CN113774155B - Molecular marker related to chicken abdominal fat character and application thereof - Google Patents
Molecular marker related to chicken abdominal fat character and application thereof Download PDFInfo
- Publication number
- CN113774155B CN113774155B CN202111293675.6A CN202111293675A CN113774155B CN 113774155 B CN113774155 B CN 113774155B CN 202111293675 A CN202111293675 A CN 202111293675A CN 113774155 B CN113774155 B CN 113774155B
- Authority
- CN
- China
- Prior art keywords
- chicken
- abdominal fat
- molecular marker
- breeding
- locus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a molecular marker related to chicken abdominal fat traits and application thereof, belonging to the technical field of molecular breeding, wherein the molecular marker is located in NC-006088.5 in chicken MDFIC gene: 25921285, the base is mutated into T or C; the molecular marker is NC-006088.5 located in chicken MDFIC gene: 25921285 locus is a detection locus, the correlation of the polymorphism of the locus and the chicken abdominal fat character is analyzed, and experiments show that the allele TT of the locus is beneficial to reducing the deposition of chicken abdominal fat. The method provides theoretical basis and reference data for chicken breeding and molecular marker-assisted selection through chicken abdominal fat characters. Compared with the traditional phenotypic data breeding, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity and practicability, strong repeatability and capability of being carried out in a common laboratory.
Description
Technical Field
The invention relates to the technical field of molecular breeding, in particular to a molecular marker related to chicken abdominal fat traits and application thereof.
Background
The consumption of chicken in China is second to that of pork, while the provenance of yellow-feather broilers in the broiler industry is completely and autonomously cultivated domestically, and the genetic breeding work of the systemic yellow-feather broilers is started from the end of the 20 th century. Yellow-feathered broilers are widely popular among people because of better meat quality. However, compared with white feather broilers, yellow feather broilers have slow growth speed and low feed conversion rate, so that breeding of yellow feather broilers mainly focuses on improving the feed conversion rate and growth speed. With the promotion of breeding work, the improvement of nutrition and the scientific promotion of environmental management, the growth performance of yellow-feathered broilers is greatly improved. However, over-breeding at growth rates also leads to problems, especially the increasing abdominal fat deposition in broiler chickens. The abdominal fat is an important carcass characteristic of chickens, proper fat deposition can improve the meat quality, excessive fat deposition can greatly reduce the feed conversion rate of the broilers, the breeding cost is increased, and the disease resistance of the broilers is influenced. How to reduce the abdominal fat deposition of yellow-feathered broilers has gradually become a new breeding target in the broiler industry.
The MyoD family inhibitor domain gene (MDFIC) is located on chromosome 1 of chicken (reference genome GRCg6a, chrome 1). The product of the MDFIC gene is considered to be a protein containing MyoD inhibitor structural domain, which is characterized by having a specific C-terminal structural domain rich in cysteine, is involved in the transcriptional regulation of the expression of viral genome, and can influence the development process of organisms by inhibiting the function of MyoD. The MDFIC gene is reported to regulate the proliferation and migration of lymphoma cells so as to influence the development of Marek's disease of chickens. Previous studies have shown that the MDFIC gene can also control the proliferation, differentiation and apoptosis of chicken cells. The specific function of the gene in birds is rarely reported, and particularly, the gene is less researched on chickens.
Single Nucleotide Polymorphism (SNP) molecular markers have heritable characteristics, and can be widely used for large-group large-scale breeding and screening of yellow-feathered broilers.
Disclosure of Invention
The invention aims to provide a molecular marker related to chicken abdominal fat traits and application thereof, so as to solve the problems in the prior art, the molecular marker can realize early selection of chicken abdominal fat traits, save production cost, accelerate genetic breeding progress and provide a basis for molecular marker breeding and selective breeding.
In order to achieve the purpose, the invention provides the following scheme:
the invention provides a molecular marker related to chicken abdominal fat traits, which is positioned in NC-006088.5: 25921285, the base is mutated to T or C.
The invention also provides application of the detection reagent of the molecular marker related to the chicken abdominal fat character in detecting the chicken abdominal fat character.
The invention also provides a primer for detecting the molecular marker related to the chicken abdominal fat character, which comprises the following components:
an upstream primer F: TCCTTCTTCCCATCGCTTGC, respectively;
a downstream primer R: CTCTTGTGGAGCCTGCCATT are provided.
The invention also provides application of the primer in detecting the abdominal fat character of the chicken or preparing a kit for detecting the abdominal fat character of the chicken.
The invention also provides a kit for detecting the chicken abdominal fat character, which comprises the primer.
The invention also provides a method for detecting the chicken abdominal fat character, which is used for detecting the genotype of the molecular marker in a chicken sample to be detected.
Further, the method for detecting the chicken abdominal fat character comprises the following steps:
(1) extracting the genome DNA of a chicken sample to be detected;
(2) carrying out PCR amplification by using the primers to obtain an amplification product;
(3) Sequencing the amplification product to obtain the genotype of the molecular marker;
(4) and judging the abdominal fat character of the chicken to be detected according to the genotyping result.
Further, in the step (2), the amplification system for PCR amplification comprises: DNA 1.5. mu.L, 2xTaq MasterMix 20. mu.L, mix primers 1. mu.L each, ddH2O 16.5μL。
Further, in the step (2), the reaction procedure of the PCR amplification is: 95 ℃ for 3min, 95 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 10s, 36cycles, 72 ℃ for 5 min.
The invention also provides the molecular marker related to chicken abdominal fat traits, the primer and the application of the kit in chicken breeding.
The invention discloses the following technical effects:
the invention provides a molecular marker related to chicken abdominal fat traits, which is characterized in that the molecular marker is a molecular marker consisting of NC-006088.5: 25921285 locus is a detection locus, the correlation of the polymorphism of the locus and the chicken abdominal fat character is analyzed, and experiments show that the allele TT of the locus is beneficial to reducing the deposition of chicken abdominal fat. The method provides theoretical basis and reference data for chicken breeding and molecular marker-assisted selection through chicken abdominal fat characters. Compared with the traditional phenotypic data breeding, the detection method constructed by the molecular marker has the advantages of low cost, simple and convenient operation, accurate result, simplicity and practicability, strong repeatability and capability of being carried out in a common laboratory.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.
FIG. 1 is a schematic diagram of SNP site typing of molecular markers associated with chicken abdominal fat traits.
Detailed Description
Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.
It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in the present disclosure, it is understood that each intervening value, to the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the documents are cited. In case of conflict with any incorporated document, the present specification will control.
It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. It is intended that the specification and examples be considered as exemplary only.
As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.
Example 1
1. Animal material
731 100-day-old spotted-brown chickens (Fuhe Ji farm, Guangdong Jiangfeng company) were selected, 1.2mL of subgenus venous blood was collected using a vacuum anticoagulation tube, and stored in a low-temperature refrigerator at-80 ℃ for subsequent DNA extraction. 100-day-old chickens were slaughtered and sampled, and the weight of the chickens and the abdominal fat were measured.
2. Principal agent
NRBC Blood DNA Kit (brand: OMEGA; cat # D0715; Guangzhou Feiyang Biotechnology, Inc.), 2xTaq MasterMix (Dye) (kang century, CW0682), DNA marker (brand: Novozan; cat # MD 101; Jiangsu Novozan Biotechnology, Inc.), high-purity low-electroosmosis agarose (brand: cat; cat # TSJ 001; Beijing Stroke Biotechnology, Inc.).
3. Blood DNA extraction
DNA extraction procedures for all individuals were performed according to the NRBC Blood DNA Kit instructions, after extracting genomic DNA from Blood samples, DNA sample concentrations and OD values were determined, and samples with DNA concentrations greater than 25 ng/. mu. L, OD260/OD280 in a ratio of 1.7-1.8 were stored in a freezer at-20 ℃ for subsequent PCR amplification.
4. Primer design
Primer design was performed using the Primer-BLAST tool of NCBI according to the reference genomic sequence of the chicken (Gallus gallimus) MDFIC gene provided by the official website of NCBI (national Center for Biotechnology information). The length of the PCR product is 900bp, the sequence is shown as SEQ ID No.3, the primer information is shown in Table 1, and the primer is synthesized by Guangzhou branch of Beijing Optimoku Biotechnology Co., Ltd.
TABLE 1 PCR amplification primer information for MDFIC genes
SEQ ID No.3:>Chromosome 1:25,920,881-25,921,780
TCCTTCTTCCCATCGCTTGCCTTGTTCTCTCTGTCCAATTGACAGAGAACCACAAGCCAGTACAGTGCTGAACAGGGATTCTAGGCCTCATCTAGACGTGAGTGAGACACTTTATAAATGTTTAATTGTAATTATTTTTAATCTTTCTTGTTTTGTCTGGGGATGTTAATTTTTGCCCAGTCTAGCCTAAAGTATTTGGTGTTCAATTTACAGTTTTAATTAACACCTTCTTTCTCTTTCATTTTAAGCACAACCTCAACGTTTGCCTCAGCCGAATACTTCAGCACTGGAAGGGGGTGAGGAAGAAATTGGCAAAGTGCAGAATGGCCACGCAGGCTTGAGTAATGGAAGTGGAATGCACAATGGAGTCAAGCATGCATCAGCAAACAACAGAAAACTTTCATCTCCTGTTTCAGAAAAAATGCACAGGAAAATTCAGTCCACCTTGTCTGTCAACAGCAATGGCAGCAAGAAGAGTAAAATAAGCTCTGCGTT【T/C】TCTCAAAAGCCTTCACCTGAAGGTAAGCATAAATTCTTATTAAAAAAACAAACGGAATGAAGACTAGCCAAACCCTGTTCTCACTAATAATTACACAATCAACTGAAAATAATTGAAGAGCGTGACTCATGCTCCAGAAGCAAATAGAAATCATTATGATAAAAAGCAAGTTACTTCCCCAAAGGAAACTATTAAGTATTTGAAGGAAATTGAAGCAATGGGAGATTTGTTGCTTTCAAATATTTTGCCAACATAGTCTGGTGATGTTTTCTTCTTTGTAGTTAGTATCATGAACGGACAGAAACTCCTGTCAACATCATCACAAGTATATCAGGAAAAAAGTTAAAGCAGTAGTTGAAAACACAGTAAATACTTAATTGCATTAATGGCAGGCTCCACAAGAG
5. PCR amplification of chicken MDFIC Gene
The DNA of the blood sample was used as a template for PCR amplification of MDFIC gene (chrome 1: 25,920,881-25,921,780) using 2 XTAQA MasterMix (Dye) reagent, and the PCR system is shown in Table 2. The PCR program was performed according to 2xTaq MasterMix (Dye) protocol, and the specific procedure was: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 10s (36 cycles), post-extension at 72 ℃ for 5 min. The product was stored at 4 ℃ until use. The PCR product was sent to Guangzhou division, Beijing Ongke Biotechnology, Inc. for Sangge sequencing. The sequencing result is correct, and the MDFIC gene sequence is successfully amplified. Sequencing result detection shows that NC-006088.5 in chicken MDFIC gene: 25921285 site is SNP mutation site 25921285: c > T.
TABLE 2 PCR amplification System
6. Genotyping of SNP sites, Gene frequency calculation, and genotype frequency calculation
Alignment of the sequencing data for each sample using the SeqMan tool of DNAstar 11 software, for SNP site 25921285: peak plot for C > T (fig. 1) was analyzed and SNP site 25921285: c > T genotyping. And (3) carrying out gene frequency calculation and Hardy-Weinberg (Hardy-Weinberg) equilibrium coefficient detection on the parting result, wherein the calculation formula is as follows:
Wherein, Fi represents the frequency of SNP locus alleles, Aii and Aij represent the number of individuals homozygous (ii) and heterozygous (ij) for a SNP locus, and n is the total number of populations.
The hardy weinberg balance test uses excel software for chi-square test. The calculation results are shown in Table 3. The results show that the HW coefficient P is >0.05, indicating that the population number is large enough, no mutation, artificial selection, population migration, etc., consistent with genetic balance.
Table 3 SNP site 25921285: gene frequency results for C > T
7. SNP site 25921285: association analysis of C > T and abdominal fat traits
Performing association analysis of SNP sites and abdominal fat traits (abdominal fat weight and abdominal fat rate) by using SAS 9.0 software, wherein the adopted model is a Proc-GLMR function model, and the model formula is as follows:
Y=u+F+M+S+G+e
wherein Y is a phenotypic value, u is a population mean, F is a paternal effect, M is a maternal effect, S is a gender effect, G is a genotype effect, and e is a random residual.
And displaying a correlation analysis result: SNP site 25921285: the correlation between C > T and the abdominal fat weight trait reaches a very significant level (P <0.0001), and is very significantly related to the abdominal fat rate trait (P ═ 0.0003). Wherein TT genotype individuals show the lowest abdominal fat weight and abdominal fat rate, and TC genotype individuals show the highest abdominal fat weight and abdominal fat rate, and the specific information is shown in Table 4.
Table 4.SNP site 25921285: correlation analysis result of C > T and abdominal fat traits
Note: different letters indicate significant differences between groups.
The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.
Sequence listing
<110> southern China university of agriculture
<120> molecular marker related to chicken abdominal fat character and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tccttcttcc catcgcttgc 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ctcttgtgga gcctgccatt 20
<210> 3
<211> 900
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (496)
<223> n = c or t
<400> 3
tccttcttcc catcgcttgc cttgttctct ctgtccaatt gacagagaac cacaagccag 60
tacagtgctg aacagggatt ctaggcctca tctagacgtg agtgagacac tttataaatg 120
tttaattgta attattttta atctttcttg ttttgtctgg ggatgttaat ttttgcccag 180
tctagcctaa agtatttggt gttcaattta cagttttaat taacaccttc tttctctttc 240
attttaagca caacctcaac gtttgcctca gccgaatact tcagcactgg aagggggtga 300
ggaagaaatt ggcaaagtgc agaatggcca cgcaggcttg agtaatggaa gtggaatgca 360
caatggagtc aagcatgcat cagcaaacaa cagaaaactt tcatctcctg tttcagaaaa 420
aatgcacagg aaaattcagt ccaccttgtc tgtcaacagc aatggcagca agaagagtaa 480
aataagctct gcgttntctc aaaagccttc acctgaaggt aagcataaat tcttattaaa 540
aaaacaaacg gaatgaagac tagccaaacc ctgttctcac taataattac acaatcaact 600
gaaaataatt gaagagcgtg actcatgctc cagaagcaaa tagaaatcat tatgataaaa 660
agcaagttac ttccccaaag gaaactatta agtatttgaa ggaaattgaa gcaatgggag 720
atttgttgct ttcaaatatt ttgccaacat agtctggtga tgttttcttc tttgtagtta 780
gtatcatgaa cggacagaaa ctcctgtcaa catcatcaca agtatatcag gaaaaaagtt 840
aaagcagtag ttgaaaacac agtaaatact taattgcatt aatggcaggc tccacaagag 900
Claims (6)
1. The application of a detection reagent of a molecular marker related to chicken abdominal fat traits in detecting the chicken abdominal fat traits is characterized in that the molecular marker is located in NC-006088.5: 25921285, the base is mutated to T or C.
2. The application of the primer in detecting the abdominal fat character of the chicken or preparing the kit for detecting the abdominal fat character of the chicken is characterized in that the primer comprises:
An upstream primer F: TCCTTCTTCCCATCGCTTGC;
a downstream primer R: CTCTTGTGGAGCCTGCCATT are provided.
3. A method for detecting the abdominal fat character of a chicken, which is characterized in that the genotype of the molecular marker as defined in claim 1 in a chicken sample to be detected is detected.
4. A method according to claim 3, characterized by the steps of:
(1) extracting the genome DNA of a chicken sample to be detected;
(2) performing PCR amplification using the primers of claim 2 to obtain an amplification product;
(3) sequencing the amplification product to obtain the genotype of the molecular marker;
(4) and judging the abdominal fat character of the chicken to be detected according to the genotyping result.
5. The method according to claim 4, wherein in the step (2), the PCR-amplified amplification system comprises: DNA 1.5. mu.L, 2xTaq MasterMix 20. mu.L, mixed primers 1. mu.L each, ddH2O 16.5μL。
6. The method of claim 4, wherein in step (2), the reaction procedure of the PCR amplification is: 95 ℃ for 3min, 95 ℃ for 30s, 58 ℃ for 30s, 72 ℃ for 10s, 36cycles, 72 ℃ for 5 min.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111293675.6A CN113774155B (en) | 2021-11-03 | 2021-11-03 | Molecular marker related to chicken abdominal fat character and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111293675.6A CN113774155B (en) | 2021-11-03 | 2021-11-03 | Molecular marker related to chicken abdominal fat character and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN113774155A CN113774155A (en) | 2021-12-10 |
CN113774155B true CN113774155B (en) | 2022-06-28 |
Family
ID=78956678
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111293675.6A Active CN113774155B (en) | 2021-11-03 | 2021-11-03 | Molecular marker related to chicken abdominal fat character and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN113774155B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113913539B (en) * | 2021-12-03 | 2022-07-08 | 华南农业大学 | Molecular marker related to chicken skin yellowness character and application thereof |
CN114790477A (en) * | 2022-05-06 | 2022-07-26 | 华南农业大学 | Molecular marker related to abdominal fat character of yellow-feathered broilers and application thereof |
CN114875161B (en) * | 2022-06-16 | 2024-02-09 | 江苏省家禽科学研究所 | Molecular marker related to chicken low temperature tolerance, primer combination and corresponding breeding method |
CN115851962B (en) * | 2022-07-06 | 2024-01-02 | 中国农业科学院北京畜牧兽医研究所 | Molecular marker related to abdominal fat weight character of chicken and application thereof |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200066946A (en) * | 2018-12-03 | 2020-06-11 | 사회복지법인 삼성생명공익재단 | Composition, kit for predicting weight control according to dietary habits, and method using the same |
-
2021
- 2021-11-03 CN CN202111293675.6A patent/CN113774155B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN113774155A (en) | 2021-12-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113774155B (en) | Molecular marker related to chicken abdominal fat character and application thereof | |
CN112322753B (en) | SNP molecular marker related to intramuscular fat of pork and application thereof | |
CN113913538B (en) | SNP molecular marker related to chicken carcass traits and application | |
CN113913539B (en) | Molecular marker related to chicken skin yellowness character and application thereof | |
CN109825598B (en) | SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application | |
CN114457170B (en) | DNAJC30 gene molecular marker related to chicken carcass traits and application thereof | |
CN109234404B (en) | Method for identifying sheep meat production character and special primer | |
CN111926085B (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
CN114150070A (en) | SNP molecular marker related to chicken growth and slaughter traits, detection primer, kit and breeding method | |
CN114908176A (en) | Molecular marker related to chicken carcass and growth traits and application thereof | |
CN107475414B (en) | Method for screening parent oysters with high glycogen content | |
CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
CN117144017B (en) | Molecular marker related to chicken growth traits and application thereof | |
CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
CN114317776B (en) | Molecular marker combination related to duck egg laying characteristics, obtaining method and application | |
CN106834521B (en) | SNP molecular marker of growth trait related gene of odontobutis potamophila, amplification primer and application thereof | |
CN106755422B (en) | Detection method of MEG3 gene SNP related to cattle growth traits and application thereof | |
CN113502336B (en) | Siniperca chuatsi hypoxia-resistant character-related SNP molecular marker and application thereof | |
CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
CN115896299A (en) | PSMD3 gene molecular marker related to chicken skin color character and carcass character and application thereof | |
CN110468213B (en) | Molecular marker related to contents of inosinic acid and intramuscular fat in golden black chicken and application of molecular marker | |
CN110484628B (en) | Molecular marker related to golden black chicken abdominal fat character and application | |
CN114150071A (en) | Application of SNP molecular marker of chicken TRIM13 gene in chicken growth and slaughter trait improvement breeding and breeding method | |
CN114369670B (en) | SNP molecular marker located in SREBF2 gene and related to muscovy duck sexual precocity trait and application | |
CN112391482B (en) | SNP molecular marker related to pork conductivity and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |