CN112322746B

CN112322746B - Application of SNHG9 gene in cell mechanical stress detection and kit

Info

Publication number: CN112322746B
Application number: CN202011013561.7A
Authority: CN
Inventors: 林爱福; 李俊宏; 李瑞花
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-09-24
Filing date: 2020-09-24
Publication date: 2022-03-18
Anticipated expiration: 2040-09-24
Also published as: CN112322746A

Abstract

The invention discloses an application of a SNHG9 gene in cell mechanical stress detection and a kit for detecting the SNHG9 gene, wherein the kit comprises three pairs of amplification primers for detecting the expression level of the SNHG9 gene and a pair of B2M reference primers, and the kit can be used for the auxiliary judgment of the cell mechanical stress level, is efficient and accurate, is convenient to operate, and has potential application value.

Description

Application of SNHG9 gene in cell mechanical stress detection and kit

(I) technical field

The invention relates to the technical field of biology, in particular to a PCR detection kit for a SNHG9 gene and application thereof in cell mechanical stress detection.

(II) background of the invention

In mammalian organisms, interactions between cells and neighboring cells, interactions between cells and the extracellular matrix (ECM), and interactions between cells and fluid streams, produce a variety of different types of mechanical signals. In the process of cell growth and metabolism, mechanical signals and biological signals are mutually converted and mutually influenced through a certain mechanism, finally, the expression state of related genes is changed, and the cell fate and tissue morphology are determined and controlled, so that an important regulation and control effect is played in an organism. The correct mechanical signal can induce the cells to differentiate and grow in the correct direction, while the wrong mechanical signal is more likely to cause the disease. At present, the mechanism of the regulation of cellular mechanical force is not completely understood, but can be mostly decomposed into 3 steps: (1) mechanical signals are transmitted to specific cellular structures. (2) The mechanical signal is converted into a biological signal. (3) Subsequent reaction of the cells to these biological signals.

In order to clarify the role of mechanical signals in various physiological processes of cells or disease development, various instruments for measuring mechanical forces at the sub-cellular level have been developed over the past many years, such as: a traction force microscope, a single molecule atomic microscope, a tension sensor based on fluorescence energy resonance transfer, and the like. The instruments are generated for accurately quantifying mechanical stress, have high accuracy, are expensive and difficult to popularize, cannot benefit common researchers, are mostly inconvenient to use, and take long time to obtain reliable data. Therefore, a method for rapidly and accurately detecting the mechanical stress level of cells is needed.

SNHG9, known as small nucleolar RNA host gene (small nucleolar RNA host gene 9), whose gene expression level is regulated by mechanical force levels. When the level of mechanical force perceived by the cell increases, the level of gene expression of SNHG9 also increases.

Disclosure of the invention

The invention aims to provide an application of a SNHG9 gene in cell mechanical stress detection and a kit for detecting the SNHG9 gene, wherein the kit comprises three pairs of amplification primers for detecting the expression level of the SNHG9 gene and a pair of B2M reference primers, can be used for auxiliary judgment of the cell mechanical stress level, has the characteristics of high efficiency, accuracy and convenience in operation, and has potential application value.

The technical scheme adopted by the invention is as follows:

the invention provides an application of a SNHG9 gene in cell mechanical stress detection, wherein the application is to detect the expression quantity of a SNHG9 gene in a cell to be detected by adopting PCR (polymerase chain reaction), and if the expression quantity of the SNHG9 gene is increased compared with the expression quantity of a SNHG9 gene of a normal cell (namely a cell cultured under a normal condition), the mechanical stress level of the cell to be detected is increased.

The invention also provides a PCR detection kit for detecting the expression level of the SNHG9 gene, wherein the kit comprises a SNHG9 gene detection primer and an internal reference gene B2M primer;

the SNHG9 gene detection primers are one group of SNHG9F #1+ SNHG9R #1, SNHG9F #2+ SNHG9R #2 and SNHG9F #3+ SNHG9R #3, and the sequences are as follows:

SNHG9 F#1：CTACGTCACCCGAAAAGCGA(SEQ ID NO.1)；

SNHG9 R#1：CGCGGACGTTTATAGCCACT(SEQ ID NO.2)；

SNHG9 F#2：TAGGACACTGGTCCTCCCAC(SEQ ID NO.3)；

SNHG9 R#2：CAGCCAAGTTCCCCCAACC(SEQ ID NO.4)；

SNHG9 F#3：GGGAATCTACGTCACCCGAA(SEQ ID NO.5)；

SNHG9 R#3：CACTCTTCGGGTGGATTCCC(SEQ ID NO.6)；

the internal reference primer B2M F:AGATGAGTATGCCTGCCGTG(SEQ ID NO.7)；B2M R：TCATCCAATCCAAATGCGGC(SEQ ID NO.8)。

the PCR detection kit of the invention also comprisesA PCR reaction solution, wherein the reaction solution comprises SYBR Premix Ex Taq^TMDouble distilled water and cDNA template.

The PCR detection kit comprises: 10 μ L SYBR Premix Ex Taq^TMMu.l of upstream primer of 10. mu. mol/L, 0.5. mu.l of downstream primer of 10. mu. mol/L, 8. mu.l of double distilled water without nuclease, 1. mu.l of cDNA template, and 20. mu.l of reaction system.

The PCR detection reaction conditions of the invention are as follows: pre-denaturation at 94 ℃ for 2 min; 40 cycles: denaturation at 94 ℃ for 15 seconds, annealing at 60 ℃ for 20 seconds, and extension at 72 ℃ for 20 seconds; all samples were measured in duplicate at least three times using B2M gene as the reference gene, and the results were averaged.

The method for rapidly detecting the mechanical stress level of the cells by utilizing the PCR detection kit comprises the following steps: extracting RNA of a cell to be detected, carrying out reverse transcription to obtain cDNA serving as a template, carrying out RT-PCR reaction by using primers in the PCR detection kit and internal reference gene primers, taking normal cells as a control, repeatedly measuring all samples for at least three times, and taking an average value as a result; the cycle threshold obtained for each sample is Cq, the relative abundance is calculated as 2^ Δ Δ Cq (Δ Cq ═ target gene Cq-reference gene Cq, Δ Δ Cq ═ target gene Δ Cq-reference gene Δ Cq), and if the obtained results are statistically significant, the mechanical stress of the cells changes.

The cells of the invention are preferably human breast cancer cells MDA-MB-231 (purchased from the American Standard cell culture center,

HTB-26^TM)。

compared with the prior art, the invention has the following beneficial effects: the kit for detecting the SNHG9 gene provided by the invention has the advantages of strong specificity, high sensitivity, good adaptability and good practicability. The kit provides 3 pairs of detection primers, compared with the traditional method that only 1 pair of detection primers is used, the randomness of the result is greatly reduced, the statistical significance is higher, and the result is more accurate and reliable; the detection primers in the kit have high sensitivity, and the test can be completed only by a small amount of samples.

(IV) description of the drawings

FIG. 1 shows the screening of differentially expressed genes.

Fig. 2 is a dissolution curve of 3 pairs of detection primers for the SNHG9 gene.

FIG. 3 shows the result of the measurement of the transcriptional activity of SNHG9 gene under different mechanical stress levels.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

unless defined otherwise, all technical and scientific terms used herein have the same meaning as is familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only. The percentage concentration in the examples is mass concentration unless otherwise specified, and the solvent is water.

Example 1 screening of differentially expressed genes

1. Cell culture

To simulate two-and three-dimensional culture of cells, we formulated a soft matrix gel (0.1KPa), a hard matrix gel (40 KPa).

The preparation method of the soft gel comprises the following steps:

1) cell slide: the edges of the cell slide (i.e., circular coverslip) were wiped dry with a dust free wipe. The cell slide was placed in a 6-well plate with the amino-silanized surface facing up, and the 6-well plate was placed in a humid environment, but the cell slide surface was kept dry.

2) Square cover glass: an appropriate amount of ice-cold (4 ℃) dichlorodimethylsiloxane (Sigma-Aldrich) was added evenly to a 25mm square coverslip in a fume hood to cover the entire square coverslip evenly and allowed to stand for 1 min. Repeatedly washing the square cover glass for 2 times with appropriate amount of distilled water, wiping with dust-free wiping paper, and placing the treated surface upward while exposing and drying.

3) Soft matrix gel solution: in a 1.5mL centrifuge tube, add 40% acrylamide, 2% methylenebisacrylamide, 10% APs, TEMED and ddH as in Table 1₂O, mix well and freshly prepare 500. mu.L of soft matrix (0.1kPa) gel solution.

TABLE 1 Soft matrix gel (0.1KPa) solution composition

4) Adding 35 mu L of soft matrix gel solution to the aminosilane modification surface of the cell slide in the pore plate 6 in the step 1) to ensure that the soft matrix gel solution uniformly covers the whole cell slide to form a flat and uniform polyacrylamide hydrogel surface. The treated side of the square cover glass of step 2) was covered down on a 6-well plate and after standing at room temperature for about 1.5h, gel polymerization was completed and the square cover glass was carefully removed. Quickly add 2mL of 1 XPBS to each well of a 6-well plate and soak the gel in 1 XPBS.

5) The 1 × PBS in the 6-well plate was discarded, and the cell slide gel was transferred face up to a new 6-well plate with forceps. In the dark, 300. mu.L of 1 XSULFO-SANPAH solution was added to each well to uniformly cover the gel surface. UV crosslinking at 365nm for 20min turned Sulfo-SANPAH into rust-like brown. The gel was washed repeatedly 2 times with 50mmol/L HEPES (pH 8.5) buffer in the dark, and then discarded.

6) Freshly prepared 0.2mg/mL collagen solution: collagen (purchased from BD Biosciences) was diluted to 2mg/mL with ice-cold (4 ℃)0.1mol/L glacial acetic acid, followed by 10-fold dilution with ice-cold (4 ℃)50mmol/L HEPES (pH 8.5) buffer to give a 0.2mg/mL fresh collagen solution.

7) Adding 1mL of the 0.2mg/mL fresh collagen solution prepared in the step 6) into each well of the 6-well plate in the step 5), uniformly covering the gel surface, incubating overnight in a shaking table in a constant temperature incubator at 37 ℃ in the absence of light, and coating the collagen on the gel surface. The collagen-coated gels were transferred to new 6-well plates and 1.5mL of 1 × PBS was added to cover the collagen-coated gels, respectively. The 6-well plate was placed under UV irradiation for at least 90min with the lid removed to give a soft matrix gel.

8) Cell culture: human breast cancer cells MDA-MB-231 (purchased from the american standard cell culture center,

HTB-26^TM) Inoculating into L15 medium (sigma) containing soft matrix gel of step 7), 37 deg.C, and 5% CO₂The cells were cultured in a cell incubator, and the medium was changed 1 time every 1 day.

Hard matrix gel preparation and cell culture were performed in the same manner as soft matrix gel, except that the hard matrix gel composition was changed to table 2, and the preparation method was as follows: in a 1.5mL centrifuge tube, 40% acrylamide, 2% methylenebisacrylamide, 10% APs, TEMED and ddH were added as shown in Table 2₂O, mix well and freshly prepare 500. mu.L of a hard matrix (40kPa) gel solution.

TABLE 2 hard matrix gel (40KPa) gel solution composition

2. Extraction of tissue RNA

1) The soft and hard matrigel cultured cells MDA-MB-231 were collected by cell scraping on ice into 1.5ml RNase-free centrifuge tubes, centrifuged at 3000rpm for 5min, the supernatant was discarded after centrifugation, and 1ml TRIzol was added.

2) An appropriate amount of chloroform (200. mu.L chloroform/1 mL TRIzol) was added to the RNase-free 1.5mL centrifuge tube of step 1), vigorously shaken for 5min, and allowed to stand at room temperature for 5 min.

3) Centrifuging at 12000rpm and 4 deg.C for 15min to separate the upper colorless aqueous phase, the middle layer protein precipitate and the lower organic phase, and collecting the upper colorless aqueous phase in a new RNase-free 1.5mL centrifuge tube.

4) Adding isopropanol with the same volume as the water phase into the RNase-free 1.5mL centrifuge tube filled with the colorless water phase in the step 3), uniformly mixing, and standing for 10min at room temperature. Then, the mixture was centrifuged at 12000rpm at 4 ℃ for 10min, and RNA was precipitated to the bottom, and the supernatant was discarded.

5) 1mL of 75% ethanol prepared from DEPC water was added to the 1.5mL RNase-free centrifuge tube of step 4), and the RNase-free centrifuge tube was gently inverted upside down to wash the RNA precipitate. 7500rpm, centrifuging at 4 deg.C for 5min, discarding supernatant, and standing at room temperature for drying RNA precipitate.

6) Adding an appropriate amount of DEPC water into the RNase-free 1.5mL centrifuge tube in the step 5) to dissolve the RNA.

3. RNA sample quality analysis

The NanoDrop One spectrophotometer detects the absorbance of the RNA sample, and the result shows that the OD260/OD280 is 2.0.

4. Gene chip hybridization and scanning

After the total RNA extracted in the step 6) is subjected to linear amplification, cy3-UTP is marked, the cRNAs marked by fluorescence are purified by adopting an RNEASY Mini Kit, and the marked cRNAs are fragmented by RNA Fragmentation Reagents of Amhion. Using the human whole gene expression profiling chip (4X 44K gene) from Agilent, USA, hybridization was carried out for 17h at 65 ℃ in a chip hybridization oven, then elution, staining and finally scanning with Agilent DNA Microarray Scanner.

5. Chip data processing and analysis

After the hybridized chip reads data points by a chip scanner, the natural logarithm absolute value of two groups of ratio values is larger than 2.0 or smaller than 0.5 and is used as a differential expression gene.

6. Statistical treatment

SPSS 13.0 statistical software is adopted for data analysis, a one-factor variance analysis method is adopted for comparison of differences among groups, and differences with P <0.05 have significance.

7. Results

The results are shown in fig. 1, when the mechanical stress level sensed by the cells is increased, the expression level of the SNHG9 gene is significantly increased, the difference is statistically significant (P <0.05), and the expression levels of the TMEM191A, the AIRN, the TERC and the HOTTIP gene are down-regulated.

Example 2 selection and quality identification of SNHG9 Gene detection primers

The NCBI database of mRNA sequences encoding the SNHG9 gene encodes NR _003142.2(https:// www.ncbi.nlm.nih.gov/nuccore/NR _ 003142.2). Based on the sequence, a sequence with a proper Tm value (about 60) and low complementarity is searched as a detection primer, and three pairs of primers are obtained by screening.

Three pairs of detection primers:

SNHG9 F#1：CTACGTCACCCGAAAAGCGA

SNHG9 R#1：CGCGGACGTTTATAGCCACT

SNHG9 F#2：TAGGACACTGGTCCTCCCAC

SNHG9 R#2：CAGCCAAGTTCCCCCAACC

SNHG9 F#3：GGGAATCTACGTCACCCGAA

SNHG9 R#3：CACTCTTCGGGTGGATTCCC

a pair of internal reference primers B2M F: AGA TGA GTA TGC CTG CCG TG, respectively; b2 MR: TCA TCC AAT CCA AAT GCG GC are provided.

The primers were verified by NCBI BLAST test to have no non-specific target genes, the quality test results of the primers are shown in tables 3-5, and the dissolution curves are shown in FIG. 2. The results show that the three pairs of SNHG9 detection primers provided by the invention are effective in detection and can be used for detecting the expression condition of the SNHG9 gene specifically and highly sensitively.

TABLE 3 quality information of SNHG9 detection primers

TABLE 4 quality information of SNHG9 detection primers

TABLE 5 quality information of SNHG9 detection primers

Example 3 sensitive detection of primers provided in the kit

1. Extraction of tissue RNA

MDA-MB-231 cellular RNA cultured in two dimensions (soft matrix gel) and three dimensions (hard matrix gel) was extracted as described in example 1.

2. Reverse transcription of RNA

Using NanoDrop (Therm)o) after RNA quantification by A260 method, an equal amount of RNA (500ng) was taken into a common PCR tube, after which iScript was added^TMReverse Transcription Supermix for RT-qPCR 4. mu.L, Nuclean-Free Water was replenished to 20. mu.L. Reaction conditions are as follows: 5min at 25 ℃; at 46 ℃ for 60 min; 95 ℃ for 1 min.

3. qPCR detection

The expression level of SNHG9 in the two-dimensional cultured cells and the three-dimensional cultured cells were measured using the three pairs of primers (#1 to #3) and the internal reference primer (B2M) selected in example 2. A20 μ L reaction system was used, with 3 replicates per sample set up to ensure the reliability of the results. The following reaction system was prepared: iTaq Universal SYBR Green supermix 10. mu.L, template cDNA 2. mu.L, upstream primer 2. mu.L, downstream primer 2. mu.L, ddH₂O4. mu.L. All operations were performed on ice. The amplification procedure was: 1min at 95 ℃; (95 ℃ 10s, 60 ℃ 10s, 72 ℃ 30s) 40 cycles. SYBR Green is used as a fluorescent substrate, PCR reaction is carried out on a fluorescent real-time quantitative PCR instrument (Bio-RAD), and the expression quantity of SNHG9 RNA, namely the expression activity level of the SNHG9 gene is represented according to the Cq value.

The SNHG9 expression level detection is carried out on all samples, the detection effects of three pairs of detection primers are used as repetition, the B2M gene is used as an internal reference, statistical analysis is carried out, and then a table is drawn, and the results are shown in figure 3. RNA abundance of two-dimensional (2D) cultured cells was analyzed in comparison to three-dimensional (3D) cultured cells, which differed significantly (P <0.01) indicating that SNHG9 expression was significantly upregulated in three-dimensional culture. The example shows that the primer detection method provided by the kit can quickly detect the transcription level of the SNHG9 gene and can quickly judge the mechanical stress level of the cell.

The value of the kit lies in that the mechanical stress level of cells can be rapidly detected by the kit without complex instruments, so that the states of cell growth, differentiation, proliferation and the like are roughly evaluated, and the kit has high specificity, practicability and universality.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Sequence listing

<110> Zhejiang university

Application of <120> SNHG9 gene in cell mechanical stress detection and kit

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 1

ctacgtcacc cgaaaagcga 20

<210> 2

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 2

cgcggacgtt tatagccact 20

<210> 3

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 3

taggacactg gtcctcccac 20

<210> 4

<211> 19

<212> DNA

<213> Unknown (Unknown)

<400> 4

cagccaagtt cccccaacc 19

<210> 5

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 5

gggaatctac gtcacccgaa 20

<210> 6

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 6

cactcttcgg gtggattccc 20

<210> 7

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 7

agatgagtat gcctgccgtg 20

<210> 8

<211> 20

<212> DNA

<213> Unknown (Unknown)

<400> 8

tcatccaatc caaatgcggc 20

Claims

1. The application of the SNHG9 gene in cell mechanical stress detection is characterized in that the application is to detect the expression quantity of the SNHG9 gene in a cell to be detected by adopting PCR (polymerase chain reaction), and if the expression quantity is increased compared with the expression quantity of the SNHG9 gene of a normal cell, the mechanical stress level of the cell to be detected is increased.

2. The use of claim 1, wherein the test cell is human breast cancer cell MDA-MB-231.

3. A PCR detection kit for use according to claim 1, characterized in that the kit comprises SNHG9 gene detection primers, internal reference gene B2M primers;

SNHG9 F#1：CTACGTCACCCGAAAAGCGA；

SNHG9 R#1：CGCGGACGTTTATAGCCACT；

SNHG9 F#2：TAGGACACTGGTCCTCCCAC；

SNHG9 R#2：CAGCCAAGTTCCCCCAACC；

SNHG9 F#3：GGGAATCTACGTCACCCGAA；

SNHG9 R#3：CACTCTTCGGGTGGATTCCC；

the internal reference primer B2M F: AGATGAGTATGCCTGCCGTG, respectively; B2M R: TCATCCAATCCAAATGCGGC are provided.

4. The PCR detection kit of claim 3, wherein the PCR detection kit further comprises a PCR reaction solution, and the reaction solution comprises SYBR Premix Ex Taq^TMDouble distilled water and cDNA template.

5. The PCR detection kit according to claim 3, wherein the PCR detection kit comprises: 10 μ L SYBR Premix Ex Taq^TMMu.l of 10. mu. mol/L forward primer, 0.5. mu.l of 10. mu. mol/L reverse primer, 8. mu.l of double distilled water without nuclease, and 1. mu.l of cDNA template.

6. The PCR detection kit according to claim 3, wherein the conditions for PCR detection are: pre-denaturation at 94 ℃ for 2 min; 40 cycles: denaturation at 94 ℃ for 15 seconds, annealing at 60 ℃ for 20 seconds, and extension at 72 ℃ for 20 seconds.