CN112321718A - Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof - Google Patents
Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof Download PDFInfo
- Publication number
- CN112321718A CN112321718A CN201910716829.4A CN201910716829A CN112321718A CN 112321718 A CN112321718 A CN 112321718A CN 201910716829 A CN201910716829 A CN 201910716829A CN 112321718 A CN112321718 A CN 112321718A
- Authority
- CN
- China
- Prior art keywords
- ferritin
- pprv
- amino acid
- leu
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/385—Haptens or antigens, bound to carriers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/52—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an inorganic compound, e.g. an inorganic ion that is complexed with the active ingredient
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
- A61K47/65—Peptidic linkers, binders or spacers, e.g. peptidic enzyme-labile linkers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/69—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
- A61K47/6921—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
- A61K47/6927—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
- A61K47/6929—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/60—Medicinal preparations containing antigens or antibodies characteristics by the carrier linked to the antigen
- A61K2039/6031—Proteins
- A61K2039/6068—Other bacterial proteins, e.g. OMP
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
- C12N2760/18422—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18411—Morbillivirus, e.g. Measles virus, canine distemper
- C12N2760/18434—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Abstract
The invention discloses a self-assembly ferritin-based nano antigen particle, a peste des petits ruminants vaccine, a preparation method and application thereof. The invention fuses peste des petits ruminants virus hemagglutinin protein and the N end of the self-assembled ferritin nanoparticle subunit to obtain the fusion protein. Furthermore, after the membrane spanning region of the hemagglutinin protein of the peste des petits ruminants virus is removed, single-site or multi-site mutation is carried out, and the soluble expression quantity and the expression efficiency of the mutant are obviously improved. The invention utilizes a prokaryotic expression system, a silkworm and AcMNPV-insect cell eukaryotic expression system to express recombinant protein or carries out gene presentation in a vertebrate body through recombinant baculovirus to generate antigen-induced antibody. The vaccine provided by the invention displays the structure of the PPRV hemagglutinin protein on the surface of the helicobacter pylori ferritin cage structure to cause a neutralizing anti-PPRV antibody, thereby not only increasing the immune efficacy, but also increasing the immune range, and being capable of immunizing PPRVs of different genetic strains in different years.
Description
Technical Field
The invention relates to a self-assembly ferritin nano antigen particle, in particular to a nano antigen particle formed by fusing a PPRV hemagglutinin protein and a monomeric ferritin subunit and a PPV vaccine prepared from the nano antigen particle, belonging to the field of PPV vaccines.
Background
Peste des petits ruminants is an acute, highly infectious and highly pathogenic disease caused by Pest des Pest viruses (PPRV), mainly harms Peste des ruminants such as goats and sheep, and is classified as an infectious disease by the Ministry of agriculture of China. Phylogenetically, PPRV can be divided into 4 lineages, and PPRV belonging to lineages i and ii can be isolated only in western countries where PPRV originates, although some viruses of lineage iii have also been isolated in the south india, lineage iii is only present in eastern countries of arabia and africa. Lineage iv is considered a new lineage consisting of newly emerging virus strains. The best tool for preventing and treating PPRV is mainly vaccine, attenuated live vaccine is mostly applied at present, the main mechanism is that protective antibody aiming at surface antigen Hemagglutinin (HA) of peste des petits ruminants virus is generated by an induction mechanism, the main defect is that wild virus infected animals and vaccine immune animals cannot be distinguished, and efficient genetic engineering vaccine can make up the defect, and the protein Hemagglutinin (HA) of peste des petits ruminants virus is taken as the main antigen protein of the vaccine, which is always the hotspot of research on the genetic engineering vaccine of peste des petits ruminants. The best treatment for the disease is no longer preventive, but vaccines for various diseases are formally preventive. Therefore, the production of safe, efficient and cheap genetically engineered vaccines is a new requirement, and ferritin nanoparticles self-assembled from 24 subunits are formally an ideal antigen presentation and vaccine development platform.
Ferritin is mainly composed of a mineral core and a protein shell, the protein shell is formed by self-assembling 24 ferritin subunits, wherein each 3 subunits form a trimer subunit, 8 trimers form a spherical hollow nano cage-shaped structure with the outer diameter of 12nm and the inner diameter of 8nm, the mineral core is in the nano cage-shaped structure, ferritin is very stable, can endure high temperature and various denaturants without influencing the natural protein structure, protein is disintegrated under the acidic condition of pH2.0, when the pH is restored to the physiological condition (pH7.0), the disintegrated protein subunits can be reassembled into complete ferritin again, and based on the high temperature enduring characteristic, the ferritin can be depolymerized and reassembled into ferritin cavities to load drugs or nano particles. Ferritin is an ideal multifunctional nano-carrier due to its property of being modified by chemical methods and gene fusion, and its highly ordered repetitive antigens are liable to induce strong T cell-dependent antibody responses when distributed at 5-10nm intervals on the surface of microorganisms. The research on ferritin in recent years has mainly focused on: (1) coating a specific medicine in the ferritin shell or promoting the synthesis of a nano material by modifying the inner surface of the ferritin; (2) the outer surface of the ferritin is modified and connected with PEG or antibody to expand new functions; (3) the self-assembly of ferritin is controlled by the modification of the ferritin outer surface or the interface between subunits. The ferritin nanoparticles display the antigen, can remarkably enhance the immunogenicity of the antigen, and cause stronger humoral and cellular immune reactions, so ferritin is an ideal nano vaccine platform.
Disclosure of Invention
It is an object of the present invention to provide a self-assembling ferritin nano-antigen particle comprising a fusion protein;
the second purpose of the invention is to remove the transmembrane region of the fusion protein and carry out mutation so as to improve the expression quantity or the expression efficiency of the fusion protein;
the invention also aims to provide a nano-particle peste des petits ruminants vaccine obtained based on self-assembled ferritin nano-antigen particles;
the fourth object of the present invention provides a method for efficiently expressing the fusion protein;
the fifth purpose of the invention is to provide a method for presenting a fusion gene constructed by self-assembled ferritin nanoparticles and hemagglutinin protein to an animal body and presenting antigen in the animal body to induce the generation of antibodies.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the invention firstly provides a nano antigen particle containing fusion protein, wherein the fusion protein is obtained by connecting the N ends of a peste des petits ruminants virus hemagglutinin protein and a monomeric ferritin subunit; preferably, the original fusion protein is obtained by connecting the PPRV hemagglutinin protein and the N end of the monomeric ferritin subunit through a connecting peptide SGG.
The monomeric ferritin subunit comprises any one of bacterial ferritin, plant ferritin, algal ferritin, insect ferritin, fungal ferritin or mammalian ferritin; preferably, the monomeric ferritin subunit is a helicobacter pylori ferritin monomer with the amino acid sequence WP _ 000949190;
the PPRV hemagglutinin protein of different genetic strains; preferably, the selected region of the peste des petits ruminants virus hemagglutinin protein comprises a region selected from the group consisting of: a region capable of allowing hemagglutinin trimer formation, a transmembrane region, an extracellular domain; most preferably, the peste des petits ruminants virus hemagglutinin protein is selected from two specific parts, namely a transmembrane region and an extracellular domain of the peste des petits ruminants virus hemagglutinin protein; most preferably, the amino acid sequence of the peste des petits ruminants virus hemagglutinin protein is the amino acid shown as the sequence number AJE 30413;
in order to improve the expression quantity of the fusion protein obtained after the PPRV hemagglutinin protein is connected with the ferritin monomer, the invention further carries out mutation optimization on the homologous sequence of the original fusion protein, and carries out glycosylation site analysis after the sequence optimization so as to eliminate the glycosylation site to increase the soluble expression. Thus, after the optimization of the homologous sequence, the transmembrane region is designed to be removed, and amino acid single-site mutation and multi-site mutation are carried out to improve the soluble expression quantity and the expression efficiency:
specifically, the inventor analyzes 20 amino acid sequences of hemagglutinin proteins of peste des petits ruminants strains which are epidemic in different regions in the latest year by comparison and finds out a most universal homologous sequence, wherein the amino acid sequence of the homologous sequence is shown in SEQ ID NO.1 and is used as an antigen gene of a corresponding strain so as to obtain the optimal protection effect; on the basis, the invention further utilizes OptimumGeneTMThe technology optimizes the amino acid sequence of the hemagglutinin protein of the peste des petits ruminants virus, modifies the amino acid sequence of the hemagglutinin protein and the amino acid sequence of the ferritin monomer subunit after optimization according to the codon preference of escherichia coli, optimizes and designs various related parameters which influence the transcription efficiency and the translation efficiency of genes, the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the free energy stability of mRNA, the RNA unstable gene sequence, the repetitive sequence and the like, and keeps the translation into the final proteinThe protein sequence of (a) is not changed. In addition, in order to increase the expression level of ferritin and increase soluble expression, the ferritin monomer subunit was subjected to point mutation N19Q. Finally, the nucleotide of the homologous sequence SEQ ID NO.2 of the original fusion protein obtained by the optimization method is shown as SEQ ID NO. 3.
The optimized homologous sequence is expressed in a silkworm expression system, and the expression quantity of the homologous sequence after codon optimization is obviously improved compared with that before optimization according to the ELISA titer result of a gene expression product.
The invention designs the optimized homologous sequence to express the fusion protein sequence (shown in SEQ ID NO. 4) after the transmembrane region is removed in a silkworm baculovirus expression system, and the expression quantity of the fusion protein sequence after the transmembrane region is removed is obviously improved compared with the expression quantity of the fusion protein sequence before according to the ELISA effect of a gene expression product.
The invention obtains PPRV HA-ferritin-C-O-T mutant, and designs a plurality of pairs of primers to perform site-directed mutagenesis on conserved sequences by taking a gene sequence of a transmembrane region removed after codon optimization of the PPRV-ferritin-C-O-T mutant as a template:
multiple single-site mutants were obtained by performing single-site mutation of the sequence (shown in SEQ ID NO. 4) obtained by removing the transmembrane region from the amino acid sequence shown in SEQ ID NO.1, in accordance with the amino acid sequence of L57R, I140H, P147Q, L157R, V170S, L182H, V196Q, L204T, W212E, L223H, L276H, P295Q, L308S, V323K, V349R, and L359S; on the basis, 5 multi-site mutants are obtained according to the multi-site mutation modes of I140H-V196Q-V170S, I140H-L223H-V196Q, V170S-V196Q-L276H, L223H-V196Q-V323K and L223H-L276H-V323K.
The amino acid single-site mutation 'L57R' of the invention refers to the mutation of the 57 th amino acid of the amino acid sequence shown in SEQ ID NO.4 from L to R; the expression of the remaining single-site mutations is analogized.
The amino acid multi-site mutation 'I140H-V196Q-V170S' of the invention means that the amino acid 140 position of the amino acid shown in SEQ ID NO.4 is mutated from I to H, the amino acid 196 position is mutated from V to Q, and the amino acid 170 position is mutated from V to S; the remainder of the multi-site mutations are expressed and so on.
The invention expresses the mutated single-site mutants in a silkworm expression system, and according to the expression result, the expression method comprises the following steps: the titer of expression products of 6 mutants obtained by carrying out amino acid single-site mutation on a sequence (shown as SEQ ID No. 4) with the amino acid sequence shown as SEQ ID No.1 except a transmembrane region is remarkably improved according to the amino acid single-site mutation mode of I140H, V170S, V196Q, L223H, L276H and V323K, wherein the titer of the mutant obtained by carrying out amino acid single-site mutation on the sequence (shown as SEQ ID No. 4) with the amino acid sequence shown as SEQ ID No.1 except the transmembrane region is remarkably improved according to V196Q; on the basis of single-site mutation, in the multi-site mutants obtained by removing a transmembrane region from the amino acid sequence shown in SEQ ID No.1 (shown in SEQ ID No. 4) according to the multi-site mutation modes of I140H-V196Q-V170S, I140H-L223H-V196Q, V170S-V196Q-L276H, L223H-V196Q-V323K and L223H-L276H-V323K, the titer of the expression products of the 2 multi-site mutants is obviously improved, wherein the titer of the mutants obtained by removing the transmembrane region from the amino acid sequence shown in SEQ ID No.1 (shown in SEQ ID No. 4) according to the multi-site mutation of V170S-V196Q-L276H amino acids is obviously improved;
the invention further purifies the expression product of the multi-site mutant in a silkworm expression system primarily and observes the expression product by adopting an electron microscope, the observation result shows that the size of the product is consistent with the expected nano particles, the diameter of the cage body is about 12 nanometers, and the antenna-shaped protrusion is observed carefully.
The obtained multi-site mutant coding gene is cloned into an expression vector of baculovirus mammals to construct recombinant baculovirus presenting genes; the recombinant baculovirus is presented to mice, and the result shows that the titer of the antibody generated by the mice is obviously higher than that of a healthy silkworm pupa control and a traditional vaccine.
Therefore, the self-assembled ferritin nano antigen particles containing the fusion protein provided by the invention are applied to the preparation of Peste des petits ruminants vaccines, and the application method comprises the following steps:
expressing the encoding gene of the fusion protein or the mutant in prokaryotic cells by adopting a prokaryotic expression system to obtain nano antigen particles, purifying the expressed nano antigen particle product, and mixing the purified nano antigen particle product with a medically acceptable immunologic adjuvant or carrier to obtain the peste des petits ruminants vaccine;
for reference, the step of expressing the nano-antigen particles in prokaryotic cells by using prokaryotic system expression system comprises:
(1) cloning the original sequence of the fusion protein or the sequence of the fusion protein after mutation optimization to an expression vector pET28a to obtain a recombinant plasmid pET28a-PPRV HA-Ferritin;
(2) and (3) transforming the recombinant plasmid pET28a-PPRV HA-Ferritin into BL21(DE3) competent cells for expression, and then purifying by a nickel column to obtain the recombinant plasmid.
(II) the encoding gene of the fusion protein or the mutant is expressed in eukaryotic cells by adopting a eukaryotic expression system, and the expressed antigen product is purified and then mixed with medically acceptable immune adjuvant or carrier to obtain the peste des petits ruminants vaccine.
For reference, the method for expressing the fusion protein encoding gene in eukaryotic cells by using a eukaryotic expression system comprises the following steps:
expressing the encoding gene of the fusion protein or the mutant in a silkworm expression system, and collecting and purifying the expressed antigen; preferably, the fusion protein coding gene is constructed into a silkworm baculovirus expression vector to prepare a recombinant silkworm baculovirus; amplifying the recombinant silkworm baculovirus in silkworm cells and expressing the amplified recombinant silkworm baculovirus in silkworms or silkworm pupas;
or expressing the encoding gene of the fusion protein or the mutant in an AcMNPV-insect cell eukaryotic expression system, and collecting and purifying the expressed antigen; preferably, the encoding gene of the fusion protein or the mutant is cloned into a baculovirus transfer vector to construct a recombinant baculovirus transfer vector; co-transfecting the recombinant baculovirus transfer vector and baculovirus DNA into an insect cell to obtain a recombinant baculovirus; infecting the recombinant baculovirus into an insect host or an insect cell, culturing the infected insect cell or the insect host to express a corresponding antigen, and purifying to obtain the recombinant baculovirus;
(III) the fusion protein coding gene can be cloned to a gene presenting vector to construct a recombinant baculovirus transfer vector presenting exogenous genes to vertebrate cells or individuals, and the recombinant baculovirus transfer vector is transfected to silkworm cells to obtain recombinant viruses; the resulting recombinant virus presents antigen in animals and induces antibodies in animals by injection or orally.
The invention further provides a vaccine for preventing and treating Peste des petits ruminants, which comprises the following components: a prophylactically or therapeutically effective amount of self-assembled ferritin nano-antigen particles comprising a fusion protein and a pharmaceutically acceptable immunoadjuvant or carrier.
The vaccines of the present invention may be formulated with a variety of different pharmaceutical excipients or carriers. They may include salts and buffers to provide physiological ionic strength and pH, surfactants such as polysorbates 20 and 80 to prevent antigen aggregation, stabilizers for antigen stabilization such as PEG, trehalose and gelatin and polymers for sustained release such as CMC, HEC, and dextran. Vaccines can also be formulated with controlled release or enhanced display systems such as hydrogels, virosomes, nanoparticles, and emulsions. The vaccine may also be formulated with adjuvants to further increase the cross-reactive immune response and cross-protection, suitable adjuvants may be selected from polysaccharides such AS lipopolysaccharides and saponins, nucleic acids, lipids such AS MPL (monophosphoryl lipid a), proteins such AS bacterial flagellin, inorganic salts such AS aluminium salts and calcium phosphate, emulsions such AS freund's incomplete adjuvant, MF59 and AS03 and various Toll-like receptor ligands. Different adjuvants can be tested with the treated antigen to identify suitable adjuvants that produce higher levels of cross-reactive immune response and cross-protection, including complete or 100% protection, at appropriate adjuvant doses.
The peste des petits ruminants vaccines of the present invention may be administered by a variety of routes, such as intramuscular, subcutaneous, intranasal, topical, sublingual, or oral.
The vaccine provided by the invention can display the structure of the peste des petits ruminants virus hemagglutinin protein on the surface of the helicobacter pylori ferritin cage structure, so that a neutralizing anti-peste des petits ruminants virus antibody can be caused. The vaccine induces individuals to generate neutralizing antibodies, so that the immunity effect is improved, the immunity range is also enlarged, and the peste des petits ruminants viruses of different genetic strains in different years can be immunized.
Compared with the prior art, the invention has the following advantages and effects:
1. according to the invention, a prokaryotic expression system escherichia coli, silkworm baculovirus and an AcMNPV-insect cell eukaryotic expression system are used for expressing the recombinant protein vaccine, live harmful viruses are not involved in the vaccine preparation process, and compared with the traditional attenuated live vaccine method, the method is safer and simpler to operate, and is suitable for rapid large-scale production.
2. The nano peste des petits ruminants vaccine provided by the invention can induce peste des petits ruminants antibodies with broad spectrum properties, and lays a foundation for preparing a peste des petits ruminants vaccine.
3. The nano peste des petits ruminants vaccine provided by the invention is used for immunizing and inoculating animals to generate anti-peste des petits ruminants antibody with higher level obviously than that of the traditional vaccine.
Definitions of terms to which the invention relates
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The words "antigen" and "immunogen" are used interchangeably and refer to a molecule, substance, protein, glycoprotein, or live virus capable of inducing specific humoral (antibody) and cellular immune responses.
The term "antigenicity" refers to the ability of an antibody to react or bind to a specific antigen; the term "immunogenicity" refers to the ability of an antigen or vaccine to induce a specific immune response; the term "immune response" refers to both humoral or antibody-mediated and cell-mediated immune responses against antigens, vaccines or infectious agents; the term "vaccine" refers to a composition comprising an antigen for the therapeutic treatment or prophylactic immunization against an infectious or non-infectious disease; the term "immunization" refers to an immune response generated by vaccination or infection that provides protection against infectious or foreign agents; the term "recombinant protein or antigen" refers to a protein or antigen produced by recombinant DNA techniques that can be used to clone and express genes to produce proteins in a variety of hosts including bacteria, mammalian cells, insect cells, and plants. The term "potency" refers to the amount of antigen in an antigen preparation or vaccine as measured by a specified potency assay.
The terms "mutation" and "mutant" have their usual meanings herein, and refer to a genetic, naturally occurring or introduced change in a nucleic acid or polypeptide sequence, which has the same meaning as is commonly known to those of skill in the art.
The term "host cell" or "recombinant host cell" means a cell comprising a polynucleotide of the invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome.
The term "transfection" refers to the process by which eukaryotic cells acquire a new genetic marker due to the incorporation of foreign DNA.
Drawings
FIG. 1 is a polyacrylamide gel electrophoresis diagram of the expression product of PPRV HA-Ferritin in a prokaryotic expression system; m is Marker; 1 is a PPRV HA-Ferritin prokaryotic expression sample; 2 is a pET-28a no-load prokaryotic expression sample; 3 is an uninduced prokaryotic expression sample.
FIG. 2PPRV HA-Ferritin-C-O-T-M3Schematic diagram of hemagglutination assay of the expression product in silkworm expression system; the initial dilution was 10-fold and the hemagglutination value reached 5120.
FIG. 3PPRV HA-Ferritin-C-O-T-M3Western blotting detection image of expression product in silkworm expression system; a is PPRV HA-Ferritin-C-O-T-M3Silkworm expression products; b is a negative control.
FIG. 4PPRV HA-Ferritin-C-O-T-M3Electron micrograph of the expression product in the silkworm expression system.
Detailed Description
The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.
1. Test materials and reagents
(1) Strains, strains and vectors: prokaryotic expression vector pET-28a (+), escherichia coli TOP10 strain, transfer vector pVL1393, prokaryotic expression strain BL21(DE3), silkworm cell BmN, silkworm nuclear polyhedrosis virus parent strain BmBacmid and silkworm variety JY1 are all preserved in molecular microorganism laboratories of the institute of biotechnology of the Chinese academy of agricultural sciences;
(2) ferritin sequence and Peste des petits ruminants virus HA protein gene sequence: the consensus sequence obtained by analysis was artificially synthesized and cloned into the prokaryotic expression vector pUC 57.
(3) Enzymes and reagents: restriction enzyme, T4The DNA ligase and the corresponding buffer solution are purchased from Promega corporation; LA Taq polymerase and buffer were purchased from TaKaRa; DNA and protein molecular weight standards of various specifications are products of TranGen Biotech company; 2K Plus II DNA Marker was purchased from Beijing Quanjin Biotechnology Ltd; murine H protein monoclonal antibodies were purchased from Pirbright, Inc. Goat anti-rabbit IgG secondary antibody labeled by horseradish peroxidase was purchased from MBL company; DEPC, M-MLV-Rtase (reverse transcriptase) was purchased from Promega;
(4) biochemical reagents: tris, Ampicillin, Kanamycin, IPTG, SDS, urea, imidazole, TritonX-100, TEMED (N, N, N ', N' -tetramethylenethylene diamine), Ammonium Persulfate (Ammonium Persulfate), Kanamycin (Kanamycin) were purchased from Sigma; bisacrylamide, acrylamide, IPTG, X-Gal were purchased from Promega; agarose is a product of Sunbiotech company; yeast Extract (Yeast Extract), tryptone were purchased from OXOID, UK; 0.2um, 0.45um filters were purchased from Gelman Sciences; ethidium Bromide (EB), Coomassie Brilliant blue R-250 from Fluka; Ni-NTA Agarose, Proteinase K, fetal bovine serum were purchased from Invitrogen; bovine serum albumin was purchased from roche; the others are all domestic or imported analytical pure reagents. The primer synthesis and gene sequencing are completed by the biotechnology limited of Beijing Optimalaceae New industry.
(5) Culture medium: the Escherichia coli culture medium is LB culture medium; the silkworm insect cell culture medium is TC-100 purchased from Applichem company;
(6) animal experiments of the nano vaccine constructed by fusing the peste des petits ruminants virus and the ferritin are carried out in an isolated laboratory.
2. Fusion PCR method for site-directed mutagenesis in experimental methods
Refer to Kuang Jatin et al (a new method for vector construction: recombinant fusion PCR method, genomics and applied biology, 2012, volume 31, phase 6, page 634-639).
Example 1PPRV HA-Ferritin original sequence nanoparticle vaccine preparation and potency assay
1 arrangement of solutions and culture media
Reference is made to the relevant tool book for the preparation of solutions and media (Joseph et al, third edition of the molecular cloning guidelines, 2002; Oseber, et al, eds. molecular biology guidelines, 1998).
2, synthesizing a PPRV hemagglutinin protein gene sequence and a ferritin gene sequence.
In order to realize better fusion expression of PPRV hemagglutinin and ferritin, the amino acid sequence of PPRV (AJE30413) virus hemagglutinin protein is analyzed by using transmembrane domain analysis software (TMHMM), so that the transmembrane region of the PPRV hemagglutinin protein is 36-58 sites and consists of 23 amino acids, and the extracellular domain of the PPRV hemagglutinin protein is 586 amino acids.
In order to promote the expression efficiency of the Peste des petits ruminants virus and ferritin fusion nanoparticles and improve the soluble expression, asparagine (N) at the 19 th position in the helicobacter pylori ferritin amino acid sequence is mutated into glutamine (Q) so as to eliminate glycosylation sites. The protein sequence of the PPRV hemagglutinin is connected with the ferritin sequence through a connecting peptide (SGG), the first 4 amino acids of the ferritin amino acid sequence are removed, and then the connecting peptide is connected with the 5 th amino acid at the N end of the ferritin.
In order to improve the translation initiation efficiency of a target gene in a silkworm baculovirus eukaryotic expression system, a Kozak sequence AAC is added in front of the gene, and in order to improve the translation termination efficiency, a termination codon is changed into TAA. In addition, restriction sites for BamHI, EcoRI and the like within the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene, for subsequent cloning into the eukaryotic transfer vector pVL 1393.
The target gene sequence was translated using ATG on pET-28a (+) vector for initiation of translation. In addition, restriction sites for BamHI, EcoRI and the like within the gene sequence were removed, BamHI was added upstream of the gene, and EcoRI restriction sites were added downstream of the gene, for subsequent cloning into the prokaryotic vector pET-28a (+).
Artificially synthesizing the designed Peste des petits ruminants virus hemagglutinin gene sequence and ferritin sequence.
Plasmid construction of Peste des petits ruminants virus and ferritin fusion protein
3.1 PCR amplification of Peste des petits ruminants Virus and ferritin fusion proteins
The Peste des petits ruminants virus hemagglutinin protein and the ferritin are fused together by using a fusion PCR technology. The specific experimental method is shown in the experimental method 2.
3.1.1 PCR amplification of E.coli expression plasmids
PCR amplification of PPRV HA full sequence (transmembrane and ectodomain sequences): plasmid pUC57-PPRV HA was used as a template
F1：5’-GTGGACAGCAAATGGGTCGCACCATGAGCGCGCAGCGTG-3’
R1：5’-TTGATGATGTCGCCACCGGACACAGGATTACAAGTGACTT-3’
PCR amplification of Ferritin sequence: using pUC57-Ferritin as template
F2：5’-AAGTCACTTGTAATCCTGTGTCCGGTGGCGACATCATCAAGCTG-3’
R2：5’-CAAGCTTGTCGACGGAGCTCTTAGCTCTTGCGGGACTTGG-3’
PPRV HA-Ferritin is amplified by Overlap-PCR by taking PCR products PPRV HA and Ferritin as templates
F1：5’-GTGGACAGCAAATGGGTCGCACCATGAGCGCGCAGCGTG-3’
R2：5’-CAAGCTTGTCGACGGAGCTCTTAGCTCTTGCGGGACTTGG-3’
3.1.2 PCR amplification of expression plasmids in silkworm expression systems
PCR amplification of PPRV HA full sequence: plasmid pUC57-PPRV HA was used as a template
F3：5’-ACCGTCCCACCATCGGGCGCACCATGAGCGCGCAGCGTGA-3’
R3：5’-TTGATGATGTCGCCACCGGA CACAGGATTACAAGTGACTT-3’
PCR amplification of Ferritin sequence: using pUC57-Ferritin as template
F4：5’-AGGTTACCTGCAACCCGGTGTCCGGTGGCGACATCATCAAGCTG-3’
R4：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
PPRV HA-Ferritin is amplified by Overlap-PCR by taking PCR products PPRV HA and Ferritin as templates
F3：5’-ACCGTCCCACCATCGGGCGCACCATGAGCGCGCAGCGTGA-3’
R4：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
The PCR reaction system is shown below:
Setting PCR parameters:
95 ℃ for 5 min; 30 cycles of 95 ℃, 30s, 58 ℃, 30s, 72 ℃ and 3 min; 72 ℃ for 10 min. 3.2 purification and recovery of DNA fragments from glass milk
Preparing 1% (w/v) agarose gel, and carrying out electrophoresis on the PCR amplification product; placing the agarose gel under an ultraviolet lamp, quickly cutting the gel containing a single target nucleic acid strip, placing the gel into a centrifugal tube of 1.5mL, weighing, adding 6M NaI with three times of volume, and placing the gel in a constant-temperature incubator at 37 ℃ for melting; adding 8 μ L of Glassmik into the completely melted solution, mixing, ice-cooling for 5min, and shaking twice; centrifuging at 8000rpm for 10s, and discarding the supernatant; adding 800 mu L of New Wash to Wash, slightly bouncing, centrifuging, and repeating for 2 times; removing the supernatant, and drying the centrifuge tube in a constant-temperature incubator at 37 ℃ for 2-3 min; after drying, 20. mu.L of 0.1 XTE was added to dissolve, the DNA was mixed and dissolved thoroughly, centrifuged at 12000rpm for 5min, the supernatant was immediately used for ligation, and the rest was stored at-20 ℃.
3.3 Mini-Production of competent cells
Coli Top10 competent cells were prepared and stored at-80 ℃.
3.4 ligation and transformation of the Gene of interest to pET-28a (+) vector and pVL1393 vector
3.4.1 enzymatic digestion of pET-28a (+) and pVL1393 vectors
The transferred transformants pVL1393 and pET-28a (+) were digested simultaneously with restriction enzymes BamH I and EcoRI, inactivated at 65 ℃ for 20min and stored at-20 ℃ for further use.
The enzyme digestion system is as follows:
vector 5. mu.L, 10 XBuffer E5. mu.L, BamH I1. mu.L, EcoRI 1. mu.L, ddH2O38. mu.L, 50. mu.L total.
3.4.2 recombinant ligation
The recovered target fragment is recombined and connected with the transfer vector pVL1393 and pET-28a (+) after double enzyme digestion treatment by BamHI/EcoRI. Using 2 xclone Express Mix recombinase at 50 ℃ for 10 min. The recombinant ligation system is shown below: mu.L of the target fragment, 2. mu.L of the vector, 5. mu.L of 2 xclone Express Mix, and 10. mu.L in total were recovered.
3.4.3 transformation
Taking competent cells stored at-80 ℃, rapidly thawing half, adding 3 mu L of the recombinant product, and standing on ice for half an hour; placing the mixture in a constant-temperature water bath kettle at 42 ℃ for 90s, and quickly placing the mixture on ice for 3-5 min; adding a proper amount of 1mL LB culture medium into the tube, and standing and culturing for 60min in a constant temperature incubator at 37 ℃; after centrifugation, most of the supernatant was discarded, and 200. mu.L of the supernatant was applied to LB plates (100. mu.g/mL Amp), and cultured in a 37 ℃ incubator for 30min in the upright position and then in the inverted position overnight.
3.5 Rapid extraction of nucleic acids Positive clones were coarse screened
Picking a single colony on an LB plate, inoculating the single colony in an LB liquid culture medium (100 mu g/mL Amp), placing the single colony in a constant-temperature shaking incubator at 37 ℃, setting the rotating speed to be 220rpm, and culturing overnight; taking 500 mu L of bacterial liquid in a centrifugal tube, and collecting thalli; adding 30 mu L of Loading Buffer and 20 mu L of phenol/chloroform (1:1), and fully mixing by using a vortex shaker to resuspend the thalli; centrifugation was carried out at 12000rpm for 3min, and 8. mu.L of the supernatant was subjected to agarose gel electrophoresis, while an empty vector treated in the same manner was used as a control. Observing the band under an ultraviolet lamp of the gel imaging system, and selecting bacterial liquid with the plasmid band obviously retreated to extract the plasmid.
3.6SDS alkaline lysis method for extracting plasmid DNA
3mL of bacterial liquid is collected in a centrifuge tube, plasmid DNA is extracted by an SDS alkaline lysis method, and the plasmid DNA is stored at the temperature of minus 20 ℃ for standby.
3.7 enzyme digestion and sequencing identification of Positive clones
The enzyme digestion system is as follows: recombinant plasmid DNA 3. mu.L, 10 XBuffer E3. mu.L, BamH I0.5. mu.L, EcoRI 0.5. mu.L, ddH2O14. mu.L, 20. mu.L total. After reaction at 37 ℃ for 2 hours, 7. mu.L of the reaction mixture was subjected to electrophoresis using 1% agarose. And (3) carrying out DNA sequencing on the plasmid with correct enzyme digestion detection, wherein the result is consistent with the target gene, and the obtained recombinant plasmids are named as pET28a-PPRV HA-Ferritin and pVL1393-PPRV HA-Ferritin.
4 expression and purification of recombinant plasmids
4.1 inducible expression of recombinant plasmids in E.coli
Converting a correctly identified recombinant expression plasmid pET28a-PPRV HA-Ferritin into BL21 competent cells, inducing for 1h, 2h, 3h, 4h and 5h respectively under the conditions of 37 ℃ and IPTG final concentration of 0.5mM, collecting bacterial liquid, analyzing the expression condition by SDS-PAGE electrophoresis, wherein a specific band appears at the position of about 82kD of pET28a-PPRV HA-Ferritin, the specific band is consistent with the size of an expected recombinant protein with His, the specific band is not generated by an uninduced recombinant expression vector, the fusion protein is successfully expressed in escherichia coli, the expression quantity is gradually increased 1-4 h after IPTG is added, and the multiple-accumulation recombinant proteins of 5h and 4h are induced are almost as much. And (3) crushing the bacterial cells by using ultrasonic waves, finding that the supernatant HAs a small amount of target protein, and the precipitate HAs an obvious target band, which indicates that the recombinant protein His-PPRV HA-Ferritin mainly exists in an insoluble inclusion body form. The polyacrylamide gel electrophoresis chart is shown in figure 1
4.2 Mass expression of recombinant proteins and treatment of Inclusion body protein samples
Streaking the strain with high expression quantity stored at-80 ℃, culturing overnight at 37 ℃, selecting a single colony, inoculating the single colony in 4mL LB liquid medium (50 mu g/mL Kan), and culturing overnight at 37 ℃; transferring 1% of the bacterial solution into 200mL LB liquid medium (50. mu.g/mL Kan), shaking and culturing at 37 ℃ until OD value reaches about 0.6, adding IPTG (final concentration of 0.5mM), and continuously culturing at 37 ℃ for 4 h; centrifuging at 4 deg.C and 5000rpm for 10min to collect thallus, and sterilizing with sterile ddH2O washing for 2 times, and centrifuging to collect thalli. Resuspending the thallus with lysis buffer solution with dosage of 100 μ L lysate/mL bacterial solution, ice-bathing for 30min, and breaking the thallus with ultrasonic wave on ice; centrifuging at 4 ℃ and 12000rpm for 10min, removing supernatant, and obtaining a precipitate as a recombinant protein inclusion body; resuspending and washing the precipitate with a proper amount of inclusion body washing solution I and an appropriate amount of inclusion body washing solution II, and discarding the supernatant; the pellet was resuspended in the appropriate amount of urea NTA-0Buffer and dissolved overnight at 4 ℃.
4.3 Nickel column affinity chromatography purification of recombinant proteins
Centrifuging the overnight dissolved inclusion body solution at 4 ℃ and 12000rpm for 15min, taking the supernatant, and filtering with a 0.45 mu m membrane; purifying the expressed protein by using a Ni-NTA resin chromatographic column, collecting eluent in 5 gradients of urea NTA-25, urea NTA-50, urea NTA-100, urea NTA-250 and urea NTA-500, collecting penetration liquid and eluent, collecting an NTA volume in each tube, and determining the binding condition of the protein and the distribution condition of the target protein in the eluent by SDS-PAGE analysis. Protein electrophoresis showed that the protein eluted most at 100mM imidazole, also eluted at 150mM and very little at 250 mM. After SDS-PAGE electrophoresis, the purified recombinant protein is observed to have correct size and single protein band.
4.4 preparation of polyclonal antibodies
Quantifying the purified His-Ferritin protein, collecting 1.5mg protein, cutting off gel containing target protein after SDS-PAGE electrophoresis, cutting up the gel as much as possible, drying at 37 ℃, grinding into powder, diluting the antigen protein to 2 times of final concentration by using normal saline, fully mixing the adjuvant, taking out the required dosage under aseptic condition, and mixing the required dosage with the antigen protein according to the volume ratio of 1:1, mixing the mixture quickly, injecting the mixture into an immune mouse through hind leg and calf muscles, collecting all serum after two immunizations, and measuring the antibody titer of the serum.
5 recombinant plasmid is expressed and purified in a silkworm eukaryotic expression system
5.1 reproduction of parent strain BmBacmid of Bombyx mori nuclear polyhedrosis virus and preparation of virus DNA
Preparing a 1 XTC-100 culture medium according to the product specification of Applichem company, adjusting the pH to 6.22 by using 2M NaOH, supplementing 10 percent fetal bovine serum to the culture medium after filtration sterilization, and culturing the bombyx mori cell BmN at 27 ℃. Infecting about 50mL of cells in logarithmic growth phase with parent strain of bombyx mori nuclear polyhedrosis virus, collecting virus infection liquid after 3-4 days, centrifuging at 10000rpm for 10min, removing precipitate, centrifuging the supernatant at 25000rpm for 1h, removing supernatant, suspending virus particles with 1mL of virus DNA extract (1L containing 12.1g of Tris, 33.6g of EDTA, 14.1g of KCl and pH 7.5), transferring to a 1.5mL centrifuge tube, adding proteinase K to the final concentration of 50 mu g/mL, keeping the temperature at 50 ℃ for 2h, adding 35% of Sarkorsel to the final concentration of 1%, keeping the temperature at 50 ℃ for 2h, extracting with equal volumes of saturated phenol, chloroform (1:1) and chloroform sequentially, transferring the upper aqueous phase to a new tube, adding 1/10 volume of 3M NaCl, adding 2 times of absolute ethanol, standing at-20 ℃ for more than 2h to precipitate virus DNA, centrifuging at 5000rpm for 10min, washing the precipitate with 75% ethanol, and freeze drying. Dissolved in 100. mu.L of TE Buffer and stored at 4 ℃ until use.
5.2 recombinant Bombyx mori baculovirus rBmBacmid (P)PHConstruction and acquisition of PPRV HA-Ferritin)
Inoculation of about 1X 106Cells at 15cm2After the cells were attached to the wall in the flask, the Fetal Bovine Serum (FBS) -containing medium was removed, washed three times with FBS-free medium, and 1.5mL FBS-free medium was added. Mu.g of bombyx mori baculovirus parent strain BmBcimid DNA (patent number: ZL201110142492.4), 2. mu.g of recombinant transfer plasmid pVL1393-PPRV HA-Ferritin and 5. mu.L of liposome were sequentially added to a sterilizing tube, and sterile double distilled water was usedMake up the volume to 60 μ L, mix gently, stand for 15min, add drop by drop to the flask for cotransfection. After 4h incubation at 27 ℃ 1.5mL serum free medium and 300. mu.L FBS were supplemented. Culturing at 27 ℃ for 4-5 days at constant temperature, collecting supernatant for recombinant virus rBmBacmid (P)PHPPRVHA-Ferritin). Inoculating a proper amount of cells (about 70-80%) in a small 35mm dish, sucking out the culture medium after the cells adhere to the wall, diluting the co-transfection supernatant at different concentrations, adding 1mL of co-transfection solution into the adherent cells, and uniformly distributing. Infecting for 1h at 27 ℃, sucking off infection liquid, melting 2% low melting point agarose gel in water bath at 60 ℃, cooling to 40 ℃, uniformly mixing with 2 XTC-100 culture medium (containing 20% FBS) preheated at 40 ℃, adding 4mL of the gel into each dish, sealing with Parafilm after solidification, carrying out inverted culture at 27 ℃ for 3-5 d, observing by a microscope, selecting out hollow spots without polyhedra, repeating the steps, and obtaining pure recombinant silkworm baculovirus rBmBacmid (P) through 2-3 rounds of purificationPH-PPRV-Ferritin)。
5.3 recombinant Virus rBmBacmid (P)PHPPRV HA-Ferritin) amplification in silkworm cells
Recombinant bombyx mori baculovirus rBmBacmid (P)PHPPRV HA-Ferritin) to infect the normal growth BmN cells, collecting supernatant after culturing for 3 days, wherein the supernatant contains a large amount of recombinant virus rBmBacmid (P)PH-PPRV HA-Ferritin)。
5.4 identification of recombinant viruses
The PCR method is used for analyzing the integration of the exogenous gene, and the extraction method of the free virus genome DNA is as follows: collecting virus supernatant 150 μ L, adding 150 μ L (0.5mol/L) NaOH, mixing, adding 20 μ L (8mol/L) ammonium acetate, mixing, extracting with phenol and chloroform with equal volume, precipitating with ethanol, and dissolving DNA with 20 μ L TE. Taking 1 mu L of the virus genome DNA for PCR amplification, wherein the reaction conditions are as follows: denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 1min, denaturation at 58 deg.C for 1min, and denaturation at 72 deg.C for 3min for 30 cycles, and final extension at 72 deg.C for 10 min. Electrophoresis analysis was performed on 15. mu.L of the reaction product, and the result confirmed that the recombinant virus was obtained.
5.5PPRV HA-Ferritin expression in silkworm body and silkworm pupa
The silkworm pupa is high-expression varietyJY1 (kept by the laboratory). The breeding of JY1 silkworm is carried out according to the conventional method of China sericulture (Shanghai science and technology Press, 1991) compiled by Luhong Yin. Selecting silkworm with the same average weight 48h after the food in the area and selecting 15 silkworm pupas with the same average weight seven days after cocooning, wherein each silkworm pupa and silkworm are inoculated with about 1.0 multiplied by 105pfu rBmBacmid(PPHAnd (4) -PPRV HA-Ferritin), collecting the silkworm pupae with diseases and taking silkworm blood after 4-5 days, and freezing and storing at-20 ℃ for ELISA detection.
5.6 Collection and purification of PPRV HA-Ferritin viroid particles
Silkworm pupae containing the gene of interest were ground with precooled PBS (1: 9 ratio) in a homogenizer and then filtered through a 0.45um filter. In 30% sucrose solution, 1.5X 105g ultra-high speed centrifugation for 2 h. The pellet was reconstituted to volume with 0.1M NaCl in Tris-HCl (pH7.0) and eluted through cation exchange chromatography packing SP (GE Inc.), 0.5M NaCl in Tris-HCl (pH 7.0). Then, the mixture was subjected to molecular sieve chromatography S200 (GE). The purity can reach 95%, and the yield can reach more than 40%. It was also demonstrated that the target protein expressed in Bombyx mori could self-assemble into viroid particles at high concentration.
6Western blotting detection
Diluting 10 times of ultrasonic waves by PBS (pH 7.4) to break silkworm hemolymph infected by recombinant virus, carrying out SDS-PAGE gel electrophoresis, carrying out 5% concentration gel and 15% separation gel concentration, transferring protein to a polyvinylidene fluoride (PVDF) membrane by a semi-dry transfer method, preparing 3% BSA (bovine serum albumin) by PBST for blocking, using a mouse-derived H protein monoclonal antibody as a primary antibody (1:1000 for dilution), using HRP-labeled goat anti-mouse IgG as a secondary antibody (1:5000 for dilution, manufactured by a laboratory), finally carrying out color development by DAB (diaminobenzidine), terminating by deionized water, and detecting a result.
Western blotting results showed that a specific band of 82kDa (PPRV HA-Ferritin) size was detectable in the supernatant of silkworm hemolymph samples after recombinant virus infection.
7 hemagglutination assay
7.1 Material preparation
96-well V-type microplate, micropipette (equipped with a dripper); aldehydic liquid (Alsevers), chicken red blood cell suspension (1%); pH7.2PBS.
7.2 method of operation
0.025ml PBS is added into 1-12 holes of the micro reaction plate, and the drippers are replaced. 0.025mL of virus suspension was aspirated into the first well and mixed well. Sucking 0.025mL of virus solution from the first well, adding the virus solution into the 2 nd well, sucking 0.025mL of virus solution after mixing, adding the virus solution into the 3 rd well, performing gradient dilution by 2 times to the 11 th well, sucking 0.025mL of virus solution from the 11 th well, discarding the virus solution, and changing a dropper. 0.025ml LPBS was added per well. And red blood cell control wells without sample. 0.025mL of a suspension of 1% by volume of chicken red blood cells was added to each well (the suspension was added after shaking well). Shaking and mixing uniformly, standing for 20-40 minutes at room temperature, and observing the result. The control hole red blood cells are obviously button-shaped and sink to the bottom of the hole; table 1 shows the experimental data of the PPRV HA-Ferritin original gene sequence expression product.
TABLE 1 hemagglutination titer of PPRV HA-Ferritin original sequence expression product
| Group of | Potency of the drug |
| PPRV HA-Ferritin | 1：256 |
8 ELISA detection
Diluting the silkworm hemolymph sample to be detected by using a coating solution in a proper multiple proportion, taking a silkworm hemolymph sample infected by a parent virus as a negative control, only adding the coating solution as a blank control, adding 100 mu L of the coating solution into each hole of an enzyme label plate, and standing overnight at 4 ℃. The well was quickly drained and washed 3 times with PBST. mu.L of 3% BSA blocking solution was added to each well, acted on at 37 ℃ for 3h, and washed 3 times with PBST. Diluting a His-Ferritin polyclonal antibody prepared in a laboratory by 1:1000, 100. mu.L per well, 1.5h at 37 ℃ and 4 washes with PBST. 100 μ LHRP-labeled goat anti-mouse (1: 5000) was added to each well, incubated at 37 ℃ for 45-60 min, and washed 4 times with PBST. Then adding 100 mu L of freshly prepared OPD (o-phenylenediamine) color developing solution, and developing for 10-30 min at room temperature in a dark place. The reaction was terminated by adding 50. mu.L of 2M sulfuric acid to each reaction well. The OD value is measured by the wavelength at 492nm on a microplate reader, the OD value of each well is measured after the blank control well is zeroed, and the positive is determined by the P/N value (the OD value of the positive well minus the OD value of the blank control well/the OD value of the negative well) being more than or equal to 2.1.
And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the PPRV HA-Ferritin gene expression product can reach 1: 128.
TABLE 2 ELISA Titers of PPRV HA-Ferritin original sequence expression products
| Group of | Potency of the drug |
| PPRV HA-Ferritin | 1：128 |
| Silkworm blood sample infected with parental virus (negative control) | 1：4 |
Example 2PPRV HA-Ferritin original sequence homology sequence design and optimized nanoparticle vaccine preparation and efficacy detection
1 arrangement of solutions and culture media
The specific solution and culture medium preparation method is shown in example 1.
2 genes of PPRV hemagglutinin protein isogenic sequence and optimized gene acquisition
The invention compares the original amino acid sequence (AJE30413) of the PPRV hemagglutinin protein in the embodiment 1 with the other 20 hemagglutinin amino acid sequences obtained from NCBI to obtain a homologous sequence. The isogenic sequence is optimized, and further OptimumGene is utilizedTMThe technology optimizes the amino acid sequence of PPRV hemagglutinin protein, modifies the amino acid sequence of the optimized hemagglutinin protein amino acid sequence and ferritin monomer subunit amino acid sequence according to the preference of silkworm codons, optimizes and designs various related parameters which influence the gene transcription efficiency, the translation efficiency, the GC content of protein folding, the CpG dinucleotide content, the codon preference, the secondary structure of mRNA, the stability of mRNA free energy, the RNA instability gene sequence, the repetitive sequence and the like, and keeps the finally translated protein sequence unchanged. The homologous sequence is named PPRV HA-Ferritin-C (SEQ ID NO.2), the optimized homologous sequence is named PPRV HA-Ferritin-C-O, and the nucleotide sequence is shown in SEQ ID NO. 3; see example 1 for a specific optimization procedure.
3 plasmid construction of fusion proteins
See example 1 for a specific experimental procedure.
PPRV HA-Ferritin-C fusion PCR primer:
F5：5‘-GTCCCACCATCGGGCGCACCATGTCTGCTCAAAGAGA-3’
R5：5’-TTGATGATGTCGCCACCGGA CACAGGATTACAAGTGACTT-3’
ferritin PCR primers:
F6:5’-AAGTCACTTGTAATCCTGTG TCCGGTGGCGACATCATCAAGCTG-3’
R6：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
Over-lapPCR primers:
F5:5‘-GTCCCACCATCGGGCGCACCATGTCTGCTCAAAGAGA-3’
R6：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
PPRV HA-Ferritin-C-O fusion PCR primer:
F7:5’-GTCCCACCATCGGGCGCAACATGAGCGCGCAGCGTGAACG-3’
R7:5’-TTGATGATGTCGCCACCGGACACCGGGTTGCAGGTAACCT-3’
ferritin PCR primers:
F8：5’-AGGTTACCTGCAACCCGGTGTCCGGTGGCGACATCATCAAGCTG-3’
R8：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
Over-lapPCR primers:
F7：5’-ACCGTCCCACCATCGGGCGCAACATGAGCGCGCAGCGTGAACG-3’
R8：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
4 recombinant plasmids pVL1393-PPRV HA-Ferritin-C and pVL1393-PPRV-HA-Ferritin-C-O are expressed and purified in a silkworm expression system
See example 1 for a specific experimental procedure.
5Western blotting detection
See example 1 for a specific experimental procedure.
6 hemagglutination assay
See example 1 for a specific experimental procedure.
7 results identification
And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the PPRV HA-Ferritin-C-O gene expression product can reach 1: 512. as can be seen from the results in tables 3 and 4, the expression level of the codon-optimized consensus sequence was greatly improved, indicating that the modification and optimization work of this example was successful.
TABLE 3 hemagglutination titers of PPRV HA-Ferritin-C and PPRV HA-Ferritin-C-O gene expression products
| Group of | Potency of the drug |
| PPRV HA-Ferritin | 1：256 |
| PPRV HA-Ferritin-C | 1：512 |
| PPRV HA-Ferritin-C-O | 1：1024 |
TABLE 4 ELISA Titers of PPRV HA-Ferritin-C and PPRV HA-Ferritin-C-O Gene expression products
Example 3 preparation and potency assay of nanoparticle vaccine with transmembrane region removed by PPRV HA-Ferritin optimized consensus sequence design
1 arrangement of solutions and culture media
The specific solution and culture medium preparation method is shown in example 1.
2 Peste des petits ruminants virus hemagglutinin protein isogenic sequence transmembrane region
The invention analyzes the optimized homologous sequence of the hemagglutinin protein of the peste des petits ruminants virus in the embodiment 2 by transmembrane domain analysis software (TMHMM), finds that the 36-58 sites in the sequence are transmembrane regions, the rest are extracellular domains and 586 amino acids, in order to improve the expression level, the transmembrane regions are removed, and the sequence is named PPRV HA-Ferritin-C-O-T (the amino acid sequence of which is shown in SEQ ID No. 4), and the specific optimization process is shown in the embodiment 1.
3 plasmid construction of fusion proteins
See example 1 for a specific experimental procedure.
PPRV HA-Ferritin-C-O-T primer:
F9:5’-ACCGTCCCACCATCGGGCGCAACATGAGCGCGCAGCGTGAACG-3’
R9:5’-TTGATGATGTCGCCACCGGACACCGGGTTGCAGGTAACCT-3’
ferritin PCR primers:
F10：5’-AGGTTACCTGCAACCCGGTGTCCGGTGGCGACATCATCAAGCTG-3’
R10：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
Over-lapPCR primers:
F9:5’-ACCGTCCCACCATCGGGCGCAACATGAGCGCGCAGCGTGAACG-3’
R10：5’-GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG-3’
4 recombinant plasmid pVL1393-PPRV HA-Ferritin-C-O-T is expressed and purified in a silkworm expression system
See example 1 for a specific experimental procedure.
5Western blotting detection
See example 1 for a specific experimental procedure.
6 hemagglutination assay
See example 1 for a specific experimental procedure.
7 results identification
And (3) judging an ELISA result: the positive result is that the P/N value (the OD value of the positive hole minus the OD value of the blank control hole/the OD value of the negative hole) is more than or equal to 2.1, and the result shows that the ELISA titer of the PPRV HA-Ferritin-C-O-T gene expression product can reach 1: 1024. as is clear from the results in tables 5 and 6, the expression level was greatly improved by removing the transmembrane region, indicating that the modification of this example was successful.
TABLE 5 hemagglutination titer of PPRV HA-Ferritin-C-O-T Gene expression product
| Group of | Potency of the drug |
| PPRV HA-Ferritin-C-O | 1：1024 |
| PPRV HA-Ferritin-C-O-T | 1：2560 |
TABLE 6PPRV HA-Ferritin-C-O-T expression product ELISA Titers
| Group of | Potency of the drug |
| PPRV HA-Ferritin-C-O | 1：512 |
| PPRV HA-Ferritin-C-O-T | 1:1024 |
| Silkworm blood sample infected with parental virus (negative control) | 1：4 |
Example 4 preparation and potency assay of amino acid Single-site and Multi-site mutated nanoparticle vaccines with PPRV HA-Ferritin-C-O-T mutants
Construction of 1PPRV HA-Ferritin-C-O-T amino acid sequence single site mutant and multi-site mutant gene
Based on the result of example 3, the PPRV HA-Ferritin-C-O-T mutant is obtained, the gene sequence of the PPRV HA-Ferritin-C-0-T mutant after codon optimization is taken as a template, a plurality of pairs of primers are designed to carry out site-directed mutagenesis on the conserved sequence, the site-directed mutagenesis is carried out by utilizing a fusion PCR method, and the fusion PCR method is shown in example 1.
The mutation sites are PPRV: L57R, I140H, P147Q, L157R, V170S, V196Q, L204T, W212E, L223H, L276H, P295Q, L308S, V323K, V349R, L359S. The obtained mutant is named PPRV HA-Ferritin-C-O-T-M (L57R, I140H, P147Q, L157R, V170S, V196Q, L204T, W212E, L223H, L276H, P295Q, L308S, V323K, V349R and L359S).
On the basis of single-site mutation, the invention carries out multi-site mutation, and the mutation sites are PPRV: I140H-V196Q-V170S, I140H-L223H-V196Q, V170S-V196Q-L276H, L223H-V196Q-V323K and L223H-L276H-V323K. The obtained mutant is named as PPRV HA-Ferritin-C-O-T-M3(I140H-V196Q-V170S、I140H-L223H-V196Q、V170S-V196Q-L276H、L223H-V196Q-V323K、L223H-L276H-V323K)。
PPRV-HA-Ferritin-C-O-T-M3Expressing in silkworm eukaryotic expression system and AcMNPV-insect cell expression system.
Carrying out amino acid single-site mutation on PPRV HA-Ferritin-C-O-T by using the following primers:
PPRV HA-Ferritin-C-O-T-M
(1) primers for upstream and downstream on both sides:
F：ACCGTCCCACCATCGGGCGCAACATGAGCGCGCAGCGTGAACG
R：GATCTGCAGCGGCCGCTCCGTTAGCTCTTGCGGGACTTGG
(2) middle upstream and downstream primers:
1.
F：GAACACCAACATCAAGCGCACCGAAAGCATTGA
R：TCAATGCTTTCGGTGCGCTTGATGTTGGTGTTC
2.
F：GGCGGCGGTTAAAAGCCACGAGCACATTTTCGAA
R：TTCGAAAATGTGCTCGTGGCTTTTAACCGCCGCC
3.
F：GCACATTTTCGAAAGCCAACTGAACAAAAGCAA
R：TTGCTTTTGTTCAGTTGGCTTTCGAAAATGTGC
4.
F：CAAGAAACTGCAGAGCCGCACCCTGGGTCCGGGT
R：ACCCGGACCCAGGGTGCGGCTCTGCAGTTTCTTG
5.
F：TTGCCTGGGTCGTACCTCAACCCGTGCGCACTTT
R：AAAGTGCGCACGGGTTGAGGTACGACCCAGGCAA
6.
F：GCACAACGTTAGCAGCCAATTCACCGTGGTTGAG
R：CTCAACCACGGTGAATTGGCTGCTAACGTTGTGC
7.
F：CGTGGTTGAGGAAGGTACATTTGGCCGTACCTAC
R：GTAGGTACGGCCAAATGTACCTTCCTCAACCACG
8.
F：CCGTACCTACACCGTTGAACGTAGCGATGCGCGT
R：ACGCGCATCGCTACGTTCAACGGTGTAGGTACGG
9.
F：TGACCCGAGCACCGATCACGGCATCGGTCACTTC
R：GAAGTGACCGATGCCGTGATCGGTGCTCGGGTCA
10.
F：GCTGAAACTGACCGCGCATTGCACCAGCAGCGAGA
R：TCTCGCTGCTGGTGCAATGCGCGGTCAGTTTCAGC
11.
F：TGTGCCGCGTCGTGAACAGCTGGTTGTGGTTATT
R：AATAACCACAACCAGCTGTTCACGACGCGGCACA
12.
F：TGGCGGGTCCGACCTCAGGTGGCGAGCTGTA
R：TACAGCTCGCCACCTGAGGTCGGACCCGCCA
13.
F:ACCAGCGACCTGATGAAAGAAAAGCTGTATCT
R:AGATACAGCTTTTCTTTCATCAGGTCGCTGGT
14.
F:GTGCCGAGCACCGATCGACGTGACCTGCAGAA
R:TTCTGCAGGTCACGTCGATCGGTGCTCGGCAC
15.
F:ACAAGGGCGAGTGCTCGGTGGAAGCGTGCAA
R:TTGCACGCTTCCACCGAGCACTCGCCCTTGT
2PPRV HA-Ferritin-C-O-T-M and PPRV HA-Ferritin-C-O-T-M3Plasmid construction of mutants
See example 1 for a specific experimental procedure.
3 transformation and identification of recombinant plasmids
See example 1 for a specific experimental procedure.
4 the recombinant plasmid is expressed and purified in a silkworm expression system and an AcMNPV-insect cell expression system
See example 1 for a specific experimental procedure. In addition, construction and preparation of AcBacmid DNA: the preparation method comprises the following steps of (Zhangyifang, Lianecdotal, Yi yong bamboo, and the like, an insect bioreactor for expressing multiple exogenous genes, a construction method and application thereof [ P ]. China: CN102286534A, 2011.).
Identification and expression of recombinant virus rAcBacmid in insect cells: exogenous gene integration was analyzed by PCR. Extracting virus genome DNA. Taking 1 mu L of the virus genome DNA for PCR amplification, taking 15 mu L of reaction product for electrophoretic analysis, and the result proves that the recombinant virus rAcBacmid-PPRV HA-Ferritin-C-O-T-M is obtained3. The recombinant virus rAcBacmid-PPRV HA-Ferritin-C-O-T-M3Culture solution according to 106-7pfu was infected with 100 ml insect cells, and after 96 hours infected cells were harvested and frozen at-20 ℃ for ELISA detection.
5 identification of results
Determination standard of ELISA results: positive results were obtained when the P/N value (OD value of positive well minus OD value of blank well/OD value of negative well) was greater than or equal to 2.1, and the highest ELISA value for single mutants was about 3200. The highest ELISA value for the multiple mutants was around 4096.
As can be seen from the data in tables 7 and 8, the amino acid single-site mutation is carried out on the basis of the optimized homologous sequence without the transmembrane region, and the expression level of the expression products of six single mutants (I140H, V170S, V196Q, L223H, L276H and V323K) is obviously improved compared with the expression level of the homologous sequence without the transmembrane region, wherein the expression level of one mutant (V196Q) is the highest and reaches 4096. Multiple site mutation is carried out on the basis of single mutation to obtain 6 multiple mutants (I140H-V196Q-V170S, I140H-L223H-V196Q, V170S-V196Q-L276H, L223H-V196Q-V323K, L223H-L276H-V323K), wherein the expression level of one multiple mutant (V170S-V196Q-L276H) is the highest and reaches 5120.
TABLE 7 PPRV HA-Ferritin-C-O-T-M and PPRV HA-Ferritin-C-O-T-M3Hemagglutination titer of mutant expression product
| Group of | Potency of the drug |
| PPRV HA-Ferritin-C-O-T | 1：2560 |
| PPRV HA-Ferritin-C-O-T-L57R | 1：1024 |
| PPRV HA-Ferritin-C-O-T-I140H | 1：3200 |
| PPRV HA-Ferritin-C-O-T-P147Q | 1：512 |
| PPRV HA-Ferritin-C-O-T-L157R | 1：1024 |
| PPRV HA-Ferritin-C-O-T-V170S | 1：3200 |
| PPRV HA-Ferritin-C-O-T-V196Q | 1：4096 |
| PPRV HA-Ferritin-C-O-T-L204T | 1：512 |
| PPRV HA-Ferritin-C-O-T-W212E | 1：1024 |
| PPRV HA-Ferritin-C-O-T-L223H | 1：3200 |
| PPRV HA-Ferritin-C-O-T-L276H | 1：3200 |
| PPRV HA-Ferritin-C-O-T-P295Q | 1：800 |
| PPRV HA-Ferritin-C-O-T-L308S | 1：1024 |
| PPRV HA-Ferritin-C-O-T-V323K | 1：3200 |
| PPRV HA-Ferritin-C-O-T-V349R | 1：512 |
| PPRV HA-Ferritin-C-O-T-L359S | 1：800 |
| PPRV HA-Ferritin-C-O-T-I140H-V196Q-V170S | 1：2048 |
| PPRV HA-Ferritin-C-O-T-I140H-L223H-V196Q | 1：4096 |
| PPRV HA-Ferritin-C-O-T-V170S-V196Q-L276H | 1：5120 |
| PPRV HA-Ferritin-C-O-T-L223H-V196Q-V323K | 1：3200 |
| PPRV HA-Ferritin-C-O-T-L223H-L276H-V323K | 1：1024 |
| AcPPRV HA-Ferritin-C-O-T-V170S-V196Q-L276H | 1：3200 |
TABLE 8 PPRV HA-Ferritin-C-O-T-M and PPRV HA-Ferritin-C-O-T-M3ELISA titers of mutant expression products
6Western blotting detection
See example 1 for a specific experimental procedure. Western blotting results showed that a specific band of 82kDa (PPRV HA-Ferritin) size was detectable in the supernatant of silkworm hemolymph samples after recombinant virus infection (see FIG. 3).
7 Electron microscopy
A1 mL syringe was used to aspirate a quantity of 1% uranium acetate for use, and another syringe was used to aspirate a quantity of distilled water. PPRV HA-Ferritin-C-O-T-M3After preliminary purification of the nano-particle silkworm hemolymph, diluting the nano-particle silkworm hemolymph by using a suspension, dripping a suspended sample on a sealing film to form a small liquid bead, clamping a carrying net by using a forceps tip, enabling one surface with the film to face downwards, dipping the sample, then sucking the sample by using filter paper, washing off redundant suspended matters, and washing for 5 times. After the drying, the carrying net is placed on the liquid drop of the 1% uranium acetate dye solution for dyeing for 3 minutes, the filter paper is used for sucking the redundant dye solution from the edge of the copper net, the process is repeated for 2-3 times, and after the drying, the microscopic examination is carried out, and the microscopic examination result is shown in figure 4.
Example 5 pVLCAG-PPRV HA-Ferritin-C-O-T-M3Construction of recombinant virus for baculovirus mammalian expression and animal experiment
1 construction of pVLCAG vector
Specific experimental methods were performed with reference to the method of expressing an exogenous gene in animal cells or animal tissues [ P ]. china: ZL 201210408558.4 ], by zhangshihan, yabin, anecdotal et al, to construct recombinant baculovirus transfer vectors that present the exogenous gene in vertebrate cells or individuals.
2 construction of recombinant viruses presenting reporter genes
2.1 PPRV HA-Ferritin-C-O-T-M3Cloning of genes into Gene presenting transfer vectors
PPRV HA-Ferritin-C-O-T-M with enzyme cutting site in example 43The gene fragment is cut by enzyme, recovered and connected to a pVLCAG vector treated by the same enzyme, and pVLCAG-PPRV HA-Ferritin-C-O-T-M is obtained after correct identification3。
2.2 construction of recombinant viruses for Gene presentation and preparation thereof in Large quantities
Respectively using pVLCAG-PPRV HA-Ferritin-C-O-T-M3The transfer vector uses rebmBac to co-transfect BmN cells to obtain recombinant virus Bm-CAG PPRV HA-Ferritin-C-O-T-M3The pVL1393-Luc was still required as a control during the co-transfection procedure to determine the success of the co-transfection and the virus purification procedure was as above.
Infecting larva of 5-instar silkworm with recombinant virus for 4-5 daysThe silkworm hemolymph is harvested and contains a large amount of the amplified recombinant virus. Silkworm hemolymph was diluted with PBS and sonicated (10 s.times.10 times), and then centrifuged at 12000rpm for 10 minutes to remove cell debris, followed by 15X 104g centrifuging for 3h, removing supernatant, and resuspending the precipitate with appropriate amount of PBS to obtain virus particles of primarily purified recombinant baculovirus, wherein the recombinant virus of 10mL silkworm blood is resuspended with 2mL PBS after centrifugation, and the amount of the recombinant virus after resuspension is about 2.5 × 1012PFU/mL (about 5X 10)12viral genes (vg)/mL, viral copy number was calculated by fluorescent quantitative PCR using BmNPV viral DNA backbone sequence primers, GJ-1F (CGAACGGAGACGATGGATGGATGGGATC) and GJ-1R (GTGCCGAGCGATTGTAAGGGATC).
3 expression of recombinant viruses in mammalian cells
Recombinant virus Bm-CAG PPRV HA-Ferritin-C-O-T-M was targeted for gene presentation using VERO cells3100MOI of each virus was taken for study. The method comprises the following steps:
1) six well plates were seeded with VERO cells (1X 10)6cell/well), adherent culture at 37 ℃ for 8-12h
2) Take 1X 108PFU purified recombinant virus Bm-CAG PPRV HA-Ferritin-C-O-T-M3Adding into six-well plate cells, and incubating at 37 deg.C for 1h
3) And (3) removing a culture medium containing viruses after incubation, replacing a normal DMEM serum-containing culture medium, treating cells for about 42 hours, collecting an expression product, and detecting the titer of hemagglutination 1: 600.
4 animal test
4.1 PPRV HA-Ferritin-C-O-T-M3Expression product immunization of animals
The optimal sequence PPRV HA-Ferritin-C-O-T-M obtained by analysis3Expressing the obtained silkworm pupa in a silkworm eukaryotic expression system according to the formula 29-10Animals were injected with HA units/mouse to prepare 50 parts per g of pupa vaccine. The preparation method comprises the following steps: respectively weighing 10g of expression PPRV HA-Ferritin-C-O-T-M3Adding 90mL PBS buffer solution into silkworm pupas with nano-particle antigens, stirring for 5-10 min by a stirrer to fully mix the solution uniformly, preparing a mother solution, and putting the mother solution into a sterilization bottle. The 206 adjuvant is sterilized in advance and then is put into a 30 ℃ incubator for heat preservation. An appropriate amount of the mother liquor is put on ice and adjusted, when the mother liquor is mixed with the adjuvant, 3mL of the adjuvant is added into a 15mL centrifuge tube, 3mL of the mother liquor is slowly dropped, and the homogenate is carried out for 3min by a homogenizer. Ciprofloxacin hydrochloride was added. The vaccine is milk white, a small amount of the vaccine can be taken out when the quality of the vaccine is detected, the vaccine is centrifuged at 3000rpm for 15min, and the vaccine is qualified if the vaccine is not layered. The same method is used to treat healthy pupa Bombycis to obtain vaccine as control.
The optimal sequence PPRV HA-Ferritin-C-O-T-M obtained by analysis3Expressing the resulting cell pellet in an AcBacmid-insect cell eukaryotic expression system, according to 29-10Animals were injected with HA units/volume.
The preparation method comprises the following steps: the antigen expressed by insect cells is prepared by mixing corresponding adjuvant after the cell precipitation amount of hemagglutination unit required by the vaccine preparation is determined and is broken by ultrasonic.
After 40 SPF mice are taken and adaptively raised for one week, the SPF mice are randomly divided into 4 groups, 10 mice in each group are injected with PPRV HA-Ferritin-C-O-T-M through the tail part respectively31 part (0.2mL) of vaccine prepared by expressing the product in a silkworm eukaryotic expression system and 1 part of vaccine prepared by expressing the product in an AcBacmid-insect cell eukaryotic expression system. The vaccine prepared by inoculating 10 healthy silkworm pupas is used as a negative silkworm pupa immune group, 10 silkworm pupas are used as a normal control group without immune treatment, and 10 silkworm pupas are inoculated with a traditional vaccine strain and used as a negative control. After 15 days of inoculation, blood is collected from the orbit, about 1mL of blood is collected, the blood is placed in a test tube in an inclined mode, the test tube is placed at 37 ℃ for 2 hours, and then the test tube is turned to the room temperature to be overnight. Transferring the serum into a centrifuge tube for 2000rpmin and 10min, collecting the serum, and measuring the HI antibody by using the prokaryotic protein pET-28a-PPRV HA-Ferritin as an antigen. HI titers in the negative silkworm pupa immunization group should not be higher than 1: 4, HI titer of the traditional vaccine strain is 1: 64, and PPRV HA-Ferritin-C-O-T-M3HI titers of the expression sample set in the silkworm eukaryotic expression system were 1: more than 256 PPRV HA-Ferritin-C-O-T-M3HI titers for the expression sample set in AcMNPV-insect cell expression system were 1: above 128. The results are shown in Table 10.
4.2 presentation of PPRV HA-Ferritin-C-O-T-M to mice Using recombinant viruses3Gene
PurifiedRecombinant virus Bm-CAG PPRV HA-Ferritin-C-O-T-M3By tail vein injection (1X 10)12vg/mouse) and perfusion (1X 10)13vg/mouse) was administered to mice weighing about 25 g. Mouse serum is collected at 5d, 11d, 17d and 21d respectively, prokaryotic protein pET-28a-PPRV HA-Ferritin is used as a detection target protein, and the antibody titer in the serum is determined. The results are shown in Table 9.
5 antibody potency detection
See above for the specific experimental procedures, the antibody titer was highest at day 21, and the specific results are shown in table 9. As can be seen from the data in Table 9, PPRV HA-Ferritin-C-O-T-M3The antibody titers produced in mice presented were higher than those of healthy silkworm pupa controls and traditional vaccines.
TABLE 9 PPRV HA-Ferritin-C-O-T-M3Mouse serum antibody titer test (21 days)
6 hemagglutination inhibition
The specific procedure is shown in example 1, and the best results are 21 days, and the results are shown in Table 10. As can be seen from the data in Table 10, PPRV HA-Ferritin-C-O-T-M3The antibody titers produced in mice presented were higher than those of healthy silkworm pupa controls and traditional vaccines.
TABLE 10 PPRV HA-Ferritin-C-O-T-M3Blood coagulation inhibition titer of mouse serum
| Composition of | Potency of the drug |
| Healthy silkworm control (mouse) | 1：4 |
| Traditional vaccine (mouse) | 1：64 |
| PPRV HA-Ferritin-C-O-T-M3Mouse serum | 1：256 |
| AcPPRV HA-Ferritin-C-O-T-M3Mouse serum | 1：128 |
SEQUENCE LISTING
<110> institute of biotechnology of Chinese academy of agricultural sciences
<120> self-assembly ferritin-based nano antigen particle, Peste des petits ruminants vaccine, and preparation method and application thereof
<130> BJ-2002-190724A
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 775
<212> PRT
<213> Artifical sequence
<400> 1
Met Ser Ala Gln Arg Glu Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro
1 5 10 15
His Asn Lys Asn His Arg Val Ile Leu Asp Arg Glu Arg Leu Val Ile
20 25 30
Glu Arg Pro Tyr Ile Leu Leu Gly Val Leu Leu Val Met Phe Leu Ser
35 40 45
Leu Ile Gly Leu Leu Ala Ile Ala Gly Ile Arg Leu His Arg Ala Thr
50 55 60
Val Gly Thr Ser Glu Ile Gln Ser Arg Leu Asn Thr Asn Ile Lys Leu
65 70 75 80
Thr Glu Ser Ile Asp His Gln Thr Lys Asp Val Leu Thr Pro Leu Phe
85 90 95
Lys Ile Ile Gly Asp Glu Val Gly Ile Arg Ile Pro Gln Lys Phe Ser
100 105 110
Asp Leu Val Lys Phe Ile Ser Asp Lys Ile Lys Phe Leu Asn Pro Asp
115 120 125
Arg Glu Tyr Asp Phe Arg Asp Leu Arg Trp Cys Met Asn Pro Pro Glu
130 135 140
Arg Val Lys Ile Asn Phe Asp Gln Phe Cys Glu Tyr Lys Ala Ala Val
145 150 155 160
Lys Ser Ile Glu His Ile Phe Glu Ser Pro Leu Asn Lys Ser Lys Lys
165 170 175
Leu Gln Ser Leu Thr Leu Gly Pro Gly Thr Gly Cys Leu Gly Arg Thr
180 185 190
Val Thr Arg Ala His Phe Ser Glu Leu Thr Met Thr Leu Met Asp Leu
195 200 205
Asp Leu Glu Met Lys His Asn Val Ser Ser Val Phe Thr Val Val Glu
210 215 220
Glu Gly Leu Phe Gly Arg Thr Tyr Thr Val Trp Arg Ser Asp Ala Arg
225 230 235 240
Asp Pro Ser Thr Asp Leu Gly Ile Gly His Phe Leu Arg Val Phe Glu
245 250 255
Ile Gly Leu Val Arg Asp Leu Gly Leu Gly Pro Pro Val Phe His Met
260 265 270
Thr Asn Tyr Leu Thr Val Asn Met Ser Asp Asp Tyr Arg Arg Cys Leu
275 280 285
Leu Ala Val Gly Glu Leu Lys Leu Thr Ala Leu Cys Thr Ser Ser Glu
290 295 300
Thr Val Thr Leu Ser Glu Arg Gly Val Pro Arg Arg Glu Pro Leu Val
305 310 315 320
Val Val Ile Leu Asn Leu Ala Gly Pro Thr Leu Gly Gly Glu Leu Tyr
325 330 335
Ser Val Leu Pro Thr Ser Asp Leu Met Val Glu Lys Leu Tyr Leu Ser
340 345 350
Ser His Arg Gly Ile Ile Lys Asp Asp Glu Ala Asn Trp Val Val Pro
355 360 365
Ser Thr Asp Val Arg Asp Leu Gln Asn Lys Gly Glu Cys Leu Val Glu
370 375 380
Ala Cys Lys Thr Arg Pro Pro Ser Phe Cys Asn Gly Thr Gly Ser Gly
385 390 395 400
Pro Trp Ser Glu Gly Arg Ile Pro Ala Tyr Gly Val Ile Arg Val Ser
405 410 415
Leu Asp Leu Ala Ser Asp Pro Asp Val Val Ile Thr Ser Val Phe Gly
420 425 430
Pro Leu Ile Pro His Leu Ser Gly Met Asp Leu Tyr Asn Asn Pro Phe
435 440 445
Ser Lys Ala Val Trp Leu Ala Val Pro Pro Tyr Glu Gln Ser Phe Leu
450 455 460
Gly Met Ile Asn Thr Ile Gly Phe Pro Asn Arg Ala Glu Val Met Pro
465 470 475 480
His Ile Leu Thr Thr Glu Ile Arg Gly Pro Arg Gly Arg Cys His Val
485 490 495
Pro Ile Glu Leu Ser Arg Arg Val Asp Asp Asp Ile Lys Ile Gly Ser
500 505 510
Asn Met Val Ile Leu Pro Thr Met Asp Leu Arg Tyr Ile Thr Ala Thr
515 520 525
Tyr Asp Val Ser Arg Ser Glu His Ala Ile Val Tyr Tyr Ile Tyr Asp
530 535 540
Thr Ser Arg Ser Ser Ser Tyr Phe Tyr Pro Val Arg Leu Asn Phe Lys
545 550 555 560
Gly Asn Pro Leu Ser Leu Arg Ile Glu Cys Phe Pro Trp Arg His Lys
565 570 575
Val Trp Cys Tyr His Asp Cys Leu Ile Tyr Asn Thr Ile Thr Gly Glu
580 585 590
Glu Val His Thr Arg Gly Leu Thr Gly Ile Glu Val Thr Cys Asn Pro
595 600 605
Val Ser Gly Gly Asp Ile Ile Lys Leu Leu Asn Glu Gln Val Asn Lys
610 615 620
Glu Met Gln Ser Ser Asn Leu Tyr Met Ser Met Ser Ser Trp Cys Tyr
625 630 635 640
Thr His Ser Leu Asp Gly Ala Gly Leu Phe Leu Phe Asp His Ala Ala
645 650 655
Glu Glu Tyr Glu His Ala Lys Lys Leu Ile Ile Phe Leu Asn Glu Asn
660 665 670
Asn Val Pro Val Gln Leu Thr Ser Ile Ser Ala Pro Glu His Lys Phe
675 680 685
Glu Gly Leu Thr Gln Ile Phe Gln Lys Ala Tyr Glu His Glu Gln His
690 695 700
Ile Ser Glu Ser Ile Asn Asn Ile Val Asp His Ala Ile Lys Ser Lys
705 710 715 720
Asp His Ala Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln His
725 730 735
Glu Glu Glu Val Leu Phe Lys Asp Ile Leu Asp Lys Ile Glu Leu Ile
740 745 750
Gly Asn Glu Asn His Gly Leu Tyr Leu Ala Asp Gln Tyr Val Lys Gly
755 760 765
Ile Ala Lys Ser Arg Lys Ser
770 775
<210> 2
<211> 2331
<212> DNA
<213> Artifical sequence
<400> 2
accatgtctg ctcaaagaga aagaattaac gccttctaca aagataatcc ccacaacaag 60
aatcacagag tcatactcga cagagaaaga ctggtgatag aaagacctta catcctgttg 120
ggcgtgctcc tggttatgtt cctctctctg atcggcttgc tcgctatagc cggtatcaga 180
ctgcacagag ctaccgtggg tacaagtgaa atccaatcaa gactgaacac taacatcaaa 240
ttgaccgaaa gcattgatca ccagacaaaa gacgtcctca ctcccctgtt caagatcatt 300
ggtgatgaag tgggaattag aatacctcag aaattctcag acctggttaa gttcatctct 360
gacaagatca agttcttgaa cccagataga gaatacgatt tcagagacct cagatggtgc 420
atgaaccctc cagaaagagt caaaatcaat ttcgaccaat tctgtgaata caaagctgcc 480
gtgaagtcca ttgaacacat attcgaatcc ccactcaaca agtctaaaaa actgcaatcc 540
ctgaccctcg gaccaggtac aggatgcctc ggcagaaccg tcacaagagc tcacttctcg 600
gaattgacta tgaccctcat ggatctggac ttggaaatga aacacaatgt ctcatctgtg 660
ttcaccgtgg ttgaagaagg tttgttcgga agaacataca ctgtgtggag atcggatgcc 720
agagacccga gtacagattt gggcatcggt cacttcctca gagttttcga aattggtctc 780
gtcagagacc tcggactggg accaccagtt ttccacatga ctaactacct gaccgtcaat 840
atgagtgacg attacagaag atgcctgttg gctgtgggag aattgaagct cacagccctc 900
tgtactagct ccgaaaccgt gacactgtca gaaagaggag ttccgagaag agaacccctg 960
gtcgtggtta ttctgaactt ggctggccca acactgggtg gagaattgta ctcagttctc 1020
ccgacttctg acttgatggt cgaaaaactc tacctgtcga gtcacagagg tataatcaag 1080
gacgatgaag ctaactgggt cgtgccttcc accgatgtga gagacctgca aaataaagga 1140
gaatgcttgg ttgaagcctg taagactaga cctccatcgt tctgcaatgg tacaggatct 1200
ggcccttgga gcgaaggaag aataccagct tacggcgtta tcagagtcag cttggatctc 1260
gcctccgatc cagacgttgt cattacaagc gttttcggcc ctctgatacc acacttgtcc 1320
ggtatggacc tgtacaacaa tccgttctcg aaagctgtgt ggttggccgt tccgccctac 1380
gaacagagct tcctcggtat gatcaacact attggattcc cgaatagagc cgaagtgatg 1440
ccccacattt tgacaactga aataagaggc cctagaggta gatgtcacgt gccaatcgaa 1500
ctcagtagaa gagttgacga tgacatcaag attggatcaa acatggttat attgcccact 1560
atggatctca gatacatcac tgctacctac gacgtctcca gatcggaaca cgccattgtg 1620
tactacatat acgatacatc aagatcatca tcatacttct accctgtgag actgaacttc 1680
aaaggaaatc ccctgagctt gagaatagaa tgcttccctt ggagacacaa ggtttggtgc 1740
taccacgact gtctgatcta caacacaatt actggcgaag aagtccacac cagaggattg 1800
acaggcattg aagtcacttg taatcctgtg tccggtggcg acatcatcaa gctgctgaac 1860
gaacaggtga acaaggagat gcagtccagc aacctgtaca tgtctatgtc ttcatggtgc 1920
tacacccact cactggacgg agctggtctg ttcctgttcg accacgctgc cgaggaatac 1980
gaacacgcca agaagctgat catcttcctg aacgagaaca acgtgcctgt ccagctgacc 2040
tccatcagcg ctcccgaaca caagttcgag ggtctgactc aaatcttcca gaaggcctac 2100
gaacacgagc agcacatctc tgaatcaatc aacaacatcg tggaccacgc tatcaagagc 2160
aaggaccacg ccactttcaa cttcctgcaa tggtacgtgg ctgagcagca cgaggaagag 2220
gtcctgttca aggacatcct ggacaagatc gaactgatcg gcaacgagaa ccacggactg 2280
tacctggctg accagtacgt caagggcatc gccaagtccc gcaagagcta a 2331
<210> 3
<211> 2331
<212> DNA
<213> Artifical sequence
<400> 3
accatgagcg cgcagcgtga acgtatcaac gcgttctaca aggataaccc gcacaacaaa 60
aaccaccgtg ttattctgga ccgtgagcgt ctggtgatcg aacgtccgta tattctgctg 120
ggtgttctgc tggtgatgtt tctgagcctg atcggtctgc tggcgatcgc gggcattcgt 180
ctgcatcgtg cgaccgtggg taccagcgag attcagagcc gtctgaacac caacatcaag 240
ctgaccgaaa gcattgatca ccaaaccaag gacgttctga ccccgctgtt caaaatcatt 300
ggtgatgaag tgggcatccg tattccgcaa aagttcagcg atctggttaa gttcatcagc 360
gacaagatca agttcctgaa cccggatcgt gaatacgatt ttcgtgacct gcgttggtgc 420
atgaacccgc cggagcgtgt gaagatcaac ttcgaccagt tttgcgaata taaggcggcg 480
gttaaaagca tcgagcacat tttcgaaagc ccgctgaaca aaagcaagaa actgcagagc 540
ctgaccctgg gtccgggtac cggttgcctg ggtcgtaccg tgacccgtgc gcactttagc 600
gagctgacca tgaccctgat ggatctggac ctggaaatga agcacaacgt tagcagcgtg 660
ttcaccgtgg ttgaggaagg tctgtttggc cgtacctaca ccgtttggcg tagcgatgcg 720
cgtgacccga gcaccgatct gggcatcggt cacttcctgc gtgtttttga gattggtctg 780
gtgcgtgacc tgggtctggg tccgccggtt ttccacatga ccaactacct gaccgtgaac 840
atgagcgacg attatcgtcg ttgcctgctg gcggttggcg agctgaaact gaccgcgctg 900
tgcaccagca gcgagaccgt taccctgagc gaacgtggtg tgccgcgtcg tgaaccgctg 960
gttgtggtta ttctgaacct ggcgggtccg accctgggtg gcgagctgta cagcgttctg 1020
ccgaccagcg acctgatggt ggaaaagctg tatctgagca gccaccgtgg tatcattaaa 1080
gacgatgaag cgaactgggt tgtgccgagc accgatgttc gtgacctgca gaacaagggc 1140
gagtgcctgg tggaagcgtg caaaacccgt ccgccgagct tttgcaacgg taccggtagc 1200
ggtccgtgga gcgagggtcg tatcccggcg tatggtgtta ttcgtgtgag cctggatctg 1260
gcgagcgatc cggacgttgt gatcaccagc gtgttcggtc cgctgattcc gcacctgagc 1320
ggcatggacc tgtacaacaa cccgtttagc aaagcggttt ggctggcggt gccgccgtat 1380
gaacaaagct tcctgggtat gatcaacacc attggctttc cgaaccgtgc ggaagtgatg 1440
ccgcacatcc tgaccaccga aattcgtggt ccgcgtggcc gttgccatgt tccgatcgag 1500
ctgagccgtc gtgtggacga tgacatcaaa attggtagca acatggttat cctgccgacc 1560
atggatctgc gttacattac cgcgacctat gacgttagcc gtagcgagca cgcgatcgtg 1620
tactatattt atgataccag ccgtagcagc agctacttct atccggttcg tctgaacttt 1680
aagggtaacc cgctgagcct gcgtatcgaa tgcttcccgt ggcgtcacaa agtgtggtgc 1740
taccacgact gcctgatcta taacaccatt accggcgagg aagttcacac ccgtggtctg 1800
accggcatcg aggttacctg caacccggtg tccggtggcg acatcatcaa gctgctgaac 1860
gaacaggtga acaaggagat gcagtccagc aacctgtaca tgtctatgtc ttcatggtgc 1920
tacacccact cactggacgg agctggtctg ttcctgttcg accacgctgc cgaggaatac 1980
gaacacgcca agaagctgat catcttcctg aacgagaaca acgtgcctgt ccagctgacc 2040
tccatcagcg ctcccgaaca caagttcgag ggtctgactc aaatcttcca gaaggcctac 2100
gaacacgagc agcacatctc tgaatcaatc aacaacatcg tggaccacgc tatcaagagc 2160
aaggaccacg ccactttcaa cttcctgcaa tggtacgtgg ctgagcagca cgaggaagag 2220
gtcctgttca aggacatcct ggacaagatc gaactgatcg gcaacgagaa ccacggactg 2280
tacctggctg accagtacgt caagggcatc gccaagtccc gcaagagcta a 2331
<210> 4
<211> 752
<212> PRT
<213> Artifical sequence
<400> 4
Met Ser Ala Gln Arg Glu Arg Ile Asn Ala Phe Tyr Lys Asp Asn Pro
1 5 10 15
His Asn Lys Asn His Arg Val Ile Leu Asp Arg Glu Arg Leu Val Ile
20 25 30
Glu Arg Pro Arg Leu His Arg Ala Thr Val Gly Thr Ser Glu Ile Gln
35 40 45
Ser Arg Leu Asn Thr Asn Ile Lys Leu Thr Glu Ser Ile Asp His Gln
50 55 60
Thr Lys Asp Val Leu Thr Pro Leu Phe Lys Ile Ile Gly Asp Glu Val
65 70 75 80
Gly Ile Arg Ile Pro Gln Lys Phe Ser Asp Leu Val Lys Phe Ile Ser
85 90 95
Asp Lys Ile Lys Phe Leu Asn Pro Asp Arg Glu Tyr Asp Phe Arg Asp
100 105 110
Leu Arg Trp Cys Met Asn Pro Pro Glu Arg Val Lys Ile Asn Phe Asp
115 120 125
Gln Phe Cys Glu Tyr Lys Ala Ala Val Lys Ser Ile Glu His Ile Phe
130 135 140
Glu Ser Pro Leu Asn Lys Ser Lys Lys Leu Gln Ser Leu Thr Leu Gly
145 150 155 160
Pro Gly Thr Gly Cys Leu Gly Arg Thr Val Thr Arg Ala His Phe Ser
165 170 175
Glu Leu Thr Met Thr Leu Met Asp Leu Asp Leu Glu Met Lys His Asn
180 185 190
Val Ser Ser Val Phe Thr Val Val Glu Glu Gly Leu Phe Gly Arg Thr
195 200 205
Tyr Thr Val Trp Arg Ser Asp Ala Arg Asp Pro Ser Thr Asp Leu Gly
210 215 220
Ile Gly His Phe Leu Arg Val Phe Glu Ile Gly Leu Val Arg Asp Leu
225 230 235 240
Gly Leu Gly Pro Pro Val Phe His Met Thr Asn Tyr Leu Thr Val Asn
245 250 255
Met Ser Asp Asp Tyr Arg Arg Cys Leu Leu Ala Val Gly Glu Leu Lys
260 265 270
Leu Thr Ala Leu Cys Thr Ser Ser Glu Thr Val Thr Leu Ser Glu Arg
275 280 285
Gly Val Pro Arg Arg Glu Pro Leu Val Val Val Ile Leu Asn Leu Ala
290 295 300
Gly Pro Thr Leu Gly Gly Glu Leu Tyr Ser Val Leu Pro Thr Ser Asp
305 310 315 320
Leu Met Val Glu Lys Leu Tyr Leu Ser Ser His Arg Gly Ile Ile Lys
325 330 335
Asp Asp Glu Ala Asn Trp Val Val Pro Ser Thr Asp Val Arg Asp Leu
340 345 350
Gln Asn Lys Gly Glu Cys Leu Val Glu Ala Cys Lys Thr Arg Pro Pro
355 360 365
Ser Phe Cys Asn Gly Thr Gly Ser Gly Pro Trp Ser Glu Gly Arg Ile
370 375 380
Pro Ala Tyr Gly Val Ile Arg Val Ser Leu Asp Leu Ala Ser Asp Pro
385 390 395 400
Asp Val Val Ile Thr Ser Val Phe Gly Pro Leu Ile Pro His Leu Ser
405 410 415
Gly Met Asp Leu Tyr Asn Asn Pro Phe Ser Lys Ala Val Trp Leu Ala
420 425 430
Val Pro Pro Tyr Glu Gln Ser Phe Leu Gly Met Ile Asn Thr Ile Gly
435 440 445
Phe Pro Asn Arg Ala Glu Val Met Pro His Ile Leu Thr Thr Glu Ile
450 455 460
Arg Gly Pro Arg Gly Arg Cys His Val Pro Ile Glu Leu Ser Arg Arg
465 470 475 480
Val Asp Asp Asp Ile Lys Ile Gly Ser Asn Met Val Ile Leu Pro Thr
485 490 495
Met Asp Leu Arg Tyr Ile Thr Ala Thr Tyr Asp Val Ser Arg Ser Glu
500 505 510
His Ala Ile Val Tyr Tyr Ile Tyr Asp Thr Ser Arg Ser Ser Ser Tyr
515 520 525
Phe Tyr Pro Val Arg Leu Asn Phe Lys Gly Asn Pro Leu Ser Leu Arg
530 535 540
Ile Glu Cys Phe Pro Trp Arg His Lys Val Trp Cys Tyr His Asp Cys
545 550 555 560
Leu Ile Tyr Asn Thr Ile Thr Gly Glu Glu Val His Thr Arg Gly Leu
565 570 575
Thr Gly Ile Glu Val Thr Cys Asn Pro Val Ser Gly Gly Asp Ile Ile
580 585 590
Lys Leu Leu Asn Glu Gln Val Asn Lys Glu Met Gln Ser Ser Asn Leu
595 600 605
Tyr Met Ser Met Ser Ser Trp Cys Tyr Thr His Ser Leu Asp Gly Ala
610 615 620
Gly Leu Phe Leu Phe Asp His Ala Ala Glu Glu Tyr Glu His Ala Lys
625 630 635 640
Lys Leu Ile Ile Phe Leu Asn Glu Asn Asn Val Pro Val Gln Leu Thr
645 650 655
Ser Ile Ser Ala Pro Glu His Lys Phe Glu Gly Leu Thr Gln Ile Phe
660 665 670
Gln Lys Ala Tyr Glu His Glu Gln His Ile Ser Glu Ser Ile Asn Asn
675 680 685
Ile Val Asp His Ala Ile Lys Ser Lys Asp His Ala Thr Phe Asn Phe
690 695 700
Leu Gln Trp Tyr Val Ala Glu Gln His Glu Glu Glu Val Leu Phe Lys
705 710 715 720
Asp Ile Leu Asp Lys Ile Glu Leu Ile Gly Asn Glu Asn His Gly Leu
725 730 735
Tyr Leu Ala Asp Gln Tyr Val Lys Gly Ile Ala Lys Ser Arg Lys Ser
740 745 750
Claims (10)
1. A nano-antigen particle comprising a fusion protein, wherein the fusion protein is obtained by linking the N-terminus of a peste des petits ruminants virus hemagglutinin protein and a monomeric ferritin subunit; preferably, the fusion protein is obtained by connecting the hemagglutinin protein of peste des petits ruminants virus and the N end of the monomeric ferritin subunit through a connecting peptide SGG.
2. The fusion protein-containing nano-antigen particle of claim 1, wherein the monomeric ferritin subunit comprises any one of bacterial ferritin, plant ferritin, algal ferritin, insect ferritin, fungal ferritin, or mammalian ferritin; preferably, the monomeric ferritin subunit is a helicobacter pylori ferritin monomer, and the amino acid sequence of the monomeric ferritin subunit is the amino acid sequence shown in the sequence number WP _ 000949190;
the PPRV hemagglutinin protein of different genetic strains; preferably, the peste des petits ruminants virus hemagglutinin protein is only selected from two parts, namely a transmembrane region and an extracellular domain of the peste des petits ruminants virus hemagglutinin protein; most preferably, the amino acid sequence of the peste des petits ruminants virus hemagglutinin protein is the amino acid sequence shown as the sequence number AJE 30413.
3. The fusion protein of claim 1, wherein the amino acid sequence is shown in SEQ ID No.1, and the nucleotide sequence of the coding gene is shown in SEQ ID No. 2.
4. The optimized gene of the homologous sequence of claim 3, wherein the nucleotide sequence is represented by SEQ ID NO. 3.
5. Mutant of the homologous sequence of the fusion protein according to claim 3, characterized in that its amino acid sequence is represented by SEQ ID No. 4.
6. Single-site mutants of the consensus sequence of the fusion protein of claim 5, characterized by single-site mutants obtained by single-site mutation of the amino acid sequence shown in SEQ ID No.4 in any one of L57R, I140H, P147Q, L157R, V170S, V196Q, L204T, W212E, L223H, L276H, P295Q, L308S, V323K, V349R or L359S; preferably, the single-site mutant is obtained by single-site mutation of the amino acid sequence shown in SEQ ID NO.4 according to any one of I140H, V170S, V196Q, L223H, L276H or V323K; most preferably, the single-site mutant is obtained by single-site mutation of V196Q amino acid after removing the transmembrane region from the amino acid sequence shown in SEQ ID NO. 1.
7. Mutant multi-site variants of the consensus sequence of the fusion protein of claim 5, characterized in that the multi-site mutants obtained by multi-site mutagenesis of the amino acid sequence shown in SEQ ID No.4 according to I140H-V196Q-V170S, I140H-L223H-V196Q, V170S-V196Q-L276H, L223H-V196Q-V323K or L223H-L276H-V323K; preferably, the multi-site mutant is obtained by carrying out multi-site mutation on the amino acid sequence shown in SEQ ID NO.4 according to I140H-L223H-V196Q or V170S-V196Q-L276H; most preferably, the multi-site mutant is obtained by carrying out multi-site mutation on the amino acid sequence shown in SEQ ID NO.4 according to the amino acid sequence V170S-V196Q-L276H.
8. Use of the nano-antigen particle of any one of claims 1 to 3, the optimized gene of claim 4, the mutant of any one of claims 5 to 7 for the preparation of a Peste des petits ruminants vaccine.
9. Use according to claim 8, comprising: expressing the gene encoding the fusion protein according to claim 1, the optimized gene according to claim 4, and the gene encoding the mutant according to any one of claims 5 to 7 in a prokaryotic expression system of Escherichia coli, and collecting and purifying the expressed antigen;
or, the fusion protein encoding gene of claim 1, the optimized gene of claim 4, the mutant encoding gene of any one of claims 5 to 7 is expressed in a silkworm expression system or an AcMNPV-insect cell eukaryotic expression system, and the expressed antigen is collected and purified; preferably, the fusion protein coding gene is cloned into a baculovirus transfer vector to construct a recombinant transfer vector; co-transfecting the recombinant transfer vector and baculovirus DNA into an insect cell to obtain recombinant baculovirus; infecting insect host or cell with recombinant baculovirus, culturing infected insect cell or insect host to express corresponding antigen, and purifying to obtain the recombinant baculovirus;
or cloning the fusion protein encoding gene of claim 1, the optimized gene of claim 4, and the mutant encoding gene of any one of claims 5 to 7 into an expression vector of baculovirus mammal to obtain recombinant baculovirus; recombinant baculoviruses are genetically presented to produce antigens in tissues of vertebrate animals.
10. A peste des petits ruminants vaccine comprising an effective amount of the nano-antigen particle of claims 1-2, the consensus sequence of the fusion protein of claim 3, the mutant of any one of claims 5-7, and a pharmaceutically acceptable adjuvant or carrier.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910716829.4A CN112321718B (en) | 2019-08-05 | 2019-08-05 | Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910716829.4A CN112321718B (en) | 2019-08-05 | 2019-08-05 | Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112321718A true CN112321718A (en) | 2021-02-05 |
| CN112321718B CN112321718B (en) | 2022-06-17 |
Family
ID=74319731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910716829.4A Active CN112321718B (en) | 2019-08-05 | 2019-08-05 | Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112321718B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114230671A (en) * | 2021-11-18 | 2022-03-25 | 中国科学院武汉病毒研究所 | Zika virus recombinant protein vaccine and preparation method thereof |
-
2019
- 2019-08-05 CN CN201910716829.4A patent/CN112321718B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| MASARU KANEKIYO 等: "Self-Assembling Influenza Nanoparticle Vaccines Elicit Broadly Neutralizing H1N1 Antibodies", 《NATURE》 * |
| ZHAO,J. 等: "AJE30413.1", 《GENBANK》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114230671A (en) * | 2021-11-18 | 2022-03-25 | 中国科学院武汉病毒研究所 | Zika virus recombinant protein vaccine and preparation method thereof |
| CN114230671B (en) * | 2021-11-18 | 2023-12-01 | 中国科学院武汉病毒研究所 | Zika virus recombinant protein vaccine and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112321718B (en) | 2022-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112076315B (en) | Nanometer antigen particle fused by novel coronavirus S protein and ferritin subunit, novel coronavirus vaccine, preparation method and application thereof | |
| CN112876570B (en) | African swine fever virus vaccine and preparation method thereof | |
| CN111825768B (en) | Self-assembly ferritin-based nano antigen particle, influenza vaccine and preparation method | |
| CN112439056B (en) | Self-assembly ferritin-based nano antigen particle, O-type foot-and-mouth disease vaccine prepared from same and application | |
| CN107227311B (en) | Recombinant porcine parvovirus-like particle and preparation method and application thereof | |
| CN105695491B (en) | Preparation method of Newcastle disease glycoprotein virus antigen and product thereof | |
| CN107098974A (en) | A kind of fusion protein and its application | |
| CN108101967B (en) | I-group serum 4 type avian adenovirus genetic engineering subunit vaccine, preparation method and application thereof | |
| CN110981968B (en) | Fusion protein containing rabies virus G protein, preparation method, application and vaccine thereof | |
| CN113862284B (en) | Gene, virus-like particle, vaccine and preparation and application for encoding recombinant avian influenza virus HA protein | |
| CN114524862A (en) | Construction and application of avian influenza (H5+ H7) trivalent DNA vaccine | |
| CN112500458B (en) | Novel variant subunit vaccine of chicken infectious bursal disease virus, preparation method and application thereof | |
| CN112321718B (en) | Self-assembly ferritin-based nano antigen particle, peste des petits ruminants vaccine and preparation method and application thereof | |
| KR101919002B1 (en) | Soluble Multi-Epitope Antigen of Foot-and-Mouth Disease Virus and Uses Thereof | |
| CN112111503A (en) | Adenovirus vector bivalent vaccine for simultaneously preventing avian influenza H5 and H9 subtypes and preparation method thereof | |
| CN112442131B (en) | Self-assembly ferritin-based nano antigen particle, infectious bursal disease vaccine prepared from self-assembly ferritin-based nano antigen particle and application of infectious bursal disease vaccine | |
| CN112442130B (en) | Self-assembly ferritin-based nano antigen particle, rabies vaccine prepared from same and application of self-assembly ferritin-based nano antigen particle | |
| CN113827714B (en) | H7N9 subtype avian influenza virus-like particle vaccine preparation, preparation and application | |
| CN106905434A (en) | A kind of recombination fusion protein comprising hoof bat hepatitis B core protein and its preparation method and application | |
| CN112891528B (en) | Vaccine strain for infectious bronchitis | |
| CN112439057B (en) | Self-assembly ferritin nano-antigen particle, swine fever vaccine prepared from same and application of swine fever vaccine | |
| CN112316127B (en) | Self-assembled ferritin nano antigen particles, porcine circovirus vaccine prepared from self-assembled ferritin nano antigen particles and application of porcine circovirus vaccine | |
| CN111349621B (en) | Recombinant baculovirus and application thereof in preparation of newcastle disease virus-like particles | |
| CN107827986B (en) | Pig O/Mya98 and O/PanAsia type foot-and-mouth disease gene engineering inactivated vaccine | |
| CN115160442A (en) | Self-assembly ferritin-based nano antigen particle, influenza vaccine and preparation method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |