CN112410440B - Reagent, primer, kit and application for detecting sheep muscle fat content - Google Patents
Reagent, primer, kit and application for detecting sheep muscle fat content Download PDFInfo
- Publication number
- CN112410440B CN112410440B CN202011478131.2A CN202011478131A CN112410440B CN 112410440 B CN112410440 B CN 112410440B CN 202011478131 A CN202011478131 A CN 202011478131A CN 112410440 B CN112410440 B CN 112410440B
- Authority
- CN
- China
- Prior art keywords
- chr
- sheep
- detecting
- sparcl1
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to a reagent, a primer, a kit and application for detecting the content of muscle fat of sheep, belonging to the technical field of molecular biology. The invention provides application of a reagent for detecting the gene type of SPARCL1 in detecting the content of muscle fat in sheep. The application of the invention can provide a quick and effective method for searching sheep individuals with relatively high fat content in a fixed group, and provides a basis for breeding for improving the quality of the sheep meat.
Description
Technical Field
The invention relates to the technical field of molecular biology, in particular to a reagent, a primer, a kit and application for detecting the content of muscle fat of sheep.
Background
Sheep has a long breeding history in China, and mutton is also an indispensable meat food in daily life of residents in China. The mutton has the characteristics of high protein and low cholesterol, is rich in nutrition, has delicate taste, and has the benefits of tonifying spleen, enriching blood and the like. With the economic progress of China, the living standard of residents is continuously improved, the catering industry is developed vigorously, and mutton is popular with the public more and more. The requirement of people on meat quality is increased while the demand of mutton is increased. In recent years, breeding workers gradually shift the research direction to the improvement of sheep meat quality, and by utilizing a molecular breeding method, a theoretical basis is provided for breeding sheep to improve the quality of the meat by exploring the action mechanism of candidate genes influencing the sheep meat quality.
The mutton quality is influenced by various factors, wherein the intramuscular fat content is one of important influencing factors, and the tenderness, flavor, texture and the like of the mutton can be obviously influenced by increasing the intramuscular fat content, so that the mouthfeel is improved. However, at present, no report related to the gene related to the intramuscular fat content in sheep is explored from the molecular level, and further, a theoretical basis and a scientific basis cannot be provided for the breeding work of high-quality sheep.
Disclosure of Invention
The invention aims to provide a reagent, a primer, a kit and application for detecting the content of muscle fat in sheep. The application of the invention can provide a quick and effective method for searching individual sheep with relatively high fat content in a fixed group, and provides a basis for breeding for improving the quality of the sheep meat.
The invention provides application of a reagent for detecting the gene type of SPARCL1 in detecting the content of muscle fat in sheep.
Preferably, the locus for detecting the SPARCL1 genotype is located at the 10 th exon of the SPARCL1 gene.
Preferably, the locus for detecting the SPARCL1 genotype is the chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of the sheep genome.
The invention also provides a reagent for detecting the genotype of SPARCL1, which is used for detecting the fat content of sheep muscle and is used for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996 and 542 sites of sheep genome.
The invention also provides a primer for detecting the genotype of the SPARCL1 gene for detecting the content of the sheep muscle fat, wherein the primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
The invention also provides a kit for detecting the genotype of SPARCL1 in sheep muscle fat content, which comprises reagents for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996 and 542 positions of sheep genome.
The invention also provides a method for detecting the content of the muscle fat of the sheep, which comprises the following steps: detecting genotypes of chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of a sheep genome, wherein the genotypes corresponding to the sheep muscle fat content from high to low are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence.
The invention also provides a method for detecting the content of the sheep muscle fat based on the primer in the technical scheme, which comprises the following steps:
carrying out PCR amplification on a sample to be detected by using the primer in the technical scheme to obtain a PCR product;
and (3) directly carrying out Sanger sequencing on the PCR product, counting the genotype combination, wherein the genotypes corresponding to the high-to-low muscle fat content of the sheep are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence.
Preferably, the amplification system comprises 2 XMasterMix 10. mu.L each, 0.4. mu.L each of primers, 1. mu.L of sample to be tested and the balance ddH per 20. mu.L reaction system 2 O。
Preferably, the reaction conditions for the amplification are: 5min at 94 ℃; 35 cycles of 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16 s; 8min at 72 ℃; finally the temperature was reduced to 12 ℃.
The invention provides application of a reagent for detecting the gene type of SPARCL1 in detecting the content of muscle fat in sheep. Genotype combination analysis is carried out aiming at mutation of a 10 th exon DNA fragment of the SPARCL1 gene, related gene sites for detecting the content of the sheep muscle fat are obtained by screening, and the application of a reagent for detecting the SPARCL1 genotype in detecting the content of the sheep muscle fat is provided. Compared with the traditional single genotype selection, the method has higher accuracy, has obvious advantages for screening sheep individuals with high fat content, saves the feeding cost and improves the breeding of dominant mutton sheep.
Drawings
FIG. 1 is a graph of the sequencing results provided by the present invention;
FIG. 2 is a first peak plot of mutation sites provided by the present invention;
FIG. 3 is a second peak plot of mutation sites provided by the present invention;
FIG. 4 is a third peak plot of mutation sites provided by the present invention;
FIG. 5 is an electrophoretogram of a target fragment provided by the present invention.
Detailed Description
The invention provides application of a reagent for detecting the genotype of SPARCL1 gene in detecting the content of sheep muscle fat. In the invention, the locus for detecting the SPARCL1 genotype is positioned at the 10 th exon of the SPARCL1 gene.
The early stage of the invention works, all DNA sequences including the 10 th exon of SPARCL1 gene are cloned, sheep blood is taken as a test sample, polymorphism of the 10 th exon of SPARCL1 gene is detected by using direct sequencing technology, different genotypes are formed and combined, linkage analysis is carried out according to meat quality character data corresponding to different combined genotypes, dominant combined genotypes are found out, and theoretical basis is provided for high-quality sheep breeding work. In the invention, the locus for detecting the SPARCL1 genotype is the chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of the sheep genome. In the invention, the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3: TGACCCAACAGGGAAGCCCTCTTTCTCATTCTTGATCCTAAATTTCCAAGATACTCTGATGGACCCCACTTGAGTCAAATGCCCACAATCGGGTAGCCCAGTGGTAAGATCTAGGTTGCATAAACATGATTCTTGGGGTGCATCCGATAAATTTAGGGTGGAGGGAGGACAGTTCCTAGTGAAGGAGGAAACCTTATCCATTGACATTCAAAAAGCTGCATCTTGCCCATAAATGGTTTATTTCATTTGTAGCTTTTCATGAATGTACTATGTATTTGCTATCCTTGGCAACCTTGTGAAAGAAAAGCACCCTTGGTGATCAGAAGAGTTCACTTTTCGTACCCTGGTTACCCAGTTAACTGGCTGCCATTTGTCTCATTGCAGGGTCCTGACCCACTCTGAGCTY (T/C) GCGCCY (T/C) TTGCGAGCATCTCTCGTGCCCATGGAACACTGCATAACGCGCTTCTTTGAAGAS (G/C) TGTGACCCCAACAAGGATAAGCACATCACCCTGCAGGAGTGGGGCCACTGCTTTGAAATTAAAGAAGGTAAATTGACCATCAGCCCAGGGAGAG, wherein at chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542, there are T-C, T-C and G-C mutations, respectively. The sequencing result of sanger is shown in FIG. 1, and it can be seen from FIG. 1 that the target fragment has 3 mutation sites. The first mutation site peak diagram is shown in figure 2, which indicates that the mutation site is composed of CT, TT and CC genotypes, the second mutation site peak diagram is shown in figure 3, which indicates that the mutation site is composed of CT and CC genotypes, and the third mutation site peak diagram is shown in figure 4, which indicates that the mutation site is composed of GC and GG genotypes.
The invention also provides a reagent for detecting the genotype of SPARCL1, which is used for detecting the fat content of sheep muscle and is used for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996 and 542 sites of sheep genome. In the present invention, the reagent includes a primer.
The invention also provides a primer for detecting the genotype of the SPARCL1 gene for detecting the content of the sheep muscle fat, wherein the primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2. The source of the primer is not particularly limited in the present invention, and the primer can be synthesized by conventional primer synthesis companies, for example, by Cinzonly Biotechnology Limited, Suzhou, and the target fragment amplified by the primer has a length of 560 bp. The electrophoretogram of the target fragment is shown in FIG. 5. The primer sequence is specifically as follows: SPARCL1 gene (exon10) upstream primer sequence: 5'-TGACCCAACAGGGAAGCC-3' (SEQ ID NO.1), downstream primer sequence of SPARCL1 gene (exon 10): 5'-CTCTCCCTGGGCTGATGGT-3' (SEQ ID NO. 2).
The invention also provides a kit for detecting the genotype of SPARCL1 in sheep muscle fat content, which comprises reagents for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996 and 542 positions of sheep genome.
In the invention, each 20 mu L reaction system of the kit comprises 2 xMasterMix 10 mu L, primers 0.4 mu L, sample to be detected 1 mu L and ddH for the rest 2 And O. In the invention, the sample to be detected comprises blood to be detected or genome DNA to be detected, when the sample to be detected is blood to be detected, the blood is preferably stored in an anticoagulation tube, and when the sample to be detected is stored in a refrigerator at 4 ℃, the blood is preferably directly used as an amplification template during detection; when the sample to be tested is genomic DNA, the concentration of the genomic DNA is preferably 50 ng/. mu.L.
In the present invention, the reaction conditions of the kit are: 5min at 94 ℃; 35 cycles of 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16 s; 8min at 72 ℃; finally the temperature was reduced to 12 ℃.
The invention also provides a method for detecting the content of the muscle fat of the sheep, which comprises the following steps: detecting genotypes of chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of a sheep genome, wherein the genotypes corresponding to the sheep muscle fat content from high to low are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence.
The invention also provides a method for detecting the content of the sheep muscle fat based on the primer in the technical scheme, which comprises the following steps:
carrying out PCR amplification on a sample to be detected by using the primers in the technical scheme to obtain a PCR product; each 20. mu.L amplified reaction system preferably comprises 2 XPMasterMix 10. mu.L, 0.4. mu.L each of primers, 1. mu.L of sample to be tested and the balance ddH 2 O; the amplification reaction conditions are preferably: 5min at 94 ℃; 35 cycles of 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16 s; 8min at 72 ℃; finally the temperature was reduced to 12 ℃.
And (3) directly carrying out Sanger sequencing on the PCR product, counting the genotype combination, wherein the genotypes corresponding to the high-to-low muscle fat content of the sheep are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence.
In the invention, each 20 mu L of amplification reaction system comprises 2 xMasterMix 10 mu L, primers 0.4 mu L, sample to be detected 1 mu L and ddH for the rest 2 And O. In the invention, the sample to be detected comprises blood to be detected or genome DNA to be detected, when the sample to be detected is blood to be detected, the blood is preferably stored in an anticoagulation tube, and when the sample to be detected is stored in a refrigerator at 4 ℃, the blood is preferably directly used as an amplification template during detection; when the sample to be tested is genomic DNA, the concentration of the genomic DNA is preferably 50 ng/. mu.L.
In the present invention, the reaction conditions for the amplification are: 5min at 94 ℃; 35 cycles of 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16 s; 8min at 72 ℃; finally the temperature was reduced to 12 ℃.
The reagent, the primer, the kit and the application for detecting the sheep muscle fat content are further described in detail with reference to specific examples, and the technical scheme of the invention includes but is not limited to the following examples.
Example 1
1 determination of polymorphic sites
Designing a primer: a sheep SPARCL1 gene DNA sequence is used as a reference to design a primer 1 pair, the primer is synthesized by Jinwei Zhi biology Limited, Suzhou, and the length of a target fragment is 560 bp. The primer sequence is as follows:
SPARCL1 gene exon10 upstream primer sequence: 5'-TGACCCAACAGGGAAGCC-3' (SEQ ID NO. 1);
the sequence of the primer at the downstream of the exon10 of the SPARCL1 gene: 5'-CTCTCCCTGGGCTGATGGT-3' (SEQ ID NO. 2).
Extracting sheep blood genome DNA, using the sheep blood genome DNA as a template, determining the optimal test temperature by using a gradient PCR test, and adding a PCR reaction amplification system into a 200 mu L PCR centrifuge tube: 2 XPCR mix10 uL, upstream and downstream primers 0.5 uL, genomic DNA1 uL, using ddH 2 The content of O is filled to 20 mu L.
Placing the PCR tube in a PCR instrument, and setting the reaction condition to be 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; gradient annealing is carried out for 30s at the temperature of 55-65 ℃; extension at 72 ℃ for 16s, 35 cycles starting from the second step; extending for 8min at 72 ℃; storing at 4 ℃.5 u LPCR products using 2% agarose gel in 1 x TBE electrophoresis detection for 20 min. And determining the final annealing temperature according to the brightness and the definition of the strip.
After the final annealing temperature is determined, a full-type gold blood PCR kit is utilized, sheep blood is used as a template, and a PCR reaction system is as follows: 2 XMasterMix 10. mu.L each was added 0.4. mu.L of upstream and downstream primers, 1. mu.L of DNA (DNA was diluted to 50 ng/. mu.L before the assay), and ddH was used 2 The content of O is filled to 20 mu L.
And (4) operating on ice, and putting the sample into a PCR instrument after fully and uniformly mixing.
The PCR reaction conditions are as follows: 94 ℃ for 5min, 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16s, 35 cycles from the second step, 72 ℃ for 8min and finally a temperature drop to 12 ℃.
After the reaction, 5. mu.L of the LPCR product was detected by electrophoresis on a 2% agarose gel in 1 XTBE. The PCR products of the band of interest were directly subjected to Sanger sequencing.
After sequencing, three mutation sites exist by comparison, and T-C, T-C and G-C mutations occur at the positions of chr.6101,996,482, chr.6101,996,488 and chr.6101,996 and 542 respectively. In the actual population, the present invention detects 6 combined genotypes: CTTT GG, CC TT GG, CC TT CG, TT TT TT GG, CT TT CG and CT GG. The meat quality character data of 110 sheep aged 8 months are tested, wherein 48 CTTT GG combined genotypes are provided, 24 CC TT GG combined genotypes are provided, 18 CC TT CG combined genotypes are provided, 18 TT TT GG combined genotypes are provided, 1 CTTT CG combined genotype is provided, 1 CT GG combined genotype is provided, 1 CTTT CG and CT CT CT GG combined genotype are provided, and the two combined genotypes are respectively provided with only 1 gene and have no statistical significance, so that the meat quality character correlation analysis is not carried out.
Linkage analysis of different genotype combinations of exon10 of 2SPARCL1 gene and meat quality traits
The combination analysis of each genotype combination and the actual meat quality traits in the population discovers that the muscle fat content of the CT-TT-GG genotype combination is obviously greater than that of the CC TT CG and TT TT GG genotype combinations (P is less than 0.05) in the 4 different genotypes of the population. The muscle fat content numerical values are sequentially CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG, and the specific numerical values are shown in a table 1. Therefore, screening SPARCL1 gene CT-TT-GG genotype combination individuals in sheep breeding production can increase fat content of muscle.
TABLE 1 examination of the significance of the differences in muscle fat of the 10 th exon of the sheep SPARCL1 gene
The data in the same row are marked with different letters to show significant difference (P < 0.05); shoulder marks with the same letter or without letter representing no significant difference (P > 0.05)
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Jilin province academy of agricultural sciences
<120> reagent, primer, kit and application for detecting sheep muscle fat content
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgacccaaca gggaagcc 18
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctctccctgg gctgatggt 19
<210> 3
<211> 560
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgacccaaca gggaagccct ctttctcatt cttgatccta aatttccaag atactctgat 60
ggaccccact tgagtcaaat gcccacaatc gggtagccca gtggtaagat ctaggttgca 120
taaacatgat tcttggggtg catccgataa atttagggtg gagggaggac agttcctagt 180
gaaggaggaa accttatcca ttgacattca aaaagctgca tcttgcccat aaatggttta 240
tttcatttgt agcttttcat gaatgtacta tgtatttgct atccttggca accttgtgaa 300
agaaaagcac ccttggtgat cagaagagtt cacttttcgt accctggtta cccagttaac 360
tggctgccat ttgtctcatt gcagggtcct gacccactct gagctygcgc cyttgcgagc 420
atctctcgtg cccatggaac actgcataac gcgcttcttt gaagastgtg accccaacaa 480
ggataagcac atcaccctgc aggagtgggg ccactgcttt gaaattaaag aaggtaaatt 540
gaccatcagc ccagggagag 560
Claims (8)
1. The application of the reagent for detecting the gene type of SPARCL1 in detecting the content of muscle fat in sheep; the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3;
the locus for detecting the SPARCL1 genotype is positioned in the 10 th exon of a SPARCL1 gene; the locus for detecting the SPARCL1 genotype is chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of the sheep genome; at positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542, there are T-C, T-C and G-C mutations, respectively.
2. A reagent for detecting the genotype of SPARCL1 gene for detecting the content of sheep muscle fat, which is characterized in that the reagent is used for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of sheep genome; the positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of the sheep genome are located at the 10 th exon of the SPARCL1 gene; the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3; at positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542, there are T-C, T-C and G-C mutations, respectively.
3. The primers for detecting the genotype of the SPARCL1 gene and detecting the content of the sheep muscle fat comprise an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown as SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO. 2.
4. A kit for detecting the genotype of SPARCL1 used for detecting the content of muscle fat in sheep, which is characterized in that the kit comprises reagents for detecting the genotypes of the chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of a sheep genome; the positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of the sheep genome are located at the 10 th exon of the SPARCL1 gene; the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3; at positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542, there are T-C, T-C and G-C mutations, respectively.
5. A method for detecting the muscle fat content of sheep comprises the following steps: detecting genotypes of chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of a sheep genome, wherein the genotypes corresponding to the sheep muscle fat content from high to low are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence; the positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of the sheep genome are located at the 10 th exon of the SPARCL1 gene; the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3; at positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542, there are T-C, T-C and G-C mutations, respectively.
6. A method for detecting the content of the sheep muscle fat based on the primer of claim 3, which comprises the following steps:
carrying out PCR amplification on a sample to be detected by using the primer of claim 3 to obtain a PCR product;
performing Sanger sequencing on the PCR product directly, and counting genotype combinations, wherein the genotypes corresponding to the sheep muscle fat content from high to low are CT-TT-GG, CC-TT-CG, CC-TT-GG and TT-TT-GG in sequence;
the statistical genotype combination is the genotype combination at the chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 positions of the statistical sheep genome; the positions chr.6101,996,482, chr.6101,996,488 and chr.6101,996,542 of the sheep genome are located at the 10 th exon of the SPARCL1 gene; the nucleotide sequence of the SPARCL1 gene is shown in SEQ ID NO. 3.
7. The method of claim 6, wherein the amplification comprises 10 μ L of 2 xMasterMix, 0.4 μ L of each primer, 1 μ L of the sample to be tested, and the balance ddH per 20 μ L of reaction system 2 O。
8. The method of claim 6, wherein the amplification reaction conditions are: 5min at 94 ℃; 35 cycles of 95 ℃ for 30s, 60 ℃ for 30s, 72 ℃ for 16 s; 8min at 72 ℃; finally the temperature was reduced to 12 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011478131.2A CN112410440B (en) | 2020-12-15 | 2020-12-15 | Reagent, primer, kit and application for detecting sheep muscle fat content |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011478131.2A CN112410440B (en) | 2020-12-15 | 2020-12-15 | Reagent, primer, kit and application for detecting sheep muscle fat content |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112410440A CN112410440A (en) | 2021-02-26 |
| CN112410440B true CN112410440B (en) | 2022-08-02 |
Family
ID=74776788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011478131.2A Active CN112410440B (en) | 2020-12-15 | 2020-12-15 | Reagent, primer, kit and application for detecting sheep muscle fat content |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112410440B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111537719A (en) * | 2020-06-04 | 2020-08-14 | 复旦大学附属中山医院 | Application of serum Sparcl1 protein in non-alcoholic steatohepatitis diagnosis |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2832293C (en) * | 2003-11-26 | 2015-08-04 | Celera Corporation | Single nucleotide polymorphisms associated with cardiovascular disorders and statin response, methods of detection and uses thereof |
-
2020
- 2020-12-15 CN CN202011478131.2A patent/CN112410440B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111537719A (en) * | 2020-06-04 | 2020-08-14 | 复旦大学附属中山医院 | Application of serum Sparcl1 protein in non-alcoholic steatohepatitis diagnosis |
Non-Patent Citations (2)
| Title |
|---|
| Lin-sheng Gui等.Association between Single Nucleotide Polymorphisms in SIRT1 and SIRT2 Loci and Growth in Tibetan Sheep.《animals》.2020,1362. * |
| 肖成 等.小尾寒羊SPARCL1基因编码区克隆及表达分析.《中国畜牧兽医》.2019,第3466-3474页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112410440A (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112048562B (en) | SNP molecular marker influencing diameter of alpine merino sheep wool fiber and application thereof | |
| CN107354211B (en) | Forest musk deer four-base microsatellite genetic marker locus and screening method thereof | |
| CN113774155B (en) | Molecular marker related to chicken abdominal fat character and application thereof | |
| CN112662788B (en) | SNP marker related to milk production traits of Holstein cows in south China and application thereof | |
| CN117070637B (en) | Molecular marker related to chicken immune traits and application thereof | |
| CN114736973B (en) | SNP molecular marker related to chicken carcass skin color traits and application thereof | |
| CN112813177A (en) | Pig offspring hair color prediction method based on haplotype MC1R x 31 gene | |
| CN107227351B (en) | Molecular beacon probe, primer pair and detection method for SNPs sites of GC genes | |
| CN114752681B (en) | SNP marker affecting wool length of merino sheep in alpine and application thereof | |
| CN113215271A (en) | SNP molecular marker related to weight and shank length of broiler chicken and application thereof | |
| CN110846408A (en) | Primer combination for detecting TTN gene mutation and application thereof | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN112501314B (en) | Reagent for detecting genotype of SNP (single nucleotide polymorphism) locus correlated with egg laying traits of Riezou black ducks | |
| CN117144017B (en) | Molecular marker related to chicken growth traits and application thereof | |
| CN107287283B (en) | High-throughput detection kit for multiple SNP sites related to children susceptibility diseases and use method thereof | |
| CN112410440B (en) | Reagent, primer, kit and application for detecting sheep muscle fat content | |
| CN116694783A (en) | SNP (Single nucleotide polymorphism) marker primer pair related to growth traits of jewfish and application thereof | |
| CN108359713B (en) | Screening method of gene polymorphism detection probe | |
| CN106167825A (en) | Microsatellite marker that a kind of yellow catfish growing characteristic is relevant and detection thereof and application | |
| CN114657265B (en) | SNP marker for identifying weaning weight of alpine merino sheep and application thereof | |
| CN108486274B (en) | Molecular marker related to content of feruloyl arabinoxylan in wheat grains | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN110878365A (en) | Method for detecting pathogenic bacteria of fish sarcoidosis by multiple PCR | |
| KR102634978B1 (en) | Primer sets for determining genotype of ADH1C gene related to meat of Korean native cattle and uses thereof | |
| CN116676400B (en) | Molecular marker, primer, kit, method and application related to intramuscular fat traits of pigs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |