, 30 ℃, 35 ℃, 40 ℃ and 45 ℃ respectively.

And detecting the conversion of the trehalose after 24h of conversion, wherein the detection result is as follows: at a reaction temperature of 35 ℃ the conversion was highest, up to 58.5%, with concomitant production of 15.1% glucose, and at the remaining temperatures the conversion was below 35 ℃ with a conversion of only 42.7% at 45 ℃ with concomitant production of 18.5% glucose.

Example 5: trehalose synthase mutant and construction of recombinant bacterium containing gene encoding trehalose synthase mutant

The method comprises the following specific steps:

the following primers were designed:

site-directed mutagenesis primer introducing the K246A mutation:

K246A-F：CTCAAGCGGGTCCGCGCAGAGATCGACGCCCACTA(SEQ ID No.11)；

site-directed mutagenesis primer for introducing the a165T mutation:

A165T-F：TTCGTCGACACCGAGACGTCCAACTGGACCTTCGA(SEQ ID No.12)；

site-directed mutagenesis primer for introducing F178Y mutation:

F178Y-F：GTCCGCAAGCAGTACTACTTCCACCGCTTCTTCTC(SEQ ID No.13)；

site-directed mutagenesis primer introducing the F179W mutation:

F179W-F：CGCAAGCAGTACTTCTGGCACCGCTTCTTCTCCCA(SEQ ID No.14)；

vector universal primers for introducing mutations:

pET28a-2254-R：GCCTTACTGGTTAGCAGAATG(SEQ ID No.15)；

carrying out PCR by using a recombinant plasmid pET-28a-ScTreS as a template to obtain a PCR product, transforming the PCR product into E.coliB L21 competent cells, adding the transformed product into 800 mu L L B liquid culture medium, culturing for 2h at 37 ℃ and 180r/min, centrifuging, discarding supernatant, coating the precipitate on a plate containing 50 mu g/m L kanamycin, culturing for 12h in a 37 ℃ culture box, picking positive clones, adding 10m L into L B liquid culture medium containing 50 mu g/m L kanamycin, culturing for 10h in the 37 ℃ culture box by shaking, extracting plasmids, and carrying out restriction enzyme digestion verification to obtain successfully verified recombinant plasmids pET-28a-ScTreS (K246A), pET-28a-ScTreS (A165T), pET-28 a-ScS (pEF 178Y), pET-28 a-ScS (F179) and recombinant bacteria E.21B 21T-ScTres (E3528A 4642) tre 165-3642, and pET-28 a-Sci 4628 a A (Coli) and A-A. coli 4628A A A3642, and coli 19B 4628A 3628A A-A B80;

wherein the PCR reaction system comprises a mutation primer of 0.2 mu L, a universal primer of 0.2 mu L, a plasmid template of 0.25 mu L, double distilled water of 11.85 mu L and a high-fidelity polymerase premix solution of 12.5 mu L2 ×, and the total system is 25 mu L;

the PCR conditions were pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30S, annealing at 55 ℃ for 1min, extension at 72 ℃ for 3min for 5 cycles, denaturation at 95 ℃ for 30S, extension at 68 ℃ for 6min, 20 cycles, and full extension at 68 ℃ for 12min, after the reaction was complete, the template in the digested PCR product was added at 1. mu. L DpnI37 ℃ and held for 1 h.

Example 6: expression of trehalose synthase mutants

The method comprises the following specific steps:

the recombinant bacterium E.coli B L21 pET28a-ScTreS obtained in example 1, the recombinant bacterium E.coli B L21 pET28a-ScTreS (K246A) obtained in example 5, E.coli B L21 pET28a-ScTreS (A165T), E.coli B L21 pET28a-ScTreS (F178Y) and E.coli B L21 pET28a-ScTreS (F179W) were added to 10m L L B medium, cultured for 10 hours at 37 ℃ and 180rpm, transferred to 50m L L B liquid medium with 1% inoculum size, cultured for 2-3 hours at 37 ℃ and 180rpm, and further cultured for 12 hours under 16 ℃ with IPTG added to a final concentration of 0.5mM to obtain a fermentation broth.

The detection result shows that the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermenting the recombinant bacterium E.coli B L pET28a-ScTreS is 35.2U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermenting the recombinant bacterium E.coli B L pET28a-ScTreS (K246A) is 50.3U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermenting the recombinant bacterium E.coli B L pET28a-ScTreS (A165T) is 48.9U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermenting the recombinant bacterium E.coli B L pET28a-ScTreS (F178Y) is 41.5U/mg, the specific enzyme activity of the trehalose synthase in the recombinant bacterium E.coli B6321 pET 28-ScTreS a-ScTreS (F178Y) is higher than that of the trehalose synthase in the crude enzyme liquid obtained by fermenting the recombinant bacterium E.coli B.coli B L pET 28-ScTreS (F179), the enzyme liquid obtained by fermenting the mutant is higher than that of the trehalose synthase in the wild enzyme liquid obtained by fermenting the mutant of trehalose synthase, the mutant of the trehalose synthase in the mutant E.coli B.coli B.5B, the mutant is higher than the mutant, the trehalose synthase of the trehalose synthase in the mutant obtained by fermenting the mutant, the mutant of the mutant obtained by fermenting the mutant, the mutant of the mutant, the mutant of trehalose synthase in the mutant, the mutant of trehalose.

Example 7: trehalose synthase and application of trehalose synthase mutant in trehalose production

The method comprises the following specific steps:

the recombinant bacterium E.coli B L21 pET28a-ScTreS obtained in example 1 and the recombinant bacterium E.coli B L21 pET28a-ScTreS (K246A), E.coli B L21 pET28a-ScTreS (A165T) and E.coli B L21 pET28a-ScTreS (F178Y) obtained in example 4 were singly inoculated into L B liquid culture mediumCulturing at 37 deg.C and 180rpm for 10 hr to obtain first-stage seed liquid, transferring the first-stage seed liquid to L B liquid culture medium at 1-2% inoculum size, and culturing at 37 deg.C and 180rpm to OD₆₀₀1.0-1.5 to obtain a secondary seed solution; transferring the obtained secondary seed liquid into TY culture medium, culturing at 37 deg.C and 200-400 rpm to thallus concentration OD₆₀₀The method comprises the steps of obtaining a culture solution, adding 0.2 mmol/L IPTG into the obtained culture solution, continuously culturing for 12-14 hours at 28 ℃ and 600rpm to obtain a fermentation liquor, centrifuging the obtained fermentation liquor for 20 minutes at 6000r/min to remove supernatant, collecting thalli, washing the obtained thalli for 2-3 times by using 50mM sodium phosphate buffer solution with pH7.0, suspending the thalli by using 100-800 g/L maltose solution prepared by the buffer solution as a reaction system, and carrying out whole-cell conversion reaction at 35 ℃ and 200rpm to prepare trehalose.

After the conversion reaction for 24 hours, the conversion rate of trehalose in the reaction system was measured.

The detection result when the substrate concentration is 300 g/L shows that the trehalose conversion rate of the recombinant bacterium E.coli B L pET28a-ScTreS is 58.3%, the trehalose conversion rate of the recombinant bacterium E.coli B L pET28a-ScTreS (K246A) is 73.7%, the trehalose conversion rate of the recombinant bacterium E.coli B6321 pET28a-ScTreS (A165T) is 67.8%, and the trehalose conversion rate of the recombinant bacterium E.coli B L pET28a-ScTreS (F178Y) is 63.1%, and compared with the wild-type trehalose synthase, the trehalose conversion rates of the trehalose synthase mutants K A, A T and F178Y are obviously improved, wherein the trehalose conversion rate of the trehalose synthase mutant K246 is improved by about 15%, the trehalose synthase A165 is improved by about 165% and the trehalose synthase mutant K178 is improved by about 178% and the trehalose synthase mutant K A is improved by about 178% compared with the wild-type trehalose synthase.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of south of the Yangtze river

<120> trehalose synthase mutant and preparation method and application thereof

<160>15

<170>PatentIn version 3.3

<210>1

<211>1701

<212>DNA

<213> Artificial sequence

<400>1

atgatcgtca acgagcccgt tcaggacacc ttcgaggaca cgcctgccaa ggatcgtgac 60

ccggattggt tcaagcgcgc cgtcttctac gaggtcctgg tccgctcctt ccaggacagc 120

aacggcgacg gcgtcggcga cctcaaaggc ctgacggcca aactcgacta tctgcaatgg 180

ctcggcgtcg actgcctgtg gctgccgccc ttcttcaagt caccgctgag ggacggcggc 240

tacgacgtct ccgactacac ctccgtactc cccgaattcg gcgacctcgc cgacttcgtg 300

gaattcgtgg actccgccca ccagcgcggt atgcgggtca tcatcgactt cgtcatgaac 360

cacaccagcg accagcaccc gtggttccag gagtcgagga aagaccccga cggcccctac 420

ggcgactact acgtgtgggc cgacgacgac aaggcatacg gcgacgcgcg catcatcttc 480

gtcgacaccg aggcctccaa ctggaccttc gacccggtcc gcaagcagta cttcttccac 540

cgcttcttct cccaccagcc ggatctcaac tacgagaacc cgaccgtgca ggaggagatc 600

atctccgccc tgcggttctg gctggacctg ggaatcgacg gcttccggct cgatgccgtg 660

ccgtatctgt atgcgcagga gggcaccaac tgcgagaacc tgccggcgac ccatgagttc 720

ctcaagcggg tccgcaagga gatcgacgcc cactacccgg acacggtgct gctggcggag 780

gccaaccagt ggccggagga cgtcgtcgac tatttcggcg acttccgcag cggcggcgac 840

gagtgccaca tggccttcca cttcccggtg atgccgcgga tcttcatggc cgtacggcgg 900

gaatcccgct acccggtctc ggaaatcctc gccaagacac cggccatccc ctccggctgc 960

caatggggca tcttcctgcg caaccacgac gagctgaccc tcgaaatggt caccgacgag 1020

gaacgcgact acatgtacgc ggagtacgcg aaggacccgc gtatgcgcgc caacatcggt 1080

atccgcaggc gcctcgcccc gctcctcgac aacgaccgca accagatcga gctgttcacc 1140

gccttgctgc tgtcgctccc cggctcgccg atcctctact acggcgacga gatcggcatg 1200

ggcgacaaca tctggctcgg cgaccgcgac gccgtccgca cgcccatgca gtggaccccg 1260

gaccgcaacg cgggcttctc gtccagtgac ccggggcggc tgttcctgcc ggcgatcatg 1320

gacccggtct acggctacca ggtgaccaac gtcgaggcgt cgatggcctc cccgtcctca 1380

ctcctgcact ggacgcgccg gatgatcgag atccgcaagc agaaccccgc tttcggactc 1440

ggcacctaca cggaactcca gtcgtcgaat ccggccgtga tcgccttcct gcgggaatac 1500

gaggacgatc tcgtcctgtg cgtgaacaac ttctcccggt tcgcccagcc gacggagttg 1560

gacctgcgca ggttcaacgg acgacatccg gtggagctgt tcggcggggt gcgattcccg 1620

gccatcggtg agctgccgta cttgctgacg ctcggtggtc acggcttcta ctggttccgg 1680

ctgcgcaagg acgccgcctg a 1701

<210>2

<211>566

<212>PRT

<213> Artificial sequence

<400>2

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr Glu Val

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 40 45

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Ala Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Phe Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Ala Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315 320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385 390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475 480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545 550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>3

<211>566

<212>PRT

<213> Artificial sequence

<400>3

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr GluVal

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 40 45

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Thr Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Phe Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Lys Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315 320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385 390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475 480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545 550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>4

<211>566

<212>PRT

<213> Artificial sequence

<400>4

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr Glu Val

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 40 45

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Ala Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Tyr Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Lys Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315 320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475 480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>5

<211>40

<212>DNA

<213> Artificial sequence

<400>5

tgggtcgcgg atccgaattc atgatcgtca acgagcccgt 40

<210>6

<211>40

<212>DNA

<213> Artificial sequence

<400>6

tcgagtgcgg ccgcaagctt tcaggcggcg tccttgcgca 40

<210>7

<211>56

<212>DNA

<213> Artificial sequence

<400>7

aaacagaatt aattaagctt aaaggaggga aatcatgatc gtcaacgagc ccgtgc 56

<210>8

<211>60

<212>DNA

<213> Artificial sequence

<400>8

acctgcaggc atgcaagctt ttagtggtgg tggtggtggt gggcggcgtc cttgcgcagg 60

<210>9

<211>1797

<212>DNA

<213> Artificial sequence

<400>9

atgaattctc agccgagtgc agatcaccac cctgatcacg cggctcgccc agttcttgat 60

gcccacggct tgatcgttga gcacgaatcg gaagagtttc cagtccccgc acccgctccc 120

ggtgaacagc cctgggagaa gaaaaaccgc gagtggtaca aagacgccgt tttctacgaa 180

gtgctggttc gtgccttcta cgatccagaa ggcaacggag tcggatcgtt gaaaggcctg 240

accgaaaaac tggattacat ccagtggctc ggcgtggatt gcatttggat cccaccgttt 300

tatgattccc cactgcgcga cggcggttac gatatccgca acttccgtga aatcctgccc 360

gaattcggca ccgtcgatga cttcgtggaa ctcgttgacc acgcccaccg ccgtggcctg 420

cgtgttatca ccgacttggt catgaatcac acctccgacc agcacgcatg gttccaagaa 480

tcccggcgcg acccaaccgg cccctacgga gatttctatg tgtggagcga tgatcccacc 540

ctgtacaacg aagcccgcat catctttgta gatacagaag aatccaactg gacctatgat 600

ccggtgcgtg gccagtactt ctggcaccgc ttcttctccc accaaccaga cctcaactac 660

gacaaccccg cagtccaaga ggccatgcta gatgtcttgc gtttctggct ggacctggga 720

cttgatggtt tccgactaga tgccgttcct tatctttttg aacgcgaagg caccaacggc 780

gaaaacctca aagaaaccca cgatttcctc aaactgtgtc gctctgtcat tgagaaggaa 840

taccccggcc gaatcctgct cgcagaagcc aaccaatggc cccaagatgt ggtcgaatac 900

ttcggtgaaa aagacaaagg cgatgaatgc cacatggcct tccacttccc tttgatgccg 960

cgcatcttca tgggagttcg ccaaggttca cgcaccccga tcagtgagat cctggccaac 1020

accccggaga ttcccaagac tgcccaatgg ggtattttcc tgcgtaatca tgatgagctc 1080

acccttgaaa tggtctccga tgaggaacgc agctacatgt actcccaatt cgcctccgaa 1140

cctcgcatgc gcgccaacgt aggaatccgc aggcgccttt ccccactgct tgaaggcgac 1200

cgcaaccagc tggaactcct tcacggtttg ttgctgtctc tacctggctc acccgtgttg 1260

tattacggtg atgaaattgg catgggcgac aatatctggc tccacgaccg cgacggagtg 1320

cgcaccccca tgcagtggtc caacgaccgc aacggtggtt tctccaaagc tgatcctgaa 1380

cgcctgtacc ttccagcgat ccaaaatgat caatacggct acgcccaagt aaacgtggaa 1440

agccaactca accgcgaaaa ctccctgctg cgctggctcc gaaaccaaat ccttatccgc 1500

aagcagtacc gcgcatttgg tgccggaacc taccgtgaag tgtcctccac caatgagtca 1560

gtgttgacat ttttacgaga acacaagggc caaaccattt tgtgtgtcaa caacatgagc 1620

aaatatcctc aggcagtctc gcttgatttg cgtgaatttg caggacacac ccctcgagag 1680

atgtcgggcg ggcagctgtt ccctaccatt gctgaacggg agtggattgt cactttagcc 1740

cctcacggat tcttctggtt tgatctcacc gccgatgaaa aggacgatat ggaatga 1797

<210>10

<211>2070

<212>DNA

<213> Artificial sequence

<400>10

atgagcatcc cagacaacac ctatatcgaa tggctggtca gccagtccat gctgcatgcg 60

gcccgcgagc ggtcgcgtca ttacgccggc caggcgcgtc tctggcagcg gccttatgcc 120

caggcccgcc cgcgcgatgc cagcgccatc gcctcggtgt ggttcaccgc ctatccggcg 180

gccatcatca cgccggaagg cggcacggta ctcgaggccc tcggcgacga ccgcctctgg 240

agtgcgctct ccgaactcgg cgtgcagggc atccacaacg ggccgatgaa gcgttccggt 300

ggcctgcgcg gacgcgagtt caccccgacc atcgacggca acttcgaccg catcagcttc 360

gatatcgacc cgagcctggg gaccgaggag cagatgctgc agctcagccg ggtggccgcg 420

gcgcacaacg ccatcgtcat cgacgacatc gtgccggcac acaccggcaa gggtgccgac 480

ttccgcctcg cggaaatggc ctatggcgac taccccgggc tgtaccacat ggtggaaatc 540

cgcgaggagg actgggagct gctgcccgag gtgccggccg ggcgtgattc ggtcaacctg 600

ctgccgccgg tggtcgaccg gctcaaggaa aagcactaca tcgtcggcca gctgcagcgg 660

gtgatcttct tcgagccggg catcaaggac accgactgga gcgtcaccgg cgaggtcacc 720

ggggtcgacg gcaaggtgcg tcgctgggtc tatctgcact acttcaagga gggccagccg 780

tcgctgaact ggctcgaccc gaccttcgcc gcgcagcagc tgatcatcgg cgatgcgctg 840

cacgccatcg acgtcaccgg cgcccgggtg ctgcgcctgg acgccaacgg cttcctcggc 900

gtggaacggc gcgccgaggg cacggcctgg tcggagggcc acccgctgtc cgtcaccggc 960

aaccagctgc tcgccggggc gatccgcaag gccggcggct tcagcttcca ggagctgaac 1020

ctgaccatcg atgacatcgc cgccatgtcc cacggcgggg ccgatctgtc ctacgacttc 1080

atcacccgcc cggcctatca ccatgcgttg ctcaccggcg ataccgaatt cctgcgcatg 1140

atgctgcgcg aagtgcacgc cttcggcatc gacccggcgt cactgatcca tgcgctgcag 1200

aaccatgacg agttgaccct ggagctggtg cacttctgga cgctgcacgc ctacgaccat 1260

taccactaca agggccagac cctgcccggc ggccacctgc gcgaacatat ccgcgaggaa 1320

atgtacgagc ggctgaccgg cgaacacgcg ccgtacaacc tcaagttcgt caccaacggg 1380

gtgtcctgca ccaccgccag cgtgatcgcc gcggcgctta acatccgtga tctggacgcc 1440

atcggcccgg ccgaggtgga gcagatccag cgtctgcata tcctgctggt gatgttcaat 1500

gccatgcagc ccggcgtgtt cgccctctcc ggctgggatc tggtcggcgc cctgccgctg 1560

gcgcccgagc aggtcgagca cctgatgggc gatggcgata cccgctggat caatcgcggc 1620

ggctatgacc tcgccgatct ggcgccggag gcgtcggtct ccgccgaagg cctgcccaag 1680

gcccgctcgc tgtacggcag cctggccgag cagctgcagc ggccaggctc cttcgcctgc 1740

cagctcaagc gcatcctcag cgtgcgccag gcctacgaca tcgctgccag caagcagatc 1800

ctgattccgg atgtgcaggc gccgggactc ctggtgatgg tccacgagct gcctgccggc 1860

aagggcgtgc agctcacggc actgaacttc agcgccgagc cggtcagcga gaccatctgc 1920

ctgcccggcg tggcgcccgg cccggtggtg gacatcattc acgagagtgt ggagggcgac 1980

ctcaccgaca actgcgagct gcagatcaac ctcgacccgt acgaggggct tgccctgcgt 2040

gtggtgagcg ccgcgccgcc ggtgatctga 2070

<210>11

<211>35

<212>DNA

<213> Artificial sequence

<400>11

ctcaagcggg tccgcgcaga gatcgacgcc cacta 35

<210>12

<211>35

<212>DNA

<213> Artificial sequence

<400>12

ttcgtcgaca ccgagacgtc caactggacc ttcga 35

<210>13

<211>35

<212>DNA

<213> Artificial sequence

<400>13

gtccgcaagc agtactactt ccaccgcttc ttctc 35

<210>14

<211>35

<212>DNA

<213> Artificial sequence

<400>14

cgcaagcagt acttctggca ccgcttcttc tccca 35

<210>15

<211>21

<212>DNA

<213> Artificial sequence

<400>15

gccttactgg ttagcagaat g 21

Claims

1. A mutant trehalose synthase, wherein the mutation of phenylalanine at position 178 to tyrosine is compared to the mutant trehalose synthase; the nucleotide sequence for coding the trehalose synthetase is shown as SEQ ID No. 1.

2. The mutant trehalose synthase according to claim 1, wherein the amino acid sequence of the mutant is SEQ ID No. 4.

3. A gene encoding the mutant trehalose synthase of claim 1 or 2.

4. A recombinant plasmid carrying the gene of claim 3.

5. The recombinant plasmid of claim 4, wherein the vector of the recombinant plasmid is a pET-28a plasmid, a pET-22b plasmid, a pET-Duet plasmid, or a pXMJ19 plasmid.

6. A host cell carrying the gene of claim 3 or the recombinant plasmid of claim 4 or 5.

7. The host cell of claim 6, wherein the host cell is Corynebacterium glutamicum or Escherichia coli.

8. The method for producing a mutant trehalose synthase according to claim 1 or 2, which comprises using the host cell according to claim 6 or 7, inoculating the host cell according to claim 6 or 7 into a fermentation medium, fermenting, centrifuging the fermentation broth to collect cells, and finally crushing the cells to obtain a mutant trehalose synthase.

9. A process for producing trehalose, which comprises reacting a trehalose synthase mutant according to claim 1 or 2 or a host cell according to claim 6 or 7 with maltose in a reaction system containing the trehalose synthase mutant according to claim 1 or 2 or the host cell according to claim 6 or 7.

10. A formulation useful for the production of trehalose, wherein the components of the formulation comprise a trehalose synthase mutant according to claim 1 or 2 or a host cell according to claim 6 or 7.