CN112375758A

CN112375758A - Novel anti-hantavirus antisense nucleic acid sequence and application thereof

Info

Publication number: CN112375758A
Application number: CN202011285937.XA
Authority: CN
Inventors: 李明凯; 翟东昇; 程林峰; 雷迎峰; 张芳琳
Original assignee: Air Force Medical University of PLA
Current assignee: Air Force Medical University of PLA
Priority date: 2020-11-17
Filing date: 2020-11-17
Publication date: 2021-02-19
Anticipated expiration: 2040-11-17
Also published as: CN112375758B

Abstract

The invention relates to a novel hantavirus-resistant antisense nucleic acid sequence and application thereof. The sequence is selected from one of the sequences shown in SEQ ID NO 1-4; the application relates to the application of the antisense nucleic acid compound in preparing medicine for resisting hantavirus infection.

Description

Novel anti-hantavirus antisense nucleic acid sequence and application thereof

Technical Field

The invention relates to antisense nucleic acid compounds and their use against hantavirus.

Background

Hantavirus (HV) diseases are a group of natural Epidemic diseases caused by hantaviruses of Hantavirus genus of Bunyaviridae family (Bunyaviridae), and rats are hosts and comprise nephrotic Fever With Renal Syndrome (HFRS) or Epidemic Hemorrhagic Fever (EHF) and Hantavirus Pulmonary Syndrome (HPS), 15-20 HV infection cases are worldwide every year, and the fatality rate of HFRS and HPS can reach 60%. China is the most seriously harmed country by HV, the distribution of cases is wide, and the number of diseases and death people are the first in the world. Therefore, treatment of hemorrhagic fever has been the focus of medical attention. However, the current antiviral drugs have low specificity, and there is no drug having specific anti-HV activity, and there is no effective therapeutic drug for curing the disease.

Nucleic acid drugs are novel special drugs for treating various diseases in recent years, including oligoribonucleotides and oligodeoxyribonucleotides with different functions, and the like, and mainly play a therapeutic role at the gene level. Antisense nucleic acid is a more important nucleic acid medicament, inhibits the transcription and replication of viruses by specifically identifying pathogenic genes and targets, represents that the medicament has triazahou, acyclic bird ying, acalypha and the like, is clinically used for resisting hepatitis viruses, herpes viruses and other viruses, and has wide antiviral application prospect. However, there is currently no nucleic acid drug against hantavirus.

Disclosure of Invention

In view of the shortcomings or drawbacks of the prior art, it is an object of the present invention to provide a novel class of antisense nucleic acid compounds.

The provided sequence is selected from one of the sequences shown in SEQ ID NO. 1-SEQ ID NO. 4.

Further, the above sequence is modified by thioation.

The invention also aims to provide the application of the antisense nucleic acid compound in preparing anti-hantavirus medicaments. Because the design of antisense nucleic acid medicine is based on the base complementary pairing principle and nucleic acid hybridization principle, after combining with specific sequence, the antisense nucleic acid medicine can inhibit or destroy the expression of target gene, and then interfere the translation of protein. However, due to uncertainty of prediction of secondary spatial structure, etc., the phenomenon of off-target of nucleic acid drugs also exists, and the designed and synthesized antisense nucleic acid compound also needs activity evaluation to screen out compounds with potential therapeutic effects. Therefore, based on the research, the invention also provides the application of the antisense nucleic acid compound in preparing a medicine for treating hantavirus infection.

Drawings

FIG. 1 shows the secondary structure of RNA sequences encoding the S gene of hantavirus (76-118);

FIG. 2 shows the secondary structure of RNA sequences encoding the M gene of hantavirus (76-118);

FIG. 3 shows the secondary structure of RNA sequences encoding the L gene of Hantaan virus (76-118);

figure 4 statistical graphs of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "S1, S2, S3" on inhibiting hantavirus (76-118) replication in trypsinized african green monkey kidney (Vetro E6) cells, P <0.05, > P <0.01, > P <0.001, n ═ 3, respectively, as compared to control (NC);

FIG. 5 is a statistical graph of the effect of real-time quantitative PCR detection of various concentrations of the antisense nucleic acid sequence "S1" on inhibition of replication of hantavirus (76-118) in trypsinized African green monkey kidney (Vetro E6) cells, P <0.05,. P <0.01,. P <0.001,. n-3, respectively, as compared to control (NC);

FIG. 6 is a statistical graph showing the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "M1, M2, M3, M4 and M5" on inhibition of replication of hantavirus (76-118) in trypsinized Vetro E6 cells; p <0.05, P <0.01, P <0.001, n-3, respectively, compared to control (NC);

FIGS. 7-8 are graphs showing the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequences "M1, M5" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells; p <0.05, P <0.01, P <0.001, n-3, respectively, compared to control (NC);

FIG. 9 is a statistical chart of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "L1, L2, L3" on inhibition of replication of hantavirus (76-118) in trypsinized Vetro E6 cells; p <0.05, P <0.01, P <0.001, n-3, respectively, compared to control (NC);

FIG. 10 is a statistical graph of the effect of real-time quantitative PCR detection of various concentrations of the antisense nucleic acid sequence "L1" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells, p <0.05,. p <0.01, and n 3, respectively, as compared to control (NC).

Detailed Description

Unless otherwise indicated, the terms herein are to be understood in accordance with the conventional knowledge of those skilled in the art.

Hantavirus is an enveloped segmented negative-strand RNA virus whose genome comprises S, M, L fragments encoding nucleoprotein, G1 and G2 glycoproteins, and L polymerase protein, respectively. The invention is based on the principle of nucleic acid complementation, and can be complemented with a target gene or a transcript thereof to inhibit the transcription and translation process of the gene. Early work obtains its gene sequence by inquiring GenBank, and on-line bioinformatics

(http:// rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAAfold.cgi) analyzing the secondary structure of RNA encoded by the gene of the hantavirus (76-118), and designing antisense nucleic acid for the circular single-stranded bindable region according to the specificity of the secondary structure, the nucleic acid complementary principle and the like. Finally, a plurality of candidate antisense nucleic acid sequences are determined, wherein representative sequences of the candidates are shown in Table 1, wherein the antisense nucleic acid sequences 'S1, S2, S3' designed aiming at the secondary structure of the RNA sequence coded by the S gene of the hantavirus (76-118); antisense nucleic acid sequences "M1, M2, M3, M4, M5" encoding RNA sequences secondary structure against the M gene of hantavirus (76-118); antisense nucleic acid sequences "L1, L2, L3" directed against the secondary structure of the RNA sequence encoding the L gene of Hantaan virus (76-118); NC-1, NC-2 and NC-3 are three different negative control antisense nucleic acid sequences.

TABLE 1 anti-Hantaan Virus candidate antisense nucleic acid sequences

Sequence name	siRNA sequence (5 '-3')
		NC-1	TGGAATTTTTGGGGCCCTTT
NC-2	CCTAAAAACTTTGCAAGGGT
		NC-3	AAATCGCATAATCCAGCTGT
S1	TGCCATCGTTGTTCTAGTAG
		S2	CTCTGGTCTAGTTGTATCCCCATTG
S3	GATGTTTTGGTTTCCGGATACCGT
		M1	CCCATGTTGCTGATTGACTG
M2	ACAACCCCAGCTCGTCTCATATTGG
		M3	GATCACTACCGGTCAAATC
M4	AACTTGTTCTCTCGTAATT
		M5	TCAGCCTTTCCTCTCCAACT
L1	TTATCCATTCTTTTCAGAGT
		L2	CCTATTGCTTCTTCTGAATC
L3	CTGCAGTTAATGTACCAGGA

Further, in order to improve the stability of the antisense nucleic acid sequence in cells, the inventors have carried out a thioation modification of the entire nucleic acid sequence. The sulfo-modified oligonucleotide is mainly used for preventing the sequence from being degraded by nuclease in use, the phosphate between two basic groups can be converted into double bond 'S' (by using a sulfo reagent) to replace common double bond 'O' to form S-oligos, the modified sequence structure is unchanged, and the chemically synthesized product is the antisense nucleic acid sequence to be detected.

The present invention will be described in further detail with reference to the accompanying drawings and specific experimental results.

The following examples used biological materials and reagents from Protista (Shanghai), Proteus Biopsis, Inc. of sequence Synthesis (Shanghai), culture media from Gibco (USA), and Hantaan virus strain (HNTV76-118) from the institute for microbiology, the basic medical institute of military university, air force, China.

It should be noted that in the following examples, the subject of the present invention is selected as a subject to be studied by trypsinizing Vetro E6 cells, but the present invention is not limited to the infection of the cells, and according to the related art disclosed in the prior art, a549 (adenocarcinoma human alveolar basal epithelial cells), and Thp-1 (macrophages) can be selected as representative of human lung cells and typical antiviral immune cells.

Example (b):

1. antisense nucleic acids and modifications

The Antisense nucleic acids and thio-modification shown in Table 1 were performed by Shanghai Bionical corporation, and the method of thio-modification was disclosed in "Sully, E.K., and Geller, B.L. (2016. Antisense nucleic acid therapy in Microbiology 33, 47-55.".

2. Antisense nucleic acid transfection

Trypsinize Vetro E6 cells, seeded into 24 plates, 1 × 105 cells per well, transfected per well the following day (after 24-36 hours);

dissolving 100nm siRNA sequences in Table 1 in 50 μ l Opti-mem serum-free culture medium, dissolving 1 μ l 1ipo2000 in 50 μ l0pti-mem serum-free culture medium, mixing, standing at room temperature for 5min, mixing AB tubes, and standing at room temperature for 20 min; respectively carrying out subsequent operations on the culture system containing each siRNA sequence;

during transfection, the 24-well plate culture medium is changed into a serum-free culture medium, each hole has 400 mu 1, and C tube mix is added into the 24-well plate;

③ changing the culture medium to a normal culture medium after 6 to 8 hours (DMEM medium contains 10 percent fetal calf serum);

3. infection with hantavirus

The normal medium was discarded, and after washing 3 times with 1 × PBS, the virus solution was diluted with serum-free medium, and each well was infected with virus (MIC ═ 0.1);

4. RNA Collection and cDNA reverse transcription

After 4 days of virus infection of cells, removing the culture medium, washing with 1 XPBS for 3 times, adding 1mL of Trisol into each hole, cracking and blowing on ice for 5min, and transferring the lysate into a 1.5mL EP tube;

adding 200 μ L chloroform into EP tube, violently reversing, mixing, centrifuging at 4 deg.C at 12000rpm × 15min to obtain three layers of liquid, the top layer is transparent liquid;

slightly sucking out the transparent liquid at the uppermost layer, about 500 mu L, transferring into a new EP tube, adding 500 mu L isopropanol, gently mixing uniformly, centrifuging at 12000rpm multiplied by 10min at 4 ℃, discarding the supernatant, and allowing a fine white precipitate to be seen at the bottom of the tube;

adding 500 μ L DEPC-75% ethanol, shaking gently, centrifuging at 4 deg.C at 12000rpm × 5min, discarding supernatant, and centrifuging at 12000rpm × 2 min;

sucking off the liquid on the tube wall by using a vacuum pump without touching the white precipitate at the tube bottom, standing for 10min at the open room temperature, adding 20 mu L DEPC water after the ethanol is volatilized, and blowing and dissolving on ice to obtain RNA;

RNA concentration and purity were quantified using a Nanodrop, 2000ng of each RNA sample was taken, and reverse transcription was performed using a reverse transcription kit according to the following system:

reacting at 37 ℃ for 2h to obtain sample cDNA, and storing at-20 ℃.

5. Real-Time quantitative PCR (Real-Time PCR)

1) Reaction system:

the upstream primer sequence is HNTV-S:5 'GATCAGTCACAGTCTAGTCA-3' (Forward)

The sequence of the downstream primer is HNTV-S: 5'-TGATTCTTCCACCATTTTGT-3' (Reverse)

2) Reaction conditions are as follows: 30s at 95 ℃; 5s at 95 ℃ and 35s at 60 ℃ for 40 cycles;

dissolution curve: 95 ℃ for 15s, 60 ℃ for 1min and 95 ℃ for 15 s.

And (4) analyzing results: the ABI 7500Fast instrument is used for carrying out the Real-Time PCR reaction, self-contained software is used for recording and analyzing the result, each sample is repeatedly added with the sample for 3 times, and the experiment result uses' 2-^△△CtThe value "is displayed. The results are shown in FIGS. 4-10, which were analyzed as follows:

FIG. 4 is a statistical chart of the effect of real-time quantitative PCR detection on replication inhibition of hantavirus (76-118) in trypsinized Vetro E6 cells by candidate antisense nucleic acid sequences "S1, S2 and S3", wherein the antisense nucleic acid sequence S1 has obvious virus inhibition effect and has statistical difference compared with a control group (NC), and S2 and S3 have no inhibition effect on viruses. P <0.05, P <0.01, P <0.001, n-3;

FIG. 5 is a statistical chart showing the effect of real-time quantitative PCR detection of different concentrations of the antisense nucleic acid sequence "S1" on inhibition of hantavirus (76-118) replication in trypsinized Vetro E6 cells, and the different concentrations of the antisense nucleic acid sequence S1 all have inhibitory effects on viruses compared with the control group (NC), respectively. P <0.05, P <0.01, P <0.001, n-3;

FIG. 6 is a statistical graph showing the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "M1, M2, M3, M4 and M5" on inhibition of replication of hantavirus (76-118) in trypsinized Vetro E6 cells; compared with a control group (NC), the two antisense nucleic acid sequences M1 and M5 have obvious inhibition effects on viruses and have statistical difference, and M2, M3 and M4 have no inhibition effect on the viruses. P <0.05, P <0.01, P <0.001, n-3;

FIGS. 7-8 are graphs showing the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequences "M1, M5'" on inhibition of replication of hantavirus (76-118) in trypsinized Vetro E6 cells; the antisense nucleic acid sequences M1 and M5 had inhibitory effects against viruses at different concentrations compared to the control (NC), respectively. P <0.05, P <0.01, P <0.001, n-3;

FIG. 9 is a statistical chart of the effect of real-time quantitative PCR detection of candidate antisense nucleic acid sequences "L1, L2, L3" on inhibition of replication of hantavirus (76-118) in trypsinized Vetro E6 cells; compared with a control group (NC), the antisense nucleic acid sequence L1 has obvious inhibition effect on the virus and has statistical difference, and L2 and L3 have no inhibition effect on the virus. P <0.05, P <0.01, P <0.001, n-3;

FIG. 10 is a statistical chart showing the effect of real-time quantitative PCR detection of different concentrations of antisense nucleic acid sequence "L1" on inhibition of hantaan virus (76-118) replication in trypsinized Vetro E6 cells, and compared with control group (NC), the antisense nucleic acid sequence L1 has obvious inhibition effect on virus at 250nM and 125nM, and has statistical difference, while L1 has no inhibition effect on virus at 62.5nM, respectively. P <0.05, p <0.01, n-3.

Nucleotide sequence list electronic file

<110> China people liberation military and military medical university

<120> novel anti-hantavirus antisense nucleic acid sequences and uses thereof

<210>1

<211>20

<212>DNA

<213>

<220> sequence S1

<400>1

5’-TGCCATCGTTGTTCTAGTAG-3’

<210>2

<211>20

<212>DNA

<213>

<220> sequence M1

<400>2

5’-CCCATGTTGCTGATTGACTG-3’

<210>3

<211>20

<212>DAN

<213>

<220> sequence M5

<400>3

5’-TCAGCCTTTCCTCTCCAACT-3’

<210>4

<211>20

<212>DAN

<213>

<220> sequence L1

<400>4

5’-TTATCCATTCTTTTCAGAGT-3’

Claims

1. A novel anti-hantavirus antisense nucleic acid sequence is selected from one of the sequences shown in SEQ ID NO 1-SEQ ID NO 4.

2. The novel class of antisense nucleic acid sequences against hantavirus of claim 1, wherein said sequences are thioated modified.

3. Use of the sequences of claim 1 or 2 for the preparation of a medicament against hantavirus.

4. An anti-hantavirus agent comprising the sequence of claim 1 or 2.