CN112375758B

CN112375758B - Anti-hantavirus antisense nucleic acid sequence and application thereof

Info

Publication number: CN112375758B
Application number: CN202011285937.XA
Authority: CN
Inventors: 李明凯; 翟东昇; 程林峰; 雷迎峰; 张芳琳
Original assignee: Air Force Medical University of PLA
Current assignee: Air Force Medical University of PLA
Priority date: 2020-11-17
Filing date: 2020-11-17
Publication date: 2022-12-13
Anticipated expiration: 2040-11-17
Also published as: CN112375758A

Abstract

The invention relates to an anti-hantavirus antisense nucleic acid sequence and application thereof. The sequence is selected from one of the sequences shown in SEQ ID NO 1-4; the application relates to the application of the antisense nucleic acid compound in preparing medicine for resisting hantavirus infection.

Description

Anti-hantavirus antisense nucleic acid sequence and application thereof

Technical Field

The invention relates to antisense nucleic acid compounds and their use against hantavirus.

Background

Hantavirus (HV) diseases are a group of natural Epidemic diseases caused by hantaviruses of Hantavirus genus of Bunyaviridae family (Bunyaviridae), and murine species are hosts, including nephrotic Fever With Renal Syndrome (HFRS) or Epidemic Hemorrhagic Fever (EHF) and Hantavirus Pulmonary Syndrome (HPS), and there are 15-20 HV infection cases worldwide every year, and the fatality rate of HFRS and HPS can reach 60%. Therefore, treatment of hemorrhagic fever has been the focus of medical attention. However, the current antiviral drugs have low specificity, and there is no drug having specific anti-HV activity, and there is no effective therapeutic drug for curing the disease.

Nucleic acid drugs are novel special drugs for treating various diseases in recent years, including oligoribonucleotides and oligodeoxyribonucleotides with different functions, and the like, and mainly play a therapeutic role at the gene level. Antisense nucleic acid is a more important nucleic acid medicament, inhibits the transcription and replication of viruses by specifically identifying pathogenic genes and targets, represents that the medicament has triazahou, acyclic bird ying, acalypha and the like, is clinically used for resisting hepatitis viruses, herpes viruses and other viruses, and has wide antiviral application prospect. However, there is currently no nucleic acid drug against hantavirus.

Disclosure of Invention

In response to the deficiencies or inadequacies of the prior art, it is an object of the present invention to provide a class of antisense nucleic acid compounds of chemical structure.

The sequence provided is one selected from the sequences shown in SEQ ID NO. 1-SEQ ID NO. 4.

Further, the above sequence is modified by thioation.

The invention also aims to provide the application of the antisense nucleic acid compound in preparing anti-hantavirus medicaments. Because the design of antisense nucleic acid medicine is based on the base complementary pairing principle and nucleic acid hybridization principle, after combining with specific sequence, the antisense nucleic acid medicine can inhibit or destroy the expression of target gene, and then interfere the translation of protein. However, due to uncertainty of secondary spatial structure prediction and the like, nucleic acid drugs also have off-target phenomena and the like, and the designed and synthesized antisense nucleic acid compounds also need activity evaluation to screen out compounds with potential therapeutic effects. Therefore, based on the research, the invention also provides the application of the antisense nucleic acid compound in preparing a medicine for treating hantavirus infection.

Drawings

FIG. 1 shows the secondary structure of RNA sequences encoding the S gene of Hantaan viruses (76-118);

FIG. 2 shows the secondary structure of RNA sequences encoding the M gene of hantavirus (76-118);

FIG. 3 shows the secondary structure of RNA sequences encoding the L gene of Hantaan virus (76-118);

FIG. 4 is a statistical graph of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "S1, S2, S3" on inhibition of replication of hantavirus (76-118) in trypsinized African green monkey kidney (Vetro E6) cells, P <0.05, > P <0.01, > P <0.001, n =3, respectively, as compared to control (NC);

FIG. 5 is a statistical graph of the effect of real-time quantitative PCR detection of different concentrations of the antisense nucleic acid sequence "S1" on inhibition of hantavirus (76-118) replication in trypsinized African green monkey kidney (Vetro E6) cells at P <0.05,. P <0.01,. P <0.001, n =3, respectively, as compared to control (NC);

FIG. 6 is a statistical chart of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "M1, M2, M3, M4, M5" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; p <0.05, # P <0.01, # P <0.001, n =3, respectively, as compared to control (NC);

FIGS. 7-8 are statistical graphs of the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequences "M1, M5" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; p <0.05, # P <0.01, # P <0.001, n =3, respectively, as compared to control (NC);

FIG. 9 is a statistical chart of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "L1, L2, L3" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; p <0.05, # P <0.01, # P <0.001, n =3, respectively, as compared to control (NC);

FIG. 10 is a statistical graph of the effect of real-time quantitative PCR detection of different concentrations of the antisense nucleic acid sequence "L1" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells, p <0.05,. P <0.01, n =3, respectively, as compared to control (NC).

Detailed Description

Unless otherwise indicated, the terms herein are to be understood in accordance with the conventional knowledge of those skilled in the art.

Hantavirus is an enveloped segmented negative strand RNA virus whose genome comprises three segments S, M, L, encoding nucleoprotein, G1 and G2 glycoproteins, and L polymerase protein, respectively. The invention is based on the principle of nucleic acid complementation, and can be complemented with a target gene or a transcript thereof to inhibit the transcription and translation process of the gene. In the earlier work, the gene sequence is obtained by inquiring GenBank, the secondary structure of the gene coding RNA of the hantavirus (76-118) is analyzed in online bioinformatics (http:// rna.tbi. Univie.ac. At/cgi-bin/RNAWebSuite/RNAFold.cgi), and the antisense nucleic acid design is carried out on the circular single-stranded bindable region according to the specificity of the secondary structure, the nucleic acid complementary principle and the like. Finally, a plurality of candidate antisense nucleic acid sequences are determined, wherein representative sequences to be selected are shown in Table 1, wherein the antisense nucleic acid sequences 'S1, S2 and S3' designed aiming at the secondary structure of the RNA sequence coded by the S gene of the hantavirus (76 to 118); an antisense nucleic acid sequence 'M1, M2, M3, M4, M5' aiming at the secondary structure of an RNA sequence coded by an M gene of a hantavirus (76-118); an antisense nucleic acid sequence 'L1, L2, L3' aiming at the secondary structure of the RNA sequence coded by Hantaan virus (76-118) L gene; NC-1, NC-2 and NC-3 are three different negative control antisense nucleic acid sequences.

TABLE 1 anti-Hantaan Virus candidate antisense nucleic acid sequences

Sequence name	siRNA sequence (5 '-3')
		NC-1	TGGAATTTTTGGGGCCCTTT
NC-2	CCTAAAAACTTTGCAAGGGT
		NC-3	AAATCGCATAATCCAGCTGT
S1	TGCCATCGTTGTTCTAGTAG
		S2	CTCTGGTCTAGTTGTATCCCCATTG
S3	GATGTTTTGGTTTCCGGATACCGT
		M1	CCCATGTTGCTGATTGACTG
M2	ACAACCCCAGCTCGTCTCATATTGG
		M3	GATCACTACCGGTCAAATC
M4	AACTTGTTCTCTCGTAATT
		M5	TCAGCCTTTCCTCTCCAACT
L1	TTATCCATTCTTTTCAGAGT
		L2	CCTATTGCTTCTTCTGAATC
L3	CTGCAGTTAATGTACCAGGA

Further, in order to improve the stability of the antisense nucleic acid sequence in cells, the inventors have carried out a thioation modification of the entire nucleic acid sequence. The sulfo-modified oligonucleotide is mainly used for preventing the sequence from being degraded by nuclease in use, the phosphate between two basic groups can be converted into double bond 'S' (by using a sulfo reagent) to replace common double bond 'O' to form S-oligos, the modified sequence structure is unchanged, and the chemically synthesized product is the antisense nucleic acid sequence to be detected.

The present invention will be described in further detail with reference to the accompanying drawings and specific experimental results.

The following examples used biological materials and reagents from Proteus (Shanghai), competition Nature Biolabs, inc. (Shanghai), culture media from Gibco (USA), and Hantaan virus strain (HNTV 76-118) from the microbiology research laboratory of the basic medical institute, the university of the liberated military air force military medical university, people in China.

In the following examples, the subject of trypsinized Vetro E6 cells was selected to demonstrate the antiviral activity of the sequences of the present invention, but the sequences of the present invention are not limited to infection of the cells, and alternatively, a549 (adenocarcinoma human alveolar basal epithelial cells) and Thp-1 (macrophages), which represent human lung cells and typical antiviral immune cells, are selected according to the related art disclosed in the prior art.

Example (b):

1. antisense nucleic acids and modifications

Antisense nucleic acids and thio-modification shown in table 1 were performed by shanghai bio-organisms, and the method for thio-modification was disclosed in "Sully, e.k., and Geller, b.l. (2016. Antisense biological therapy. Current Opinion in Microbiology 33,47-55.".

2. Antisense nucleic acid transfection

(1) Trypsinize Vetro E6 cells, seed cells into 24 plates, 1 × 105 cells per well, and transfect each well the following day (24-36 hours later);

dissolving 100nm siRNA sequences in Table 1 in 50 μ l Opti-mem serum-free culture medium, dissolving 1 μ l 1ipo in 50 μ l0pti-mem serum-free culture medium, mixing, standing at room temperature for 5min, mixing AB tubes, and standing at room temperature for 20min; respectively carrying out subsequent operations on the culture system containing each siRNA sequence;

(2) during transfection, the 24-well plate medium was changed to serum-free medium at 400 μ 1 per well and C-tube mix was added to the 24-well plate;

(3) after 6-8 hours, the medium was changed to normal medium (DMEM medium containing 10% fetal bovine serum);

3. infection with hantavirus

The normal medium was discarded, and after 3 washes with 1 × PBS, the virus solution was diluted with serum-free medium, and each well was infected with virus (MIC = 0.1);

4. RNA Collection and cDNA reverse transcription

After 4 days of virus infection of cells, removing the culture medium, washing with 1 XPBS for 3 times, adding 1 mL of Trisol into each hole, cracking and blowing on ice for 5min, and transferring the lysate into a 1.5mL EP tube;

adding 200 μ L chloroform into EP tube, violently inverting, mixing, centrifuging at 4 deg.C at 12000rpm × 15min to obtain three layers of liquid, the uppermost layer is transparent liquid;

slightly sucking out the transparent liquid at the uppermost layer, about 500 mu L, transferring into a new EP tube, adding 500 mu L isopropanol, gently mixing uniformly, centrifuging at 12000rpm multiplied by 10min at 4 ℃, discarding the supernatant, and allowing a fine white precipitate to be seen at the bottom of the tube;

adding 500 μ L DEPC-75% ethanol, shaking gently, centrifuging at 4 deg.C at 12000rpm × 5min, discarding supernatant, and centrifuging at 12000rpm × 2 min;

sucking off the liquid on the tube wall by using a vacuum pump without touching the white precipitate at the tube bottom, standing for 10min at the open room temperature, adding 20 mu L DEPC water after the ethanol is volatilized, and blowing and dissolving on ice to obtain RNA;

RNA concentration and purity were quantified using a Nanodrop, 2000ng of each RNA sample was taken, and reverse transcription was performed using a reverse transcription kit according to the following system:

reacting at 37 ℃ for 2h to obtain sample cDNA, and storing at-20 ℃.

5. Real-Time quantitative PCR (Real-Time PCR)

1) Reaction system:

the upstream primer sequence is HNTV-S:5'GATCAGTCACAGTCTAGTCA-3' (Forward)

The downstream primer sequence is HNTV-S:5'-TGATTCTTCCACCATTTTGT-3' (Reverse)

2) Reaction conditions are as follows: 30s at 95 ℃; at 95 ℃ for 5s and at 60 ℃ for 35s, 40 cycles;

dissolution curve: 95 ℃ 15s,60 ℃ 1min,95 ℃ 15s.

And (4) analyzing results: the above Real-Time PCR reaction was carried out by using ABI 7500Fast instrument, and the results were recorded and analyzed by using self-contained software, each sample was repeatedly loaded for 3 times, and the experimental results used' 2- ^△△Ct The value "is displayed. The results are shown in FIGS. 4-10, which were analyzed as follows:

FIG. 4 is a statistical chart showing the effect of real-time quantitative PCR detection on the replication inhibition of hantavirus (76-118) in trypsinized Vetro E6 cells by the antisense nucleic acid sequences "S1, S2, S3" to be selected, wherein the antisense nucleic acid sequence S1 has obvious virus inhibition effect and has statistical difference compared with the control group (NC), and the antisense nucleic acid sequences S2, S3 have no inhibition effect on the virus. * P <0.05, P <0.01, P <0.001, n =3;

FIG. 5 is a statistical chart showing the effect of real-time quantitative PCR detection of different concentrations of the antisense nucleic acid sequence "S1" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells, and the different concentrations of the antisense nucleic acid sequence S1 all have inhibitory effects on the virus compared with the control group (NC). * P <0.05, P <0.01, P <0.001, n =3;

FIG. 6 is a statistical chart of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "M1, M2, M3, M4, M5" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; compared with a control group (NC), the two antisense nucleic acid sequences M1 and M5 have obvious inhibitory effects on viruses and have statistical difference, and M2, M3 and M4 have no inhibitory effect on the viruses. * P <0.05, P <0.01, P <0.001, n =3;

FIGS. 7-8 are statistical graphs of the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequences "M1, M5'" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; the antisense nucleic acid sequences M1 and M5 had inhibitory effects on viruses at different concentrations compared with the control group (NC), respectively. * P <0.05, P <0.01, P <0.001, n =3;

FIG. 9 is a statistical chart of the effect of real-time quantitative PCR detection of the antisense nucleic acid sequences "L1, L2, L3" to inhibit replication of hantavirus (76-118) in trypsinized Vetro E6 cells; compared with a control group (NC), the antisense nucleic acid sequence L1 has obvious inhibition effect on the virus and has statistical difference, and L2 and L3 have no inhibition effect on the virus. * P <0.05, P <0.01, P <0.001, n =3;

FIG. 10 is a statistical chart showing the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequence "L1" on inhibition of hantaan virus (76-118) replication in trypsinized Vetro E6 cells, and compared with control group (NC), the antisense nucleic acid sequence L1 has significant inhibitory effect on virus at 250nM and 125nM, and has statistical difference, while L1 has no inhibitory effect on virus at 62.5 nM. * p <0.05, # p <0.01, n =3.

Nucleotide sequence list electronic file

<110> China people liberation military and military medical university

<120> hantavirus-resistant antisense nucleic acid sequences and application thereof

<210>1

<211>20

<212>DNA

<213>

<220> sequence S1

<400>1

5’-TGCCATCGTTGTTCTAGTAG-3’

<210>2

<211>20

<212>DNA

<213>

<220> sequence M1

<400>2

5’-CCCATGTTGCTGATTGACTG-3’

<210>3

<211>20

<212>DAN

<213>

<220> sequence M5

<400>3

5’-TCAGCCTTTCCTCTCCAACT-3’

<210>4

<211>20

<212>DAN

<213>

<220> sequence L1

<400>4

5’-TTATCCATTCTTTTCAGAGT-3’

Claims

1. An application of an anti-hantavirus antisense nucleic acid in preparing an anti-hantavirus medicine is disclosed, wherein the sequence of the anti-hantavirus antisense nucleic acid is shown as a sequence in SEQ ID NO. 4, and the sequence shown as the SEQ ID NO. 4 is modified by thioation.

2. The anti-hantavirus medicine is characterized by comprising anti-hantavirus antisense nucleic acid, wherein the sequence of the anti-hantavirus antisense nucleic acid is shown as SEQ ID NO. 4, and the sequence shown as SEQ ID NO. 4 is subjected to thioation modification.