CN111378631A

CN111378631A - Trehalose synthase mutant and application thereof in trehalose production

Info

Publication number: CN111378631A
Application number: CN202010337872.2A
Authority: CN
Inventors: 饶志明; 吴傲; 张显; 徐美娟; 杨套伟; 邵明龙
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2019-01-28
Filing date: 2019-01-28
Publication date: 2020-07-07
Anticipated expiration: 2039-01-28
Also published as: CN109609530B; CN109609530A; CN111500566A; CN111378631B; CN111500566B

Abstract

The invention discloses a trehalose synthase mutant and application thereof in trehalose production, belonging to the technical field of enzyme engineering. The enzyme activity of the trehalose synthase is high, the specific enzyme activity of the trehalose synthase in a crude enzyme solution can be up to 35.2U/mg by inducing and culturing escherichia coli carrying the trehalose synthase for 12 hours, and the specific enzyme activity of the trehalose synthase in the crude enzyme solution can be up to 33.5U/mg by inducing and culturing corynebacterium glutamicum carrying the trehalose synthase for 12 hours; compared with wild-type trehalose synthase, the specific enzyme activity and the trehalose conversion rate of the trehalose synthase mutant are obviously improved, wherein the specific enzyme activity of the trehalose synthase mutant K246A is improved by 1.43 times compared with the wild-type enzyme, and the trehalose conversion rate is improved by about 15% compared with the wild-type enzyme.

Description

Trehalose synthase mutant and application thereof in trehalose production

Technical Field

The invention relates to a trehalose synthase mutant and application thereof in trehalose production, belonging to the technical field of enzyme engineering.

Background

Trehalose (trehalase), a disaccharide widely found in nature, is formed by the linkage of two glucoses through α -1, 1-glycosidic bonds, was originally isolated from ergot cerebellum by Wiggers and is widely found in bacteria, fungi, yeasts, lower ferns, algae, insects, and invertebrates.

In addition to being used as a structural component and providing energy, trehalose plays an important role as a typical stress metabolite in organisms to protect components such as proteins, lipids, saccharides and nucleic acids in organism cells from being damaged under many environmental conditions such as dryness, low temperature, high permeability and the like, so that the cells are protected from being damaged, and therefore, the trehalose is an important protective agent for biological activity preservation of vaccines, enzymes, living tissues and cells; meanwhile, trehalose has high stability to acid and heat, can prevent starch aging and protein denaturation, can inhibit fat rancidity, has the functions of correcting taste and odor, has high glass transition temperature, low hygroscopicity and low sweetness, and has the characteristics of wide application in the food processing industry, the pharmaceutical industry, the agricultural industry, the biochemical product industry and the cosmetic industry, thereby becoming an additive of more than ten thousand products.

It can be said that trehalose has become one of the most important oligosaccharide resources in the world.

There are various methods for producing trehalose, including direct extraction, fermentation, gene recombination, chemical synthesis and enzymatic conversion. Among them, the enzymatic conversion method is considered to be the most promising industrial production method due to its advantages of high conversion rate, strong specificity, mild action, no pollution, etc.

At present, three main enzymes are used in the enzymatic conversion method, including trehalose phosphorylase, maltooligosyl trehalose synthase and trehalose synthase. Wherein, the trehalose phosphorylase needs to consume expensive high-energy phosphate compounds UDP-glucose and 6-glucose phosphate, and has little competitive advantage on the production cost; the maltooligosyl trehalose synthase and trehalose synthase can respectively produce trehalose by taking hydrolysate maltodextrin and maltose of starch as substrates, and have strong competitive advantages.

However, trehalose produced by using maltooligosyl trehalose synthase will eventually accumulate a large amount of oligosaccharides such as maltotriose, which in turn will affect the purity of trehalose; trehalose synthase is difficult to carry out large-scale industrial production due to low enzyme activity and trehalose conversion rate.

Therefore, there is an urgent need to find trehalose synthase with high enzyme activity and high trehalose conversion rate to solve the problem that it is difficult to perform large-scale industrial production.

Disclosure of Invention

[ problem ] to

The technical problem to be solved by the invention is to improve the enzyme activity of the trehalose synthetase and the yield of trehalose.

[ solution ]

In order to solve the problems, the invention provides trehalose synthetase, and the nucleotide sequence of the trehalose synthetase is shown as SEQ ID No. 1.

In one embodiment of the invention, the trehalose synthase is derived from Streptomyces coelicolor.

The invention also provides a mutant of the trehalose synthase, which is obtained by mutating lysine 246 and/or alanine 165 and/or phenylalanine 178 of the trehalose synthase.

In one embodiment of the present invention, the mutant is obtained by mutating lysine 246 to alanine of the above trehalose synthase, and the mutant is named as K246A;

or the mutant is obtained by mutating alanine at position 165 of the trehalose synthetase into threonine, and the mutant is named as A165T;

or the mutant is obtained by mutating phenylalanine at position 178 of the trehalose synthetase into tyrosine, and the mutant is named as F178Y.

In one embodiment of the invention, the amino acid sequence of the mutant is SEQ ID No.2, SEQ ID No.3 or SEQ ID No. 4.

The invention also provides a gene for coding the trehalose synthetase or the trehalose synthetase mutant.

The invention also provides a recombinant plasmid carrying the gene.

In one embodiment of the invention, the recombinant plasmid vector is a pET-28a plasmid, pET-22b plasmid, pET-Duet plasmid or pXMJ19 plasmid.

The invention also provides a host cell carrying the gene or the recombinant plasmid.

In one embodiment of the invention, the host cell is Corynebacterium glutamicum or Escherichia coli.

The invention also provides a preparation method of the trehalose synthase, which comprises the steps of using the host cell, inoculating the host cell into a fermentation culture medium for fermentation, then centrifuging the fermentation liquor to collect thalli, and finally crushing the thalli to obtain the trehalose synthase.

In one embodiment of the invention, the fermentation medium may be LB medium, TY medium or TB medium.

The invention also provides a preparation method of the trehalose synthase mutant, which comprises the steps of inoculating the host cell into a fermentation culture medium for fermentation, then centrifuging the fermentation liquid to collect thalli, and finally crushing the thalli to obtain the trehalose synthase mutant.

The present invention also provides a process for producing trehalose, which comprises reacting a trehalose synthase or a mutant of the trehalose synthase or a host cell with maltose in a reaction system using the trehalose synthase or the mutant of the trehalose synthase or the host cell.

In one embodiment of the present invention, the method comprises using the above host cell, streaking the above host cell on LB plate containing 50. mu.g/mL kanamycin, and culturing at 37 ℃ for 10-12 h to obtain an activated single host cell colony; inoculating the obtained single colony of the host cell into an LB liquid culture medium, and culturing for 10h at 37 ℃ and 180rpm to obtain a first-stage seed solution; transferring the obtained first-stage seed liquid to LB liquid culture medium with the inoculation amount of 1-2%, and culturing at 37 deg.C and 180rpm to OD₆₀₀1.0-1.5 to obtain a secondary seed solution; transferring the obtained secondary seed liquid into TY culture medium, culturing at 37 deg.C and 200-400 rpm to thallus concentration OD₆₀₀Obtaining a culture solution when the concentration reaches 18-20; adding 0.2mmol/L IPTG into the obtained culture solution, and continuously culturing at 28 ℃ and 600rpm for 12-14 h to obtain fermentation liquor; centrifuging the obtained fermentation liquor for 20min at 6000r/min, removing supernatant, and collecting thallus; the obtained cells were washed 2 to 3 times with a buffer solution having a pH of 7.0, suspended in a maltose reaction solution of 100 to 800g/L prepared from the above buffer solution, and subjected to a whole-cell transformation reaction at 35 ℃ and 200rpm for 24 hours to obtain trehalose.

The invention also provides a preparation for producing trehalose, and the components of the preparation comprise the trehalose synthetase or the trehalose synthetase mutant or the host cell.

[ advantageous effects ]

(1) The enzyme activity of the trehalose synthase is high, and the specific enzyme activity of the trehalose synthase in the crude enzyme solution can reach 35.2U/mg by inducing and culturing escherichia coli carrying the trehalose synthase for 12 hours; carrying the trehalose synthetase of the invention Corynebacterium glutamicum induced culture for 12 hours, can make the specific enzyme activity of trehalose synthetase in the crude enzyme liquid reach 33.5U/mg;

(2) the optimum reaction temperature of the trehalose synthetase is 35 ℃, and the adaptive temperature is higher, so that the trehalose synthetase has the advantages of low production cost and low requirement on production conditions in industrial production;

(3) compared with wild-type trehalose synthase, the specific enzyme activity and the trehalose conversion rate of the trehalose synthase mutant are obviously improved, wherein the specific enzyme activity of the trehalose synthase mutant K246A is improved by 1.43 times, and the trehalose conversion rate is improved by about 15% compared with the wild-type enzyme; the specific enzyme activity of the trehalose synthase mutant A165T is improved by 1.39 times compared with that of wild enzyme, and the trehalose conversion rate is improved by about 10% compared with that of the wild enzyme; the specific enzyme activity of the trehalose synthase mutant F178Y is improved by 1.18 times compared with that of wild enzyme, and the trehalose conversion rate is improved by about 5% compared with that of the wild enzyme;

(4) the recombinant Escherichia coli whole cell carrying the trehalose synthase mutant of the invention is added into a reaction system containing maltose as a catalyst, and the maltose with the concentration of 800g/L in the reaction system can be converted into trehalose with the concentration of 560g/L within 24 h.

Detailed Description

The invention will be further illustrated with reference to specific examples.

Coli BL21(DE3) referred to in the examples below was purchased from North Nay organisms; corynebacterium glutamicum ATCC13032 referred to in the following examples was purchased from American type culture Collection (American type culture Collection) and deposited under the accession number ATCC 13032; streptomyces _ coelicolor (GDM4.65) referred to in the following examples was purchased from the Guangdong province culture Collection with the accession number GDM 4.65; the pET28a plasmid, pXMJ19 plasmid, pET-Duet plasmid, pET-22b plasmid referred to in the examples below were purchased from Pubestin Biotechnology (Beijing) Ltd; maltose monohydrate, glucose, and trehalose dihydrate referred to in the following examples were purchased from national pharmaceutical group chemical agents, ltd; BHI liquid media referred to in the following examples were purchased from Qingdao Haibo organisms (the above-mentioned strains Escherichia coli BL21(DE3), Corynebacterium glutamicum ATCC13032, Streptomyces coelicolor (GDM4.65) are all commercially available and do not require preservation for patent procedures).

The media involved in the following examples are as follows:

LB liquid medium: 10g/L of peptone and 5g/L, NaCl 10g/L of yeast extract.

LB solid medium (LB plate): 10g/L of peptone, 5g/L, NaCl 10g/L of yeast extract and 2% agar powder (v/v).

Gao's synthetic medium No. one: soluble starch 20g/L, KNO₃1g/L、K₂HPO₄0.5g/L、MgSO₄·7H₂O0.5g/L、NaCl 0.5g/L、FeSO₄0.01g/L，pH 7.2～7.4。

TY medium: yeast powder 8.0g/L, glycerin 10.0g/L, tryptone 12.0g/L, K g/L₃PO₄4.02g/L, NaCl3g/L, citric acid monohydrate 2.1g/L, ferric ammonium citrate 0.3g/L, (NH)₄)₂SO₄2.5g/L，MgSO4·7H2O 0.5g/L，pH7.2。

BHI solid medium: 1.5 to 2 percent of agar powder (v/v) is added into BHI liquid culture medium.

The detection methods referred to in the following examples are as follows:

the method for determining the specific enzyme activity of the trehalose synthase comprises the following steps:

1. determination of enzyme Activity of trehalose synthetase

Filtering the crude enzyme solution with a 0.2 μm filter membrane, performing Ni-NTA affinity chromatography, and eluting with imidazole to obtain purified enzyme; the reaction system comprises 100g/L maltose, 50mmol/LpH 7.0.0 sodium phosphate buffer solution and 30 mu g purified enzyme, the reaction is carried out in a water bath at 35 ℃ for 1h, and the reaction is stopped in a boiling water bath for 10 min; detecting enzyme activity by using an HPLC method;

HPLC analysis, namely determining the concentration of a substrate and a product by adopting an HPLC differential method, wherein the chromatographic conditions comprise a chromatographic column, an NH2 column (5 mu m, 250mm × 4.6.6 mm), a mobile phase, acetonitrile-water (V/V is 75:25), a Detector, an RID Detector, the column temperature is 40 ℃, the sample injection amount is 10 mu L, and the flow rate is 1.0 mL/min;

the enzyme activity is defined as: the enzyme amount for generating 1 mu mol of trehalose every 1min is 1 enzyme activity unit;

2. determination of trehalose synthetase specific activity

Trehalose synthase specific enzyme activity ═ trehalose synthase enzyme activity (U)/enzyme concentration (μ g/mL).

The determination method of the trehalose conversion rate comprises the following steps:

trehalose conversion rate-trehalose concentration (g/L)/maltose substrate concentration (g/L) × 100%.

Example 1: extraction of gene encoding trehalose synthase and construction of recombinant bacteria containing gene encoding trehalose synthase

The method comprises the following specific steps:

(1) extraction of Streptomyces coelicolor (GDM4.65) genomic DNA

Extracting Streptomyces _ coelicolor (GDM4.65) genome DNA by using a bacterial DNA genome extraction kit purchased from Shanghai Czeri bioengineering GmbH;

selecting Streptomyces _ coelicolor (GDM4.65) single colony, inoculating to Gaoshi synthetic No. I liquid culture medium, shake culturing at 30 deg.C and 180rpm for 5 days, centrifuging at 8000rpm for 2min, and collecting thallus; washing the thalli with deionized water, centrifuging again, collecting the thalli, and suspending the collected thalli in 150 mu L of TE buffer to obtain a resuspension solution; adding 20 mu L of lysozyme into the resuspension, preserving heat for 30min at 37 ℃, then adding 300 mu L of LDigestion Solution, mixing uniformly, adding 4 mu L of RnaseA, mixing uniformly, preserving heat for 10min at 55 ℃, then adding 4 mu L of protease K, preserving heat for 30min at 55 ℃, and obtaining lysate; if the viscosity of the obtained cracking Solution is low, directly adding 300 mu L PB Solution into the cracking Solution, fully shaking and uniformly mixing, and centrifuging at 12000rpm at room temperature for 5 minutes to obtain a supernatant; transferring all the supernatant into a GenClean column sleeved in a 2mL collection tube, centrifuging at room temperature of 8000rpm for 1 minute, taking down the GenClean column, discarding waste liquid in the collection tube, putting the GenClean column back into the collection tube, adding 500 muL of Wash Solution, centrifuging at room temperature of 8000rpm for 1 minute, taking down the GenClean column, discarding waste liquid in the collection tube, repeating the steps once, putting the GenClean column back into the collection tube, centrifuging at room temperature of 12000rpm for 1 minute to remove residual Wash Solution, putting the GenClean column into a new clean 1.5mL centrifuge tube, adding 50-100 muL of Solution Buffer in the center of the GenClean column, standing at room temperature or 37 ℃ for 2 minutes, and centrifuging at room temperature of 12000rpm for 1 minute, wherein the liquid in the centrifuge tube is Streptomyces _ coelicolor (GDM4.65) genome DNA;

(2) extraction of Gene encoding trehalose synthase

The following primers were designed:

ScT-F：5’-tgggtcgcggatccgaattcATGATCGTCAACGAGCCCGT-3’(SEQ ID No.5)，

ScT-R：5’-tcgagtgcggccgcaagcttTCAGGCGGCGTCCTTGCGCA-3’(SEQ ID No.6)，

19/ScT-F：5’-aaacagaattaattaagcttAAAGGAGGGAAATCATGATCGTCAACGAGCCCGTGC-3’(SEQ ID No.7)，

19/ScT-R：5’-acctgcaggcatgcaagcttTTAGTGGTGGTGGTGGTGGTGGGCGGCGTCCTTGCGCAGG-3’(SEQ ID No.8)；

taking genome of Streptomyces _ coelicolor (GDM4.65) as a template, carrying out PCR amplification according to a pre-designed primer, and then recovering an amplification product to obtain a gene for coding trehalose synthase;

(3) construction of recombinant bacterium containing gene encoding trehalose synthase

Carrying out double enzyme digestion on the vector pET28a by using EcoR I and Hind III in water bath for 1h at 37 ℃, carrying out single enzyme digestion on the vector pXMJ19 by using Hind III in water bath for 1h at 37 ℃, and respectively recovering enzyme digestion products; uniformly mixing the enzyme digestion product obtained by recycling and the amplification product obtained by recycling in the step (2), and keeping the mixture at 37 ℃ for 30min for connection to obtain a connection product;

transforming E.coli BL21 competent cells with the ligation product, then performing cold shock and heat shock on the transformed product, adding the transformed product into 800 mu L of LB liquid culture medium, culturing for 1-1.5 h at 37 ℃ and 180r/min, centrifuging, and removing the supernatant; the pellet was spread on a plate containing 50. mu.g/mL kanamycin and incubated in an incubator at 37 ℃ for 12 h; respectively picking positive clones, adding the positive clones into 10mL LB liquid culture medium containing 50 ug/mL kanamycin and 10 ug/mL chloramphenicol, and placing the mixture in an incubator at 37 ℃ for shaking culture for 10 h; extracting plasmids for enzyme digestion verification to obtain successfully verified recombinant plasmids pET28a-ScTreS, pXMJ19-ScTreS and a recombinant strain E.coli BL21pET28 a-ScTreS;

mixing 5 μ L of plasmid xmj19-ScTreS and 90 μ L of c.glutamicum ATCC13032 in a clean bench, transferring the mixture into a precooled sterile electrode cup, and placing the precooled sterile electrode cup into an electric shock instrument for electric shock, wherein the voltage is 1850V and the Tc is 5 ms; adding 800 mu LBHI liquid culture medium into an electrode cup in a clean bench, slightly blowing and sucking the bacterial liquid in a gap in the electrode cup for several times, transferring the bacterial liquid in the electrode cup into a sterile 1.5mL EP tube, and carrying out water bath at 46 ℃ for 6 min; placing the mixture in an incubator at 30 ℃ for shake culture for 1-2 h; centrifuging at 8000rpm for 1min, sucking 700 μ L supernatant with pipette gun, discarding, and mixing the rest liquid with pipette gun; sucking the uniformly mixed bacterial liquid into a BHI solid culture medium containing 10 mu g/mL chloramphenicol, uniformly coating the mixture, and inverting the culture medium to culture the mixture in an incubator at 30 ℃ for 16-24 hours; selecting positive clones, adding the positive clones into 10mL of BHI liquid culture medium containing 10 microgram/mL of chloramphenicol, and placing the mixture in an incubator at 30 ℃ for shake culture for 16-24 hours; and extracting the plasmid for enzyme digestion verification to obtain a verified recombinant bacterium C.

Comparative example 1: construction of recombinant bacteria containing genes encoding trehalose synthase from other sources

The method comprises the following specific steps:

obtaining nucleotide sequences of trehalose synthetases (respectively, the trehalose synthetases with the nucleotide sequence shown as SEQ ID No.9 and derived from Corynebacterium glutamicum ATCC13032 and the trehalose synthetases with the nucleotide sequence shown as SEQ ID No.10 and derived from Pseudomonas stutzeri) from NCBI, obtaining the sequences through artificial synthesis, then respectively connecting the obtained sequences to pET28a carriers and transforming host cells E.coliBL21 to obtain recombinant bacteria BL21/pET28a-CgTreS and BL21/pET28 a-PsTreS;

wherein, the trehalose synthase gene from Corynebacterium glutamicum ATCC13032 and pET28a vector are connected after being cut by Nde I and HindIII, and the trehalose synthase gene from Pseudomonas stutzeri and pET28a vector are connected after being cut by BamH I and HindIII.

Example 2: expression of trehalose synthase in E.coli hosts

The recombinant bacterium E.coli BL21pET28a-ScTreS obtained in example 1 and the recombinant bacterium BL21/pET28a-CgTreS and BL21/pET28a-PsTreS obtained in comparative example 1 were added into 10mL LB medium respectively, cultured at 37 ℃ and 180rpm for 10h, then transferred to 50mL LB liquid medium with 1% inoculum size, cultured at 37 ℃ and 180rpm for 2-3 h, and then added with IPTG with 0.5mM final concentration and cultured at 16 ℃ for 12h to obtain fermentation broth.

And centrifuging the fermentation liquor, collecting thalli, washing the thalli by using a sodium phosphate buffer solution with the pH value of 7.050mM, suspending, ultrasonically crushing, centrifuging, taking supernatant to obtain a crude enzyme solution, and detecting the enzyme activity of the trehalose synthase in the crude enzyme solution.

The detection result is as follows: the specific enzyme activity of trehalose synthase in a crude enzyme solution obtained by fermentation of a recombinant bacterium E.coli BL21pET28a-ScTreS is 35.2U/mg, the specific enzyme activity of trehalose synthase in a crude enzyme solution obtained by fermentation of a recombinant bacterium BL21/pET28a-CgTreS is 31.3U/mg, and the specific enzyme activity of trehalose synthase in a crude enzyme solution obtained by fermentation of a recombinant bacterium BL21/pET28a-PsTreS is 28.1U/mg. It can be seen that the trehalose synthase of example 1 has a higher production potential than trehalose synthases from other sources.

Example 3: expression of trehalose synthase in a Corynebacterium glutamicum host

The recombinant bacterium C.glutamicum pXMJ19-ScTreS obtained in example 1 was added to 10mL of BHI liquid medium, cultured at 30 ℃ and 180rpm for 16 hours, transferred to 50mLBHI liquid medium containing 10. mu.g/mL of chloramphenicol in an inoculum size of 1%, cultured at 30 ℃ and 180rpm for 5 to 8 hours, and then added with IPTG (isopropyl thiogalactoside) at a final concentration of 0.5mM and cultured at 16 ℃ for 12 hours to obtain a fermentation broth.

And centrifuging the fermentation liquor, collecting thalli, washing the thalli by using a pH7.050mM sodium phosphate buffer solution, suspending, adding 20 mu L of 0.2mg/mL lysozyme, standing for 2 hours on ice, carrying out ultrasonic crushing and centrifugation, taking supernatant to obtain a crude enzyme solution, and detecting the enzyme activity of the trehalose synthase in the crude enzyme solution.

The detection result is as follows: the trehalose synthetase specific enzyme activity in the crude enzyme solution obtained by fermenting the recombinant strain C.glutamicum pXMJ19-ScTreS is 33.5U/mg. As can be seen, the trehalose synthase of example 1 can be expressed in a Corynebacterium glutamicum host.

Example 4: effect of temperature on trehalose synthase

The method comprises the following specific steps:

an appropriate amount of BL21/pET28a-ScTreS cells were suspended in 100mL of 200g/L maltose solution prepared from sodium phosphate buffer solution (pH 7.050 mM) to obtain OD₆₀₀15, the shaking table rotation speed was controlled at 150rpm, and the trehalose was synthesized by whole-cell transformation at 25 ℃, 30 ℃, 35 ℃, 40 ℃ and 45 ℃ respectively.

And detecting the conversion of the trehalose after 24h of conversion, wherein the detection result is as follows: at a reaction temperature of 35 ℃ the conversion was highest, up to 58.5%, with concomitant production of 15.1% glucose, and at the remaining temperatures the conversion was below 35 ℃ with a conversion of only 42.7% at 45 ℃ with concomitant production of 18.5% glucose.

Example 5: trehalose synthase mutant and construction of recombinant bacterium containing gene encoding trehalose synthase mutant

The method comprises the following specific steps:

the following primers were designed:

site-directed mutagenesis primer introducing the K246A mutation:

K246A-F：CTCAAGCGGGTCCGCGCAGAGATCGACGCCCACTA(SEQ ID No.11)；

site-directed mutagenesis primer for introducing the a165T mutation:

A165T-F：TTCGTCGACACCGAGACGTCCAACTGGACCTTCGA(SEQ ID No.12)；

site-directed mutagenesis primer for introducing F178Y mutation:

F178Y-F：GTCCGCAAGCAGTACTACTTCCACCGCTTCTTCTC(SEQ ID No.13)；

site-directed mutagenesis primer introducing the F179W mutation:

F179W-F：CGCAAGCAGTACTTCTGGCACCGCTTCTTCTCCCA(SEQ ID No.14)；

vector universal primers for introducing mutations:

pET28a-2254-R：GCCTTACTGGTTAGCAGAATG(SEQ ID No.15)；

carrying out PCR by taking the recombinant plasmid pET-28a-ScTreS as a template to obtain a PCR product, transforming E.coliBL21 competent cells by the PCR product, adding the transformed product into 800 mu L LB liquid culture medium, culturing for 2h at 37 ℃ and 180r/min, centrifuging, and discarding the supernatant; the pellet was spread on a plate containing 50. mu.g/mL kanamycin and incubated at 37 ℃ in an incubator for 12 h; selecting positive clones, adding the positive clones into 10mL LB liquid culture medium containing 50 ug/mL kanamycin, and placing the mixture in an incubator at 37 ℃ for shake culture for 10 h; extracting plasmids for enzyme digestion verification to obtain successfully verified recombinant plasmids pET-28a-ScTreS (K246A), pET-28a-ScTreS (A165T), pET-28a-ScTreS (F178Y), pET-28a-ScTreS (F179W), recombinant bacteria E.coli BL21pET28a-ScTreS (K246A), E.coli BL21pET28a-ScTreS (A165T), E.coli BL21pET28a-ScTreS (F178Y) and E.coli BL21pET28a-ScTreS (F179W);

wherein the PCR reaction system is a 25 mu L system comprising 0.2 mu L of mutation primer, 0.2 mu L of universal primer, 0.25 mu L of plasmid template, 11.85 mu L of double distilled water and 12.5 mu L of 2 × high-fidelity polymerase premix;

the PCR conditions were: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30S, annealing at 55 ℃ for 1min, extension at 72 ℃ for 3min, and 5 cycles; denaturation at 95 deg.C for 30s, extension at 68 deg.C for 6min, 20 cycles, and full extension at 68 deg.C for 12 min; at the end of the reaction, 1. mu.L of DpnI37 ℃ was added and the template in the PCR product was digested for 1 h.

Example 6: expression of trehalose synthase mutants

The method comprises the following specific steps:

the recombinant bacterium E.coli BL21pET28a-ScTreS obtained in example 1, the recombinant bacterium E.coli BL21pET28a-ScTreS (K246A) obtained in example 5, and the E.coli BL21pET28a-ScTreS (A165T), the E.coli BL21pET28a-ScTreS (F178Y), and the E.coli BL21pET28a-ScTreS (F179W) were added to 10mL LB medium, cultured at 37 ℃ and 180rpm for 10 hours, then transferred to 50mL LB liquid medium with 1% inoculum size, cultured at 37 ℃ and 180rpm for 2-3 hours, and IPTG with 0.5mM final concentration was added to continue induction culture at 16 ℃ for 12 hours, thus obtaining a fermentation broth.

The detection result is as follows: the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermentation of the recombinant bacterium E.coli BL21pET28a-ScTreS is 35.2U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermentation of the recombinant bacterium E.coli BL21pET28a-ScTreS (K246A) is 50.3U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermentation of the recombinant bacterium E.coli BL21pET28a-ScTreS (A165T) is 48.9U/mg, the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermentation of the recombinant bacterium E.coli BL21pET28a-ScTreS (F178Y) is 41.5U/mg, and the specific enzyme activity of the trehalose synthase in the crude enzyme liquid obtained by fermentation of the recombinant bacterium E.coli BLI BL 28a-ScTreS (F179W) is 36.1U/mg. It can be seen that the specific enzyme activities of the trehalose synthase mutants K246A, A165T and F178Y are obviously improved compared with the wild-type trehalose synthase, wherein the specific enzyme activity of the trehalose synthase mutant K246A is improved by 1.43 times compared with the wild-type enzyme, the specific enzyme activity of the trehalose synthase mutant A165T is improved by 1.39 times compared with the wild-type enzyme, the specific enzyme activity of the trehalose synthase mutant F178Y is improved by 1.18 times compared with the wild-type enzyme, and the change amplitude of the trehalose synthase mutant F179W is basically small.

Example 7: trehalose synthase and application of trehalose synthase mutant in trehalose production

The method comprises the following specific steps:

inoculating single colonies of the recombinant bacterium E.coli BL21pET28a-ScTreS obtained in example 1 and the recombinant bacterium E.coli BL21pET28a-ScTreS (K246A) obtained in example 4, E.coli BL21pET28a-ScTreS (A165T) and E.coli BL21pET28a-ScTreS (F178Y) into an LB liquid culture medium, and culturing for 10 hours at 37 ℃ and 180rpm to obtain a primary seed solution; transferring the obtained first-stage seed liquid to LB liquid culture medium with the inoculation amount of 1-2%, and culturing at 37 deg.C and 180rpm to OD₆₀₀1.0-1.5 to obtain a secondary seed solution; transferring the obtained secondary seed liquid into TY culture medium at 37 deg.C,Culturing at 200-400 rpm until the bacterial density OD₆₀₀Obtaining a culture solution when the concentration reaches 18-20; adding 0.2mmol/L IPTG into the obtained culture solution, and continuously culturing at 28 ℃ and 600rpm for 12-14 h to obtain fermentation liquor; centrifuging the obtained fermentation liquor for 20min at 6000r/min, removing supernatant, and collecting thallus; the obtained cells were washed 2 to 3 times with 50mM sodium phosphate buffer solution having a pH of 7.0, suspended in a maltose solution of 100 to 800g/L prepared from the above buffer solution as a reaction system, and subjected to a whole-cell transformation reaction at 35 ℃ and 200rpm to prepare trehalose.

After the conversion reaction for 24 hours, the conversion rate of trehalose in the reaction system was measured.

The detection result when the substrate concentration is 300g/L is as follows: the trehalose conversion rate of the recombinant bacterium E.coli BL21pET28a-ScTreS is 58.3%, the trehalose conversion rate of the recombinant bacterium E.coli BL21pET28a-ScTreS (K246A) is 73.7%, the trehalose conversion rate of the recombinant bacterium E.coli BL21pET28a-ScTreS (A165T) is 67.8%, and the trehalose conversion rate of the recombinant bacterium E.coli BL21pET28a-ScTreS (F178Y) is 63.1%. It can be seen that the trehalose conversion rates of the trehalose synthase mutants K246A, a165T and F178Y are significantly improved compared with the wild-type trehalose synthase, wherein the trehalose conversion rate of the trehalose synthase mutant K246A is improved by about 15% compared with the wild-type enzyme, the trehalose conversion rate of the trehalose synthase mutant a165T is improved by about 10% compared with the wild-type enzyme, and the trehalose conversion rate of the trehalose synthase mutant F178Y is improved by about 5% compared with the wild-type enzyme.

Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of south of the Yangtze river

<120> trehalose synthase mutant and application thereof in trehalose production

<160>15

<170>PatentIn version 3.3

<210>1

<211>1701

<212>DNA

<213> Artificial sequence

<400>1

atgatcgtca acgagcccgt tcaggacacc ttcgaggaca cgcctgccaa ggatcgtgac 60

ccggattggt tcaagcgcgc cgtcttctac gaggtcctgg tccgctcctt ccaggacagc 120

aacggcgacg gcgtcggcga cctcaaaggc ctgacggcca aactcgacta tctgcaatgg 180

ctcggcgtcg actgcctgtg gctgccgccc ttcttcaagt caccgctgag ggacggcggc 240

tacgacgtct ccgactacac ctccgtactc cccgaattcg gcgacctcgc cgacttcgtg 300

gaattcgtgg actccgccca ccagcgcggt atgcgggtca tcatcgactt cgtcatgaac 360

cacaccagcg accagcaccc gtggttccag gagtcgagga aagaccccga cggcccctac 420

ggcgactact acgtgtgggc cgacgacgac aaggcatacg gcgacgcgcg catcatcttc 480

gtcgacaccg aggcctccaa ctggaccttc gacccggtcc gcaagcagta cttcttccac 540

cgcttcttct cccaccagcc ggatctcaac tacgagaacc cgaccgtgca ggaggagatc 600

atctccgccc tgcggttctg gctggacctg ggaatcgacg gcttccggct cgatgccgtg 660

ccgtatctgt atgcgcagga gggcaccaac tgcgagaacc tgccggcgac ccatgagttc 720

ctcaagcggg tccgcaagga gatcgacgcc cactacccggacacggtgct gctggcggag 780

gccaaccagt ggccggagga cgtcgtcgac tatttcggcg acttccgcag cggcggcgac 840

gagtgccaca tggccttcca cttcccggtg atgccgcgga tcttcatggc cgtacggcgg 900

gaatcccgct acccggtctc ggaaatcctc gccaagacac cggccatccc ctccggctgc 960

caatggggca tcttcctgcg caaccacgac gagctgaccc tcgaaatggt caccgacgag 1020

gaacgcgact acatgtacgc ggagtacgcg aaggacccgc gtatgcgcgc caacatcggt 1080

atccgcaggc gcctcgcccc gctcctcgac aacgaccgca accagatcga gctgttcacc 1140

gccttgctgc tgtcgctccc cggctcgccg atcctctact acggcgacga gatcggcatg 1200

ggcgacaaca tctggctcgg cgaccgcgac gccgtccgca cgcccatgca gtggaccccg 1260

gaccgcaacg cgggcttctc gtccagtgac ccggggcggc tgttcctgcc ggcgatcatg 1320

gacccggtct acggctacca ggtgaccaac gtcgaggcgt cgatggcctc cccgtcctca 1380

ctcctgcact ggacgcgccg gatgatcgag atccgcaagc agaaccccgc tttcggactc 1440

ggcacctaca cggaactcca gtcgtcgaat ccggccgtga tcgccttcct gcgggaatac 1500

gaggacgatc tcgtcctgtg cgtgaacaac ttctcccggt tcgcccagcc gacggagttg 1560

gacctgcgca ggttcaacgg acgacatccg gtggagctgt tcggcggggt gcgattcccg 1620

gccatcggtg agctgccgta cttgctgacg ctcggtggtc acggcttcta ctggttccgg 1680

ctgcgcaagg acgccgcctg a 1701

<210>2

<211>566

<212>PRT

<213> Artificial sequence

<400>2

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr Glu Val

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 40 45

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Ala Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Phe Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Ala Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385 390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545 550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>3

<211>566

<212>PRT

<213> Artificial sequence

<400>3

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr Glu Val

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 4045

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Thr Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Phe Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Lys Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315 320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385 390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475 480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545 550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>4

<211>566

<212>PRT

<213> Artificial sequence

<400>4

Met Ile Val Asn Glu Pro Val Gln Asp Thr Phe Glu Asp Thr Pro Ala

1 5 10 15

Lys Asp Arg Asp Pro Asp Trp Phe Lys Arg Ala Val Phe Tyr Glu Val

20 25 30

Leu Val Arg Ser Phe Gln Asp Ser Asn Gly Asp Gly Val Gly Asp Leu

35 40 45

Lys Gly Leu Thr Ala Lys Leu Asp Tyr Leu Gln Trp Leu Gly Val Asp

50 55 60

Cys Leu Trp Leu Pro Pro Phe Phe Lys Ser Pro Leu Arg Asp Gly Gly

65 70 75 80

Tyr Asp Val Ser Asp Tyr Thr Ser Val Leu Pro Glu Phe Gly Asp Leu

85 90 95

Ala Asp Phe Val Glu Phe Val Asp Ser Ala His Gln Arg Gly Met Arg

100 105 110

Val Ile Ile Asp Phe Val Met Asn His Thr Ser Asp Gln His Pro Trp

115 120 125

Phe Gln Glu Ser Arg Lys Asp Pro Asp Gly Pro Tyr Gly Asp Tyr Tyr

130 135 140

Val Trp Ala Asp Asp Asp Lys Ala Tyr Gly Asp Ala Arg Ile Ile Phe

145 150 155 160

Val Asp Thr Glu Ala Ser Asn Trp Thr Phe Asp Pro Val Arg Lys Gln

165 170 175

Tyr Tyr Phe His Arg Phe Phe Ser His Gln Pro Asp Leu Asn Tyr Glu

180 185 190

Asn Pro Thr Val Gln Glu Glu Ile Ile Ser Ala Leu Arg Phe Trp Leu

195 200 205

Asp Leu Gly Ile Asp Gly Phe Arg Leu Asp Ala Val Pro Tyr Leu Tyr

210 215 220

Ala Gln Glu Gly Thr Asn Cys Glu Asn Leu Pro Ala Thr His Glu Phe

225 230 235 240

Leu Lys Arg Val Arg Lys Glu Ile Asp Ala His Tyr Pro Asp Thr Val

245 250 255

Leu Leu Ala Glu Ala Asn Gln Trp Pro Glu Asp Val Val Asp Tyr Phe

260 265 270

Gly Asp Phe Arg Ser Gly Gly Asp Glu Cys His Met Ala Phe His Phe

275 280 285

Pro Val Met Pro Arg Ile Phe Met Ala Val Arg Arg Glu Ser Arg Tyr

290 295 300

Pro Val Ser Glu Ile Leu Ala Lys Thr Pro Ala Ile Pro Ser Gly Cys

305 310 315 320

Gln Trp Gly Ile Phe Leu Arg Asn His Asp Glu Leu Thr Leu Glu Met

325 330 335

Val Thr Asp Glu Glu Arg Asp Tyr Met Tyr Ala Glu Tyr Ala Lys Asp

340 345 350

Pro Arg Met Arg Ala Asn Ile Gly Ile Arg Arg Arg Leu Ala Pro Leu

355 360 365

Leu Asp Asn Asp Arg Asn Gln Ile Glu Leu Phe Thr Ala Leu Leu Leu

370 375 380

Ser Leu Pro Gly Ser Pro Ile Leu Tyr Tyr Gly Asp Glu Ile Gly Met

385 390 395 400

Gly Asp Asn Ile Trp Leu Gly Asp Arg Asp Ala Val Arg Thr Pro Met

405 410 415

Gln Trp Thr Pro Asp Arg Asn Ala Gly Phe Ser Ser Ser Asp Pro Gly

420 425 430

Arg Leu Phe Leu Pro Ala Ile Met Asp Pro Val Tyr Gly Tyr Gln Val

435 440 445

Thr Asn Val Glu Ala Ser Met Ala Ser Pro Ser Ser Leu Leu His Trp

450 455 460

Thr Arg Arg Met Ile Glu Ile Arg Lys Gln Asn Pro Ala Phe Gly Leu

465 470 475 480

Gly Thr Tyr Thr Glu Leu Gln Ser Ser Asn Pro Ala Val Ile Ala Phe

485 490 495

Leu Arg Glu Tyr Glu Asp Asp Leu Val Leu Cys Val Asn Asn Phe Ser

500 505 510

Arg Phe Ala Gln Pro Thr Glu Leu Asp Leu Arg Arg Phe Asn Gly Arg

515 520 525

His Pro Val Glu Leu Phe Gly Gly Val Arg Phe Pro Ala Ile Gly Glu

530 535 540

Leu Pro Tyr Leu Leu Thr Leu Gly Gly His Gly Phe Tyr Trp Phe Arg

545 550 555 560

Leu Arg Lys Asp Ala Ala

565

<210>5

<211>40

<212>DNA

<213> Artificial sequence

<400>5

tgggtcgcgg atccgaattc atgatcgtca acgagcccgt 40

<210>6

<211>40

<212>DNA

<213> Artificial sequence

<400>6

tcgagtgcgg ccgcaagctt tcaggcggcg tccttgcgca 40

<210>7

<211>56

<212>DNA

<213> Artificial sequence

<400>7

aaacagaatt aattaagctt aaaggaggga aatcatgatc gtcaacgagc ccgtgc 56

<210>8

<211>60

<212>DNA

<213> Artificial sequence

<400>8

acctgcaggc atgcaagctt ttagtggtgg tggtggtggt gggcggcgtc cttgcgcagg 60

<210>9

<211>1797

<212>DNA

<213> Artificial sequence

<400>9

atgaattctc agccgagtgc agatcaccac cctgatcacg cggctcgccc agttcttgat 60

gcccacggct tgatcgttga gcacgaatcg gaagagtttc cagtccccgc acccgctccc 120

ggtgaacagc cctgggagaa gaaaaaccgc gagtggtaca aagacgccgt tttctacgaa 180

gtgctggttc gtgccttcta cgatccagaa ggcaacggag tcggatcgtt gaaaggcctg 240

accgaaaaac tggattacat ccagtggctc ggcgtggatt gcatttggat cccaccgttt 300

tatgattccc cactgcgcga cggcggttac gatatccgca acttccgtga aatcctgccc 360

gaattcggca ccgtcgatga cttcgtggaa ctcgttgacc acgcccaccg ccgtggcctg 420

cgtgttatca ccgacttggt catgaatcac acctccgacc agcacgcatg gttccaagaa 480

tcccggcgcg acccaaccgg cccctacgga gatttctatg tgtggagcga tgatcccacc 540

ctgtacaacg aagcccgcat catctttgta gatacagaag aatccaactg gacctatgat 600

ccggtgcgtg gccagtactt ctggcaccgc ttcttctccc accaaccaga cctcaactac 660

gacaaccccg cagtccaaga ggccatgcta gatgtcttgc gtttctggct ggacctggga 720

cttgatggtt tccgactaga tgccgttcct tatctttttg aacgcgaagg caccaacggc 780

gaaaacctca aagaaaccca cgatttcctc aaactgtgtc gctctgtcat tgagaaggaa 840

taccccggcc gaatcctgct cgcagaagcc aaccaatggc cccaagatgt ggtcgaatac 900

ttcggtgaaa aagacaaagg cgatgaatgc cacatggcct tccacttccc tttgatgccg 960

cgcatcttca tgggagttcg ccaaggttca cgcaccccga tcagtgagat cctggccaac 1020

accccggaga ttcccaagac tgcccaatgg ggtattttcc tgcgtaatca tgatgagctc 1080

acccttgaaa tggtctccga tgaggaacgc agctacatgt actcccaatt cgcctccgaa 1140

cctcgcatgc gcgccaacgt aggaatccgc aggcgccttt ccccactgct tgaaggcgac 1200

cgcaaccagc tggaactcct tcacggtttg ttgctgtctc tacctggctc acccgtgttg 1260

tattacggtg atgaaattgg catgggcgac aatatctggc tccacgaccg cgacggagtg 1320

cgcaccccca tgcagtggtc caacgaccgc aacggtggtt tctccaaagc tgatcctgaa 1380

cgcctgtacc ttccagcgat ccaaaatgat caatacggct acgcccaagt aaacgtggaa 1440

agccaactca accgcgaaaa ctccctgctg cgctggctcc gaaaccaaat ccttatccgc 1500

aagcagtacc gcgcatttgg tgccggaacc taccgtgaag tgtcctccac caatgagtca 1560

gtgttgacat ttttacgaga acacaagggc caaaccattt tgtgtgtcaa caacatgagc 1620

aaatatcctc aggcagtctc gcttgatttg cgtgaatttg caggacacac ccctcgagag 1680

atgtcgggcg ggcagctgtt ccctaccatt gctgaacggg agtggattgt cactttagcc 1740

cctcacggat tcttctggtt tgatctcacc gccgatgaaa aggacgatat ggaatga 1797

<210>10

<211>2070

<212>DNA

<213> Artificial sequence

<400>10

atgagcatcc cagacaacac ctatatcgaa tggctggtca gccagtccat gctgcatgcg 60

gcccgcgagc ggtcgcgtca ttacgccggc caggcgcgtc tctggcagcg gccttatgcc 120

caggcccgcc cgcgcgatgc cagcgccatc gcctcggtgt ggttcaccgc ctatccggcg 180

gccatcatca cgccggaagg cggcacggta ctcgaggccc tcggcgacga ccgcctctgg 240

agtgcgctct ccgaactcgg cgtgcagggc atccacaacg ggccgatgaa gcgttccggt 300

ggcctgcgcg gacgcgagtt caccccgacc atcgacggca acttcgaccg catcagcttc 360

gatatcgacc cgagcctggg gaccgaggag cagatgctgc agctcagccg ggtggccgcg 420

gcgcacaacg ccatcgtcat cgacgacatc gtgccggcac acaccggcaa gggtgccgac 480

ttccgcctcg cggaaatggc ctatggcgac taccccgggc tgtaccacat ggtggaaatc 540

cgcgaggagg actgggagct gctgcccgag gtgccggccg ggcgtgattc ggtcaacctg 600

ctgccgccgg tggtcgaccg gctcaaggaa aagcactaca tcgtcggcca gctgcagcgg 660

gtgatcttct tcgagccggg catcaaggac accgactgga gcgtcaccgg cgaggtcacc 720

ggggtcgacg gcaaggtgcg tcgctgggtc tatctgcact acttcaagga gggccagccg 780

tcgctgaact ggctcgaccc gaccttcgcc gcgcagcagc tgatcatcgg cgatgcgctg 840

cacgccatcg acgtcaccgg cgcccgggtg ctgcgcctgg acgccaacgg cttcctcggc 900

gtggaacggc gcgccgaggg cacggcctgg tcggagggcc acccgctgtc cgtcaccggc 960

aaccagctgc tcgccggggc gatccgcaag gccggcggct tcagcttcca ggagctgaac 1020

ctgaccatcg atgacatcgc cgccatgtcc cacggcgggg ccgatctgtc ctacgacttc 1080

atcacccgcc cggcctatca ccatgcgttg ctcaccggcg ataccgaatt cctgcgcatg 1140

atgctgcgcg aagtgcacgc cttcggcatc gacccggcgt cactgatcca tgcgctgcag 1200

aaccatgacg agttgaccct ggagctggtg cacttctgga cgctgcacgc ctacgaccat 1260

taccactaca agggccagac cctgcccggc ggccacctgc gcgaacatat ccgcgaggaa 1320

atgtacgagc ggctgaccgg cgaacacgcg ccgtacaacc tcaagttcgt caccaacggg 1380

gtgtcctgca ccaccgccag cgtgatcgcc gcggcgctta acatccgtga tctggacgcc 1440

atcggcccgg ccgaggtgga gcagatccagcgtctgcata tcctgctggt gatgttcaat 1500

gccatgcagc ccggcgtgtt cgccctctcc ggctgggatc tggtcggcgc cctgccgctg 1560

gcgcccgagc aggtcgagca cctgatgggc gatggcgata cccgctggat caatcgcggc 1620

ggctatgacc tcgccgatct ggcgccggag gcgtcggtct ccgccgaagg cctgcccaag 1680

gcccgctcgc tgtacggcag cctggccgag cagctgcagc ggccaggctc cttcgcctgc 1740

cagctcaagc gcatcctcag cgtgcgccag gcctacgaca tcgctgccag caagcagatc 1800

ctgattccgg atgtgcaggc gccgggactc ctggtgatgg tccacgagct gcctgccggc 1860

aagggcgtgc agctcacggc actgaacttc agcgccgagc cggtcagcga gaccatctgc 1920

ctgcccggcg tggcgcccgg cccggtggtg gacatcattc acgagagtgt ggagggcgac 1980

ctcaccgaca actgcgagct gcagatcaac ctcgacccgt acgaggggct tgccctgcgt 2040

gtggtgagcg ccgcgccgcc ggtgatctga 2070

<210>11

<211>35

<212>DNA

<213> Artificial sequence

<400>11

ctcaagcggg tccgcgcaga gatcgacgcc cacta 35

<210>12

<211>35

<212>DNA

<213> Artificial sequence

<400>12

ttcgtcgaca ccgagacgtc caactggacc ttcga 35

<210>13

<211>35

<212>DNA

<213> Artificial sequence

<400>13

gtccgcaagc agtactactt ccaccgcttc ttctc 35

<210>14

<211>35

<212>DNA

<213> Artificial sequence

<400>14

cgcaagcagt acttctggca ccgcttcttc tccca 35

<210>15

<211>21

<212>DNA

<213> Artificial sequence

<400>15

gccttactgg ttagcagaat g 21

Claims

1. A mutant trehalose synthase, wherein the mutation of alanine at position 165 to threonine is compared with the mutant trehalose synthase; the nucleotide sequence for coding the trehalose synthetase is shown as SEQ ID No. 1.

2. The mutant trehalose synthase according to claim 1, wherein the amino acid sequence of the mutant is SEQ ID No. 3.

3. A gene encoding the mutant trehalose synthase of claim 1 or 2.

4. A recombinant plasmid carrying the gene of claim 3.

5. The recombinant plasmid of claim 4, wherein the vector of the recombinant plasmid is a pET-28a plasmid, a pET-22b plasmid, a pET-Duet plasmid, or a pXMJ19 plasmid.

6. A host cell carrying the gene of claim 3 or the recombinant plasmid of claim 4 or 5.

7. The host cell of claim 6, wherein the host cell is Corynebacterium glutamicum or Escherichia coli.

8. The method for producing a mutant trehalose synthase according to claim 1 or 2, which comprises using the host cell according to claim 6 or 7, inoculating the host cell according to claim 6 or 7 into a fermentation medium, fermenting, centrifuging the fermentation broth to collect cells, and finally crushing the cells to obtain a mutant trehalose synthase.

9. A process for producing trehalose, which comprises reacting a trehalose synthase mutant according to claim 1 or 2 or a host cell according to claim 6 or 7 with maltose in a reaction system containing the trehalose synthase mutant according to claim 1 or 2 or the host cell according to claim 6 or 7.

10. A formulation useful for the production of trehalose, wherein the components of the formulation comprise a trehalose synthase mutant according to claim 1 or 2 or a host cell according to claim 6 or 7.