CN112322777A - SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding - Google Patents
SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding Download PDFInfo
- Publication number
- CN112322777A CN112322777A CN202011542979.7A CN202011542979A CN112322777A CN 112322777 A CN112322777 A CN 112322777A CN 202011542979 A CN202011542979 A CN 202011542979A CN 112322777 A CN112322777 A CN 112322777A
- Authority
- CN
- China
- Prior art keywords
- wheat
- snp
- cold resistance
- dna
- kasp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a group of (23) SNP loci obviously associated with wheat cold resistance and an application method thereof in heredity and breeding. The markers are identified by simplified genome sequencing (GBS) of 768 wheat varieties and excellent strains and comparing with a reference genome sequence, the SNP sites have good accuracy, and the sites can be converted into single SNP markers (such as KASP markers) and SNP chips, are used for positioning, fine mapping and candidate gene cloning of wheat cold-resistant genes, marker-assisted selection, gene polymerization and whole genome selective breeding of the wheat cold resistance, and are widely applied to genetic research and breeding work of the wheat cold resistance.
Description
Technical Field
The invention relates to the technical field of plant molecular markers, in particular to a group of SNP (Single nucleotide polymorphism) obviously associated with a wheat cold-resistant gene locus and application thereof in cold-resistant inheritance and molecular breeding.
Background
The cold resistance of wheat refers to the condition that winter wheat seedlings are frozen in winter. Wheat is an important grain crop in China and is mainly distributed in the north of 30 degrees north latitude. The winter wheat area in the north of China including the Huang-Huai-winter wheat area and the winter wheat area in the north of China account for 59% of the total area of the wheat field in China, the wheat area has frequent cold air activity in winter, low absolute temperature in winter, less rainfall, severe winter conditions of wheat and freezing injury which are important factors influencing the wheat production. In addition, the variety bred in recent years tends to be short, long and big, and have large grains, so that the cold resistance is reduced, and the freezing injury is further aggravated. At present, freezing injury becomes one of environmental stress factors threatening wheat production, and the growth and development of wheat plants and the yield of the plants are seriously influenced. Therefore, the cold resistance of the wheat plant is an important factor to be considered in winter wheat production and breeding in China.
The genetic research on the cold resistance of wheat plays an important role in understanding the genetic structure of the traits, exploring key cold-resistant genes, mapping and cloning the cold-resistant genes and effectively improving the cold resistance in breeding. The molecular marker technology is the most commonly used technology for breeding researches such as inheritance of wheat related traits, gene mapping, marker-assisted breeding, genome selective breeding and the like. The commonly used DNA molecular markers include RFLP (restriction fragment length polymorphism), SSR (simple repeat sequence), SNP (single nucleotide polymorphism), and the like. The traditional RFLP and SSR markers have the limitations of low flux, small quantity, complicated operation process and the like, have low working efficiency and can not meet the requirement of large-scale functional genomics research. The SNP markers are extremely abundant in the genome, have two-state property, are easy to carry out high-throughput automatic detection, and are the molecular marker technology with the greatest application prospect in genetic research and breeding.
Currently, the high-throughput detection technology for SNP mainly comprises sequencing and DNA chip technology. The high density of SNP markers can be obtained by DNA resequencing of sample materials using sequencing techniques, but the cost of resequencing is high. The simplified genome sequencing-by-sequencing (GBS) is to perform enzyme digestion and other methods on genome DNA to reduce the complexity of the genome, construct a low-complexity genome DNA library, and perform deep sequencing by using a second-generation sequencing technology, thereby reducing the sequencing cost to a certain extent. The technology of constructing a DNA library by treating genomic DNA with two restriction enzymes and identifying SNPs by sequencing in wheat has been developed. However, the deep sequencing cost is still high for the huge genome (16G) relative to wheat, and the process of GBS data processing, sequence alignment, genotyping and the like has high requirements on data analysis, and the process can be completed only by personnel with professional bioinformatics background, so that the deep sequencing cost is difficult for general breeders to master and utilize.
Disclosure of Invention
The development of a large number of molecular markers is needed in the processes of controlling the mapping and gene cloning of important character genes of wheat and assisting in the selection breeding of the molecular markers. The SNP developed based on methods such as re-sequencing and GBS can be transformed into KASP (Kompetitive Allle Specific PCR) marker, thereby genotyping a single SNP. The KASP technique, also known as competitive allele-specific PCR, allows for accurate biallelic determination of SNPs and InDels at specific sites in a wide range of genomic DNA samples. The method has the characteristics of high stability, accuracy, low cost and high flux, can be widely applied to gene positioning, fine mapping and cloning of genes and high-flux screening of large-scale breeding materials, and has important utilization value in genetic research, molecular marker-assisted breeding and genome selective breeding.
Aiming at the defects of the prior art, the method utilizes the mature GBS technology in wheat to carry out simplified genome sequencing on 768 parts of wheat materials to obtain SNP sites covering the whole genome at high density, and the SNP sites obviously associated with cold resistance are identified through whole genome association analysis.
The invention provides a set of SNP which is obviously related to the cold resistance of wheat, can be used for developing KASP markers and SNP chips, and is widely applied to marker-assisted selection and whole genome selective breeding of single or multiple cold resistance related genes in further fine mapping, cloning and breeding of wheat cold resistance related genes.
The technical scheme adopted by the invention is as follows:
the invention provides a group (23) of Single Nucleotide Polymorphism (SNP) sites which are obviously associated with wheat cold resistance, comprising SNP flanking sequences, SNP site information and base mutation information, wherein the SNPs are positioned on 13 chromosomes of common wheat.
1. A group of SNP loci which are obviously associated with the cold resistance of wheat is characterized in that: the SNP loci comprise 23 SNP loci with the numbers of SNP 01-SNP 23, and the information is as follows:
the physical position in the table takes the Chinese spring genome IWGSC reference genome v1.1 (IWGSC, 2018) as a reference sequence;
the sequences listed in the table are shown in sequence tables SEQ ID NO. 1-SEQ ID NO. 46.
The SNP loci obviously associated with the cold resistance of wheat provided by the invention can be applied to the identification of the cold resistance of wheat.
The SNP loci obviously associated with the cold resistance of wheat provided by the invention can be applied to the preparation of a wheat cold resistance identification kit.
The SNP loci obviously associated with the cold resistance of wheat provided by the invention can be applied to the preparation of single detectable SNP markers or gene chips.
The SNP loci obviously associated with the cold resistance of wheat provided by the invention can be used for preparing cold-resistant gene lociqCT5A.3Co-separated KASP markers k5a520532 and k5a 523147.
The SNP loci obviously associated with the cold resistance of the wheat provided by the invention can be applied to a wheat cold resistance identification and detection method.
In specific application, KASP primers can be designed according to SNP sites, and are designed according to DNA short sequences which comprise 50bp of upstream and downstream of the SNP sites. Specifically, a website PolyMarker (http:// www.polymarker.info /) is used for primer design, and default parameter setting of the website is adopted. The primer is added with a joint, the FAM sequence is GAAGGTGACCAAGTTCATGCT, and the HEX sequence is GAAGGTCGGAGTCAACGGATT.
After the primers are designed and synthesized, the effectiveness detection can be carried out by utilizing a separation population or a natural population, whether the QTL identified by GWAS exists or not is verified, and the method is applied to researches such as cold-resistant gene mapping, marker-assisted selection and the like, and the using methods are respectively as follows:
(1) wheat DNA is used as a PCR amplification template, and a synthesized KASP primer is designed to carry out PCR amplification, wherein the reaction system is 6 mu L. The reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, and KASP Assay mix (upstream and downstream primer mix) 0.0825. mu.L. Amplified in 384-well PCR instrument.
(2) The PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, and analyzing the genotype according to the typing result.
Compared with the prior art, the research has the following advantages:
(1) the invention identifies a group of (23) SNPs which are obviously associated with the cold resistance of wheat.
(2) The SNP can be further converted into KASP markers, and is used for fine mapping and cloning of cold resistance related genes and molecular marker-assisted high-throughput screening applied to breeding materials in a large scale, so that the efficiency of molecular breeding is improved.
(3) The SNPs can also be made into gene chips, and can be applied to the whole genome selection of cold resistance of breeding materials, so that the efficiency and accuracy of molecular breeding are further improved.
(4) Develop the cold-resistant gene locusqCT5A.3Co-separated KASP labelsThe notations k5A520532 and k5A523147 not only prove that the SNPs identified by us are very effective, but also prove thatqCT5A.3The marker assisted selection provides good high-throughput identification markers。
Drawings
FIG. 1 is a Manhattan plot (left) and a QQ plot (right) of a wheat cold resistance whole genome association analysis.
Detailed Description
Example 1 identification of SNPs by simplified genomic sequencing
1.1 sequencing materials
768 wheat varieties (lines) were selected for simplified genome sequencing and SNP identification. The materials are mainly wheat varieties and excellent strains from main wheat producing areas in China, including Huang-Huai wheat areas, northern winter wheat areas, middle and lower Yangtze river wheat areas and southwest wheat areas.
Research method
1.2.1 extraction of wheat genomic DNA
Seedling leaves were used to provide genomic DNA. DNA extraction was performed by a modified CTAB (butyl trimethyl ammonium bromide) method (Stewart and Via, 1993). The method comprises the following specific operations: taking young and tender wheat leaves in a 2mL centrifuge tube, freezing by using liquid nitrogen, and grinding into powder on a tissue grinder; (b) adding 800 μ L CTAB into 2mL tube, placing in 65 deg.C water bath for 90min, and shaking gently for 5-8 times during the water bath period to fully crack DNA; (c) adding 800 μ L chloroform isoamyl alcohol (volume ratio 24: 1) and shaking for 10 min; (d) centrifuging at 12000rpm for 10min, and placing 600 μ L of supernatant in a new 2mL tube (note corresponding number); (e) add 60. mu.L of 3M sodium acetate (pH = 5.2) and 600. mu.L of isopropanol (frozen at-20 ℃ C. in advance), mix with gentle shaking to see the generation of white DNA flocs, and put in a refrigerator at-20 ℃ for 1h to increase DNA yield. (f) Centrifuging at 12000rpm for 10min, pouring out supernatant, washing the precipitate with 70% ethanol (freezing in a refrigerator at-20 deg.C in advance) for 2-3 times, standing in a fume hood, and air drying; (g) add 200. mu.L of ddH2O dissolves the DNA.
Sample quality detection
And detecting by using agarose gel electrophoresis with the mass fraction of 1%, and checking an electrophoresis result by using a gel imaging system to ensure the integrity of the genome DNA. The ratio of A260/280 of the genomic DNA should be between 1.8 and 2.0, and the ratio of A260/230 should be between 1.8 and 2.2. The DNA was diluted to a working concentration of 20 ng/ul. Storing at-20 deg.C for use.
Library construction and GBS sequencing
Construction of GBS DNA libraries was performed with reference to Poland et al. (2012 b). Genomic DNA was digested with two restriction enzymes PstI and MspI (New England BioLabs, Inc., Ipswich, MA, United States). The barcode sequence was ligated to the digested DNA fragment using T4(New England BioLabs, Inc., Ipswich, MA, United States) ligase. All products from each plate were mixed and purified using QIAq rapid PCR purification kit (Qiagen, inc., Valencia, CA, United States). PCR amplification was performed using primers complementary to the barcode sequence. The PCR products were again purified using the QIAquick PCR purification kit and the concentration was determined using the Qubit ™ double-stranded DNA high-sensitivity fluorescent quantitation kit (Life Technologies, Inc., Grand Island, NY, United States). DNA fragments of 200-300 size were screened by agarose gel electrophoresis (Life Technologies, Inc., Grand Island, NY, United States), and the concentration of each DNA library was estimated using a Qubit 2.0 fluorescent agent and a Qubit-array double-stranded DNA high sensitivity fluorescence quantification kit. Fragment size-screened DNA libraries were loaded onto P1v3 chips using an Ion CHEF instrument (Ion PI Hi-Q CHEF Kit) and sequenced using an Ion Proton sequencer (Life Technologies, Inc., Grand Island, NY, United States, software version 5.10.1). This Ion Torrent system can produce sequences of various read lengths.
Site identification
The sequencing sequence was sequenced by adding 80 poly-A bases to its 3' end and then using TASSEL 5.0, so that it was possible to process sequences shorter than 64 bases by the train Analysis by Association, Evolution and Linkage (TASSEL) pipeline 5.0 (TASSEL 5.0) (Bradbury et al, 2007) rather than just discarding these short sequences. Sequence alignment is carried out by taking the IWGSC reference gene v1.1 (IWGSC, 2018) of the Chinese spring genome as a reference sequence and using TASSEL 5.0 (Bradbury et al, 2007) to identify SNP sites. All parameters are set to default settings of TASSEL 5.0. A total of 432,588 SNP sites were obtained covering approximately 14Gb of the whole genome, with an average distance between markers of 34.0 kb. Wherein 150784 sites on the A genome are spaced at an average distance of 32.9 kb; 182192 loci on the B genome with an average spacing of 28.9 kb; the D genome has 99612 sites and the average distance is 40.3 kb. The number of SNP markers on each chromosome is 10177 to 31149, and the variation range of the marker interval is 26.1-50.1 kb. These SNPs were mainly located in the intergenic region, 364203, accounting for 84.1, followed by the CDS region, 39901 (9.2%), the intron region 22215 (5.1%), the 5 'UTR region 3543 (0.8%), and the 3' UTR region 3300 (0.8%).
TABLE 1 distribution of SNP sites identified by GBS in wheat genome
Example 2 Whole genome identification of wheat Cold resistance-associated genes
2.1 materials
768 parts of wheat material for genotyping by GBS technology.
2.2 methods
2.2.1 phenotypic identification of disease resistance
To identify the cold resistance of the material (CT), 2017-2018 (TA17), 2018-2019 (TA18), and 2019-2020 (TA19) were planted in the disease identification nursery at the experimental station of the university of agriculture in thailan shandong for 3 consecutive years. We also planted the material in the tobacco field academy of farming (YT 17) in the autumn of 2017. In the test, 1 row of each material was planted, the row length was 3m, and the row spacing was 25 cm. The frost resistance is investigated at 2 months per year, and the frost resistance is identified by a 0-4 grade method, wherein 0 = no obvious frost damage symptom; 4 = plant freeze-death.
2.2.2 Whole genome Association analysis
And (3) further screening the SNP sites with the Minimum Allele Frequency (MAF) of more than 0.01 and the deletion rate of less than 80% of all the identified 432588 SNP sites to obtain 327609 SNPs. And performing whole genome association analysis on the 3 disease resistance traits. Using GAPITv.3 package, which uses EMMA, Compressed Mixed Linear Model (CMLM) and a position parameters previous determined (P3D) to improve the efficiency of GWAS operation. Kinship was analyzed using EMMA algorithm, using the first 3 principal components to control population structure. Significance threshold was set at 1.0 × 10-5。
2.3 results
2.3.1 Whole genome Association analysis of Cold resistance
By carrying out GWAS on cold resistance grades measured under multiple environments, 132 associated loci (MTAs) are identified in total, and are combined into 21 cold resistance QTL intervals according to LD. There were 12 QTLs located within the 1.0Mb interval, each containing less than 10 annotated genes. The method shows that the cold-resistant QTL can be positioned in a smaller physical interval by using the high-density SNP marker identified by people to carry out GWAS, and great convenience is brought to the subsequent fine positioning of the cold-resistant QTL, gene cloning and molecular marker assisted breeding.
For the SNPs identified by GWAS, one SNP most significantly associated was selected for each site, and 23 SNP sites relevant to cold resistance were obtained, respectively, as shown in table 2. In the table, "QTL" column indicates the cold-resistant QTL name linked to SNP; in the table, a list of 'chromosomes and physical positions of SNPs' indicates the chromosomes and the physical positions of the SNPs, and the physical positions refer to IWGSC reference gene v1.1 (IWGSC, 2018) of the Chinese spring genome; in the table, "sequence and SNP variation site" is listed, and "base" in "[ ]" indicates a variation site, and some sites have only one base, indicating that the base is deleted after variation.
TABLE 2 SNP site information in significant association with wheat freezing resistance
Example 3 wheat Cold-resistant GeneqCT5A.3Verification and mapping of
3.1 materials
The research materials comprise cold-resistant parent sunlight No. 5 (YG 5) and cold-resistant parent medium wheat875 (ZM 875) and F constructed by hybridization2Segregating population, total 251F2And (4) single plants.
3.2 methods
3.2.1 phenotypic characterization of Cold resistance
The same procedure as in example 1 was used to identify cold resistance.
Extraction of
The same as in example 1.
3.2.3 KASP primer design, dilution:
according to GWAS analysis results, the cold resistance QTL is combined with the cold resistance QTLqCT5A.3Two significantly related GBS-SNPs (5A _520532205 and 5A _ 523147073), two (three each) sets of KASP primers k5A520532 and k5A523147 were designed based on the SNP site information. The two groups of primers, three primers and ultra pure water are diluted to 100 mu M and then the volume ratio of the forward primer-FAM-R: forward primer-HEX-S: reverse primer: ultrapure water = 6: 6: 15: 23, and storing the mixture to-20 ℃ for later use.
3.2.4 KASP PCR amplification System and procedure are as follows:
the KASP reaction system used a 6 μ L system:
the system was prepared on ice according to the following table, 3. mu.L (about 20 ng/. mu.L) of template DNA, 2 XMaster mix 3. mu.L (LGC Group UK), and 0.0825. mu.L of KASP assay primer (synthesized by Shanghai Biotech).
TABLE 3 KASP reaction System
The PCR procedure was as follows:
pre-denaturation at 1.94 ℃ for 5 min;
denaturation at 2.94 ℃ for 20 s;
3.65 ℃ for 30s (0.8 ℃ per cycle), and steps 2-3 are cycled 10 times.
Denaturation at 4.94 ℃ for 20 s;
annealing at 5.57 deg.C for 30s, and circulating step 4-5 for 35 times.
Storing at 6.10 deg.C. And (5) signal detection.
3.3 results
3.3.1 isolation of Cold resistance in the isolation population
The results of the GWAS analysis show that,qCT5A.3is a major QTL for controlling the cold resistance of wheat, and is positioned in the interval of 504.9-523.8 Mb on 5 AL. To further validate this QTL and develop a KASP marker linked thereto, F was constructed by hybridization of YG5 with ZM8752Isolating the population.
The cold resistance of the population is identified, and F2The generation cold resistance is obviously separated, the statistics of 0-2 grade as cold resistance and 3-4 grade as cold resistance are carried out, 186 and 65 single plants are respectively provided, and the chi-square test accords with the resistance: feeling =3:1 ratio. Indicating that there is a major cold-resistance gene in the population that controls the segregation of cold-resistance.
3.3.2 relationship between Cold resistance and marker genotype in segregating populations
After converting the two most significant GBS-SNPs (5A _520532205 and 5A _ 523147073) associated with the QTL into KASP markers, the population was genotyped, and the results showed that both of these KASP markers were able to genotype F2And (5) carrying out group typing. The genotype and the cold resistance performance are analyzed by ANOVA, and the difference between the genotype and the cold resistance performance reaches an extremely significant level (P)<0.001), indicating that two markers are very significantly associated with cold resistance, and two SNP markers are F with the same genotype as YG52The single plant is cold-resistant, the single plant which is the same as ZM875 is obviously frozen, and the cold resistance of the heterozygous individual is between the two, which indicates that a main effect QTL related to the control of the cold resistance of wheat exists in the interval.
The foregoing is only a preferred embodiment of this patent, and it should be noted that, for those skilled in the art, various modifications and substitutions can be made without departing from the technical principle of this patent, and these modifications and substitutions should also be regarded as the protection scope of this patent.
Sequence listing
<110> Shandong university of agriculture
<120> a group of SNP loci significantly associated with cold resistance of wheat and application thereof in genetic breeding
<160> 46
<170> SIPOSequenceListing 1.0
<210> 1
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 1
cttcagtttt tcgtacagct tcagcttcag cttcctgaca ccagagtatg caatgtcact 60
cctctgcagg atagccaagg gcgtggtgga aggcccgtcg c 101
<210> 2
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 2
cttcagtttt tcgtacagct tcagcttcag cttcctgaca ccagagtatg taatgtcact 60
cctctgcagg atagccaagg gcgtggtgga aggcccgtcg c 101
<210> 3
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 3
gaactcgcct ccaaacatca cgagcagcat gacctttccc ttcggctggc tcctacccag 60
tttgacccct tgaaatgtgc ccgtctcttc gagatctcca t 101
<210> 4
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 4
gaactcgcct ccaaacatca cgagcagcat gacctttccc ttcggctggc ccctacccag 60
tttgacccct tgaaatgtgc ccgtctcttc gagatctcca t 101
<210> 5
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 5
acgcgactgt cacagcaagc agtgtgcgtg gtgggttgga gaacctgcag tttgcaccct 60
ccaacgccct ccgagatagc atatactcct actgggcacc a 101
<210> 6
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 6
acgcgactgt cacagcaagc agtgtgcgtg gtgggttgga gaacctgcag cttgcaccct 60
ccaacgccct ccgagatagc atatactcct actgggcacc a 101
<210> 7
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 7
acctacgcac ttcgattcta cctactcctc gtcggagatc acgacgatct ccgtgcccgg 60
ctccggcagc atgggcggca gctgcagctc cggctgctcc a 101
<210> 8
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 8
acctacgcac ttcgattcta cctactcctc gtcggagatc acgacgatct tcgtgcccgg 60
ctccggcagc atgggcggca gctgcagctc cggctgctcc a 101
<210> 9
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 9
ggcccttgcc cctgccgtgc gtggctgcag ccttgagccg ccgggtcccc atcctctgcg 60
gtgctccttc gtcaagctgc tgcaaccgcc gcgccatccc t 101
<210> 10
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 10
ggcccttgcc cctgccgtgc gtggctgcag ccttgagccg ccgggtcccc gtcctctgcg 60
gtgctccttc gtcaagctgc tgcaaccgcc gcgccatccc t 101
<210> 11
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 11
tctcaggagc gcttctggcc ttcgtgcatg gggcgttgcg tgggtccacc acacagctat 60
gatcgcatgc ccttcggtct gccgaacgca gctgcagccc g 101
<210> 12
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 12
tctcaggagc gcttctggcc ttcgtgcatg gggcgttgcg tgggtccacc gcacagctat 60
gatcgcatgc ccttcggtct gccgaacgca gctgcagccc g 101
<210> 13
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 13
aggcaagctg ggctcatgca acgttgcttt ccttcgatcc ccaattattg ttgttgtaac 60
ttgcaagtgg taatgactgt ggagcctaag ggcaccttca a 101
<210> 14
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 14
aggcaagctg ggctcatgca acgttgcttt ccttcgatcc ccaattattg ctgttgtaac 60
ttgcaagtgg taatgactgt ggagcctaag ggcaccttca a 101
<210> 15
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 15
ccgagctcga ccgccgctcg ccggagctgc agctcaccag ggagcagtcg ccgtcgcccc 60
gaccgcctcc gtcgtccccg agctccactg actccatccc c 101
<210> 16
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 16
ccgagctcga ccgccgctcg ccggagctgc agctcaccag ggagcagtcg tcgtcgcccc 60
gaccgcctcc gtcgtccccg agctccactg actccatccc c 101
<210> 17
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 17
tgcagaggcg ggaggtgagc cgtcgtcctt gcgggtgatg gaggtagctt ccatgaggaa 60
cgacaaccgc tggtggtcga cctccatgtc agcacgagct cg 102
<210> 18
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 18
tgcagaggcg ggaggtgagc cgtcgtcctt gcgggtgatg gaggtagctt catgaggaac 60
gacaaccgct ggtggtcgac ctccatgtca gcacgagctc g 101
<210> 19
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 19
ccacggcgac gggaagctac aacccctagt tggcagagct gcaaccgatg gtgggttgag 60
ttgcattcga cggggcaagc tacgactgct atgggagctg c 101
<210> 20
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 20
ccacggcgac gggaagctac aacccctagt tggcagagct gcaaccgatg atgggttgag 60
ttgcattcga cggggcaagc tacgactgct atgggagctg c 101
<210> 21
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 21
gcatcactgt ctgcggacaa atgccgaagc aaatttaagg gtcggtgttg gagatacctt 60
agctgcagca ggacaatgat gaccggggcc taccgcgaag g 101
<210> 22
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 22
gcatcactgt ctgcggacaa atgccgaagc aaatttaagg gtcggtgttg aagatacctt 60
agctgcagca ggacaatgat gaccggggcc taccgcgaag g 101
<210> 23
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 23
aatacctgac catgagcagc aacccaacct ccaatgacca ccggcaggca gcgctccagc 60
tcgagatcga ggtggacagg tggtactcgg cgttctgcag c 101
<210> 24
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 24
aatacctgac catgagcagc aacccaacct ccaatgacca ccggcaggca acgctccagc 60
tcgagatcga ggtggacagg tggtactcgg cgttctgcag c 101
<210> 25
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 25
tcagtctgat ttgagattct tgttcttctg tattttcaga tactgcagtg cagtttgcag 60
agtatactac acttgtgtga agaaaaaaat aaataaacca t 101
<210> 26
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 26
tcagtctgat ttgagattct tgttcttctg tattttcaga tactgcagtg tagtttgcag 60
agtatactac acttgtgtga agaaaaaaat aaataaacca t 101
<210> 27
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 27
actccaaggc cgcccaagat ggtcccggcg agggctttgc tagacaatat ttttgtagca 60
tggggtttta gggctgggtg gatgagaaaa aagtggtgac g 101
<210> 28
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 28
actccaaggc cgcccaagat ggtcccggcg agggctttgc tagacaatat ctttgtagca 60
tggggtttta gggctgggtg gatgagaaaa aagtggtgac g 101
<210> 29
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 29
atttttgccg tggaagcaga tgttcctgca gcagcatttg cgcctttagt ccttgtcgtt 60
gagccacaag ctccggcatg ggcacagcag attgtccgtt t 101
<210> 30
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 30
atttttgccg tggaagcaga tgttcctgca gcagcatttg cgcctttagt gcttgtcgtt 60
gagccacaag ctccggcatg ggcacagcag attgtccgtt t 101
<210> 31
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 31
ccttcttccc agctgtgttg ctttggagca gttaaaactc aggagatgct gccagataac 60
taacctaaag ataccttccc tgctgcagcg actcagctac c 101
<210> 32
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 32
ccttcttccc agctgtgttg ctttggagca gttaaaactc aggagatgct cccagataac 60
taacctaaag ataccttccc tgctgcagcg actcagctac c 101
<210> 33
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 33
tgtcttaaca cgggcgagag ccatccgtgc accctctatg catgccgacc gcttcatcgc 60
ctcgatatgc ggcaccgcct caaggaattg ctgcagcaag c 101
<210> 34
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 34
tgtcttaaca cgggcgagag ccatccgtgc accctctatg catgccgacc acttcatcgc 60
ctcgatatgc ggcaccgcct caaggaattg ctgcagcaag c 101
<210> 35
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 35
catccatgga cgcgcgggga ttcgaccttc catggccgac ggcgagatgt aggcgccggc 60
gctgcaggag atgaggatgg gggcgagatc cgcggagctg c 101
<210> 36
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 36
catccatgga cgcgcgggga ttcgaccttc catggccgac ggcgagatgt gggcgccggc 60
gctgcaggag atgaggatgg gggcgagatc cgcggagctg c 101
<210> 37
<211> 102
<212> DNA
<213> wheat (Triticum aestivum)
<400> 37
tgaggaagga gctgcagcgt acccacgtcc aggctgggga gagccaaaaa accagaaatc 60
aaagattact tgcaagaaga agaacattat ccaacgccac ca 102
<210> 38
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 38
tgaggaagga gctgcagcgt acccacgtcc aggctgggga gagccaaaaa ccagaaatca 60
aagattactt gcaagaagaa gaacattatc caacgccacc a 101
<210> 39
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 39
gtcaaagaaa tcctgcagca tctgctgcac cttggggatc ttggtggagc cgccgacgag 60
cacgacgtcg tggatctgtg acttgtccat cttggcgtcg c 101
<210> 40
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 40
gtcaaagaaa tcctgcagca tctgctgcac cttggggatc ttggtggagc tgccgacgag 60
cacgacgtcg tggatctgtg acttgtccat cttggcgtcg c 101
<210> 41
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 41
caaagacatg caaaaggaaa tagaacctac gtactacgtc gatcctggct actcctcgtc 60
ggagatcacg acgatctccg tgcccggctc cggcagcatg g 101
<210> 42
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 42
caaagacatg caaaaggaaa tagaacctac gtactacgtc gatcctggct gctcctcgtc 60
ggagatcacg acgatctccg tgcccggctc cggcagcatg g 101
<210> 43
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 43
gtccccctgg tagaggagtt tgggaagaag aggacggcga cgcgaggaca tgtcgggagg 60
atcgcaagga agacacgttg gtagaggaga tcagggagaa g 101
<210> 44
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 44
gtccccctgg tagaggagtt tgggaagaag aggacggcga cgcgaggaca cgtcgggagg 60
atcgcaagga agacacgttg gtagaggaga tcagggagaa g 101
<210> 45
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 45
aggcggcggc tcccggcgct gcagcagcag agcgacatcc cttgcggcgg tggcggcggc 60
ggagcttcgc gcgcgcccga ggcggggatg gaggatgggg t 101
<210> 46
<211> 101
<212> DNA
<213> wheat (Triticum aestivum)
<400> 46
aggcggcggc tcccggcgct gcagcagcag agcgacatcc cttgcggcgg cggcggcggc 60
ggagcttcgc gcgcgcccga ggcggggatg gaggatgggg t 101
Claims (7)
1. A group of SNP loci which are obviously associated with the cold resistance of wheat is characterized in that: the SNP loci comprise 23 SNP loci with the numbers of SNP 01-SNP 23, and the information is as follows:
the physical position in the table takes the Chinese spring genome IWGSC reference genome v1.1 (IWGSC, 2018) as a reference sequence;
the sequences listed in the table are shown in sequence tables SEQ ID NO. 1-SEQ ID NO. 46.
2. The use of the set of SNP sites according to claim 1, which are significantly associated with wheat cold resistance, in the identification of wheat cold resistance.
3. The application of the SNP loci significantly associated with the cold resistance of wheat according to claim 1 in the preparation of a wheat cold resistance identification kit.
4. Use of a set of SNP sites significantly associated with wheat cold resistance according to claim 1 in the preparation of a single detectable SNP marker or gene chip.
5. The method for preparing cold-resistant gene locus of SNP (single nucleotide polymorphism) locus significantly associated with wheat cold resistance according to claim 1qCT5A.3Use of co-isolated KASP markers k5a520532 and k5a 523147.
6. The application of the SNP loci according to claim 6, wherein the SNP loci are significantly associated with wheat cold resistance, in a wheat cold resistance identification detection method.
7. Use in a detection method according to claim 4, characterized in that the detection method comprises the steps of:
designing KASP primers according to the SNP sites, and designing KASP primers according to DNA short sequences containing 50bp of upstream and downstream of the SNP sites; specifically, a website PolyMarker (http:// www.polymarker.info /) is used for primer design, and the default parameter setting of the website is adopted; adding a joint in front of the primer, wherein the FAM sequence is GAAGGTGACCAAGTTCATGCT, and the HEX sequence is GAAGGTCGGAGTCAACGGATT;
after the primers are designed and synthesized, the effectiveness detection can be carried out by utilizing a separation population or a natural population, and whether the QTL identified by GWAS exists or not is verified, and the using methods are respectively as follows:
(1) using wheat DNA as a PCR amplification template, designing a synthesized KASP primer, and carrying out PCR amplification with a reaction system of 6 mu L; the reaction system specifically comprises: 20-50 ng/. mu.L of DNA 3. mu.L, 2 XKASP Master mix 3. mu.L, KASP Assay mix (upstream and downstream primer mix) 0.0825. mu.L; amplifying in a 384-well PCR instrument;
(2) the PCR amplification program is pre-denaturation at 94 ℃ for 15 min; denaturation at 94 ℃ for 20s, renaturation at 65-57 ℃ for 60s (0.8 ℃ per cycle), 10 cycles; denaturation at 94 ℃ for 20s, renaturation at 57 ℃ for 60s, 30 cycles; storing at 10 deg.C;
(3) after the PCR is finished, placing the sample in an Omega SNP typing instrument to detect the PCR typing result;
(4) analyzing and identifying, and analyzing the genotype according to the typing result.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011542979.7A CN112322777A (en) | 2020-12-23 | 2020-12-23 | SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding |
| CN202110397635.XA CN113046465B (en) | 2020-12-23 | 2021-04-14 | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011542979.7A CN112322777A (en) | 2020-12-23 | 2020-12-23 | SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112322777A true CN112322777A (en) | 2021-02-05 |
Family
ID=74301776
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011542979.7A Withdrawn CN112322777A (en) | 2020-12-23 | 2020-12-23 | SNP loci obviously associated with cold resistance of wheat and application of SNP loci in genetic breeding |
| CN202110397635.XA Active CN113046465B (en) | 2020-12-23 | 2021-04-14 | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110397635.XA Active CN113046465B (en) | 2020-12-23 | 2021-04-14 | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN112322777A (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104232758A (en) * | 2014-08-04 | 2014-12-24 | 中国农业科学院作物科学研究所 | Identification or assisted identification method of cold resistance of wheat |
| CN108913798B (en) * | 2018-06-29 | 2021-07-23 | 安徽农业大学 | Wheat seedling stage frost resistance related CAPS (cleaved amplified polymorphic sequence) marker and method for identifying wheat seedling stage frost resistance |
-
2020
- 2020-12-23 CN CN202011542979.7A patent/CN112322777A/en not_active Withdrawn
-
2021
- 2021-04-14 CN CN202110397635.XA patent/CN113046465B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113046465A (en) | 2021-06-29 |
| CN113046465B (en) | 2023-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhang et al. | A genome-wide transcription analysis reveals a close correlation of promoter INDEL polymorphism and heterotic gene expression in rice hybrids | |
| Wanchana et al. | A rapid construction of a physical contig across a 4.5 cM region for rice grain aroma facilitates marker enrichment for positional cloning | |
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN112266973A (en) | SNP molecular marker related to wheat ear germination resistance and application thereof | |
| CN111719010A (en) | High-throughput SNP diagnostic marker of wheat powdery mildew resistance gene Pm21 and application thereof in breeding | |
| CN103937785B (en) | Watermelon female line gene C lWIP1 and chromosome translocation and linked marker | |
| CN108060260B (en) | SNP (Single nucleotide polymorphism) marker related to methionine content of soybean seeds, interval, primer and application | |
| CN106995845B (en) | Method for mining allelic variation of gene in polyploid by using third generation sequencing platform (PacBio RS II) | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN113684300A (en) | SNP loci obviously associated with wheat ear number and application thereof in wheat genetic breeding | |
| CN107988424B (en) | Molecular marker, interval, primer and application related to methionine content of soybean seeds | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| CN113106110A (en) | SiSD1 gene, application thereof in controlling millet plant height character and genotype identification method | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN113046466B (en) | SNP locus obviously associated with wheat powdery mildew resistance and application of SNP locus in genetic breeding | |
| CN108004236B (en) | Corn stalk rot disease-resistant molecular breeding method and application thereof | |
| CN113046465B (en) | SNP locus obviously associated with cold resistance of wheat and application of SNP locus in genetic breeding | |
| CN113046464B (en) | Molecular marker for screening soybean material, screening method, breeding method and application | |
| Casu et al. | Functional genomics: transcriptomics of sugarcane-current status and future prospects | |
| CN108642199B (en) | SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof | |
| CN104878004B (en) | One kind SNP marker detection associated with haliotis diversicolor Reeve growth traits and its application | |
| CN114736979B (en) | Molecular marker closely linked with watermelon complete leaf shape gene ClLL and application thereof | |
| CN115948591B (en) | Identification of corn seedling drought tolerance related monomer ZmC10.HapDR and application thereof | |
| CN112626256B (en) | Sesame seedling stage drought tolerance molecular marker and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20210205 |