CN112301123B

CN112301123B - Kit for detecting 50 genetic disease single gene mutations and probe set used by kit

Info

Publication number: CN112301123B
Application number: CN202011284834.1A
Authority: CN
Inventors: 伍建; 姬晓雯; 王海丽
Original assignee: Beijing Mygenostics Co ltd
Current assignee: Beijing Mygenostics Co ltd
Priority date: 2020-11-17
Filing date: 2020-11-17
Publication date: 2022-08-16
Anticipated expiration: 2040-11-17
Also published as: CN112301123A

Abstract

The invention discloses a kit for detecting single gene mutation of 50 genetic diseases and a probe set used by the kit. The probe set consists of 1059 specific probes, and the nucleotide sequences of the 1059 specific probes are shown as SEQ ID NO: 1 to SEQ ID NO: 1059. The inventor of the invention develops a kit based on a liquid phase capture technology through a large number of experiments, greatly reduces sequencing cost, improves sequencing depth and more accurately discovers the genetic variation information of specific regions of 50 monogenic genetic diseases on the premise of ensuring the accuracy of gene screening. The invention has important application value.

Description

Kit for detecting 50 genetic disease single gene mutations and probe set used by kit

Technical Field

The invention belongs to the field of medicine, and particularly relates to a kit for detecting single gene mutation of 50 genetic diseases and a probe set used by the kit.

Background

Genetic diseases refer to diseases caused by alterations in genetic material, such as mutations in genes or chromosomal malformations. To date, the number of established human monogenic genetic diseases reaches more than 4000, and the total number of diseases is very huge

Research shows that 2.8 genetic disease causing mutations are carried by people, most monogenic genetic diseases are recessive inheritance, healthy parents can carry the same causing mutations, and some conventional prenatal examinations (such as imaging detection, karyotyping and the like) cannot judge the condition of a fetus, so that the carrier is screened before pregnancy or in the early stage of pregnancy, the causing mutation sites carried by the parents are screened out, birth defects are prevented in advance, the risk of the sick children is known in advance, the inheritance of the monogenic disease is fundamentally blocked by means of prenatal consultation, diagnosis and other measures, the birth defects of the born children can be effectively reduced, and the good birth and good care can be realized.

For the detection of monogenic genetic diseases, gene diagnosis can be made under the condition that the molecular level even single base changes, and is considered to be a more accurate and reliable method and means. Compared with the next generation of sequencing technology (NGS), the traditional genetic disease gene diagnosis technology (such as Sanger sequencing, fluorescence in situ hybridization, comparative genome hybridization, gene chip and the like) has the problems of small flux, low speed, low accuracy, high cost and the like. However, NGS itself has problems of huge data volume and complicated analysis of genetic information.

Disclosure of Invention

The invention aims to detect whether a person to be detected or a fetus to be detected has the mutation of 50 genetic disease related single genes.

The invention firstly protects a kit for detecting whether a person to be detected or a fetus to be detected has genetic disease single gene mutation, which comprises a probe group;

the probe set may comprise 1059 specific probes; each specific probe may comprise DNA fragment 2;

the DNA fragment 2 is a part of a mutant gene corresponding to a monogenic genetic disease shown in the following table;

the design principle is as follows: obtaining an exon sequence of a mutant gene related to a monogenic genetic disease shown in the following table, extending 50bp back and forth, extending less than 50bp to 50bp after extension, extracting a reference sequence of each region, removing a sequence of a repeated region, intercepting a 78bp sequence from a first base as a probe, moving n bases backwards again, intercepting a 78bp sequence as a probe until the last 78bp sequence; wherein probes are designed separately for the different snp sites on the SMN1 gene and the SMN2 gene, and the probes are supplemented for the 300bp upstream and downstream regions of each exon of the DMD;

。

the kit may specifically consist of the set of probes.

The probe set specifically comprises 1059 specific probes.

Each specific probe may specifically consist of said DNA fragment 2.

Any of the above-mentioned DNA fragments 2 may be a single-stranded DNA molecule consisting of 60-140 (e.g., 60-80, 80-100, 100-120, 120-140, 60, 80, 100, 120 or 140) nucleotides.

The nucleotide sequence of the DNA fragment 2 of any one of the 1059 specific probes can be shown as SEQ ID NO: 1 from position 16-93 from the 5' end to SEQ ID NO: 1059 is shown at positions 16-93 from the 5' end.

Each specific probe can also comprise a DNA fragment 1 and a DNA fragment 3; the DNA segment 1 is positioned at the 5' end of the DNA segment 2; the DNA segment 3 is located at the 3' end of the DNA segment 2.

Each of the specific probes may specifically consist of the DNA fragment 1, the DNA fragment 2, and the DNA fragment 3.

Any one of the above DNA fragment 1 and any one of the above DNA fragment 3 may be a single-stranded DNA molecule consisting of 10 to 20 (e.g., 10 to 15, 15 to 20, 10, 15, or 20) nucleotides.

Any one of the kits can also comprise a primer pair A; the primer pair A can consist of a primer 1 and a primer 2; the primer 1 comprises the DNA fragment 1; the primer 2 comprises the DNA fragment 3.

Any one of the above kits may specifically consist of the probe set and the primer pair A.

The primer 1 may specifically consist of the DNA fragment 1.

The primer 2 may specifically consist of the DNA fragment 3.

Any of the above primers 1 and/or any of the above primers 2 may have a biotin label.

Any of the above DNA fragments 1 and/or any of the above DNA fragments 3 may have a biotin label.

The nucleotide sequence of any one of the 1059 specific probes can be shown as SEQ ID NO: 1 to SEQ ID NO: 1059.

Any one of the kits described above may further comprise at least one of linker 1, linker 2, primer 3, primer 4, primer 5, and primer 6.

The joint 1 can comprise a DNA fragment a, a DNA fragment b and a DNA fragment c from the 5 'end to the 3' end in sequence; the 3' end of the DNA fragment c may be T.

The linker 1 may specifically consist of the DNA fragment a, the DNA fragment b and the DNA fragment c from the 5 'end to the 3' end.

The adaptor 2 comprises a DNA fragment d and a DNA fragment e from the 5 'end to the 3' end in sequence.

The linker 2 may specifically consist of the DNA fragment d and the DNA fragment e from the 5 'end to the 3' end.

The DNA fragment b and the DNA fragment d both consist of A, T, C and G randomly.

The 5 'end of the DNA fragment e and the 3' end of the DNA fragment a are reversely complementary.

The primer 5 may include the DNA fragment A.

The primer 3 comprises the DNA segment A, DNA segment B and the DNA segment C from the 5 'end to the 3' end in sequence; the 5' ends of the DNA fragment C and the DNA fragment a are completely consistent; the DNA fragment B consisted of A, T, C and G randomly.

The primer 3 may specifically consist of the DNA fragment A, the DNA fragment B and the DNA fragment C from the 5 'end to the 3' end.

The primer 6 comprises the DNA fragment D.

The primer 4 comprises the DNA fragment D, DNA fragment E and the DNA fragment F from the 5 'end to the 3' end in sequence; the 3' ends of the DNA fragment F and the DNA fragment e are completely consistent; the DNA fragment E consisted of A, T, C and G randomly.

The primer 4 may specifically consist of the DNA fragment D, the DNA fragment E and the DNA fragment F from the 5 'end to the 3' end.

The length of the DNA fragment b and the DNA fragment d can be 6-14bp (such as 6-10bp, 10-14bp, 6bp, 10bp or 14 bp).

The DNA fragment A may be 17-25bp (e.g., 17-21bp, 21-25bp, 17bp, 21bp, or 25bp) in length.

The length of the DNA fragment B can be 1-8bp (such as 1-4bp, 4-8bp, 1bp, 4bp or 8 bp).

The DNA fragment D may be 17-25bp (e.g., 17-21bp, 21-25bp, 17bp, 21bp, or 25bp) in length.

The length of the DNA fragment E is 10-25bp (such as 10-17bp, 17-25bp, 10bp, 17bp or 25 bp).

Any of the above primers 4 may further comprise a Barcode tag sequence; the Barcode tag sequence is located upstream, downstream or in the middle of the DNA fragment E.

The 3' end of any of the above linker 1, any of the above primer 5, and any of the above primer 6 may be modified with a thio group.

The 5' end of any of the above linkers 2 may be modified by phosphorylation.

Any one of the above kits may further comprise a carrier carrying a judgment standard A and/or a judgment standard B.

The judgment standard A is used for judging whether the person to be tested has 50 genetic disease single gene mutations;

the judgment standard A can be as follows: obtaining SNP indels of the 50 monogenic genetic disease mutant genes of a person to be detected; counting the condition of mutation sites in each mutant gene;

the steps for obtaining the SNP indels of the testee about 50 monogenic genetic disease mutant genes are as follows:

(K1) preparing a genomic DNA library of a to-be-detected person; the linker for preparing the genomic DNA library of the subject may be any of the above-mentioned

linkers

1 and 2;

(K2) after the step (K1) is finished, hybridizing the genomic DNA library of the testee with the probe set of any one of the kits to obtain a hybridization product;

(K3) after step (K2) is completed, collecting the target sequence from the hybridization product to obtain a target sequence capture library;

(K4) performing high-throughput sequencing on the target sequence capture library obtained in the step (K3) to obtain sequencing original data;

(K5) cutting off an adaptor sequence and low-quality bases from the sequencing original data obtained in the step (K4), filtering, and aligning to a corresponding position of the hg19 of the reference genome;

(K6) after the step (K5) is completed, removing repeated sequences caused by PCR amplification preference to obtain the data of the testee; then analyzing to obtain related information of SNP and INDEL;

(K7) annotating the information obtained in the step (K6), and then screening to obtain the SNP Indel of the person to be tested;

(K8) annotating sites reported by an HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if the SNP Indel of the person to be detected contains any point mutation in 6636 pathogenic mutation sites, the person to be detected carries the mutation site of the corresponding mutant gene; otherwise, the testee does not carry the corresponding gene mutation site.

The "method of judging spinal muscular atrophy due to SMN1 gene mutation" and the "method of judging α thalassemia due to HBA1 gene and HBA2 gene mutation" may be as follows:

(1) counting the coverage of each gene target area, then drawing a graph by taking the position information of each target area site as an abscissa and the corresponding coverage of each position as an ordinate, and carrying out site statistical analysis to obtain a repeated and missing analysis graph through the reading depth of each site;

(2) after the step (1) is completed, obtaining copy values of the SMN1 and SMN2 by calculating absolute copy numbers of target region depths of the test sample, the negative sample SMN1 and the SMN2, and further judging specific copy values of the SMN1 and SMN 2;

(3) comparing the sequencing result with the SMN1 gene and the SMN2 gene in the human genome version Hg19, and calculating the f (Z) value of the SMN1 gene and the f (Z) value of the SMN2 gene in the sample to be detected to judge the copy number of the SMN1 gene and the SMN2 gene in the sample to be detected, so as to determine whether the sample to be detected is a spinal muscular atrophy patient or a spinal muscular atrophy carrier, wherein the method specifically comprises the following steps:

median of f (z) ═ B/all negative sample B values for SMN1 gene

B-sample sequencing depth D/alignment base number A of SMN1 gene

Wherein the D value represents the sequencing depth of the SMN1 gene of a single sample, the A value represents the number of comparison bases of the SMN1 gene of the single sample, and the B value is the ratio of the D to the A;

median of f (z) ═ B/all negative sample B values for SMN2 gene

B-sample sequencing depth D/alignment base number A of SMN2 gene

Wherein the D value represents the sequencing depth of the SMN2 gene of a single sample, the A value represents the number of comparison bases of the SMN2 gene of the single sample, and the B value is the ratio of the D to the A;

judging whether the sample to be detected is a spinal muscular atrophy patient or a spinal muscular atrophy carrier by using the f (Z) value of the SMN1 gene:

if f (Z) of the SMN1 gene is 0.75< 1.25, the copy number of the SMN1 gene of the sample to be detected is normal, namely the copy number of the SMN1 gene of the sample to be detected is 2;

if f (Z) of the SMN1 gene is not less than 0.25 and not more than 0.75, the copy number of the SMN1 gene of the sample to be detected is abnormal, namely the copy number of the SMN1 gene of the sample to be detected is 1;

if f (Z) of the SMN1 gene is 0< 0.25, the SMN1 gene of the sample to be detected is completely deleted, namely the copy number of the SMN1 gene of the sample to be detected is 0;

judging the disease degree of the spinal muscular atrophy patient to be detected by using the f (Z) value of the SMN2 gene:

0< f (Z) <0.25 of SMN2 gene, and the degree of disease of the spinal muscular atrophy patient to be detected is more than 0.25 and less than or equal to f (Z) < 0.75 of SMN1 gene, and the spinal muscular atrophy patient to be detected is detected;

(4) depth statistics is carried out on the regions HBA1 and HBA2, the copy values of the samples HBA1 and HBA2 are obtained by calculating the absolute copy number of the depth of the test sample and the negative sample, and then the specific copy values of the samples HBA1 and HBA2 are judged; calculating f (z) values for HBA1 and HBA2 as SMN1, SMN2 calculated copy number;

if f (Z) of the HBA1 gene is not less than 0.25 and not more than 0.75, f (Z) of the HBA2 gene is more than 0.75, or f (Z) of the HBA2 gene is not less than 0.25 and not more than 0.75 and f (Z) of the HBA1 gene is more than 0.75, the alpha gene of the sample to be detected is deleted;

if f (Z) of the HBA1 gene is not less than 0.25 and not more than 0.75 and f (Z) of the HBA1 gene is not less than 0.25 and not more than 0.75, two alpha genes are deleted from the sample to be detected;

if f (Z) of the HBA1 gene is more than or equal to 0.25 and less than or equal to 0.75, f (Z) of the HBA2 gene is more than or equal to 0.25, or f (Z) of the HBA2 gene is more than or equal to 0.25 and less than or equal to 0.75, and f (Z) of the HBA1 gene is more than or equal to 0.25, three alpha genes of the sample to be detected are deleted;

if 0< f (Z) <0.25 of HBA1 gene and 0< f (Z) <0.25 of HBA2 gene, the sample to be detected lacks four alpha genes;

the judgment standard B is used for judging whether the fetus to be detected has 45 genetic disease single gene mutations; 45 genetic disease monogenes are excluded from CYP21A2, SMN1, HBA1, HBA2 and MT-RNR1 genes in the 150 genes in the table.

The judgment criterion B can be as follows:

(a1) obtaining the types, mutation frequencies and sequencing depths of the mutation sites of 45 monogenic genetic disease mutation genes of the mother of the fetus;

(a2) obtaining the types, mutation frequencies and sequencing depths of mutation sites of 45 monogenic genetic disease mutation genes of the father of the fetus;

(a3) obtaining the types, mutation frequencies and sequencing depths of the mutation sites of the 45 monogenic genetic disease mutation genes of the mother and the fetus;

(a4) judging whether the fetus has 24 autosomal recessive genetic disease single gene mutations, wherein the target mutant gene is at least one of DYSF, CYPN3, MMACHC, MUT, PAH, ATP7B, SLC25A13, SLC22A5, G6PC, GAA, AGL, PYGL, ETFDH, UGT1A1, HBB, FANCA, ABCA4, CYP4V2, TYR, OCA2, SLC26A4, GJB2, OTOF and SLC12A 13;

dividing the types of the single gene mutation sites of the 24 autosomal recessive genetic diseases of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; in the third category: the same mutation site as both the fetal father and the fetal mother;

(a4-1) when both the father and mother of the fetus are heterozygous for the mutation, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step, the fetus carries the mutation site and is heterozygous for the mutation; if no mutation is detected at the mutation site in step three, the fetus does not carry the mutation site;

when the type of the mutation site is of the second type, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation; if the mutation frequency of the mutation site in the step three is more than 0.57, the fetus carries the mutation site and is homozygous mutation;

(a4-2) when the mother of fetus is heterozygous and the father is homozygous, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step, the fetus carries the mutation site and is heterozygous for the mutation;

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is a heterozygous mutation; if the mutation frequency of the mutation site in the step three is more than 0.57, the fetus carries the mutation site and is homozygous mutation;

(a4-3) when the father of the fetus is heterozygous mutation and the mother is homozygous mutation, the judgment method is as follows:

when the type of the mutation site is in the second class, if the mutation frequency of the mutation site is detected to be less than 1 in the third step, the fetus carries the mutation site and is heterozygous for the mutation;

when the mutation site is of the third type, if the mutation frequency of the mutation site in the third step is less than 1, the fetus is homozygous mutation, otherwise, the fetus is heterozygous mutation;

(a5) judging whether the fetus has 11 kinds of autosomal dominant genetic disease single gene mutations; the target mutant gene is at least one of SCN1A, PPRT2, FZD4, RB1, SLC4A1, COL1A1, FGFR3, NF1, TSC1, TSC2 and JAG 1;

(a5-1) when the mother of fetus is heterozygous mutant and the father is heterozygous mutant, the judgment method is as follows:

dividing the types of the mutation sites of the pregnant woman to be detected and the fetus obtained in the step three, which relate to the 11 autosomal monogenic dominant hereditary diseases of the mutant genes, into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; the third type: the same mutation site as that of the father and mother of the fetus;

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43, the fetus carries the mutation site and is heterozygous for the mutation; if the mutation frequency of the mutation site in the step three is more than 0.57, the fetus carries the mutation site and is homozygous mutation;

(a5-2) when the mother of the fetus is heterozygous for the mutation and the father is not mutated, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

(a5-3) when the father of the fetus is heterozygous for the mutation and the mother is not mutated, if the mutation is detected at the mutation site in step three, the fetus carries the mutation site and is heterozygous for the mutation; if no mutation is detected at the mutation site in step three, the fetus does not carry the mutation site;

(a5-4) when the mother and father of the fetus have no mutation, if the mutation site is detected in step three, the fetus carries the mutation site;

(a6) judging whether the fetus has 7X chromosome recessive genetic disease monogenic mutations, wherein the target mutant gene is at least one of DMD, PHKA2, ABCD1, RS1, WAS, BTK and IL2 RG;

(a6-1) when the mother of fetus has heterozygous mutation and hemizygous mutation, the judgment method is as follows: dividing the types of the X chromosome monogenic recessive genetic disease monogenic mutation sites of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; in the third category: the same mutation site as both the fetal father and the fetal mother;

judging the gender of the fetus;

when the fetus is a girl, the type of the mutation site is a first type, and if the mutation site is detected in the step three, the fetus carries the mutation site and is heterozygous mutation; if no mutation is detected at the mutation site in step three, the fetus does not carry the mutation site; the type of the mutation site is a second type, if the mutation frequency of the mutation site in the step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation; the type of the mutation site is a third type, if the mutation frequency of the mutation site in the third step is more than 0.57, the fetus is subjected to homozygous mutation at the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

when the fetus is a male fetus, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

(a6-2) when the mother of fetus is heterozygous and the father is not mutated, the judgment method is as follows:

judging the gender of the fetus;

when the fetus is a girl, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

when the fetus is a boy, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in the step three is more than 0.57, the fetus is hemizygous mutated; 3. when the father and mother of fetus have no mutation site of the target gene, if the mutation frequency of the mutation site of the target gene in step three is more than 0, the fetus carries the mutation site and is spontaneous mutation;

(a7) judging whether the fetus suffers from 2X chromosome dominant genetic disease single gene mutations, wherein the target gene is at least one of MECP2 gene and COL4A5 gene;

(a7-1) when the father and mother of fetus have no mutation site of the target gene, if the mutation frequency of the mutation site of the target gene in step three is more than 0, the fetus carries the mutation site and is spontaneous mutation; otherwise, the fetus does not carry the mutation site;

(a7-2) when the mother of fetus is heterozygous and the father is hemizygous, the judgment method is as follows:

dividing the types of the X chromosome monogenic recessive genetic disease monogenic mutation sites of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; in the third category: the same mutation site as both the fetal father and the fetal mother;

judging the gender of the fetus;

when the fetus is a female fetus, the type of the mutation site is a first type, and if the mutation site is detected in the step three, the fetus carries the mutation site and is heterozygous mutation; the type of the mutation site is a second type, if the mutation frequency of the mutation site in the step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation; the type of the mutation site is a third type, if the mutation frequency of the mutation site in the third step is more than 0.57, the fetus is subjected to homozygous mutation at the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

when the fetus is a male fetus, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.57, carrying the mutation site by the fetus;

(a7-3) when the mother of the fetus has the mutation site of the target gene and the father of the fetus does not have the mutation site of the target gene, the judging method is as follows:

judging the gender of the fetus;

when the fetus is a female fetus, if the mutation frequency of the target gene mutation site in the step III is more than 0.43 and less than 0.57, the fetus carries the site mutation and is a heterozygous mutation; if the mutation frequency of the target gene mutation site in the step three is less than 0.43, the fetus does not carry the site mutation;

when the fetus is a male fetus, if the mutation frequency of the target gene mutation site in the step III is more than 0.57, the fetus carries the site mutation; if the mutation frequency of the target gene mutation site in the step three is less than 0.43, the fetus does not carry the site mutation.

The step of obtaining "the type of mutation site, mutation frequency and sequencing depth of the fetal mother or fetal father itself with respect to the 44 monogenic genetic disease mutant genes" may be as follows:

(w1) preparing a genomic DNA library of the mother or father of the fetus; preparing adaptors for genomic DNA libraries of the mother or father of the fetus as described in claim 9 to 12 as described in 1 and 2;

(w2) after completion of step (w1), hybridizing the genomic DNA library of the mother or father of the fetus with the probe set of any one of claims 1 to 8 to obtain a hybridization product;

(w3) after completion of step (w2), collecting target sequences from the hybridization products to obtain a target sequence capture library;

(w4) carrying out high-throughput sequencing on the target sequence capture library obtained in the step (w3) to obtain sequencing raw data;

(w5) cutting adaptor sequences, low-quality bases from the sequencing raw data obtained in the step (w4), filtering, and aligning to the corresponding position of hg19 of a reference genome;

(w6) after the step (w5) is completed, removing the repetitive sequences caused by the PCR amplification preference to obtain the data of the mother or father of the fetus; then analyzing to obtain related information of SNP and INDEL;

(w7) annotating the information obtained in the step (w6), and then screening to obtain a fetal mother or fetal father SNP Indel;

(w8) annotating sites reported by an HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if the SNP Indel of the mother or father of the fetus contains any point mutation in 6636 pathogenic mutation sites, the mother or father of the fetus carries the mutation site of the corresponding mutant gene; otherwise, the fetal mother or the fetal father does not carry the corresponding gene mutation site; drawing a target gene deletion and repeat analysis graph according to the mutation sites of the mutant genes carried by the mother or father of the fetus, and obtaining the types, the mutation frequencies and the sequencing depths of the mutation sites of the 44 single-gene genetic disease mutant genes of the mother or father of the fetus.

The steps for obtaining the types of mutation sites, mutation frequencies and sequencing depths of the fetal mother and the fetus relative to the 44 single-gene genetic disease mutant genes can be as follows:

(Q1) preparing a fetal mother plasma episomal DNA library; preparing a linker of a fetal mother plasma free DNA library as the linker 1 and the linker 2 in claims 9 to 12;

(Q2) after completion of step (Q1), hybridizing the maternal plasma free DNA library of the fetus to the set of probes of any one of claims 1 to 8 to obtain a hybridization product;

(Q3) after completion of step (Q2), collecting target sequences from the hybridization products to obtain a target sequence capture library;

(Q4) performing high-throughput sequencing on the target sequence capture library obtained in the step (Q3) to obtain sequencing raw data;

(Q5) cutting adaptor sequences, low-quality bases from the sequencing raw data obtained in step (Q4), filtering, and aligning to the corresponding position of hg19 in the reference genome;

(Q6) after completion of step (Q5), removing the repetitive sequences due to PCR amplification bias, resulting in fetal mother and fetal data; then analyzing to obtain related information of SNP and INDEL;

(Q7) annotating the information obtained in step (Q6) and then screening to obtain the SNP indels of "mother and fetus";

(Q8) annotating sites reported by an HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if SNP Indel of 'fetal mother and fetus' contains any one point mutation in 6636 pathogenic mutation sites, then 'fetal mother and fetus' carry the mutation site of the corresponding mutant gene; otherwise, the 'fetal mother and fetus' do not carry the corresponding gene mutation site; according to the mutation sites of the mutant genes carried by the mother and the fetus, a target gene deletion and repeated analysis graph is drawn, and the types, the mutation frequencies and the sequencing depths of the mutation sites of the 44 single-gene genetic disease mutant genes of the mother and the fetus are obtained.

The invention also protects any probe set. The probe set can be used for detecting whether the testee or the fetus to be detected has 50 genetic disease single gene mutations. The probe set can be used for detecting whether a fetus to be detected or a subject to be detected is normal, heterozygous or homozygous mutated based on 50 genes corresponding to monogenic genetic diseases.

The invention also discloses a kit for detecting whether the corresponding genes of the fetus to be detected based on 50 single-gene genetic diseases are normal, heterozygous carrying or homozygous mutation, which comprises any one of the probe sets.

The invention also provides a kit for detecting whether the corresponding genes of a person to be detected are normal, heterozygous carrying or homozygous mutation based on 50 single-gene genetic diseases, which comprises any one of the probe sets.

Any one of the above kits further comprises at least one of any one of the above primer 3, any one of the above primer 4, any one of the above linker 1, and any one of the above linker 2.

Any one of the above kits further comprises any one of the above primers 5 and/or any one of the above primers 6.

The invention also protects the application of any probe set, which can be at least one of P1) -P4);

p1) detecting whether the tested person or the tested fetus has the 50 monogenic genetic diseases;

p2) detecting whether the tested person or the tested fetus has the 50 genetic disease single gene mutations;

p3) detecting whether the corresponding genes of the fetus to be detected are normal, heterozygous carrying or homozygous mutation based on the 50 single-gene genetic diseases;

p4) to test the subjects for whether the corresponding genes are normal, heterozygous or homozygous for the above 50 monogenic genetic diseases.

The invention also provides a method for detecting whether the genes corresponding to the 50 monogenic genetic diseases of the fetus to be detected are normal, heterozygous carried or homozygous mutated, which sequentially comprises the following steps:

(T1) preparing a fetal maternal plasma episomal DNA library, a fetal maternal genomic DNA library and a fetal paternal genomic DNA library, respectively;

(T2) after the step (T1) is completed, hybridizing the fetal maternal plasma episomal DNA library, the fetal maternal genomic DNA library and the fetal paternal genomic DNA library with any one of the probe sets described above, respectively, to obtain hybridization products;

(T3) after completion of step (T2), collecting target sequences from the hybridization products to obtain a target sequence capture library;

(T4) after the step (T3) is completed, sequencing the target sequence capture libraries respectively, and judging whether a single gene of the fetus to be detected is normal, heterozygous carrying or homozygous mutation according to sequencing data.

The invention also provides a method for detecting whether the gene corresponding to the single-gene genetic disease of a person to be detected is normal, heterozygous carried or homozygous mutated, which sequentially comprises the following steps:

(B1) preparing a genomic DNA library of a to-be-detected person;

(B2) after the step (B1) is finished, hybridizing the genomic DNA library of the testee with any probe set to obtain a hybridization product;

(B3) after step (B2) is completed, collecting the target sequence from the hybridization product to obtain a target sequence capture library;

(B4) and (B3) after the step is completed, sequencing the target sequence capture library, and judging whether the gene corresponding to a single genetic disease of the person to be tested is normal, heterozygous carrying or homozygous mutation according to sequencing data.

In any of the above methods, the linker of the "preparing a fetal maternal plasma episomal DNA library, a fetal maternal genomic DNA library or a fetal paternal genomic DNA library" or the "preparing a test subject genomic DNA library" may be any of the above linkers 1 and/or any of the above linkers 2.

In any of the above methods, in the step (T2), the step of hybridizing the fetal maternal plasma episomal DNA library, the fetal maternal genomic DNA library, and the fetal paternal genomic DNA library with any of the above probe sets to obtain hybridization products may be as follows:

(T2-1) preparing an enrichment system A; the enrichment system A comprises the fetal maternal plasma free DNA library, the fetal maternal genomic DNA library or the fetal paternal genomic DNA library, the probe set, any of the primers 3 described above and any of the primers 4 described above;

(T2-2) taking the enrichment system, hybridizing and enriching for more than 16h at the temperature of 60-70 ℃ to obtain a hybridization product;

in the step (B2), the step of hybridizing the genomic DNA library of the subject with any of the probe sets described above to obtain a hybridization product comprises:

(B2-1) preparing an enrichment system B; the enrichment system B comprises the genomic DNA library of the testee, the probe set, any one of the primers 3 and any one of the primers 4;

(B2-2) taking the enrichment system B, and hybridizing and enriching for more than 16h at the temperature of 60-70 ℃ to obtain a hybridization product.

In any of the above methods, the step of "collecting target sequences from hybridization products to obtain target sequence capture library" may be as follows:

(3-a) collecting the hybridization product using magnetic beads;

and (3-b) performing PCR amplification by using the product collected in the step (3-1) as a template and adopting a primer pair consisting of any one of the primers 5 and any one of the primers 6, wherein the PCR amplification product is a target sequence capture library.

The judgment standard for judging whether the gene corresponding to a single genetic disease of a fetus to be detected is normal, heterozygous carried or homozygous mutated according to the sequencing data or for judging whether the gene corresponding to a single genetic disease of a person to be detected is normal, heterozygous carried or homozygous mutated according to the sequencing data can be any one of the judgment standards A and/or any one of the judgment standards B.

The invention also provides a target sequence capture library, which can be composed of the target sequence obtained by any one of the methods described above.

Through a large number of experiments, the inventor of the invention develops a capture kit based on a liquid phase capture technology, greatly reduces sequencing cost, improves sequencing depth and more accurately discovers the genetic variation information of specific regions of 50 monogenic genetic diseases on the premise of ensuring the accuracy of gene screening. The invention has important application value.

Drawings

FIG. 1 shows the sequencing results of sanger of 45 samples obtained in example 4.

FIG. 2 shows the results of 3 in step two of example 4 in which the kit prepared in example 1 was used to detect 18C004166 in a sample.

FIG. 3 shows the results of the detection of sample 18C004166 using MLPA in step two, example 4.

FIG. 4 is the result of detecting 18C030612 using the kit prepared in example 1 in step two, step 3, example 4.

FIG. 5 shows the results of the examination of sample 18C030612 using MLPA at step two, example 4.

FIG. 6 shows the results of 4 in step two of example 4.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto.

The experimental procedures in the following examples are conventional unless otherwise specified.

The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified.

Both the pregnant woman and the pregnant woman husband in the following examples gave informed consent to the experimental contents.

In the following examples, the plasma sample of the pregnant woman contains genetic information of the fetus and the pregnant woman (i.e., the mother) himself, the leucocyte sample of the pregnant woman has only genetic information of the pregnant woman (i.e., the mother) himself, and the peripheral blood sample of the pregnant woman husband has only genetic information of the pregnant woman (i.e., the father) himself.

The systematic classification, mutant genes, disease subtypes and genetic patterns of the 50 monogenic genetic diseases referred to in the examples below are detailed in table 1.

TABLE 1

Note: XR is sex chromosome recessive inheritance, AR is autosomal recessive inheritance, XD is sex chromosome dominant inheritance, and AD is autosomal recessive inheritance.

The nucleotide sequences of the primers referred to in the examples below are shown in Table 2.

TABLE 2

Name of primer	Nucleotide sequence (5 '-3')	Position in sequence Listing
			Primer
1	GACTACATGGGACAT	SEQ ID NO：1060
			Primer 2	GGAACCTACGACGTA	SEQ ID NO：1061
Primer 3	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCT	SEQ ID NO：1062
			Primer 4	CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT	SEQ ID NO：1063
Primer 5	AATGATACGGCGACCACCGA ^* G	SEQ ID NO：1064
			Primer 6	CAAGCAGAAGACGGCATACG ^* A	SEQ ID NO：1065
Single-stranded DNA1	ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNN ^* T	SEQ ID NO：1066
			Single-stranded DNA2	P-NNNNNNNNAGATCGGAAGAGCACACGTCT	SEQ ID NO：1067

Note: ^* g represents that G is subjected to a thio modification, ^* a represents that A is subjected to thio modification, ^* t is T for thio modification, P is phosphorylation modification, and N is A, T, C or G.

Example 1 preparation of a kit for the detection of Single Gene mutations of 50 genetic diseases

First, preparation of Probe set

1. 1059 probes were designed and synthesized based on the nucleotide sequences of 50 mutant genes involved in monogenic genetic diseases. Each probe consists of 108 nucleotides, and comprises a DNA fragment 1, a DNA fragment 2 and a DNA fragment 3 from a5 'end to a 3' end in sequence. The nucleotide sequence of the DNA fragment 1 is 5'-GACTACATGGGACAT-3'. The nucleotide sequence of the DNA fragment 3 is 5'-GGAACCTACGACGTA-3'. DNA fragment 2 consisted of 78 nucleotides. DNA fragment 2 is a part of 50 mutant genes involved in monogenic genetic diseases.

The principle of probe design is as follows: obtaining exon sequences of 50 mutant genes related to monogenic genetic diseases from a UCSC database, extending 50bp back and forth, extending less than 50bp to 50bp after extension, extracting a reference sequence (reference genome version hg38) of each region, removing sequences of repeated regions, and analyzing the repeated sequences by using RepeatMask software. And (3) intercepting a 78bp sequence from the first base as a probe, moving the n bases backwards again, and intercepting the 78bp sequence as the probe until the last 78bp sequence is reached. Each region varies in n depending on the GC content of the exon, with higher or lower GC content and smaller n, the more densely the probe design is designed to achieve improved uniformity of capture. The SMN1 gene and SMN2 gene are very similar and for this gene probes were designed separately for the different snp sites on the two genes. The probability of the copy number change of the DMD gene is very high, the CNV analysis is inaccurate to the single exon analysis, and therefore, probes are supplemented to the upstream and downstream 300bp regions of each exon of the DMD gene, so that the copy number change of the single exon can be analyzed.

The probe density formula was adjusted according to GC content:

D _gc ＝a+a*10*|gc-0.5|

wherein D _gc The probe density at a certain GC content was represented, and a represents the probe density at a GC content of 50%, and was 20. GC represents GC content.

Specifically, the nucleotide sequence of the DNA fragment 2 of the 1059 probes is shown as SEQ ID NO: 1 from position 16-93 from the 5' end to SEQ ID NO: 1059 is shown at positions 16-93 from the 5' end.

2. After step 1 was completed, the probe was biotin-labeled. The method comprises the following specific steps: 1059 probes were mixed well in ddH with a total volume of 1.2mL ₂ In O, 15. mu.L of the mixture was subjected to PCR amplification (performed in three tubes) using a universal PCR primer set consisting of primer 1:5 ' -bio-GACTACATGGGACAT-3 ' (bio indicates that the 5 ' -end has a biotin label) and primer 2: 5'-GGAACCTACGACGTA-3' to obtain a PCR amplification product.

3. Purifying the PCR amplification product with MinElute PCR Purification Kit (product of Qiagen, cat # 28006) to obtain a purified product; then 500ng of the purified product was taken and bound with MyOne streptavidin magnetic beads (product of Invitrogen, cat # 35602); then adding NaOH solution for treatment, aiming at denaturing and eluting the complementary strand without biotin labeling; then washing the whole magnetic beads with formamide liquid at 100 ℃ to separate the probes from the magnetic beads; and finally, precipitating with ethanol to obtain the biotin-labeled probe set.

Preparation of kit for detecting 50 genetic disease single gene mutations

The detection kit for 50 genetic disease single gene mutations consists of enrichment buffer, hybridization buffer, library combination buffer, rinsing buffer 1, rinsing buffer 2, library enrichment eluent, neutralization buffer, PCR reaction liquid and probe sets prepared in the first step.

The enrichment buffer solution consists of 3.5 volume parts of human cot-1DNA aqueous solution, 3.5 volume parts of salmon sperm DNA aqueous solution and 3 volume parts of primer mixture solution (consisting of a primer 3, a primer 4 and water). In the enrichment buffer, the concentration of human cot-1DNA was 35% (v/v), the concentration of salmon sperm DNA was 15% (v/v), the concentration of primer 3 was 0.5 nmol/. mu.L, and the concentration of primer 4 was 0.5 nmol/. mu.L.

Hybridization buffer: an aqueous solution containing 1.25M NaCl, 0.125M sodium citrate, 0.1g/100mL BSA and 7% (v/v) Tween 20.

Library binding buffer: 10mM Tris-HCl buffer, pH7.5, containing 1M NaCl and 1mM EDTA.

Rinsing buffer 1: sodium citrate buffer containing 0.1% (m/v) SDS. The sodium citrate buffer solution is an aqueous solution containing 175g/L NaCl and 88g/L trisodium citrate; the pH was 7.4.

Rinsing buffer 2: dilutions of sodium citrate buffer containing 0.1% (m/v) SDS. The sodium citrate buffer solution diluent is formed by mixing 1 volume part of sodium citrate buffer solution and 9 volume parts of water.

Library enrichment eluent: aqueous NaOH solution having a concentration of 0.1M.

Neutralization buffer: Tris-HCl buffer (pH 7.5, 1M).

3mL of the PCR reaction solution consisted of 100. mu.L of Phusion Hot Start II DNA Polymerase (product of Thermo, cat # F549S) at a concentration of 0.05U/. mu.L and 2900. mu.L of PCR mixbuffer. PCR mixbuffer containing 0.2mM dATP, 0.2mM dTTP, 0.2mM dCTP, 0.2mM dGTP, 5% (v/v) DMSO, 2.5pmol primer 5, 2.5pmol primer 6, 4mM MgCl ₂ 500mM KCl and 0.8% (v/v) Nonidet P40.

Example 2 and establishment of method for detecting whether genetic disease single gene mutation exists by kit prepared in example 1

A. Example 1 establishment of method for noninvasive prenatal detection of whether fetus has 45 genetic disease single gene mutations by using kit prepared in example 1

Through a large number of experiments, the inventor establishes a method for noninvasive prenatal detection of whether 45 genetic disease single gene mutations exist in a fetus by using the kit prepared in the embodiment 1. The method comprises the following specific steps:

firstly, obtaining the mutation site types, mutation frequencies and sequencing depths of 45 (shown in table 1, except CYP21A2, SMN1, HBA1, HBA2 and MT-RNR1 genes) single-gene genetic disease mutation genes of the pregnant women to be tested

Extraction of genome DNA of pregnant woman to be detected

10mL of peripheral Blood of a pregnant woman to be tested is collected by an EDTA anticoagulant tube, plasma and leucocytes are separated, and genome DNA of the leucocytes is extracted by a CWE2100 Blood DNA Kit V2 (Kangji is a product of century Biotechnology Co., Ltd., product number CW 2543). The genomic DNA is named as the genomic DNA of the pregnant woman to be detected.

(II) preparation of genomic DNA library of pregnant woman to be tested

3 mu g of pregnant woman genome DNA to be detected is taken, ultrasonic breaking (the instrument model is Covaris S220, the parameters are Peak inclusion Power 175W, Duty Factor 10%, Cycles per Burst 200 and Treatment Time 180S) is carried out to about 200bp, and then a KAPA Hyper library construction kit is utilized to prepare the pregnant woman genome DNA library to be detected. The joints for preparing the pregnant woman genome DNA library to be detected are single-stranded DNA1 and single-stranded DNA 2.

Taking a genome DNA library of a pregnant woman to be detected, and carrying out Qubit quantification and 2% agarose gel electrophoresis detection.

(III) construction of target sequence Capture library A

1. And (4) preparing an enrichment system. The enrichment system is 100 mu L and consists of 48 mu L of pregnant woman genome DNA library to be detected (containing 1 mu g of pregnant woman genome DNA to be detected), 12 mu L of enrichment buffer, 5 mu L of probe set and 35 mu L of hybridization buffer (preheated at 65 ℃).

2. And (3) after the step 1 is finished, taking the enrichment system, and putting the enrichment system in a PCR instrument for overnight hybridization enrichment (the hybridization time is at least 16h) to obtain an enrichment product.

Reaction procedure: 7min at 95 ℃ and more than 16h at 65 ℃.

3. Obtaining solution of streptavidin-coated magnetic beads (streptavidin-coated magnetic beads are stored in a storage solution, which is performed to remove the storage solution)

(1) Adding 50 μ L of the low-adsorption centrifuge tube

M-280 streptavidin magnetic beads, then placed in the magnetic frame for 1 min.

(2) After completion of step (1), the supernatant was discarded, 50. mu.L of library binding buffer was added, the beads were resuspended, and then briefly centrifuged.

(3) And (3) after the step (2) is finished, taking the low-adsorption centrifuge tube, placing the low-adsorption centrifuge tube in a magnetic frame for 1min, discarding the supernatant, adding 50 mu L of library binding buffer solution, and resuspending the magnetic beads.

(4) And (4) after the step (3) is finished, taking the low-adsorption centrifuge tube, placing the low-adsorption centrifuge tube in a magnetic frame for 1min, discarding the supernatant, adding 50 mu L of library binding buffer solution, and re-suspending the magnetic beads to obtain a solution of streptavidin-coated magnetic beads.

4. Co-incubation capture

(1) And (3) after the step 3 is finished, adding all the enriched products obtained in the step 2 into the low-adsorption centrifuge tube, performing vortex oscillation for 5sec, and then placing the tube on a rotary blending machine at room temperature for 1 h.

(2) And (3) after the step (1) is finished, taking the low-adsorption centrifuge tube, placing the low-adsorption centrifuge tube in a magnetic frame for 1min, and discarding the supernatant.

5. Washing and PCR amplification

(1) And (4) after the step 4 is finished, adding 500 mu L of rinsing buffer solution 1 into the low-adsorption centrifuge tube, uniformly mixing, and placing the mixture in a rotary mixer to rotate for 15 min.

(2) And (3) after the step (1) is finished, taking the low-adsorption centrifuge tube, placing the centrifuge tube on a magnetic frame for standing for 2min, and discarding the supernatant.

(3) After step (2) was completed, the low adsorption centrifuge tube was added with 500. mu.L of rinsing buffer 2 (preheated at 65 ℃) and incubated at 65 ℃ for 10 min.

(4) And (4) after the step (3) is finished, taking the low-adsorption centrifuge tube, placing the centrifuge tube on a magnetic frame for standing for 2min, and discarding the supernatant.

(5) And (4) repeating the step (4) twice.

The purpose of carrying out the above steps is to not react with

The probes bound to the M-280 streptavidin magnetic beads were washed away.

(6) And (5) after the step (5) is finished, adding 30 mu L of library enrichment eluent into the low-adsorption centrifuge tube, resuspending magnetic beads, and placing the low-adsorption centrifuge tube in a room-temperature rotary mixer for 10-20 min.

(7) And (5) after the step (6) is finished, taking the low-adsorption centrifuge tube, and placing the centrifuge tube on a magnetic frame for standing for 1 min.

(8) And (4) after the step (7) is completed, transferring the supernatant to a centrifuge tube, adding 40 mu L of neutralization buffer solution and 30 mu L of PCR reaction solution, sucking and uniformly mixing by a pipette, and placing the mixture in a PCR instrument for PCR amplification to obtain a PCR amplification product.

PCR procedure: 30sec at 98 ℃; 30sec at 98 ℃, 30sec at 65 ℃, 30sec at 72 ℃, 15 cycles; 5min at 72 ℃ and infinity at 4 ℃.

6. Purification of

After the step 5 is completed, the PCR amplification product is taken and purified by an AgencourtAAMPure XP nucleic acid purification kit (product of Beckman Coulter company, product number A63881) to obtain a library amplification purification product.

The library amplification and purification product is the target sequence capture library A.

(IV) high throughput sequencing and data analysis

1. And (5) carrying out high-throughput sequencing on the target sequence capture library A obtained in the step (three) by a second-generation sequencing platform such as Nextseq500, X Ten, Novaseq and the like to obtain sequencing original data.

2. After step 1 is completed, the sequencing original data is cut off the linker sequence and low-quality bases (quality value is less than 10) by using cutdapt software (website: https:// cutdapt. readthetadocs. io/en/stable /), the sequence with the length less than 80bp is filtered, and then the sequence is aligned to the corresponding position of the hg19 of the reference genome by using bwa software MEM algorithm (website: http:// bio-bw.

3. After completion of step 2, the repetitive sequences due to PCR amplification preference were removed using the GATK software (website: https:// software. branched amplification. org/GATK /), and the data were analyzed to obtain information about Single Nucleotide Variations (SNV) and INDEL mutations (INDELs).

4. All SNPs and INDELs in the relevant information obtained in step 3 were annotated with ANNOVAR software (website: http:// innovar. org/en/late /), and then normal human databases (including mutation sites with frequencies of less than 0.05 in thousand human genome project (website: http:// EVS. gs. washington. edu/EVS /), exterior Variant Server (website: http:// EVS. gs.), and EXAC (website: http:// exterior. branched. upright. org.)) were screened out, missense mutations were predicted with SIFT software (website: http:// site. jcvi. org.), Polyphen-2 software (website: http:// science. bw. bright. jcgi. org.), PolyPhen-2 software (website: http:// liver. fw. rd. 32. http:// http:/,/liver, and conserved version:/(. 52. http: /), the pathogenicity of the cutting site is analyzed by using SPIDEX software (the website is http:// www.deepgenomics.com/SPIDEX), and the data is output as an Excel file named as the SNP Indel of the pregnant woman to be detected.

5. Obtaining mutation sites of 45 single genetic disease mutation genes carried by the pregnant women to be tested (the mutation sites are only limited to gene mutation and do not comprise deletion of eg. SMN/DMD exon and the like)

Annotating sites reported by an HGMD (human gene mutation database), and then screening according to a screening principle (the screening principle is that the sites are pathogenic mutant-pathogenic and are large mutations (frame shift is large mutations) and tag is equal to DM) to obtain 6636 pathogenic mutation sites; if the SNP Indel of the pregnant woman to be detected contains any point mutation in 6636 pathogenic mutation sites, the pregnant woman to be detected carries the mutation site of the corresponding mutant gene; otherwise, the pregnant woman to be detected does not carry the corresponding gene mutation site.

Through the steps, the types, mutation frequencies and sequencing depths of mutation sites of 45 single-gene genetic disease mutation genes of the pregnant woman to be detected are finally obtained.

Secondly, obtaining the types, mutation frequencies and sequencing depths of mutation sites of 45 monogenic genetic disease mutation genes of the pregnant woman husband to be detected

According to the method of the first step, the leucocytes of the pregnant woman to be detected are replaced by the peripheral blood of the pregnant woman husband to be detected, and other steps are not changed, so that the types, mutation frequencies and sequencing depths of mutation sites of 45 monogenic genetic disease mutation genes of the pregnant woman husband to be detected are obtained.

Thirdly, obtaining the types, mutation frequencies and sequencing depths of mutation sites of 45 monogenic genetic disease mutation genes of the pregnant woman to be detected and the fetus

Extraction of free DNA in blood plasma of pregnant woman to be tested

1. Collecting 10mL of peripheral blood of a pregnant woman to be detected by using an EDTA anticoagulant tube, centrifuging for 15min at 4 ℃ at 1600g, and collecting supernatant 1 (placing in a low-adsorption centrifuge tube).

2. After completion of step 1, the supernatant 1 was centrifuged at 12000rpm for 5min and the supernatant 2 was collected (placed in a low adsorption centrifuge tube). Supernatant 2 is plasma.

3. After completion of step 2, 1mL of the supernatant 2 was taken, and plasma free DNA (cfDNA) was extracted using a large-volume free nucleic acid extraction kit (product of Tiangen Biochemical technology (Beijing) Ltd., product No. DP 710). The cfDNA is named as the plasma free DNA of the pregnant woman to be detected.

(II) preparation of pregnant woman plasma free DNA library to be detected

And (3) taking 5ng of the pregnant woman plasma free DNA to be detected obtained in the step (I), and preparing the pregnant woman plasma free DNA library to be detected by using a KAPA Hyper library construction kit (a product of KAPA Biosystems, the product number is KK 8504). The joints for preparing the pregnant woman plasma free DNA library to be detected are single-stranded DNA1 and single-stranded DNA 2.

Taking a pregnant woman plasma free DNA library to be detected, and carrying out Qubit quantification and 2% agarose gel electrophoresis detection.

(III) construction of target sequence Capture library B

Replacing the pregnant woman genome DNA library to be detected (containing 1 mu g of pregnant woman genome DNA to be detected) with the pregnant woman plasma free DNA library to be detected (containing 1 mu g of pregnant woman plasma free DNA to be detected) according to the method in the step one (three), and obtaining the target sequence capturing library B without changing other steps.

(IV) high throughput sequencing and data analysis

And (3) replacing the target sequence capture library A with a target sequence capture library B according to the method in the step one (fourth), and obtaining the types, mutation frequencies and sequencing depths of the mutation sites of the 45 monogenic genetic disease mutation genes of the pregnant woman to be detected and the fetus, wherein the other steps are not changed.

Fourthly, judging whether the fetus has genetic disease single gene mutation

(I) judging whether the fetus has 24 autosomal recessive genetic disease single gene mutations

The target mutant gene is at least one of DYSF, CYPN3, MMACHC, MUT, PAH, ATP7B, SLC25A13, SLC22A5, G6PC, GAA, AGL, PYGL, ETFDH, UGT1A1, HBB, FACCA, ABCA4, CYP4V2, TYR, OCA2, SLC26A4, GJB2, OTOF and SLC12A 13.

Dividing the types of the single gene mutation sites of the 24 autosomal recessive genetic diseases of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: mutation sites that are only identical to the fetal father (i.e., the fetal and fetal father mutation sites are of the same type, and are of a different type than the fetal mother mutation sites); the second type: mutation sites that are identical only to the mother of the fetus (i.e., the type of mutation sites is identical for both the fetus and the mother of the fetus and different from the type of mutation sites for the father of the fetus); in the third category: the same mutation site as both the fetal father and the fetal mother (i.e., the same type of mutation site is found in the fetus, the fetal father, and the fetal mother).

1. When the father and mother of the fetus are heterozygous mutations, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step (mutation frequency is more than 0), the fetus carries the mutation site and is heterozygous for the mutation; if no mutation is detected at the mutation site in step three (mutation frequency of 0), the fetus does not carry the mutation site.

When the type of the mutation site is the second type, if the mutation frequency of the mutation site in the third step is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation; if the mutation frequency of the mutation site in step three is above 0.57, the fetus carries the mutation site and is a homozygous mutation.

2. When the mother of the fetus is heterozygous mutation and the father is homozygous mutation, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step (mutation frequency is more than 0), the fetus carries the mutation site and is heterozygous for the mutation;

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is a heterozygous mutation; if the mutation frequency of the mutation site in step three is above 0.57, the fetus carries the mutation site and is a homozygous mutation.

3. When the father of the fetus is heterozygous mutation and the mother is homozygous mutation, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step (mutation frequency is more than 0), the fetus carries the mutation site and is heterozygous mutation; if no mutation is detected at this mutation site in step three (mutation frequency 0), the fetus does not carry this mutation site.

When the type of the mutation site is of the second type, if the mutation frequency of the mutation site is detected to be less than 1 in step three, the fetus carries the mutation site and is heterozygous for the mutation.

When the mutation site is of the third type, if the mutation frequency of the mutation site in the third step is less than 1, the fetus is homozygous mutation, otherwise, the fetus is heterozygous mutation.

(II) judging whether the fetus has 11 autosomal dominant hereditary single gene mutations

The target mutant gene is at least one of SCN1A, PPRT2, FZD4, RB1, SLC4A1, COL1A1, FGFR3, NF1, TSC1, TSC2 and JAG 1.

1. When the mother of the fetus is heterozygous mutant and the father is heterozygous mutant, the judgment method comprises the following steps:

dividing the types of the mutation sites of the pregnant woman to be detected and the fetus obtained in the step three, which relate to the 11 autosomal monogenic dominant hereditary diseases of the mutant genes, into the following three types: the first type: mutation sites that are only identical to the fetal father (i.e., the fetal and fetal father mutation sites are of the same type, and are of a different type than the fetal mother mutation sites); the second type: only the same mutation site as the fetal mother (i.e., the fetal and fetal mother mutation sites are of the same type and different from the fetal father mutation site); in the third category: the same mutation site as both the fetal father and the fetal mother (i.e., the same type of mutation site is found in the fetus, the fetal father, and the fetal mother).

when the type of the mutation site is of the third class, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43, the fetus carries the mutation site and is heterozygous for the mutation; if the mutation frequency of the mutation site in step three is above 0.57, the fetus carries the mutation site and is a homozygous mutation.

2. When the mother of the fetus is heterozygous and the father has no mutation, if the mutation frequency of the mutation site in the step III is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation;

3. when the father of the fetus is heterozygous mutation and the mother has no mutation, if the mutation site is detected to have mutation in the step three (the mutation frequency is more than 0), the fetus carries the mutation site and is heterozygous mutation; if no mutation is detected at the mutation site in step three (mutation frequency of 0), the fetus does not carry the mutation site.

4. When the fetus has no mutation in both mother and father, if the mutation site is detected in step three (mutation frequency is more than 0), the fetus carries the mutation site (spontaneous mutation).

(III) judging whether the fetus has 7X chromosome recessive genetic disease single gene mutations

The target mutant gene is at least one of DMD, PHKA2, ABCD1, RS1, WAS, BTK and IL2 RG.

1. When the fetus mother has heterozygous mutation and father hemizygous mutation, the judgment method comprises the following steps: dividing the types of the X chromosome monogenic recessive genetic disease monogenic mutation sites of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: mutation sites that are only identical to the fetal father (i.e., the fetal and fetal father mutation sites are of the same type, and are of a different type than the fetal mother mutation sites); the second type: only the same mutation site as the fetal mother (i.e., the fetal and fetal mother mutation sites are of the same type and different from the fetal father mutation site); in the third category: the same mutation site as the fetal father and the fetal mother (i.e., the same type of mutation site as the fetal father and the fetal mother)

(1) And judging the gender of the fetus.

(2) When the fetus is a girl child, the type of the mutation site is a first type, and if the mutation site is detected in the third step (the mutation frequency is more than 0), the fetus carries the mutation site and is heterozygous mutation; if no mutation is detected at the mutation site in step three (mutation frequency of 0), the fetus does not carry the mutation site. The type of the mutation site is a second type, if the mutation frequency of the mutation site in the step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation. The type of the mutation site is a third type, if the mutation frequency of the mutation site in the third step is more than 0.57, the fetus is subjected to homozygous mutation at the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation.

(3) When the fetus is a male fetus, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.57, the fetus carries the mutation site and is heterozygous for the mutation.

2. When the mother of the fetus is heterozygous and the father is not mutated, the judgment method comprises the following steps:

(1) and judging the gender of the fetus.

(2) When the fetus is a girl, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation.

(3) When the fetus is a boy, if the mutation frequency of the mutation site in the third step is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is more than 0.57, the fetus is hemizygous mutated. 3. When the fetus father and the fetus mother do not have the mutation site of the target gene, if the mutation frequency of the mutation site of the target gene in the step three is more than 0, the fetus carries the mutation site and is spontaneous mutation.

(IV) judging whether the fetus suffers from 2X chromosome dominant genetic disease single gene mutations

The target gene is at least one of the MECP2 gene and COL4A5 gene.

1. When the father and mother of fetus have no mutation site of the target gene, if the mutation frequency of the mutation site of the target gene in step three is more than 0, the fetus carries the mutation site and is spontaneous mutation; otherwise, the fetus does not carry the mutation site.

2. When the fetus mother is heterozygous and the father is hemizygous, the judgment method is as follows:

dividing the types of the X chromosome monogenic recessive genetic disease monogenic mutation sites of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type is: mutation sites that are only identical to the fetal father (i.e., the fetal and fetal father mutation sites are of the same type, and are of a different type than the fetal mother mutation sites); the second type: mutation sites that are identical only to the mother of the fetus (i.e., the type of mutation sites is identical for both the fetus and the mother of the fetus and different from the type of mutation sites for the father of the fetus); in the third category: the same mutation site as the fetal father and the fetal mother (i.e., the same type of mutation site as the fetal father and the fetal mother)

(1) And judging the gender of the fetus.

(2) When the fetus is a female fetus, the type of the mutation site is the first type, and if the mutation site is detected in step three (the mutation frequency is more than 0), the fetus carries the mutation site and is a heterozygous mutation. The type of the mutation site is a second type, if the mutation frequency of the mutation site in the step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.43 and less than 0.57, the fetus carries the mutation site and is a heterozygous mutation. The type of the mutation site is a third type, if the mutation frequency of the mutation site in the third step is more than 0.57, the fetus is subjected to homozygous mutation at the mutation site; if the mutation frequency of the mutation site in step three is greater than 0.43 and less than 0.57, the fetus carries the mutation site and is heterozygous for the mutation.

(3) When the fetus is a male fetus, if the mutation frequency of the mutation site in step three is below 0.43, the fetus does not carry the mutation site; if the mutation frequency of the mutation site in step three is above 0.57, the fetus carries the mutation site.

3. When the mother of the fetus has the mutation site of the target gene and the father of the fetus does not have the mutation site of the target gene, the judgment method is as follows:

(1) and judging the gender of the fetus.

(2) When the fetus is a female fetus, if the mutation frequency of the target gene mutation site in the step III is more than 0.43 and less than 0.57, the fetus carries the site mutation and is a heterozygous mutation; if the mutation frequency of the target gene mutation site in the step three is less than 0.43, the fetus does not carry the site mutation.

(3) When the fetus is a male fetus, if the mutation frequency of the target gene mutation site in the third step is more than 0.57, the fetus carries the site mutation; if the mutation frequency of the target gene mutation site in the step three is less than 0.43, the fetus does not carry the site mutation.

B. Example 1 method for determining whether the subject has 50 genetic disease single gene mutations

1. And D, replacing the leucocytes of the pregnant woman to be detected with the peripheral blood of the person to be detected according to the method in the step A, wherein the other steps are unchanged, and obtaining the SNP Indel of the person to be detected about 50 monogenic genetic disease mutant genes.

2. After the step 1 is completed, counting the situation of the mutation sites in each mutant gene.

Specifically, the "method for judging spinal muscular atrophy due to SMN1 gene mutation" and the "method for judging α thalassemia due to HBA1 gene and HBA2 gene mutation" are as follows:

(1) and counting the coverage of each gene target region by using cnvkit software (http:// cnvkit. readthetadocs. io/en/stable/quick start. html), then drawing by taking the position information of each target region site as an abscissa and the corresponding coverage of each position as an ordinate, and carrying out site statistical analysis to obtain a repeated and missing analysis diagram through the reading depth of each site.

(2) After the step (1) is completed, the absolute copy numbers of the depths of the target regions of the test sample, the negative sample SMN1 and the SMN2 are calculated to obtain the copy values of the SMN1 and SMN2, and further to judge the specific copy values of the SMN1 and SMN2 (the detection range of the kit prepared in the example 1 on the SMN1 is that the copy number of the exon 7 of the SMN1 gene can be distinguished, and the others are not in the detection range).

median of f (z) ═ B/all negative sample B values for SMN1 gene

B-sample sequencing depth D/alignment base number A of SMN1 gene

median of f (z) ═ B/all negative sample B values for SMN2 gene

B-sample sequencing depth D/alignment base number A of SMN2 gene

Wherein, the D value represents the sequencing depth of the SMN2 gene of a single sample, the A value represents the number of the alignment bases of the SMN2 gene of the single sample, and the B value is the ratio of the D to the A.

if f (z) of the SMN1 gene is 0< 0.25, the SMN1 gene of the test sample is completely deleted, i.e., the copy number of the SMN1 gene of the test sample is 0.

0< f (Z) <0.25 of SMN2 gene, and the degree of disease of the spinal muscular atrophy patient to be detected is more than 0.25 and less than or equal to f (Z) < 0.75 of SMN1 gene, and the spinal muscular atrophy patient to be detected is detected.

(4) Depth statistics is carried out on the regions HBA1 and HBA2, the copy values of the samples HBA1 and HBA2 are obtained by calculating the absolute copy number of the depth of the test sample and the negative sample, and then the specific copy values of the samples HBA1 and HBA2 are judged. The f (z) values for HBA1 and HBA2 were calculated as copy numbers calculated by SMN1, SMN 2.

if 0< f (Z) <0.25 of HBA1 gene and 0< f (Z) <0.25 of HBA2 gene, the four alpha genes of the sample to be tested are deleted.

Example 3, beneficial effects of the kit prepared in example 1

The sample R-001 and the sample R-003, the sample R-002 and the sample R-004 are the same normal human peripheral blood sample, and the data volume of the sample R-001 and the sample R-003 are similar. The data amounts of the sample R-002 and the sample R-004 are similar.

A sample R-001 and a sample R-002 are taken, a universal BL-closed kit (Mikeno kit) is adopted to construct a target sequence capture library, and then high-throughput sequencing and data analysis are carried out.

Sample R-003 and sample R-004 were taken, and the target sequence capture library was constructed using the kit prepared in example 1, followed by high throughput sequencing and data analysis.

The analytical results are shown in Table 3 (precision BL is the kit prepared in example 1). The results show that the capture efficiency and the average sequencing depth of the kit prepared in example 1 are significantly improved compared with the universal BL-blocked kit.

TABLE 3

EXAMPLE 4 beneficial Effect of optimizing probes based on GC content

The sample R-005 and the sample R-006, the sample R-007 and the sample R-008 are the same normal human peripheral blood sample, and the data amount of the sample R-005 and the sample R-006 are similar. The data size of sample R-007 and sample R-008 was similar.

The kit prepared in example 1 was used for capture sequencing of the pre-optimized probes and the optimized probe sets with adjusted probe density based on GC content. The results (table 4) show that after the probe set is optimized according to GC content and subjected to capture sequencing, the optimized probe set has higher capture efficiency, coverage and average depth under the condition of similar data volume.

TABLE 4

Example 5 detection of the presence or absence of a monogenic genetic disease Gene mutation in a test subject Using the kit prepared in example 1

One, adopting the kit prepared in example 1 to detect single gene point mutation

1. Peripheral blood of 45 subjects (see column 1 of Table 5 for subject numbers) was collected and tested by the method of step B in example 2.

The results are shown in Table 5: the 2 nd column is a mutant gene, the 3 rd column is a mutant position of the mutant gene, the number of a transcript in which the 4 th column of the mutant gene is located, the 5 th example is an exon in which the mutant gene of the mutant gene is located, the 6 th column is a nucleotide change of the mutant position of the mutant gene, the 7 th column is an amino acid change of the mutant position of the mutant gene, the 8 th column is whether the mutant site is heterozygous mutation, homozygous mutation or hemizygous mutation, the 9 th column is pathogenicity analysis, the 10 th column is a genetic disease inheritance mode, the 11 th column is a disease/phenotype, and the 12 th column is a mutant site mutation source (four types including mother, father and spontaneous mutation).

TABLE 5-1

TABLE 5-2

Tables 5 to 3

Note: hom represents homozygosity, het represents heterozygosity, hemi represents hemizygosis, pathogenic represents pathogenic variation, like pathogenic variation, uncertain represents unknown clinical significance, AR represents autosomal recessive inheritance, AD represents autosomal dominant inheritance, XR represents X-chromosome recessive inheritance, and XD represents X-chromosome dominant inheritance; the genomic version was GRCh37/hg19, and the positional information for the nucleotide changes was based on the genome and transcript of the current version.

2. sanger sequencing

The 45 samples in step 1 were subjected to sanger sequencing, and partial detection results are shown in FIG. 1.

The results showed that the single gene mutation detection results using the kit prepared in example 1 were completely consistent with the sanger sequencing results.

Secondly, the kit prepared in example 1 is used for detecting copy number variation of single genes (SMN, HBA1, HBA2, DMD and CYP21A2)

1. Variation in SMN Gene copy number Using the kit prepared in example 1

8 samples were tested separately using MLPA (MLPA P060/P052, HRC-Holland) and the kit prepared in example 1.

The results are shown in Table 6. The results show that the SMN single gene copy number detection results by using the kit prepared in example 1 are consistent with the MLPA results.

TABLE 6

2. Variation in HBA Gene copy number Using the kit prepared in example 1

8 samples were detected using "deletion type alpha-thalassemia gene detection kit (Xiamen, 802004, national institutes of record 20173403211)" and Gap-PCR "and" the kit prepared in example 1 ", respectively.

The results are shown in Table 7. The result shows that the kit prepared in example 1 can detect the deletion condition of the alpha gene in the alpha thalassemia, and the deletion condition is completely consistent with the fluorescent PCR dissolution curve/Gap-PCR detection result.

TABLE 7

3. Detection of variation in the DMD Gene copy number Using the kit prepared in example 1

The samples 18C004166 and 18C030612 were respectively detected using MLPA (MLPA P060/P052, HRC-Holland) and the kit prepared in example 1. In MLPA detection, fluorescence signal intensities between 0.75 and 1.25 are generally considered normal.

The result of detecting 18C004166 of a sample by the kit prepared in example 1 is shown in fig. 2 (the abscissa represents exon and the ordinate represents copy number). The results of MLPA assay sample 18C004166 are shown in FIG. 3 (exons on the abscissa and copy number on the ordinate). The results indicated that sample 18C004166 had a deletion of exon 48 in the DMD gene.

The results of examining the sample 18C030612 with the kit prepared in example 1 are shown in FIG. 4 (the abscissa is exon and the ordinate is copy number). The results of MLPA assay sample 18C030612 are shown in FIG. 5 (exons on the abscissa and copy number on the ordinate). The results showed that the DMD gene exons 3-4 of sample 18C030612 detected increased gene copy numbers.

The results show that the results of detecting the variation of the DMD gene copy number using the kit prepared in example 1 are consistent with the MLPA results.

4. CYP21A2 gene mutation and copy number variation were detected by the kit prepared in example 1

1 sample of suspected adrenal cortex hyperplasia was tested using the kit prepared in example 1.

The results are shown in FIG. 6.

The result shows that the kit prepared in example 1 can detect CYP21A2 or CYP21A1P2 gene mutation and copy number variation, and the existence of the pseudogene CYP21A1P2 of CYP21A2 can only indicate that the sample to be detected has high risk of congenital adrenal cortex hyperplasia.

Example 5 non-invasive prenatal detection of whether the fetus to be detected has monogenic genetic disease gene mutation or not by using the kit prepared in example 1

Firstly, the kit prepared in the embodiment 1 is adopted to detect whether the fetus to be detected has the autosomal genetic disease monogenic mutation in a noninvasive prenatal manner

1. Noninvasive prenatal detection of whether the fetus to be detected has the autosomal monogenic genetic disease gene mutation or not by adopting the kit prepared in example 1

23 fetal samples to be tested (the serial numbers of the fetal samples to be tested are shown in the 1 st column in the table 8) are taken and tested according to the method of the step A in the embodiment 2. Each sample to be tested consists of a plasma sample of a pregnant woman, a leucocyte sample of the pregnant woman and a peripheral blood sample of a pregnant woman husband.

The results are shown in columns 2-8 of Table 8.

2. Amniotic fluid gold label detection of whether fetus has monogenic hereditary disease gene mutation

23 fetal samples to be detected (the serial numbers of the fetal samples to be detected are shown in the 1 st column in the table 8) are taken for amniotic fluid gold mark detection.

The results are shown in Table 8, column 9.

TABLE 8

Some of the results are described below:

sample No. 1, mother has guanine to adenine heterozygous mutation at 589 th position of coding region of SLC26A4 (SLC26A4-589G > A), father has second nucleotide mutation from adenine to guanine at 7 th intron of the gene (SLC26A4-IVS7-2A > G). The kit prepared in example 1 is used for respectively detecting free plasma DNA and genomic DNA, the mutation frequency of a plasma sample of a pregnant woman at SLC26A4-589G > A is 0.36, the mutation frequency of a leucocyte sample of the pregnant woman at the position is 0.47, and the mutation frequency of the plasma sample is obviously lower than that of the leucocyte sample, so that the fact that a fetus does not have mutation at the position, namely the fetus does not carry a mutant mother at the position, is shown. Plasma blood samples from pregnant women were found to have no mutation at SLC26A4-IVS7-2A > G, indicating that the fetus did not have a mutation at this site, i.e., the fetus did not carry a paternal mutation at this site. Therefore, sample No. 1 is fetal normal. This result is in full agreement with the amniotic fluid results.

Sample No. 2, both mother and father, had the GJB2-235delC mutation. The kit prepared in example 1 is used for detecting plasma free DNA and genome DNA respectively, the mutation frequency of the plasma sample of the pregnant woman in GJB2-235delC is 0.51, and the mutation frequency of the leucocyte sample of the pregnant woman in the site is 0.48. Indicating that the fetus has heterozygous mutation at this site. Therefore, fetus No. 2 is heterozygous for the mutation at GJB2-235delC (i.e., the fetus is heterozygous for the mutation). This result is consistent with the amniotic fluid results.

Sample No. 3, the mother did not find a mutation in ATP7B, and the father was heterozygous for both ATP7B coding region 2333 (ATP7B-2333G > T) and 2975 (ATP7B-2975C > T). The kit prepared in example 1 is used for detecting free DNA and genomic DNA of plasma respectively, the mutation frequency of the plasma sample of the pregnant woman in ATP7B-2333G > T is 0.15, and the leucocyte sample of the pregnant woman does not have mutation in ATP7B gene, which indicates that the fetus carries father mutation in ATP7B-2333G > T. Therefore, the fetus in the No. 3 sample is heterozygous for the mutation (i.e. the fetus is heterozygous for the mutation) in ATP7B-2333G > T. This result is consistent with the amniotic fluid results.

Sample No. 4, the mother had a guanine to adenine heterozygous mutation at position 9 of the coding region of the gene GJB2 (GJB2-9G > A) and the father had a GJB2-235delC mutation. The kit prepared in the embodiment 1 is used for respectively detecting plasma free DNA and genome DNA, the mutation frequency of a plasma sample of a pregnant woman in GJB2-9G > A is 0.28, the mutation frequency of a leucocyte sample of the pregnant woman at the site is 0.47, and the mutation frequency of the plasma sample is obviously lower than that of the leucocyte sample, so that the fact that no mutation exists in the site in the No. 4 fetal sample is shown, namely, the fetus does not carry maternal mutation at the site; the mutation frequency of the pregnant woman peripheral blood sample at the GJB2-235delC site is 0.15, and the pregnant woman leukocyte sample has no mutation at the site, which indicates that the fetus carries the father mutation at the site. Therefore, fetus No. 4 is heterozygous for the mutation at GJB2-235delC (i.e., the fetus is heterozygous for the mutation). This result is consistent with the amniotic fluid results.

Sample No. 5, both mother and father, had the SLC26A4-IVS7-2A > G mutation. The kit prepared in example 1 is used for detecting free plasma DNA and genomic DNA respectively, the mutation frequency of plasma samples of pregnant women at SLC26A4-IVS7-2A > G is 0.61, and the mutation frequency of leucocyte samples of pregnant women at the position is 0.51. The mutation frequency of the plasma sample was significantly higher than that of the leukocyte sample, indicating that the fetus was homozygous for the mutation at that site. Therefore, the fetus of sample No. 5 is homozygous for the mutation at SLC26A4-IVS7-2A > G, i.e., the fetus sample No. 5 has Pendred's syndrome. This result is consistent with the amniotic fluid results.

The result shows that the kit prepared in the embodiment 1 can non-invasively detect whether the fetus to be detected has the autosomal single gene genetic disease gene mutation or not in the prenatal period and has higher accuracy.

Secondly, the kit prepared in the embodiment 1 is adopted to detect whether the fetus to be detected has X chromosome monogenic genetic disease gene mutation or not in a noninvasive prenatal manner

1. Noninvasive prenatal detection of whether X chromosome monogenic genetic disease gene mutation exists in fetus to be detected by adopting kit prepared in example 1

5 fetal samples to be tested (the serial numbers of the fetal samples to be tested are shown in the 1 st column in the table 9) are taken and tested according to the method of the step A in the embodiment 2. Each sample to be tested consists of a plasma sample of a pregnant woman, a leucocyte sample of the pregnant woman and a peripheral blood sample of a pregnant woman husband.

The results are shown in columns 2-9 of Table 9.

TABLE 9

2. Amniotic fluid gold marker for detecting whether fetus has monogenic genetic disease gene mutation

5 fetal amniotic fluid samples to be detected (the serial numbers of the fetal samples to be detected are shown in the 1 st column in the table 9) are taken for carrying out amniotic fluid gold-labeled detection.

The results are shown in column 10 of Table 9.

The result shows that the kit prepared in the embodiment 1 can non-invasively detect whether the fetus to be detected has X chromosome monogenic genetic disease gene mutation or not in the prenatal period and has higher accuracy.

<110> Beijing Makino Gene science and technology Co., Ltd

<120> a kit for detecting 50 genetic disease single gene mutations and probe set used by the same

<160> 1067

<170> PatentIn version 3.5

<210> 1

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1

gactacatgg gacatgcaca ggctcctgcg cctccagctg cccagagttc ctttctggct 60

gcaggaacga gcggtgtgaa agatcagtcc tgttacgtcg taggttcc 108

<210> 2

<211> 108

<212> DNA

<213>Artificial sequence

<400> 2

gactacatgg gacattgtgg actgcataag cagcaggggt acctgggctt gtcgactggc 60

tccagcagct cgagggtgca gagggaggtc atgtacgtcg taggttcc 108

<210> 3

<211> 108

<212> DNA

<213>Artificial sequence

<400> 3

gactacatgg gacatcctgg tccagtgtgg tctgtgtgac tgagtactcc tcgatgagca 60

ggctgtcctt gtgggagagg aggagctgga agatacgtcg taggttcc 108

<210> 4

<211> 108

<212> DNA

<213>Artificial sequence

<400> 4

gactacatgg gacatgggca cgccccacca tctgcttact tggacttgag atgctgaatg 60

gtgcccatac atcgaaaggc gccctttacc atgtacgtcg taggttcc 108

<210> 5

<211> 108

<212> DNA

<213>Artificial sequence

<400> 5

gactacatgg gacatgatga tgctcacgat gacgttccac agcatgcggc gtgcctgggg 60

gtccatccct gtggtgggct catcctgggg ggttacgtcg taggttcc 108

<210> 6

<211> 108

<212> DNA

<213>Artificial sequence

<400> 6

gactacatgg gacattacca gcagcaccag cggtgggcag ccaatgagtg cgatggctgt 60

ggagagtttc cgcttgttgc ccccactgta cgttacgtcg taggttcc 108

<210> 7

<211> 108

<212> DNA

<213>Artificial sequence

<400> 7

gactacatgg gacatccttt tcgatttctt ctgctggtac acctcgaagc cgggcataaa 60

ggtaaagatg ttctcgtcct gtgagcagct cattacgtcg taggttcc 108

<210> 8

<211> 108

<212> DNA

<213>Artificial sequence

<400> 8

gactacatgg gacataggag caggatactc acctcttgcc tgctacggtg gcatcccctg 60

aggtcactgt ggtgtcccca gtgagcatct tgatacgtcg taggttcc 108

<210> 9

<211> 108

<212> DNA

<213>Artificial sequence

<400> 9

gactacatgg gacatgttcg gaagcctttc acacgtggtc tgcagagtac ccacctctcc 60

agggcgaact ccgacacaca gcctgtccac tgctacgtcg taggttcc 108

<210> 10

<211> 108

<212> DNA

<213>Artificial sequence

<400> 10

gactacatgg gacatattcc cttaccttgg ttagttcatg tagccttaag atgtcagttt 60

tatttccacc agtaataatt ctttgtcttt ctttacgtcg taggttcc 108

<210> 11

<211> 108

<212> DNA

<213>Artificial sequence

<400> 11

gactacatgg gacatacgta ccattgggag aggaagaagt ggcgctggac cagcagggtc 60

aggaggaagt acaccacccc ttccaccacc atgtacgtcg taggttcc 108

<210> 12

<211> 108

<212> DNA

<213>Artificial sequence

<400> 12

gactacatgg gacataccac ccaccaaacc gggcatagac atctgtcaca gcctggctca 60

gtgcaaggtc aatgaggccc cggcccaggc agatacgtcg taggttcc 108

<210> 13

<211> 108

<212> DNA

<213>Artificial sequence

<400> 13

gactacatgg gacatcccgg ttattctcaa ataattccaa gatgaaggta atagcactgc 60

tgttgatgcc gatgaacaga ttagcacaag atatacgtcg taggttcc 108

<210> 14

<211> 108

<212> DNA

<213>Artificial sequence

<400> 14

gactacatgg gacatccaaa cggcttaccc atacagcagg agcagtgcca caagggcagg 60

aaggttttct ggagaagtgt aggctttctt ctgtacgtcg taggttcc 108

<210> 15

<211> 108

<212> DNA

<213>Artificial sequence

<400> 15

gactacatgg gacatcgatg tcccagagga agttggtcac ccagtaggtg gtggggctca 60

ctccactgat aaactggagg tgcttggatt tgttacgtcg taggttcc 108

<210> 16

<211> 108

<212> DNA

<213>Artificial sequence

<400> 16

gactacatgg gacatcactg taatctctga gagctgctcc ttggtcaggt tcaggggttg 60

gctaatgacg gtgattccat actcctcggg gcttacgtcg taggttcc 108

<210> 17

<211> 108

<212> DNA

<213>Artificial sequence

<400> 17

gactacatgg gacatagctc cagagcagat tatacatagg tcaagtacct taatgttgtc 60

ttcagtttct agatgtttaa ggaaatcagg tattacgtcg taggttcc 108

<210> 18

<211> 108

<212> DNA

<213>Artificial sequence

<400> 18

gactacatgg gacattccag tctgtttaca taccccgctc acattcatga tccggccaag 60

gtcgcttaaa aacccaacaa gtgcttcccc cgttacgtcg taggttcc 108

<210> 19

<211> 108

<212> DNA

<213>Artificial sequence

<400> 19

gactacatgg gacatatttc aacaatgaat caatctgaga ttttaattct gataaaaata 60

gtttcttacc tctgttcatt gacccagaat ttgtacgtcg taggttcc 108

<210> 20

<211> 108

<212> DNA

<213>Artificial sequence

<400> 20

gactacatgg gacatagcat aaaaggattt cttcttacct gcttcttata agagcaggat 60

acgtttttac caagaagtcg gagatgttcc tgttacgtcg taggttcc 108

<210> 21

<211> 108

<212> DNA

<213>Artificial sequence

<400> 21

gactacatgg gacatcctgg gggggcggga ggcccccggc accctcgggg cactctggca 60

gcatggtgag cttctccctg gtgctgcacc tgctacgtcg taggttcc 108

<210> 22

<211> 108

<212> DNA

<213>Artificial sequence

<400> 22

gactacatgg gacatcaggg gcgcgtaggc acttacggaa gccacccttc cttcaggcag 60

cggttgccaa agcctggctt attcaggagg acgtacgtcg taggttcc 108

<210> 23

<211> 108

<212> DNA

<213>Artificial sequence

<400> 23

gactacatgg gacatccgcg cacctgaaga aggtgtactg ctgcccatat atccaggggt 60

gaagggtcaa agcggggtat tcgccaaaag gagtacgtcg taggttcc 108

<210> 24

<211> 108

<212> DNA

<213>Artificial sequence

<400> 24

gactacatgg gacatcctgc gccaggaagt ccttgtggct gcggatggtg tgttggaatc 60

tcttgaccag cagcgcctgc acatgctgga ggatacgtcg taggttcc 108

<210> 25

<211> 108

<212> DNA

<213>Artificial sequence

<400> 25

gactacatgg gacatggagg gaggcaagga agggaacaag ccactggctc cagcaccata 60

cccgcaaaca gaggtcctga atcagaatcc tcctacgtcg taggttcc 108

<210> 26

<211> 108

<212> DNA

<213>Artificial sequence

<400> 26

gactacatgg gacatcctct tccaggggag tgtcagaaat tccaaaactg ctgagaccaa 60

ggtcagccag cgtctcctcc agctctctga aaatacgtcg taggttcc 108

<210> 27

<211> 108

<212> DNA

<213>Artificial sequence

<400> 27

gactacatgg gacataccca agtatggccc gtccagtcct taccatccag gacttgttct 60

ggagttaggt catcgacgtg ggctggacac gtgtacgtcg taggttcc 108

<210> 28

<211> 108

<212> DNA

<213>Artificial sequence

<400> 28

gactacatgg gacatcctca ctgcctttcc tttggctctg gatgtttttc atcttgcgca 60

ccaaggttaa gtacaagcct gtgccaaagc agttacgtcg taggttcc 108

<210> 29

<211> 108

<212> DNA

<213>Artificial sequence

<400> 29

gactacatgg gacatacctg agcgatactt caggagcaga tcccagattg agcgtctcga 60

gtaagggtcc accccagagg tgggttcgtc cagtacgtcg taggttcc 108

<210> 30

<211> 108

<212> DNA

<213>Artificial sequence

<400> 30

gactacatgg gacatcctga taggtcctga gcctcttcat tccgcttgtg gtggaggcct 60

gtgtcctcca acatggcttc catctccagc tggtacgtcg taggttcc 108

<210> 31

<211> 108

<212> DNA

<213>Artificial sequence

<400> 31

gactacatgg gacatcttac tggtggaaca ggatgttgtg ctgtggacac atgccaaggc 60

tctgccggac tgcatccagg ctggtttcaa tgttacgtcg taggttcc 108

<210> 32

<211> 108

<212> DNA

<213>Artificial sequence

<400> 32

gactacatgg gacatcaagg tggtggtttt cccagctcca ttgtggccca ggaatgcggt 60

gatctggttc tcgtagaagg tgatgttcag acgtacgtcg taggttcc 108

<210> 33

<211> 108

<212> DNA

<213>Artificial sequence

<400> 33

gactacatgg gacatctgtg tattctttat cggggtttta ccgtgtattc cttctgggtg 60

ctctggatcc tccgtttcct ctgttagggg ctctacgtcg taggttcc 108

<210> 34

<211> 108

<212> DNA

<213>Artificial sequence

<400> 34

gactacatgg gacatgattt caaacattaa gatttgtgtt ttaaaggact caccttcacc 60

gccaagccaa tacgactctt gtagaagaaa gtatacgtcg taggttcc 108

<210> 35

<211> 108

<212> DNA

<213>Artificial sequence

<400> 35

gactacatgg gacatcctgg aaacacctga tcaaggtacc aagcgagtaa gccatagaca 60

gcagcatcaa ggagcatcat ctgcatggac agctacgtcg taggttcc 108

<210> 36

<211> 108

<212> DNA

<213>Artificial sequence

<400> 36

gactacatgg gacatccaca gccttcttca gctcagcggt catgcggtcc tgccaggcga 60

agcacaggat gtgtggcagg tagagggtga aattacgtcg taggttcc 108

<210> 37

<211> 108

<212> DNA

<213>Artificial sequence

<400> 37

gactacatgg gacatccatg atgaatatcg tcaggaggaa gatgctcatc gacatgatgg 60

agaagctgtc caggaaccag gtacaccaaa tcatacgtcg taggttcc 108

<210> 38

<211> 108

<212> DNA

<213>Artificial sequence

<400> 38

gactacatgg gacatcgaat cgtccacgaa gcaggggtag ggcatctgct ggaggtagat 60

tccaactgga gcctccgcct gcacctggct ccttacgtcg taggttcc 108

<210> 39

<211> 108

<212> DNA

<213>Artificial sequence

<400> 39

gactacatgg gacatatact tcacgtgggg tggtagagag ctggtccagg gatacatgtc 60

agggaatacc actccggccc agaacatgtt ttctacgtcg taggttcc 108

<210> 40

<211> 108

<212> DNA

<213>Artificial sequence

<400> 40

gactacatgg gacatcctcc aggtattgat tgaccaggcg gagggtgcga tcagtgatgt 60

taaatatgtc cctccagtcg aagttggcca tgttacgtcg taggttcc 108

<210> 41

<211> 108

<212> DNA

<213>Artificial sequence

<400> 41

gactacatgg gacataaccc cccttactct gatcatgttc atctgtgtgc tgttgtcaaa 60

gaagtaccag atctggggcc ctacttcttc ccatacgtcg taggttcc 108

<210> 42

<211> 108

<212> DNA

<213>Artificial sequence

<400> 42

gactacatgg gacatcattc ttcagtatcc ttcgtgctgc aggtgaatca ggagtgtaca 60

ggatttttcc catcagcaaa ggctttgccg ccctacgtcg taggttcc 108

<210> 43

<211> 108

<212> DNA

<213>Artificial sequence

<400> 43

gactacatgg gacatcttgt tcttctgtca taagaataga taggatcctt ccttgtggag 60

tcaatcccca gaaaggcctt atagttattg tcttacgtcg taggttcc 108

<210> 44

<211> 108

<212> DNA

<213>Artificial sequence

<400> 44

gactacatgg gacatataat tactaccatc aggctactca cctcttgaat tcttggtgac 60

atatcagata atattcctcc ccaagatctc agatacgtcg taggttcc 108

<210> 45

<211> 108

<212> DNA

<213>Artificial sequence

<400> 45

gactacatgg gacatccaca cggaagagct tgaagaagtc cacgttggca tacagagtgt 60

cttctatcca ctgtagggtg ccctgggaga gggtacgtcg taggttcc 108

<210> 46

<211> 108

<212> DNA

<213>Artificial sequence

<400> 46

gactacatgg gacatcccct acctgctctg gacggacttg agagttgatc agaaggtaga 60

ccactgagtc agacaggccg atgtttttaa tgatacgtcg taggttcc 108

<210> 47

<211> 108

<212> DNA

<213>Artificial sequence

<400> 47

gactacatgg gacatcctgc aattctctcc gggtgagtcc ggagggtgtc catgaattgg 60

gacaagatgt gtagctctgt ccaaatacgg ccatacgtcg taggttcc 108

<210> 48

<211> 108

<212> DNA

<213>Artificial sequence

<400> 48

gactacatgg gacatcatgg agttgttata gtttgacaca attccaggag attctcctgg 60

ggtggggctt tgaaaacagg gattgttcac atttacgtcg taggttcc 108

<210> 49

<211> 108

<212> DNA

<213>Artificial sequence

<400> 49

gactacatgg gacatcccaa gctaccctgc tatgcttaca ttcatgatgg ctgtagagtg 60

ggttggcatt ccttaaccag atcaagacca gaatacgtcg taggttcc 108

<210> 50

<211> 108

<212> DNA

<213>Artificial sequence

<400> 50

gactacatgg gacatccaca cctcattttt aaaccacaga cagtaactgt taccttttgc 60

cttttccgca gggtccagtt cttccagagc aaatacgtcg taggttcc 108

<210> 51

<211> 108

<212> DNA

<213>Artificial sequence

<400> 51

gactacatgg gacatcatgc cggtgctctc caggccccgg ccctggcggg ggaacacgct 60

gaagcgcacg gccgtgctcc tggccctcgc ggctacgtcg taggttcc 108

<210> 52

<211> 108

<212> DNA

<213>Artificial sequence

<400> 52

gactacatgg gacatggccc tgctacagcg ctcctaccag gacctggcct cgcagatcaa 60

cctcatcctt ctggaacgcc tgtggtatgt tattacgtcg taggttcc 108

<210> 53

<211> 108

<212> DNA

<213>Artificial sequence

<400> 53

gactacatgg gacataaggc agccttggaa aagaaggagg aggagctggt gagcgagcgc 60

acagaagcct tcactattgc ccgcaacctc ctgtacgtcg taggttcc 108

<210> 54

<211> 108

<212> DNA

<213>Artificial sequence

<400> 54

gactacatgg gacatctaca cagcccgggt gcacgagatg ttccaggtat ttgaagatgt 60

tcagcgctgt cacttcaaga ggcccaggga gcttacgtcg taggttcc 108

<210> 55

<211> 108

<212> DNA

<213>Artificial sequence

<400> 55

gactacatgg gacatgcccc gctgtgctgt ctctgcaggc caggtggtgg atgtggaaca 60

ggggatcatc tgcgagaaca tccccatcgt cactacgtcg taggttcc 108

<210> 56

<211> 108

<212> DNA

<213>Artificial sequence

<400> 56

gactacatgg gacatggtgg aggaaggcat gcatctgctc atcacaggcc ccaatggctg 60

cggcaagagc tccctgttcc ggatcctggg tggtacgtcg taggttcc 108

<210> 57

<211> 108

<212> DNA

<213>Artificial sequence

<400> 57

gactacatgg gacattgaaa gatttcaaat cctctagaag ccaaaatggg acacagtaaa 60

cagattcgaa ttttacttct gaacgaaatg gagtacgtcg taggttcc 108

<210> 58

<211> 108

<212> DNA

<213>Artificial sequence

<400> 58

gactacatgg gacatgggta tgagctacag ttccgattag gcccaacttt acagggaaaa 60

gcagttaccg tgtatacaaa ttacccattt ccttacgtcg taggttcc 108

<210> 59

<211> 108

<212> DNA

<213>Artificial sequence

<400> 59

gactacatgg gacatgaaat gagaaaagtg gtggaggtta catagttgtg gaccccattt 60

tacgtgttgg tgctgataat catgtgctac ccttacgtcg taggttcc 108

<210> 60

<211> 108

<212> DNA

<213>Artificial sequence

<400> 60

gactacatgg gacatggcta caacatgatt cattttaccc cattgcagac tcttggacta 60

tctaggtcat gctactccct tgccaatcag ttatacgtcg taggttcc 108

<210> 61

<211> 108

<212> DNA

<213>Artificial sequence

<400> 61

gactacatgg gacatgctgc taatagtaaa tggatccagg aacatccaga atgtgcctat 60

aatcttgtga attctccaca cttaaaacct gcctacgtcg taggttcc 108

<210> 62

<211> 108

<212> DNA

<213>Artificial sequence

<400> 62

gactacatgg gacatattga catttttcag tccatccgaa aaataatttg ggaggatatt 60

tttccaaagc ttaaactctg ggaatttttc caatacgtcg taggttcc 108

<210> 63

<211> 108

<212> DNA

<213>Artificial sequence

<400> 63

gactacatgg gacatttctt ttagaaaata ggcgagtaac caagtctgat ccaaaccaac 60

accttacgat tattcaagat cctgaataca gactacgtcg taggttcc 108

<210> 64

<211> 108

<212> DNA

<213>Artificial sequence

<400> 64

gactacatgg gacatatttc tccatctgct ctagcaaggg gccagcagca attgaagaat 60

gctgtaattg gtttcataaa agaatggagg aattacgtcg taggttcc 108

<210> 65

<211> 108

<212> DNA

<213>Artificial sequence

<400> 65

gactacatgg gacataacac aatttaatgt ttttcaggca gttaattgcc ttttgggaaa 60

tgtgttttat gaacgactgg ctggccatgg tcctacgtcg taggttcc 108

<210> 66

<211> 108

<212> DNA

<213>Artificial sequence

<400> 66

gactacatgg gacatggtat tttactttcc catttgaaga gatagacttc tccatggaag 60

aatctatgat tcatctgcca aataaagctt gtttacgtcg taggttcc 108

<210> 67

<211> 108

<212> DNA

<213>Artificial sequence

<400> 67

gactacatgg gacatggttc agaagtttac ctaaggagag aacttatttg ctggggagac 60

agtgttaaat tacgctatgg gaataaacca gagtacgtcg taggttcc 108

<210> 68

<211> 108

<212> DNA

<213>Artificial sequence

<400> 68

gactacatgg gacatttttt acagtacatg ttggatgctg ctaggaattt gcaacccaat 60

ttatatgtag tagctgaact gttcacagga agttacgtcg taggttcc 108

<210> 69

<211> 108

<212> DNA

<213>Artificial sequence

<400> 69

gactacatgg gacatgaggc aatgagtgca tataatagtc atgaagaggg cagattagtt 60

taccgatatg gaggagaacc tgttggatcc ttttacgtcg taggttcc 108

<210> 70

<211> 108

<212> DNA

<213>Artificial sequence

<400> 70

gactacatgg gacatttgtt gttgttgtct tctagcatag atcagcgtat gatgctcttc 60

caagtactac aattgtttct atggcatgtt gtgtacgtcg taggttcc 108

<210> 71

<211> 108

<212> DNA

<213>Artificial sequence

<400> 71

gactacatgg gacatgattt cagtggtttc tgaagaacgg ttttacacta agtggaatcc 60

tgaagcattg ccttcaaaca caggtgaagt taatacgtcg taggttcc 108

<210> 72

<211> 108

<212> DNA

<213>Artificial sequence

<400> 72

gactacatgg gacatggtgt atgtggatca agttgatgaa gacatagtgg cagtaacaag 60

acactcacct agcatccatc agtctgttgt ggctacgtcg taggttcc 108

<210> 73

<211> 108

<212> DNA

<213>Artificial sequence

<400> 73

gactacatgg gacatattcc taggcaaaat tgaagaagta gttcttgaag ctagaactat 60

tgagagaaac acgaaacctt ataggaagga tgatacgtcg taggttcc 108

<210> 74

<211> 108

<212> DNA

<213>Artificial sequence

<400> 74

gactacatgg gacattactt tttttcaagc ttaatgaaag taaaattgtt aaacaagctg 60

gagttgccac aaaagggccc aatgaatata ttctacgtcg taggttcc 108

<210> 75

<211> 108

<212> DNA

<213>Artificial sequence

<400> 75

gactacatgg gacatcagag ttagtcttga tccacatgca caagtcgctg ttggaattct 60

tcgaaatcat ctgacacaat tcagtcctca ctttacgtcg taggttcc 108

<210> 76

<211> 108

<212> DNA

<213>Artificial sequence

<400> 76

gactacatgg gacatcttag tcttgcctcc agattaactt tggctgagct aaatcagatc 60

ctttaccgat gtgaatcaga agaaaaggaa gattacgtcg taggttcc 108

<210> 77

<211> 108

<212> DNA

<213>Artificial sequence

<400> 77

gactacatgg gacataggtt taatgtctgt attggcagaa ataagaccaa agaatgactt 60

ggggcatcct ttttgtaata atttgagatc tggtacgtcg taggttcc 108

<210> 78

<211> 108

<212> DNA

<213>Artificial sequence

<400> 78

gactacatgg gacatacagg ttggtaaatg gttgcaggct atgttcttct acctgaagca 60

gatcccacgt taccttatcc catgttactt tgatacgtcg taggttcc 108

<210> 79

<211> 108

<212> DNA

<213>Artificial sequence

<400> 79

gactacatgg gacatgcttt gttcagaatg gttcaacctt tgtgaaacac ctttcattgg 60

gttcagttca actgtgtgga gtaggaaaat tcctacgtcg taggttcc 108

<210> 80

<211> 108

<212> DNA

<213>Artificial sequence

<400> 80

gactacatgg gacatgttgt gttttttttg ttaggcttac ctcatttttc ttctggtatt 60

ttccgctgct ggggaaggga tacttttatt gcatacgtcg taggttcc 108

<210> 81

<211> 108

<212> DNA

<213>Artificial sequence

<400> 81

gactacatgg gacatggaat attattttag catttgcggg taccctgagg catggtctca 60

ttcctaatct actgggtgaa ggaatttatg ccatacgtcg taggttcc 108

<210> 82

<211> 108

<212> DNA

<213>Artificial sequence

<400> 82

gactacatgg gacatttatg tctcaaacag gatcagccat tgtttgaagt catacaggaa 60

gcaatgcaaa aacacatgca gggcatacag ttctacgtcg taggttcc 108

<210> 83

<211> 108

<212> DNA

<213>Artificial sequence

<400> 83

gactacatgg gacattaggt tttaatataa ctgcaggagt tgatgaagaa acaggatttg 60

tttatggagg aaatcgtttc aattgtggca cattacgtcg taggttcc 108

<210> 84

<211> 108

<212> DNA

<213>Artificial sequence

<400> 84

gactacatgg gacatttttt taattttaga gatgggtctg ctgtggaaat tgtgggcctg 60

agtaaatctg ctgttcgctg gttgctggaa ttatacgtcg taggttcc 108

<210> 85

<211> 108

<212> DNA

<213>Artificial sequence

<400> 85

gactacatgg gacatggaaa ggctataaag gtctcatatg atgagtggaa cagaaaaata 60

caagacaact ttgaaaagct atttcatgtt tcctacgtcg taggttcc 108

<210> 86

<211> 108

<212> DNA

<213>Artificial sequence

<400> 86

gactacatgg gacatatttg tttttggcat tcactaggcc cctgagctct ttactacaga 60

aaaagcatgg aaagctttgg agattgcaga aaatacgtcg taggttcc 108

<210> 87

<211> 108

<212> DNA

<213>Artificial sequence

<400> 87

gactacatgg gacatttaac ttaaatttca atcattttgc agtgatatgg tttactgtgg 60

aatttatgac aatgcattag acaatgacaa ctatacgtcg taggttcc 108

<210> 88

<211> 108

<212> DNA

<213>Artificial sequence

<400> 88

gactacatgg gacatttagg agtggctgtg gcctattggg tattttcttc gtgcaaaatt 60

atatttttcc agattgatgg gcccggagac tactacgtcg taggttcc 108

<210> 89

<211> 108

<212> DNA

<213>Artificial sequence

<400> 89

gactacatgg gacattcttt cattcagatc cccttggaaa ggacttccag aactgaccaa 60

tgagaatgcc cagtactgtc ctttcagctg tgatacgtcg taggttcc 108

<210> 90

<211> 108

<212> DNA

<213>Artificial sequence

<400> 90

gactacatgg gacatatcag atgtactgct cctcatccct gccattcagg agcagagacc 60

acttgtcccc atcatcgtct gctgcagcgc tgttacgtcg taggttcc 108

<210> 91

<211> 108

<212> DNA

<213>Artificial sequence

<400> 91

gactacatgg gacattccac ctgaggggac tcaccacttg agctgcaggg atgagagcac 60

cacagacaca gaggaggctg ccatggccgc tgatacgtcg taggttcc 108

<210> 92

<211> 108

<212> DNA

<213>Artificial sequence

<400> 92

gactacatgg gacatagagc tgcctacctg ctgcaatggg tatcccaacc aggttataaa 60

tcagtgccag gaccaggttg atgcgtatcc ttctacgtcg taggttcc 108

<210> 93

<211> 108

<212> DNA

<213>Artificial sequence

<400> 93

gactacatgg gacatctctg ataaggacga cgtcggctgc ctcgatggcc acatccgtgc 60

cggtgccaat ggccacaccc atgtctgcct gggtacgtcg taggttcc 108

<210> 94

<211> 108

<212> DNA

<213>Artificial sequence

<400> 94

gactacatgg gacatcctgg gtggcaatag ctctggctgt cttccggttg tcccccgtga 60

tcagaaccac gtccacaccc atgctctgca gcgtacgtcg taggttcc 108

<210> 95

<211> 108

<212> DNA

<213>Artificial sequence

<400> 95

gactacatgg gacatccgtc aatagccacc aggatggctg tctgtccttt catctcgtgg 60

tctgtcatag cgtcactgac atcgctagaa atgtacgtcg taggttcc 108

<210> 96

<211> 108

<212> DNA

<213>Artificial sequence

<400> 96

gactacatgg gacatccttt ttctgcggga aggctgccag cctcattcag gtgactggcc 60

ggtgcactca aagggcgctc actgtgggcc aggtacgtcg taggttcc 108

<210> 97

<211> 108

<212> DNA

<213>Artificial sequence

<400> 97

gactacatgg gacatcctct ttacagtatt tggtgactgc cacgcccaag gggtgttcac 60

tgctggcctc cgcagtcccc accacagcca gaatacgtcg taggttcc 108

<210> 98

<211> 108

<212> DNA

<213>Artificial sequence

<400> 98

gactacatgg gacatccttg tgcgccatct ccaggggctt gcctcccttg atgaggatgc 60

cgttctgcgc ggccaccccg gtgcccacca tgatacgtcg taggttcc 108

<210> 99

<211> 108

<212> DNA

<213>Artificial sequence

<400> 99

gactacatgg gacattacag gaaagtatct ctgaacaaca ccaaaatcga taaaaccgat 60

tacaatccat accaccaacg tcaaagttga cattacgtcg taggttcc 108

<210> 100

<211> 108

<212> DNA

<213>Artificial sequence

<400> 100

gactacatgg gacatccttt gacatctgag cctcttccac cagtttcaca atctgagcca 60

aagtggtgtc attgcccacg tgggtagctt taatacgtcg taggttcc 108

<210> 101

<211> 108

<212> DNA

<213>Artificial sequence

<400> 101

gactacatgg gacatatctc acctgtgatg agggactcat cagccatggt attgccttcc 60

aggactttcc catccactgg aaactttccc ccatacgtcg taggttcc 108

<210> 102

<211> 108

<212> DNA

<213>Artificial sequence

<400> 102

gactacatgg gacataagac atttgataac cataactcac ctgatgatta aattgtcctc 60

accaagggtc acaacggtgg cttctgtggc ttgtacgtcg taggttcc 108

<210> 103

<211> 108

<212> DNA

<213>Artificial sequence

<400> 103

gactacatgg gacatccttt gccaagtgtt ccagccaccg gcccagggca atgaacacaa 60

agagcatggg gggcgtgtcg aagaatgtca cagtacgtcg taggttcc 108

<210> 104

<211> 108

<212> DNA

<213>Artificial sequence

<400> 104

gactacatgg gacatcctgg acaaaggtac acaagataaa gaagatgaga tttagaatgg 60

acagtcctgg aatgatgttg tggtccagga ccatacgtcg taggttcc 108

<210> 105

<211> 108

<212> DNA

<213>Artificial sequence

<400> 105

gactacatgg gacatgagct ggagtttatc ttttgtgttc tacctactgc tttatttcca 60

tcttgtggtc caagtgatga gcgttggggt ttctacgtcg taggttcc 108

<210> 106

<211> 108

<212> DNA

<213>Artificial sequence

<400> 106

gactacatgg gacatcctca ataattttga taatatcccg tggaccgata atttccgggt 60

caaacttaac aagggctttg ctggtggcaa gggtacgtcg taggttcc 108

<210> 107

<211> 108

<212> DNA

<213>Artificial sequence

<400> 107

gactacatgg gacatctgtc agctcaatgt tgccatcgga gcctgcgtag tcctccatga 60

ctgctgcctc aaaacccagg tcctggatga acttacgtcg taggttcc 108

<210> 108

<211> 108

<212> DNA

<213>Artificial sequence

<400> 108

gactacatgg gacatccagc ttctttctgc agattccttt ctatgttaga cacacaggat 60

gcacaggtca tgcctttgat ctgtaagaag cactacgtcg taggttcc 108

<210> 109

<211> 108

<212> DNA

<213>Artificial sequence

<400> 109

gactacatgg gacatccaga aacgactgaa gcctcaaatc ccatgtcttc tatagcagct 60

ctgagttctt ctgggctaat tacagaggga ttatacgtcg taggttcc 108

<210> 110

<211> 108

<212> DNA

<213>Artificial sequence

<400> 110

gactacatgg gacatggtgg gagtgagcac gctgcgcgga cgcgggggaa caaaactcac 60

tttccgactg gccccttctc tggctgtgat ctgtacgtcg taggttcc 108

<210> 111

<211> 108

<212> DNA

<213>Artificial sequence

<400> 111

gactacatgg gacatgaaga gaagtagaac caagaagctt attggcgagc tcaggattct 60

tcatccatga catctagaat attgctcaga agatacgtcg taggttcc 108

<210> 112

<211> 108

<212> DNA

<213>Artificial sequence

<400> 112

gactacatgg gacatcctca tgccagcaac tgtacatgat ggtatatacc ttctctgaag 60

ccagatgagg cctgtagaga cgtaggcctt gggtacgtcg taggttcc 108

<210> 113

<211> 108

<212> DNA

<213>Artificial sequence

<400> 113

gactacatgg gacattatcc acttaccaaa agcccaaatg tcagatttgc tgctgaactt 60

gctatacatc aggacttccg gtggggacca ccgtacgtcg taggttcc 108

<210> 114

<211> 108

<212> DNA

<213>Artificial sequence

<400> 114

gactacatgg gacattttac ttctggaggg aaagatgaaa aagccacact cacctggaca 60

ggccgaaatc agatacttta acaactcctt gattacgtcg taggttcc 108

<210> 115

<211> 108

<212> DNA

<213>Artificial sequence

<400> 115

gactacatgg gacatccagg tctcggtgaa ggaactgctt tgactccagg tattccatgg 60

cttcacagac atccttgcac atctctagca gcttacgtcg taggttcc 108

<210> 116

<211> 108

<212> DNA

<213>Artificial sequence

<400> 116

gactacatgg gacatcatca tgactttggc ttcttcaatg aattcatctt cagacatgga 60

gccttctttg atcatcttga tggccacgtc gtatacgtcg taggttcc 108

<210> 117

<211> 108

<212> DNA

<213>Artificial sequence

<400> 117

gactacatgg gacatagtcc accctacccc agagaaataa ggagttaccg tatcccaggc 60

ctgcagtgga aggtgcattc ttgttttgtt gagtacgtcg taggttcc 108

<210> 118

<211> 108

<212> DNA

<213>Artificial sequence

<400> 118

gactacatgg gacattactc acctgcagag ttgtgctgat ggtagttaat gagctcaggg 60

atggtgctga aaaggtgctt ctcagccagg taatacgtcg taggttcc 108

<210> 119

<211> 108

<212> DNA

<213>Artificial sequence

<400> 119

gactacatgg gacatgtcct cagggccttg gaatagtagc actcaccctg tggatttagc 60

aaacacagac actgtatatt tgccagcttt gcttacgtcg taggttcc 108

<210> 120

<211> 108

<212> DNA

<213>Artificial sequence

<400> 120

gactacatgg gacatcttat gcaaggagaa tgctgtgtgc tagtggttcc acacttacct 60

cttgctttag cagttgctca gcctgactcc gagtacgtcg taggttcc 108

<210> 121

<211> 108

<212> DNA

<213>Artificial sequence

<400> 121

gactacatgg gacattcctc ctggaagatt gtggactgac ataaacatac ttactcatac 60

atttctatgg agtcttctgc ttcagtgaca tagtacgtcg taggttcc 108

<210> 122

<211> 108

<212> DNA

<213>Artificial sequence

<400> 122

gactacatgg gacatcccat ttttatctcg tgctctccac catggtaagt tgctttcctc 60

caagataaaa tattcatcac ccttccgcag ctgtacgtcg taggttcc 108

<210> 123

<211> 108

<212> DNA

<213>Artificial sequence

<400> 123

gactacatgg gacatcattt aagcagtggc agcacccagt ttccctgtat acctggtcct 60

cctcaggcgt tgggggaaga ggcttttttg tcttacgtcg taggttcc 108

<210> 124

<211> 108

<212> DNA

<213>Artificial sequence

<400> 124

gactacatgg gacatgctta cttccattcc tgttctccaa aatttggcag cccatagcat 60

ttttggctgt ctgagagcag cagagatact gcctacgtcg taggttcc 108

<210> 125

<211> 108

<212> DNA

<213>Artificial sequence

<400> 125

gactacatgg gacatggaaa catttatttt ccaaataatt ctcaccgttt ttgagctggt 60

gaatccaccg cttccttagt tcttcagttg gggtacgtcg taggttcc 108

<210> 126

<211> 108

<212> DNA

<213>Artificial sequence

<400> 126

gactacatgg gacatgggcc tttcgagatt tggtgagaga aaataactca cctggaaggg 60

ataagggaac ctttcaatga ttgaaatttg ctctacgtcg taggttcc 108

<210> 127

<211> 108

<212> DNA

<213>Artificial sequence

<400> 127

gactacatgg gacatcagac attggtctct tcttaccgga atctgtcttt ctggaggagg 60

atttttttca ggaaccactg tttcaacaca agttacgtcg taggttcc 108

<210> 128

<211> 108

<212> DNA

<213>Artificial sequence

<400> 128

gactacatgg gacatcccca cgttcaaagt catactcata gtaggagagt ttgtgcacgg 60

tcaagagaaa caggcgcttc ttgaagttta gagtacgtcg taggttcc 108

<210> 129

<211> 108

<212> DNA

<213>Artificial sequence

<400> 129

gactacatgg gacatcatgc cgaccgtcat tagcgcatct gtggctccaa ggacagcggc 60

tgagccccgg tccccagggc cagttcctca ccctacgtcg taggttcc 108

<210> 130

<211> 108

<212> DNA

<213>Artificial sequence

<400> 130

gactacatgg gacatttatt cttacctggt catttccttt ttgtttcaca ggaaatttgc 60

gagaatcccc gatttatcat tgatggagcc aactacgtcg taggttcc 108

<210> 131

<211> 108

<212> DNA

<213>Artificial sequence

<400> 131

gactacatgg gacattctgc ctgcagggga ctgctggttt ctcgcagcca ttgcctgcct 60

gaccctgaac cagcaccttc ttttccgagt cattacgtcg taggttcc 108

<210> 132

<211> 108

<212> DNA

<213>Artificial sequence

<400> 132

gactacatgg gacatgcagt tctggcgcta tggagagtgg gtggacgtgg ttatagatga 60

ctgcctgcca acgtacaaca atcaactggt ttttacgtcg taggttcc 108

<210> 133

<211> 108

<212> DNA

<213>Artificial sequence

<400> 133

gactacatgg gacatggctc catggttcct acgaagctct gaaaggtggg aacaccacag 60

aggccatgga ggacttcaca ggaggggtgg cagtacgtcg taggttcc 108

<210> 134

<211> 108

<212> DNA

<213>Artificial sequence

<400> 134

gactacatgg gacatggatg gcacgaacat gacctatgga acctctcctt ctggtctgaa 60

catgggggag ttgattgcac ggatggtaag gaatacgtcg taggttcc 108

<210> 135

<211> 108

<212> DNA

<213>Artificial sequence

<400> 135

gactacatgg gacattaatg ggttctctgg ttactgctct acagacaatc attccggttc 60

agtatgagac aagaatggcc tgcgggctgg tcatacgtcg taggttcc 108

<210> 136

<211> 108

<212> DNA

<213>Artificial sequence

<400> 136

gactacatgg gacatgcatg agagctcttt ctgtgtgctt aaggtcccgt tcaaaggtga 60

gaaagtgaag ctggtgcggc tgcggaatcc gtgtacgtcg taggttcc 108

<210> 137

<211> 108

<212> DNA

<213>Artificial sequence

<400> 137

gactacatgg gacatctgct tccttaattc ctccattttc ccaccagatg gaaggactgg 60

agctttgtgg acaaagatga gaaggcccgt ctgtacgtcg taggttcc 108

<210> 138

<211> 108

<212> DNA

<213>Artificial sequence

<400> 138

gactacatgg gacatggatg tcctatgagg atttcatcta ccatttcaca aagttggaga 60

tctgcaacct cacggccgat gctctgcagt ctgtacgtcg taggttcc 108

<210> 139

<211> 108

<212> DNA

<213>Artificial sequence

<400> 139

gactacatgg gacatgatac tttctggacc aaccctcagt accgtctgaa gctcctggag 60

gaggacgatg accctgatga ctcggaggtg atttacgtcg taggttcc 108

<210> 140

<211> 108

<212> DNA

<213>Artificial sequence

<400> 140

gactacatgg gacattgcct tccgcaggct cctcatcctc attcacatct gaagcatctt 60

cctttctgtt tcttctcaag gttcccaaag aggtacgtcg taggttcc 108

<210> 141

<211> 108

<212> DNA

<213>Artificial sequence

<400> 141

gactacatgg gacatgatgc acgggaacaa gcagcacctg cagaaggact tcttcctgta 60

caacgcctcc aaggccagga gcaaaaccta cattacgtcg taggttcc 108

<210> 142

<211> 108

<212> DNA

<213>Artificial sequence

<400> 142

gactacatgg gacattcctg cttgcttctg gtgacactga gaccccacat gtctgtattc 60

ctcacaggga agttgaaaat accatctccg tggtacgtcg taggttcc 108

<210> 143

<211> 108

<212> DNA

<213>Artificial sequence

<400> 143

gactacatgg gacattggcg gttctgagaa cttacttttc acttattctg catttactgt 60

ttccttttct tatgcagaaa aagaaaaaaa ccatacgtcg taggttcc 108

<210> 144

<211> 108

<212> DNA

<213>Artificial sequence

<400> 144

gactacatgg gacatcctcc tctctccagc ccatcatctt cgtttcggac agagcaaaca 60

gcaacaagga gctgggtgtg gaccaggagt cagtacgtcg taggttcc 108

<210> 145

<211> 108

<212> DNA

<213>Artificial sequence

<400> 145

gactacatgg gacatctgtg aaccagtttt cctttgtgcc tccacagcca cagcctggca 60

gctctgatca ggaaagtgag gaacagcaac aattacgtcg taggttcc 108

<210> 146

<211> 108

<212> DNA

<213>Artificial sequence

<400> 146

gactacatgg gacatctgta ctcctgaacc atgaccctcc tctcccttcc tcctcaggac 60

atggagatct gtgcagatga gctcaagaag gtctacgtcg taggttcc 108

<210> 147

<211> 108

<212> DNA

<213>Artificial sequence

<400> 147

gactacatgg gacatgtctc aaagcagctc ctcactcttc tccatccccc cagacaagga 60

cctgaagaca cacgggttca cactggagtc ctgtacgtcg taggttcc 108

<210> 148

<211> 108

<212> DNA

<213>Artificial sequence

<400> 148

gactacatgg gacatgctgt gtgctgtgta gccctgacct ccctcctcca gacagatggc 60

tctggaaagc tcaacctgca ggagttccac cactacgtcg taggttcc 108

<210> 149

<211> 108

<212> DNA

<213>Artificial sequence

<400> 149

gactacatgg gacattgacc tccatcctca aattttctat tgccagaaaa ttttcaaaca 60

ctatgacaca gaccagtccg gcaccatcaa cagtacgtcg taggttcc 108

<210> 150

<211> 108

<212> DNA

<213>Artificial sequence

<400> 150

gactacatgg gacattcccc tccacaggat tccacctcaa caaccagctc tatgacatca 60

ttaccatgcg gtacgcagac aaacacatga acatacgtcg taggttcc 108

<210> 151

<211> 108

<212> DNA

<213>Artificial sequence

<400> 151

gactacatgg gacattgcgc ctgtaactgg cctctggcct gtgcattctt tcacaggagc 60

ttttcatgca tttgacaagg atggagatgg tattacgtcg taggttcc 108

<210> 152

<211> 108

<212> DNA

<213>Artificial sequence

<400> 152

gactacatgg gacatggggg ggggggggtc actcttttct gatctacatt ctgatcttgg 60

gacttctttc agtggctgca gctcaccatg tattacgtcg taggttcc 108

<210> 153

<211> 108

<212> DNA

<213>Artificial sequence

<400> 153

gactacatgg gacattttac aggaagcaga cagggccaac gtcgaagccg aattcctggt 60

ctggggcacc aacgtccaag ggggccacat cgatacgtcg taggttcc 108

<210> 154

<211> 108

<212> DNA

<213>Artificial sequence

<400> 154

gactacatgg gacatccgtg cagccatcga cagtgacgct gtaggtgaag cggctgttgc 60

cctcggcgcg gatctcgatc tcgttggagc ccttacgtcg taggttcc 108

<210> 155

<211> 108

<212> DNA

<213>Artificial sequence

<400> 155

gactacatgg gacatcctgg aatccatcgg tcatgctctc gccgaaccag acatgcctct 60

tgtccttggg gttcttgctg atgtaccagt tcttacgtcg taggttcc 108

<210> 156

<211> 108

<212> DNA

<213>Artificial sequence

<400> 156

gactacatgg gacatccact cttccagtca gagtggcaca tcttgaggtc acggcaggtg 60

cgggcggggt tcttgcggct gccctctggg ctctacgtcg taggttcc 108

<210> 157

<211> 108

<212> DNA

<213>Artificial sequence

<400> 157

gactacatgg gacatgatga ggggctacat acaacaggac cagcatcacc agtgcgaccg 60

cgaggaccag ggggcccaat ggggccaggg agatacgtcg taggttcc 108

<210> 158

<211> 108

<212> DNA

<213>Artificial sequence

<400> 158

gactacatgg gacatctggg cttggggctc aggaagagga gagagaaggc atgacttact 60

cggggaccag caggaccaga ggctccagag ggatacgtcg taggttcc 108

<210> 159

<211> 108

<212> DNA

<213>Artificial sequence

<400> 159

gactacatgg gacatgggct gagcatactt acaggagggc cagggggacc ctggaggcca 60

gagaagccac ggtgaccctt tatgcctctg tcgtacgtcg taggttcc 108

<210> 160

<211> 108

<212> DNA

<213>Artificial sequence

<400> 160

gactacatgg gacattctgt agagttctaa aggcatgggg gacacagcag ggtacttacg 60

gcggggccac gggcgccaac agggccgaca ggatacgtcg taggttcc 108

<210> 161

<211> 108

<212> DNA

<213>Artificial sequence

<400> 161

gactacatgg gacatggagc ccagctactt acagtctcac cacgatcacc actcttgcca 60

gcagggccaa cgggggggtc cagcggggcc ggttacgtcg taggttcc 108

<210> 162

<211> 108

<212> DNA

<213>Artificial sequence

<400> 162

gactacatgg gacatgaagc agcagacaag gctgtggtca tggagtgttg ccatcttacc 60

ttggcgccag gagaaccgtc tcgtccaggg gaatacgtcg taggttcc 108

<210> 163

<211> 108

<212> DNA

<213>Artificial sequence

<400> 163

gactacatgg gacatggctg gggactgctc acctcacgtc cagattcacc agggggtcca 60

gccaatccag gggggcccat gggaccaggg ggatacgtcg taggttcc 108

<210> 164

<211> 108

<212> DNA

<213>Artificial sequence

<400> 164

gactacatgg gacatgtgag gggggcactt acagaggggc caggaagacc agggaagcct 60

ctctctcctc tctgaccagg caggccgacc acatacgtcg taggttcc 108

<210> 165

<211> 108

<212> DNA

<213>Artificial sequence

<400> 165

gactacatgg gacatcagca ggaccatcag caccagggga tcctttctcg ccagcagggc 60

cagggggacc agggggacca acttcaccag gactacgtcg taggttcc 108

<210> 166

<211> 108

<212> DNA

<213>Artificial sequence

<400> 166

gactacatgg gacatagcac ccccaaccta gagcagtgga ctctgctgca gagacttaca 60

gaggggccag gaggaccgac tcggccagca gcatacgtcg taggttcc 108

<210> 167

<211> 108

<212> DNA

<213>Artificial sequence

<400> 167

gactacatgg gacattgggg agaggggaga ggctcaacag agaggcgggt gatactcaca 60

gggggaccag cgctgccgcg agcacctttg gcttacgtcg taggttcc 108

<210> 168

<211> 108

<212> DNA

<213>Artificial sequence

<400> 168

gactacatgg gacatagggc caagccactc acaatggggc cagggggtcc agcgggtccg 60

gcagggccag ggggaccagc atcgccttta gcatacgtcg taggttcc 108

<210> 169

<211> 108

<212> DNA

<213>Artificial sequence

<400> 169

gactacatgg gacatggtcc cagtcggtga tgaaaaatga tgggggtctt ggtactcaca 60

ggggggccag caaagccagc agggccgggg ggatacgtcg taggttcc 108

<210> 170

<211> 108

<212> DNA

<213>Artificial sequence

<400> 170

gactacatgg gacatgggaa gggccaagta tggggtctta acaggtcttc tgtacttacg 60

ggggcaccac gagctccagt gggaccagca gggtacgtcg taggttcc 108

<210> 171

<211> 108

<212> DNA

<213>Artificial sequence

<400> 171

gactacatgg gacatggagg cggccacctc accttgtcac caggggcacc agcagggcca 60

ggaggaccaa tggggccagt cagaccacgg acgtacgtcg taggttcc 108

<210> 172

<211> 108

<212> DNA

<213>Artificial sequence

<400> 172

gactacatgg gacatgggaa ggttgaactt actctgtcac ccttaggccc tggaagacca 60

gctgcaccac gttcaccagg cattccctga aggtacgtcg taggttcc 108

<210> 173

<211> 108

<212> DNA

<213>Artificial sequence

<400> 173

gactacatgg gacatcccct tccacgctgc cctcacctta gcaccatcgt tgccgggagc 60

accgttggcc cctcggggac cagcaggacc aggtacgtcg taggttcc 108

<210> 174

<211> 108

<212> DNA

<213>Artificial sequence

<400> 174

gactacatgg gacatgccaa gtacgacgca ccttgacgga tgcagcgaga gaggcctact 60

tactcttgct ccagaggggc caggggcgcc aagtacgtcg taggttcc 108

<210> 175

<211> 108

<212> DNA

<213>Artificial sequence

<400> 175

gactacatgg gacatattcc ctgcatctcc cacccctctg gccggctgct ccctcttacc 60

tgttcaccag gtttgcctgc ttcacctgga ggatacgtcg taggttcc 108

<210> 176

<211> 108

<212> DNA

<213>Artificial sequence

<400> 176

gactacatgg gacattccta cccctacctc ccagcatcct gacagccatg aggcctcacc 60

tggaatccgg gggagccagc agggccttgt tcatacgtcg taggttcc 108

<210> 177

<211> 108

<212> DNA

<213>Artificial sequence

<400> 177

gactacatgg gacatctccc cttttctgct ccccagatct ccccatcagg gacactcaca 60

gcagggccag ggggtccctg agctccagcc tcttacgtcg taggttcc 108

<210> 178

<211> 108

<212> DNA

<213>Artificial sequence

<400> 178

gactacatgg gacatgggca gcaatgggaa ggaggtaggg atggaaagga gatacttacg 60

acagcgccag ggggtccggg aacacctcgc tcttacgtcg taggttcc 108

<210> 179

<211> 108

<212> DNA

<213>Artificial sequence

<400> 179

gactacatgg gacatggatc ctcacttaat actcacagca gcacctttag gtccagggaa 60

tcccatcaca ccagcctgac cacgggcacc aggtacgtcg taggttcc 108

<210> 180

<211> 108

<212> DNA

<213>Artificial sequence

<400> 180

gactacatgg gacatgcaga caggacaatg gcagggggtt cagggggagt gatacttaca 60

ggggggccag ttttgccatc aggaccaggg ctgtacgtcg taggttcc 108

<210> 181

<211> 108

<212> DNA

<213>Artificial sequence

<400> 181

gactacatgg gacatgctga aagcctgggg cctcaccttg gcaccaggca gaccagcttc 60

accgggacga ccagcttcac caggagatcc ttttacgtcg taggttcc 108

<210> 182

<211> 108

<212> DNA

<213>Artificial sequence

<400> 182

gactacatgg gacatcaggg agcggcaggg tcagcccccc ggccgcaagg agaggttacc 60

ttgggaccag caacaccatc tgcgccaggg aaatacgtcg taggttcc 108

<210> 183

<211> 108

<212> DNA

<213>Artificial sequence

<400> 183

gactacatgg gacatcgggc agggacactt acacgctcgc cagggggtcc gggcaggcca 60

gtgggtccgg gttcacctcg agctcctcgc ttttacgtcg taggttcc 108

<210> 184

<211> 108

<212> DNA

<213>Artificial sequence

<400> 184

gactacatgg gacatggcag ggtgggctgg gctgcaagaa ggatggcggg gagacttaca 60

ggctctccct tagcaccagt gtctcctttg ctgtacgtcg taggttcc 108

<210> 185

<211> 108

<212> DNA

<213>Artificial sequence

<400> 185

gactacatgg gacataaggg agagtttggt actcacgctg ttacccttgg gaccaggagg 60

gccgccgggg ccctggggtc cagaggggcc tcgtacgtcg taggttcc 108

<210> 186

<211> 108

<212> DNA

<213>Artificial sequence

<400> 186

gactacatgg gacatcaggc tgcaggcggc aggagtggga ctgaagcctg gcaggatact 60

tacattggca cctttagcac caggctgtcc atctacgtcg taggttcc 108

<210> 187

<211> 108

<212> DNA

<213>Artificial sequence

<400> 187

gactacatgg gacatcactg agtcggggac acttacagca gggccagcag caccagcagg 60

gccagggggg ccaggctcac cacgcacacc ctgtacgtcg taggttcc 108

<210> 188

<211> 108

<212> DNA

<213>Artificial sequence

<400> 188

gactacatgg gacatttggc ccatgagggt catgcttaga ggagagtggg gggtctcacc 60

ttagcaccaa cagcaccagg gaagccagga ggatacgtcg taggttcc 108

<210> 189

<211> 108

<212> DNA

<213>Artificial sequence

<400> 189

gactacatgg gacatgagac ccctccccac tcccaggccc tgaggcctac aggccacact 60

cacagggggc ccggcagcac cagtagcacc atctacgtcg taggttcc 108

<210> 190

<211> 108

<212> DNA

<213>Artificial sequence

<400> 190

gactacatgg gacatccttc cagagctcag ggatccccca aggggccagg agtacttaca 60

gcagggccag gggctccagg gcgacctctc tcatacgtcg taggttcc 108

<210> 191

<211> 108

<212> DNA

<213>Artificial sequence

<400> 191

gactacatgg gacatcccct gcctcctgcc ccatccctgc cctctggaac tgggcacact 60

caccatctga ccaggagctc cattttcacc aggtacgtcg taggttcc 108

<210> 192

<211> 108

<212> DNA

<213>Artificial sequence

<400> 192

gactacatgg gacatactct ggggatgtgg aggaccatga tgttcagaca gcctcttacc 60

ttaggaccag caggaccagc atctcccttg gcatacgtcg taggttcc 108

<210> 193

<211> 108

<212> DNA

<213>Artificial sequence

<400> 193

gactacatgg gacatatgct agggacttgg ggagcttaaa tgactcaaag gtgactcact 60

ctgtgtccct tcattccagg gaggccagct gtttacgtcg taggttcc 108

<210> 194

<211> 108

<212> DNA

<213>Artificial sequence

<400> 194

gactacatgg gacatccaag tgcagtgaag cccaggttca gccacagccc cctgctcacc 60

tgaggcccag gaggcccacg ctcaccagga cgatacgtcg taggttcc 108

<210> 195

<211> 108

<212> DNA

<213>Artificial sequence

<400> 195

gactacatgg gacatgaggc catggggtca gatggtatct tcttgctggg gatacttaca 60

tcatctccat tctttccagg gggacctggg ggatacgtcg taggttcc 108

<210> 196

<211> 108

<212> DNA

<213>Artificial sequence

<400> 196

gactacatgg gacatgtgtg tttgtagaag gagtatgaat ctgtatagag agtgcttact 60

gaagctccag gctcgccagg ctcaccaggg ggatacgtcg taggttcc 108

<210> 197

<211> 108

<212> DNA

<213>Artificial sequence

<400> 197

gactacatgg gacataaaag accaaagccc aaggaggcat atgaagacgt cctggatact 60

cacaggtgca ccaggggggc cagggagacc acgtacgtcg taggttcc 108

<210> 198

<211> 108

<212> DNA

<213>Artificial sequence

<400> 198

gactacatgg gacatctctt ctgtcatcca tgctccccct gctggctcac catggggcca 60

ggcacggaaa ttcctccggt tgatttctca tcatacgtcg taggttcc 108

<210> 199

<211> 108

<212> DNA

<213>Artificial sequence

<400> 199

gactacatgg gacatactcc tccgaggcca gggaggctgt ccagggatgc catctcggcc 60

aggggggcct gcgggtccct gcagggggag aggtacgtcg taggttcc 108

<210> 200

<211> 108

<212> DNA

<213>Artificial sequence

<400> 200

gactacatgg gacatgccga gagccatgcc cacctgcagc cccccacagc ccagagtgca 60

acgcttaccc ttgggcctcg ggggccagtg tcttacgtcg taggttcc 108

<210> 201

<211> 108

<212> DNA

<213>Artificial sequence

<400> 201

gactacatgg gacatactgt gaggagtcac gggccgcgca ggggcaaaat tcgagggcag 60

gagattacct cgacgccggt ggtttcttgg tcgtacgtcg taggttcc 108

<210> 202

<211> 108

<212> DNA

<213>Artificial sequence

<400> 202

gactacatgg gacatcctga gccgtcgggg cagacgggac agcactcgcc ctcggggact 60

tcggcgccgg ggcagttctt ggtctcgtca cagtacgtcg taggttcc 108

<210> 203

<211> 108

<212> DNA

<213>Artificial sequence

<400> 203

gactacatgg gacatccaaa agtttgggac ttactgtctt cgtcttggcc ctcgacttgg 60

ccttcctctt ggccgtgcgt caggagggcg gtgtacgtcg taggttcc 108

<210> 204

<211> 108

<212> DNA

<213>Artificial sequence

<400> 204

gactacatgg gacattgctg aaggagctgc gggagccgga gaagaatgaa actgcgtgga 60

gtcagcctgg ctgccggctt gttcttactg gcctacgtcg taggttcc 108

<210> 205

<211> 108

<212> DNA

<213>Artificial sequence

<400> 205

gactacatgg gacataatga ttttttccct ctttctcttc cttataggct tgctatgggt 60

gttctccagg atcaaagtgt gactgcagtg gcatacgtcg taggttcc 108

<210> 206

<211> 108

<212> DNA

<213>Artificial sequence

<400> 206

gactacatgg gacatttctc atttaattgc agggagagag agggtttcca ggtttggaag 60

gacacccagg attgcctgga tttccaggtc cagtacgtcg taggttcc 108

<210> 207

<211> 108

<212> DNA

<213>Artificial sequence

<400> 207

gactacatgg gacattaaaa atattgcatt tttcagggtg atgatggaat tccagggcca 60

ccaggaccaa aaggaatcag agtaagtagt atttacgtcg taggttcc 108

<210> 208

<211> 108

<212> DNA

<213>Artificial sequence

<400> 208

gactacatgg gacattgcat ttttcagggt gatgatggaa ttccagggcc accaggacca 60

aaaggaatca gagtaagtag tattttctct atatacgtcg taggttcc 108

<210> 209

<211> 108

<212> DNA

<213>Artificial sequence

<400> 209

gactacatgg gacatatttt tatgggttgt catttagttt aaggatttta tttcttctta 60

tagggtcctc ctggacttcc tggatttcca gggtacgtcg taggttcc 108

<210> 210

<211> 108

<212> DNA

<213>Artificial sequence

<400> 210

gactacatgg gacatctaag acatattata catgtgttat gtcgcttttc aaagggaatg 60

ccaggccacg atggggcccc aggacctcaa ggttacgtcg taggttcc 108

<210> 211

<211> 108

<212> DNA

<213>Artificial sequence

<400> 211

gactacatgg gacatttgtt tcttgttcct ccatgctctt tatttttaac tccttctagg 60

gagaacgtgg atttccaggc agtcccggtt ttctacgtcg taggttcc 108

<210> 212

<211> 108

<212> DNA

<213>Artificial sequence

<400> 212

gactacatgg gacataattg gcgtgtttct ctctcataca tataaaataa tcccttttct 60

ttttaataat agggaccccc tgggatccca ggttacgtcg taggttcc 108

<210> 213

<211> 108

<212> DNA

<213>Artificial sequence

<400> 213

gactacatgg gacatcttag aacttccatt gatggcttct tttagggtga accaggtagt 60

ataattatgt catcactgcc aggaccaaag ggttacgtcg taggttcc 108

<210> 214

<211> 108

<212> DNA

<213>Artificial sequence

<400> 214

gactacatgg gacattgtct tattttatct tgcaaacagg gtgagcaagg tcttcagggc 60

ccacctgggc cacctgggca gatcagtgaa cagtacgtcg taggttcc 108

<210> 215

<211> 108

<212> DNA

<213>Artificial sequence

<400> 215

gactacatgg gacatcttca gggcccacct gggccacctg ggcagatcag tgaacagaaa 60

agaccaattg atgtagagtt tcagaaagga gattacgtcg taggttcc 108

<210> 216

<211> 108

<212> DNA

<213>Artificial sequence

<400> 216

gactacatgg gacatccacc tgggccacct gggcagatca gtgaacagaa aagaccaatt 60

gatgtagagt ttcagaaagg agatcaggtg agttacgtcg taggttcc 108

<210> 217

<211> 108

<212> DNA

<213>Artificial sequence

<400> 217

gactacatgg gacatctatc ctctatgttt taaagggttt gcctggtgat cctggttacc 60

ctggtgaacc cggaagggat ggtgaaaagg taatacgtcg taggttcc 108

<210> 218

<211> 108

<212> DNA

<213>Artificial sequence

<400> 218

gactacatgg gacataaaaa ggtgacactg gcccacctgg acctcctgga cttgtaagtt 60

tttttttttt agtcttcgtt tatcaaattt atttacgtcg taggttcc 108

<210> 219

<211> 108

<212> DNA

<213>Artificial sequence

<400> 219

gactacatgg gacattggga ctggtataac tataggagaa aaaggaaaca ttgggttgcc 60

tgggttgcct ggagaaaaag gagagcgagg atttacgtcg taggttcc 108

<210> 220

<211> 108

<212> DNA

<213>Artificial sequence

<400> 220

gactacatgg gacatggggc tgcagttatg ggtcctcctg gccctcctgg atttcctgga 60

gaaaggggtc agaaaggtga tgaaggacca ccttacgtcg taggttcc 108

<210> 221

<211> 108

<212> DNA

<213>Artificial sequence

<400> 221

gactacatgg gacatcctgg acctcctgga cttgacggac agcctggggc tcctgggctt 60

ccagggcctc ctggccctgc tggccctcac atttacgtcg taggttcc 108

<210> 222

<211> 108

<212> DNA

<213>Artificial sequence

<400> 222

gactacatgg gacatgcttg ctatcctttc tttatcttac tcaggtgatg agatatgtga 60

accaggccct ccaggccccc caggatctcc aggtacgtcg taggttcc 108

<210> 223

<211> 108

<212> DNA

<213>Artificial sequence

<400> 223

gactacatgg gacatacact tgcttcaact gcattggaac tggtatttca gggcctccag 60

gtcaacctgg tttgccaggt ctcccaggtc ctctacgtcg taggttcc 108

<210> 224

<211> 108

<212> DNA

<213>Artificial sequence

<400> 224

gactacatgg gacattcaac tgcattggaa ctggtatttc agggcctcca ggtcaacctg 60

gtttgccagg tctcccaggt cctccaggta aattacgtcg taggttcc 108

<210> 225

<211> 108

<212> DNA

<213>Artificial sequence

<400> 225

gactacatgg gacatgggca ttccaggagc tccaggtgct ccaggctttc ctggatctaa 60

aggtgaacct ggtgatatcc tcacttttcc aggtacgtcg taggttcc 108

<210> 226

<211> 108

<212> DNA

<213>Artificial sequence

<400> 226

gactacatgg gacatccctg gagctccagg gcttcctggt ttacctggca ctcctggaca 60

ggatggattg ccagggcttc ctggcccgaa aggtacgtcg taggttcc 108

<210> 227

<211> 108

<212> DNA

<213>Artificial sequence

<400> 227

gactacatgg gacattggtt tcggccctcc aggcccagta ggtgaaaaag gcatacaagg 60

tgtggcagga aatccaggcc agccaggaat acctacgtcg taggttcc 108

<210> 228

<211> 108

<212> DNA

<213>Artificial sequence

<400> 228

gactacatgg gacatccatt gatttactct tgctttcagg tcctaaaggg gatccaggtc 60

agactataac ccagccgggg aagcctggct tgctacgtcg taggttcc 108

<210> 229

<211> 108

<212> DNA

<213>Artificial sequence

<400> 229

gactacatgg gacatggcaa ccaggcttgc cagggatacc tggtagcaaa ggagaaccag 60

gtatccctgg aattgggctt cctggaccac ctgtacgtcg taggttcc 108

<210> 230

<211> 108

<212> DNA

<213>Artificial sequence

<400> 230

gactacatgg gacatacagg ctttcctgga attccaggac ctccaggagc acctgggaca 60

cctggaagaa ttggtctaga aggccctcct gggtacgtcg taggttcc 108

<210> 231

<211> 108

<212> DNA

<213>Artificial sequence

<400> 231

gactacatgg gacatcctgg aattccagga cctccaggag cacctgggac acctggaaga 60

attggtctag aaggccctcc tgggccaccc ggctacgtcg taggttcc 108

<210> 232

<211> 108

<212> DNA

<213>Artificial sequence

<400> 232

gactacatgg gacatacttc caggtttcaa aggagcactt ggtccaaaag gtgatcgtgg 60

tttcccagga cctccgggtc ctccaggacg cactacgtcg taggttcc 108

<210> 233

<211> 108

<212> DNA

<213>Artificial sequence

<400> 233

gactacatgg gacatacctg gaccaatggg acctcctggg ctgccaggaa taggtgttca 60

gggaccacca ggaccaccag ggattcctgg gcctacgtcg taggttcc 108

<210> 234

<211> 108

<212> DNA

<213>Artificial sequence

<400> 234

gactacatgg gacatgttcc aggaccccca ggtgaaagag gcagtccagg gatccccgga 60

gcacctggtc ctataggacc tccaggatca ccatacgtcg taggttcc 108

<210> 235

<211> 108

<212> DNA

<213>Artificial sequence

<400> 235

gactacatgg gacatggccc tacaggagaa aaaggtagta aaggagagcc tggccttcca 60

ggccctcctg gaccaatgga tccaaatctt ctgtacgtcg taggttcc 108

<210> 236

<211> 108

<212> DNA

<213>Artificial sequence

<400> 236

gactacatgg gacatcaggg ccaaaaggtt atcagggttt gcctggagac ccagggcaac 60

ctggactgag tggacaacct ggattaccag gactacgtcg taggttcc 108

<210> 237

<211> 108

<212> DNA

<213>Artificial sequence

<400> 237

gactacatgg gacattccca aaggtaaccc tggtctccct ggacagccag gtcttatagg 60

acctcctgga cttaaaggaa ccatcggtga tattacgtcg taggttcc 108

<210> 238

<211> 108

<212> DNA

<213>Artificial sequence

<400> 238

gactacatgg gacatggaca acctggctcc ccaggattac ctggacagaa aggcgacaaa 60

ggtgatcctg gtatttcaag cattggtctt ccatacgtcg taggttcc 108

<210> 239

<211> 108

<212> DNA

<213>Artificial sequence

<400> 239

gactacatgg gacatgaacc ctggtatcaa aggttctgtg ggagatcctg gtttgcccgg 60

attaccagga acccctggag caaaaggaca acctacgtcg taggttcc 108

<210> 240

<211> 108

<212> DNA

<213>Artificial sequence

<400> 240

gactacatgg gacatcaggc cctcctggac caaaaggtat tagtggccct cctgggaacc 60

ccggccttcc aggagaacct ggtcctgtag gtatacgtcg taggttcc 108

<210> 241

<211> 108

<212> DNA

<213>Artificial sequence

<400> 241

gactacatgg gacattaggt ggtggaggtc atcctgggca accagggcct ccaggcgaaa 60

aaggcaaacc cggtcaagat ggtattcctg gactacgtcg taggttcc 108

<210> 242

<211> 108

<212> DNA

<213>Artificial sequence

<400> 242

gactacatgg gacatttatc cacttgagta ctctgacagg tcaaccaggc tttggaaacc 60

caggaccccc tggacttcca ggactttctg gtatacgtcg taggttcc 108

<210> 243

<211> 108

<212> DNA

<213>Artificial sequence

<400> 243

gactacatgg gacatggcca aaagggtgat ggaggattac ctgggattcc aggaaatcct 60

ggccttccag gtccaaaggg cgaaccaggc ttttacgtcg taggttcc 108

<210> 244

<211> 108

<212> DNA

<213>Artificial sequence

<400> 244

gactacatgg gacatggtgt gcagggtccc ccaggccctc ctggttctcc gggtccagct 60

ctggaaggac ctaaaggcaa ccctgggccc caatacgtcg taggttcc 108

<210> 245

<211> 108

<212> DNA

<213>Artificial sequence

<400> 245

gactacatgg gacatttaag gtctaccagg tccagaaggt cctccaggtc tccctggaaa 60

tggaggtatt aaaggagaga agggaaatcc aggtacgtcg taggttcc 108

<210> 246

<211> 108

<212> DNA

<213>Artificial sequence

<400> 246

gactacatgg gacattaaag gagagaaggg aaatccaggc caacctgggc tacctggctt 60

gcctggtttg aaaggagatc aaggaccacc aggtacgtcg taggttcc 108

<210> 247

<211> 108

<212> DNA

<213>Artificial sequence

<400> 247

gactacatgg gacattattc agggtaatcc tggccggccg ggtctcaatg gaatgaaagg 60

agatcctggt ctccctggtg ttccaggatt ccctacgtcg taggttcc 108

<210> 248

<211> 108

<212> DNA

<213>Artificial sequence

<400> 248

gactacatgg gacatagtac ctggatcagc tggccctgag ggggaaccgg gacttattgg 60

tcctccaggt aagacttatt cctgaagata gtttacgtcg taggttcc 108

<210> 249

<211> 108

<212> DNA

<213>Artificial sequence

<400> 249

gactacatgg gacattaatt aaaggagatg ctggtcctcc aggaatccct ggccagcctg 60

ggctaaaggg tctaccagga ccccaaggac ctctacgtcg taggttcc 108

<210> 250

<211> 108

<212> DNA

<213>Artificial sequence

<400> 250

gactacatgg gacatcagga gatcctggac gcaatggact ccctggcttt gatggtgcag 60

gagggcgcaa aggagaccca ggtctgccag gactacgtcg taggttcc 108

<210> 251

<211> 108

<212> DNA

<213>Artificial sequence

<400> 251

gactacatgg gacattctgt tgcacatgga tttcttatta cacgccacag ccagacaacg 60

gatgcaccac aatgcccaca gggaacactt cagtacgtcg taggttcc 108

<210> 252

<211> 108

<212> DNA

<213>Artificial sequence

<400> 252

gactacatgg gacatatgtt ctgcaacatc aataatgttt gcaactttgc ttcaagaaat 60

gactattctt actggctctc taccccagag ccctacgtcg taggttcc 108

<210> 253

<211> 108

<212> DNA

<213>Artificial sequence

<400> 253

gactacatgg gacataagct ccagctgtgg tgatcgcagt tcacagtcag acgatccaga 60

ttccccattg tcctcaggga tgggattctc tgttacgtcg taggttcc 108

<210> 254

<211> 108

<212> DNA

<213>Artificial sequence

<400> 254

gactacatgg gacatcctag cctcccctgg ttcctgcttg gaagagtttc gttcagctcc 60

cttcatcgaa tgtcatggga ggggtacctg taatacgtcg taggttcc 108

<210> 255

<211> 108

<212> DNA

<213>Artificial sequence

<400> 255

gactacatgg gacatcagta aacctcagtc agaaacgctg aaagcaggag acttgaggac 60

acgaattagc cgatgtcaag tgtgcatgaa gagtacgtcg taggttcc 108

<210> 256

<211> 108

<212> DNA

<213>Artificial sequence

<400> 256

gactacatgg gacatcagct ggcgcccgcc tgctgtggaa ctggtggaag ctccggagcc 60

tccacctcct gcctcttgcc ccgggcttct tgctacgtcg taggttcc 108

<210> 257

<211> 108

<212> DNA

<213>Artificial sequence

<400> 257

gactacatgg gacattgcct cttgccccgg gcttcttgca cctgctgcag cccgacctcc 60

ccatctatct gcttggcctg actcagaaat tcgtacgtcg taggttcc 108

<210> 258

<211> 108

<212> DNA

<213>Artificial sequence

<400> 258

gactacatgg gacatccccg ggcttcttgc acctgctgca gcccgacctc cccatctatc 60

tgcttggcct gactcagaaa ttcgggccca tcttacgtcg taggttcc 108

<210> 259

<211> 108

<212> DNA

<213>Artificial sequence

<400> 259

gactacatgg gacatcgttg gtctctgctc tggaaagccc acaagaagct cacccgctca 60

gccctgctgc tgggcatccg tgactccatg gagtacgtcg taggttcc 108

<210> 260

<211> 108

<212> DNA

<213>Artificial sequence

<400> 260

gactacatgg gacatctgct ctggaaagcc cacaagaagc tcacccgctc agccctgctg 60

ctgggcatcc gtgactccat ggagccagtg gtgtacgtcg taggttcc 108

<210> 261

<211> 108

<212> DNA

<213>Artificial sequence

<400> 261

gactacatgg gacattttct ccacagcgca tgagagccca gcccggcacc cctgtggcca 60

ttgaggagga attctctctc ctcacctgca gcatacgtcg taggttcc 108

<210> 262

<211> 108

<212> DNA

<213>Artificial sequence

<400> 262

gactacatgg gacataggag gacaacttaa tgcctgccta ttacaaatgt atccaggagg 60

tgttaaaaac ctggagccac tggtccatcc aaatacgtcg taggttcc 108

<210> 263

<211> 108

<212> DNA

<213>Artificial sequence

<400> 263

gactacatgg gacatactta atgcctgcct attacaaatg tatccaggag gtgttaaaaa 60

cctggagcca ctggtccatc caaattgtgg acgtacgtcg taggttcc 108

<210> 264

<211> 108

<212> DNA

<213>Artificial sequence

<400> 264

gactacatgg gacatgctgc attctcatgc ttcctgccgc agttcttccc caatccaggt 60

ctccggaggc tgaagcaggc catagagaag aggtacgtcg taggttcc 108

<210> 265

<211> 108

<212> DNA

<213>Artificial sequence

<400> 265

gactacatgg gacattcatg cttcctgccg cagttcttcc ccaatccagg tctccggagg 60

ctgaagcagg ccatagagaa gagggaccac aactacgtcg taggttcc 108

<210> 266

<211> 108

<212> DNA

<213>Artificial sequence

<400> 266

gactacatgg gacatggtgg caggccagtg gagggacatg atggactaca tgctccaagg 60

ggtggcgcag ccgagcatgg aagagggctc tggtacgtcg taggttcc 108

<210> 267

<211> 108

<212> DNA

<213>Artificial sequence

<400> 267

gactacatgg gacatccagt ggagggacat gatggactac atgctccaag gggtggcgca 60

gccgagcatg gaagagggct ctggacagct ccttacgtcg taggttcc 108

<210> 268

<211> 108

<212> DNA

<213>Artificial sequence

<400> 268

gactacatgg gacatgtggt tttttttgct tcaccaccct gaggtgcgtc ctgcggacaa 60

gcaaaaggct ccttcccagc aacctggcca gggtacgtcg taggttcc 108

<210> 269

<211> 108

<212> DNA

<213>Artificial sequence

<400> 269

gactacatgg gacatgcgac tgtaggagga gctagaccac gaactgggcc ctggtgcctc 60

cagctcccgg gtcccctaca aggaccgtgc acgtacgtcg taggttcc 108

<210> 270

<211> 108

<212> DNA

<213>Artificial sequence

<400> 270

gactacatgg gacatactgg gccctggtgc ctccagctcc cgggtcccct acaaggaccg 60

tgcacggctg cccttgctca atgccaccat cgctacgtcg taggttcc 108

<210> 271

<211> 108

<212> DNA

<213>Artificial sequence

<400> 271

gactacatgg gacatccccc ttcagcatct ccggctacga catccctgag ggcacagtca 60

tcattccgaa cctccaaggc gcccacctgg atgtacgtcg taggttcc 108

<210> 272

<211> 108

<212> DNA

<213>Artificial sequence

<400> 272

gactacatgg gacattccct gagggcacag tcatcattcc gaacctccaa ggcgcccacc 60

tggatgagac ggtctgggag aggccacatg agttacgtcg taggttcc 108

<210> 273

<211> 108

<212> DNA

<213>Artificial sequence

<400> 273

gactacatgg gacatctgcc ccactgcagt gtcatcctca agatgcagcc tttccaagtg 60

cggctgcagc cccgggggat gggggcccac agctacgtcg taggttcc 108

<210> 274

<211> 108

<212> DNA

<213>Artificial sequence

<400> 274

gactacatgg gacatatcct caagatgcag cctttccaag tgcggctgca gccccggggg 60

atgggggccc acagcccagg ccagaaccag tgatacgtcg taggttcc 108

<210> 275

<211> 108

<212> DNA

<213>Artificial sequence

<400> 275

gactacatgg gacatgatgg cggggctctg gctggggctc gtgtggcaga agctgctgct 60

gtggggcgcg gcgagtgccc tttccctggc cggtacgtcg taggttcc 108

<210> 276

<211> 108

<212> DNA

<213>Artificial sequence

<400> 276

gactacatgg gacatatgtt tttccccaga attttttcag cagatcattg agtacacaga 60

ggaataccgc cacatgccgc tgctgaagct ctgtacgtcg taggttcc 108

<210> 277

<211> 108

<212> DNA

<213>Artificial sequence

<400> 277

gactacatgg gacatctcta aagtatgttt ttctcttcct aaggtaattt taactagttc 60

aaagcaaatt gacaaatcct ctatgtacaa gtttacgtcg taggttcc 108

<210> 278

<211> 108

<212> DNA

<213>Artificial sequence

<400> 278

gactacatgg gacatgtact ggaaacaaat ggcgctccag gagaaagatg ttaacaccca 60

ctttccattt taccattctg gaagatttct tagtacgtcg taggttcc 108

<210> 279

<211> 108

<212> DNA

<213>Artificial sequence

<400> 279

gactacatgg gacattgaat tgaatggttg cttctcaccc atattttata gaaacagcta 60

tggggaagaa tattggtgct caaagtaatg atgtacgtcg taggttcc 108

<210> 280

<211> 108

<212> DNA

<213>Artificial sequence

<400> 280

gactacatgg gacattttat agaatgagtg agatgatatt tcgaagaata aagatgccct 60

ggctttggct tgatctctgg taccttatgt ttatacgtcg taggttcc 108

<210> 281

<211> 108

<212> DNA

<213>Artificial sequence

<400> 281

gactacatgg gacatggtca tcgctgaacg ggccaatgaa atgaacgcca atgaagactg 60

tagaggtgat ggcaggggct ctgccccctc caatacgtcg taggttcc 108

<210> 282

<211> 108

<212> DNA

<213>Artificial sequence

<400> 282

gactacatgg gacatttgtt ttctgcattt gtaggggcac gatacaactg cagctgcaat 60

aaactggtcc ttatacctgt tgggttctaa ccctacgtcg taggttcc 108

<210> 283

<211> 108

<212> DNA

<213>Artificial sequence

<400> 283

gactacatgg gacatcaggg aagtctgacc gtcccgctac agtagaagac ctgaagaaac 60

ttcggtatct ggaatgtgtt attaaggaga ccctacgtcg taggttcc 108

<210> 284

<211> 108

<212> DNA

<213>Artificial sequence

<400> 284

gactacatgg gacatgcagg ttacagagtt ctaaaaggca ctgaagccgt catcattccc 60

tatgcattgc acagagatcc gagatacttc ccctacgtcg taggttcc 108

<210> 285

<211> 108

<212> DNA

<213>Artificial sequence

<400> 285

gactacatgg gacatggtca aaagtttgct gtgatggaag aaaagaccat tctttcgtgc 60

atcctgaggc acttttggat agaatccaac cagtacgtcg taggttcc 108

<210> 286

<211> 108

<212> DNA

<213>Artificial sequence

<400> 286

gactacatgg gacatggaat caggagttgt aaaacattta ttctgctcct tcttcatctg 60

tcatgactga tactaaggac tccatcgctc tgctacgtcg taggttcc 108

<210> 287

<211> 108

<212> DNA

<213>Artificial sequence

<400> 287

gactacatgg gacataaaaa gcaggatgag acagacagaa gccatggccg tgagcctgaa 60

tctcactaac ctctctcatt ggctttccag gggtacgtcg taggttcc 108

<210> 288

<211> 108

<212> DNA

<213>Artificial sequence

<400> 288

gactacatgg gacattccct tctaggtatt ggagcttacc tcttgaacta gggaaggagt 60

tgttgagttg ctccatcacc tcctctaacc ctgtacgtcg taggttcc 108

<210> 289

<211> 108

<212> DNA

<213>Artificial sequence

<400> 289

gactacatgg gacatgacac ttacccatgg agtccgaagt ttgactgcca accactcgga 60

gcagcatagg ctgactgctg tcggacctct gtatacgtcg taggttcc 108

<210> 290

<211> 108

<212> DNA

<213>Artificial sequence

<400> 290

gactacatgg gacatcttgc tccagcagct gccttagcct gtgtaactgt gactccagct 60

gtttattgtg gtcttccagg atttgcatcc tggtacgtcg taggttcc 108

<210> 291

<211> 108

<212> DNA

<213>Artificial sequence

<400> 291

gactacatgg gacatcctgt tttcttcctc aagatctgct aggattctct ctagctcccc 60

tctttcctca ctctctaagg aaatcaagat ctgtacgtcg taggttcc 108

<210> 292

<211> 108

<212> DNA

<213>Artificial sequence

<400> 292

gactacatgg gacattgtca ggaacatttt gtaaaaagag atgggatact tacatgctct 60

cattaggaga gatgctatca tttagataag atctacgtcg taggttcc 108

<210> 293

<211> 108

<212> DNA

<213>Artificial sequence

<400> 293

gactacatgg gacattcaat caatatttgc ctggcataca actagtctca tacctgctag 60

cataatgttc aatgcgtgaa tgagtatcat cgttacgtcg taggttcc 108

<210> 294

<211> 108

<212> DNA

<213>Artificial sequence

<400> 294

gactacatgg gacatcgagc gaatgtgttg gtggtagcag cacccttcag caaaaaaagt 60

actcacgcag aatctactgg ccagaagttg atctacgtcg taggttcc 108

<210> 295

<211> 108

<212> DNA

<213>Artificial sequence

<400> 295

gactacatgg gacatctcac gtttccatgt tgtccccctc taagacagtc tgcactggca 60

ggtagcccat tcggggatgc ttcgcaaaat acctacgtcg taggttcc 108

<210> 296

<211> 108

<212> DNA

<213>Artificial sequence

<400> 296

gactacatgg gacattggcg tcaaacttac cggagtgcaa tattccacca tgggatagtg 60

cattttatgg ccttttgcaa ctcgaccaga aaatacgtcg taggttcc 108

<210> 297

<211> 108

<212> DNA

<213>Artificial sequence

<400> 297

gactacatgg gacatcctga atccaatgat tggacactct ttgcagatgt tacatttggc 60

ctgatgcttg gcagtttctg cagcagccac tcttacgtcg taggttcc 108

<210> 298

<211> 108

<212> DNA

<213>Artificial sequence

<400> 298

gactacatgg gacatcaaat tggaagcagc tccggacact tggctcaatg ttactgcccc 60

caaaggatgc aacttcaccc aactgtcttg gaatacgtcg taggttcc 108

<210> 299

<211> 108

<212> DNA

<213>Artificial sequence

<400> 299

gactacatgg gacatgaata cagcattaat atacacgact tacatctgta cttgtcttcc 60

aaatgtgctt tacacaggga aatgatgcca gtttacgtcg taggttcc 108

<210> 300

<211> 108

<212> DNA

<213>Artificial sequence

<400> 300

gactacatgg gacatcgtat cataaacatt cagcagccag ttcagacaca tatccacgca 60

gagagggacg ttgaccaaat tgttgtgctc ttgtacgtcg taggttcc 108

<210> 301

<211> 108

<212> DNA

<213>Artificial sequence

<400> 301

gactacatgg gacattatca agatcttcaa atactggcca atacttacag caaagggcct 60

tctgcagtct tcggagtttc atggcagtcc tattacgtcg taggttcc 108

<210> 302

<211> 108

<212> DNA

<213>Artificial sequence

<400> 302

gactacatgg gacatcctgt catttaactt ggaggaaaca tggccatgtc cttacctaaa 60

gactggtaga gctctgtcat tttgggatgg tcctacgtcg taggttcc 108

<210> 303

<211> 108

<212> DNA

<213>Artificial sequence

<400> 303

gactacatgg gacatcactt accctttgag ctgttccctc atggctgcaa gggctccgcg 60

gtcgagtgtg ggtacgagtg gaggagtgag ctttacgtcg taggttcc 108

<210> 304

<211> 108

<212> DNA

<213>Artificial sequence

<400> 304

gactacatgg gacatcaata aatgctcttt taaaaatgtg atacttccaa cttacttgat 60

atagtagggc actttgtttg gcgagatggc tcttacgtcg taggttcc 108

<210> 305

<211> 108

<212> DNA

<213>Artificial sequence

<400> 305

gactacatgg gacatagtta agtgataaaa gctgaaaatg acttactgga aagaaagtgc 60

tgagatgctg gaccaaagtc cctgtgggct tcatacgtcg taggttcc 108

<210> 306

<211> 108

<212> DNA

<213>Artificial sequence

<400> 306

gactacatgg gacatcctgc agaagcttcc atctggtgtt caggtcttcc agagtgctga 60

ggttatacgg tgagagctga atgcccaaag tggtacgtcg taggttcc 108

<210> 307

<211> 108

<212> DNA

<213>Artificial sequence

<400> 307

gactacatgg gacatccttg actttctcga ggtgatcttg gagagagtca atgaggagat 60

cgcccacggg ctgccaggat cccttgatca ccttacgtcg taggttcc 108

<210> 308

<211> 108

<212> DNA

<213>Artificial sequence

<400> 308

gactacatgg gacatattca attacctctg ggctcctggt agagtttctc tagtccttcc 60

aaaggctgct ctgtcagaaa tattcgtaca gtctacgtcg taggttcc 108

<210> 309

<211> 108

<212> DNA

<213>Artificial sequence

<400> 309

gactacatgg gacatcccta tgtacatcgt tctgcttctg aactgctgga aagtcgcctc 60

caataggtgc ctgccggctt aattcatcat ctttacgtcg taggttcc 108

<210> 310

<211> 108

<212> DNA

<213>Artificial sequence

<400> 310

gactacatgg gacatcctaa tgttgagaga ctttttccga agttcactcc acttgaagtt 60

catgttatcc aaacgtcttt gtaacaggac tgctacgtcg taggttcc 108

<210> 311

<211> 108

<212> DNA

<213>Artificial sequence

<400> 311

gactacatgg gacatacctt tacatggtat gtcttcctgt gtaacatttt cagcttgaac 60

cgggcactac agcactgatc ctgttgcata gcatacgtcg taggttcc 108

<210> 312

<211> 108

<212> DNA

<213>Artificial sequence

<400> 312

gactacatgg gacatcttgc cattgtttca tcagctcttt tactcccttg gagtcttcta 60

ggagcctttc cttacgggta gcatcctgta ggatacgtcg taggttcc 108

<210> 313

<211> 108

<212> DNA

<213>Artificial sequence

<400> 313

gactacatgg gacatccttt tatgaatgct tctccaagag gcattgatat tctctgttat 60

catgtggact tttctggtat catctgcaga atatacgtcg taggttcc 108

<210> 314

<211> 108

<212> DNA

<213>Artificial sequence

<400> 314

gactacatgg gacatccttg gtttctgtga ttttcttttg gattgcatct actgtatagg 60

gaccctcctt ccatgactca agcttggctc tggtacgtcg taggttcc 108

<210> 315

<211> 108

<212> DNA

<213>Artificial sequence

<400> 315

gactacatgg gacattaaaa aacttacttc gatccgtaat gattgttcta gcctcttgat 60

tgctggtctt gtttttcaaa ttttgggcag cggtacgtcg taggttcc 108

<210> 316

<211> 108

<212> DNA

<213>Artificial sequence

<400> 316

gactacatgg gacatccttc tgcttgatga tcatctcgtt gatatcctca aggtcaccca 60

ccatcaccct ctgtgatttt ataacttgat caatacgtcg taggttcc 108

<210> 317

<211> 108

<212> DNA

<213>Artificial sequence

<400> 317

gactacatgg gacatgatcc agtatactta caggctccaa tagtggtcag tccaggagct 60

aggtcaggct gctttgccct cagctcttga agttacgtcg taggttcc 108

<210> 318

<211> 108

<212> DNA

<213>Artificial sequence

<400> 318

gactacatgg gacattagag gttgcttcat taccttcact ggctgagtgg ctggtttttc 60

cttgtacaaa tgctgccctt tagacaaaat ctctacgtcg taggttcc 108

<210> 319

<211> 108

<212> DNA

<213>Artificial sequence

<400> 319

gactacatgg gacattaacg tcaaatggtc cttcttggtt tggttggtta taaatttcca 60

actgattcct aataggagat aaccacagca gcatacgtcg taggttcc 108

<210> 320

<211> 108

<212> DNA

<213>Artificial sequence

<400> 320

gactacatgg gacatccttt atccactgga gatttgtctg cttgagctta ttttcaagtt 60

tatcttgctc ttctgggctt atgggagcac ttatacgtcg taggttcc 108

<210> 321

<211> 108

<212> DNA

<213>Artificial sequence

<400> 321

gactacatgg gacatccttg acttgctcaa gcttttcttt tagttgctgc tcttttccag 60

gttcaagtgg gatactagca atgttatctg ctttacgtcg taggttcc 108

<210> 322

<211> 108

<212> DNA

<213>Artificial sequence

<400> 322

gactacatgg gacatcctct tttttctgtc tgacagctgt ttgcagacct cctgccaccg 60

cagattcagg cttcccaatt tttcctgtag aattacgtcg taggttcc 108

<210> 323

<211> 108

<212> DNA

<213>Artificial sequence

<400> 323

gactacatgg gacatcctta agataccatt tgtatttagc atgttcccaa ttctcaggaa 60

tttgtgtctt tctgagaaac tgttcagctt ctgtacgtcg taggttcc 108

<210> 324

<211> 108

<212> DNA

<213>Artificial sequence

<400> 324

gactacatgg gacatccctt gtcggtcctt gtacattttg ttaacttttt cccattggaa 60

atcaagctgg gagagagctt cctgtagctt cactacgtcg taggttcc 108

<210> 325

<211> 108

<212> DNA

<213>Artificial sequence

<400> 325

gactacatgg gacatccttc agagactcct cttgcttaaa gagatcttca aagtccttag 60

cacagaggtc aggagcattg agaagttgtt ccatacgtcg taggttcc 108

<210> 326

<211> 108

<212> DNA

<213>Artificial sequence

<400> 326

gactacatgg gacatcaatt tgtgcaaagt tgagtcttcg aaactgagca aatttgctct 60

caatttcccg ccagcgcttg ctgagctgga tcttacgtcg taggttcc 108

<210> 327

<211> 108

<212> DNA

<213>Artificial sequence

<400> 327

gactacatgg gacatccttt attttccttt catctctggg ctcaggtagg ctggctaatt 60

ttttttcaat gtcatccaag catttcagga gattacgtcg taggttcc 108

<210> 328

<211> 108

<212> DNA

<213>Artificial sequence

<400> 328

gactacatgg gacatacctt gagagcatta tgttttgtct gtaacagctg ctgttttatc 60

tttatttcct ctcgctttct ctcatctgtg atttacgtcg taggttcc 108

<210> 329

<211> 108

<212> DNA

<213>Artificial sequence

<400> 329

gactacatgg gacatccaat ttaccatatc tttattgaag tcttcctctt tcagattcac 60

cccctgctga atttcagcct ccagtggttc aagtacgtcg taggttcc 108

<210> 330

<211> 108

<212> DNA

<213>Artificial sequence

<400> 330

gactacatgg gacatccttt ccagtcttaa ttctgtgtga aatggctgca aatcgatggt 60

tgagctctga gatttggggc tctactaatt tcctacgtcg taggttcc 108

<210> 331

<211> 108

<212> DNA

<213>Artificial sequence

<400> 331

gactacatgg gacattgcta ccttaagcac gtcttctttt tgctggggtt tctttttctc 60

tgattcatcc aaaagtgtgt cagcctgaat gattacgtcg taggttcc 108

<210> 332

<211> 108

<212> DNA

<213>Artificial sequence

<400> 332

gactacatgg gacatccaac aaaagattta accactcttc tgctcgggag gtgacagcta 60

tccagttact attcagaaga ctgagtttat ctttacgtcg taggttcc 108

<210> 333

<211> 108

<212> DNA

<213>Artificial sequence

<400> 333

gactacatgg gacatccttt ccccaggcaa cttcagaatc caaattacta ggcattcctt 60

caactgctga tctctttgtc aattccatat ctgtacgtcg taggttcc 108

<210> 334

<211> 108

<212> DNA

<213>Artificial sequence

<400> 334

gactacatgg gacatccttt gctcccagct cattataatg caatttcaaa gctgttactc 60

tttcatcaag ttctttggga ttttccgtct gcttacgtcg taggttcc 108

<210> 335

<211> 108

<212> DNA

<213>Artificial sequence

<400> 335

gactacatgg gacatccaca caatgattta gctgtgactg tactacttcc tgttccacac 60

tctttgtttc caatgcaggc aagtgcatct tcatacgtcg taggttcc 108

<210> 336

<211> 108

<212> DNA

<213>Artificial sequence

<400> 336

gactacatgg gacattgaaa taacatatac ctgtgcaaca tcaatctgag acaggactct 60

ttgggcagcc tccttcccct gattatgttt ctttacgtcg taggttcc 108

<210> 337

<211> 108

<212> DNA

<213>Artificial sequence

<400> 337

gactacatgg gacatcctgg gcttcctgag gcatttgagc tgcgtccacc ttgtctgcaa 60

tataagctgc caactgcttg tcaatgaatg tgatacgtcg taggttcc 108

<210> 338

<211> 108

<212> DNA

<213>Artificial sequence

<400> 338

gactacatgg gacatctgta atcctgctga acaataaatg aagattctag actcttccac 60

aatcaccttt ttgtaagaca gatttcgcag ctttacgtcg taggttcc 108

<210> 339

<211> 108

<212> DNA

<213>Artificial sequence

<400> 339

gactacatgg gacatcctct tcatgtagtt ccctccaacg agaattaaat gtctcaagtt 60

cctcattgat tagctcatcc atgactccgc cattacgtcg taggttcc 108

<210> 340

<211> 108

<212> DNA

<213>Artificial sequence

<400> 340

gactacatgg gacattacat ctagcacctc agagatttcc tcagctccgc caggaatgtt 60

ttcagtggtt ttaagtttaa attctacttc atttacgtcg taggttcc 108

<210> 341

<211> 108

<212> DNA

<213>Artificial sequence

<400> 341

gactacatgg gacatcttcc aaagtcttgc atttcccatt cagcctagtg cagagccact 60

ggtagttggt ggttagagtt tcaagttcct ttttacgtcg taggttcc 108

<210> 342

<211> 108

<212> DNA

<213>Artificial sequence

<400> 342

gactacatgg gacatccttc atctcttcaa ctgctttctg taattcatct ggagttttat 60

attcaaaatc tctctcaaga tactcttctt cagtacgtcg taggttcc 108

<210> 343

<211> 108

<212> DNA

<213>Artificial sequence

<400> 343

gactacatgg gacatcctgt tggcacatgt gatcccactg agtgttaagt tctttgagtt 60

ctgtctcaag tctcgaagca aactctggct ctgtacgtcg taggttcc 108

<210> 344

<211> 108

<212> DNA

<213>Artificial sequence

<400> 344

gactacatgg gacattataa aaatcttact ctgcactgtt tcagctgctt ttttagaatt 60

tctgaatccc caagggcagg ccattcctcc ttctacgtcg taggttcc 108

<210> 345

<211> 108

<212> DNA

<213>Artificial sequence

<400> 345

gactacatgg gacatcctga atttttcgga gtttattcat ttgctcctct agcttttgac 60

aatgctcaac cagctgggag gagagcttct tcctacgtcg taggttcc 108

<210> 346

<211> 108

<212> DNA

<213>Artificial sequence

<400> 346

gactacatgg gacatcctgc aattccccga gtctctgctc catgatttca tagtcggtga 60

cactaagttg aggtatggag agtttggttt ctgtacgtcg taggttcc 108

<210> 347

<211> 108

<212> DNA

<213>Artificial sequence

<400> 347

gactacatgg gacatcttgt ctgtagctct ttctctctgg cctgcacatc agaaaagact 60

tgcttaaaat gatttgtaaa ggccacaaag tcttacgtcg taggttcc 108

<210> 348

<211> 108

<212> DNA

<213>Artificial sequence

<400> 348

gactacatgg gacatcctta caaattttta actgactttt aattgctgtt ggctctgatg 60

gggtggtggg ttggattttc aaccagtttt cagtacgtcg taggttcc 108

<210> 349

<211> 108

<212> DNA

<213>Artificial sequence

<400> 349

gactacatgg gacatattat ctaaatcaac tcgtgtaatt accattcacc atctgttcca 60

ccagggcctg agctgatctg ctggcatctt gcatacgtcg taggttcc 108

<210> 350

<211> 108

<212> DNA

<213>Artificial sequence

<400> 350

gactacatgg gacatataac ctacattgac tttttctttt aagtctgaga agttgccttc 60

cttccgaaag attgcaaatt caggactctg caatacgtcg taggttcc 108

<210> 351

<211> 108

<212> DNA

<213>Artificial sequence

<400> 351

gactacatgg gacatccttt tcctaatttc agaatccaca gtaatctgcc tcttcttttg 60

gggaggtggt ggtggaagtt cctcttgagc atgtacgtcg taggttcc 108

<210> 352

<211> 108

<212> DNA

<213>Artificial sequence

<400> 352

gactacatgg gacatcctgt gctgtactct tttcaagttt ttggactaaa ttatcccaac 60

accgggcaaa gttatccagc catgcttccg tcttacgtcg taggttcc 108

<210> 353

<211> 108

<212> DNA

<213>Artificial sequence

<400> 353

gactacatgg gacatagcta gaaagtacat acggccagtt tttgaagact tgataacatt 60

tcattttgat ctttaaagcc agttgtgtga atctacgtcg taggttcc 108

<210> 354

<211> 108

<212> DNA

<213>Artificial sequence

<400> 354

gactacatgg gacatgtttc tcacacatga cacacctgtt cttcagtaag acgttgccat 60

ttgagaagga tgtcttgtaa aagaacccag cggtacgtcg taggttcc 108

<210> 355

<211> 108

<212> DNA

<213>Artificial sequence

<400> 355

gactacatgg gacataataa tctgacctta agttgttctt ccaaagcagc agttgcgtga 60

tctccactag attcatcaac taccaccacc atgtacgtcg taggttcc 108

<210> 356

<211> 108

<212> DNA

<213>Artificial sequence

<400> 356

gactacatgg gacatcctta tgttgttgta cttggcgttt taggtcttca agatcaggtc 60

caagaggctc ttcctccatt ttccttgttc ttttacgtcg taggttcc 108

<210> 357

<211> 108

<212> DNA

<213>Artificial sequence

<400> 357

gactacatgg gacatcttgc tttgtttttc catgctagct accctgaggc attcccatct 60

tgaatttagg agattcatct gctcttgtac ttctacgtcg taggttcc 108

<210> 358

<211> 108

<212> DNA

<213>Artificial sequence

<400> 358

gactacatgg gacatcctca tgagtatgaa actggtcttt caccacttcc acatcattag 60

aaatctctcc ttgtgcttgc aatgtgtcct cagtacgtcg taggttcc 108

<210> 359

<211> 108

<212> DNA

<213>Artificial sequence

<400> 359

gactacatgg gacatacaga cctgtgaagg aaatgggctc cgtgtagggt cagaggtggt 60

gacataagca gcctgtgtgt aggcatagct ctttacgtcg taggttcc 108

<210> 360

<211> 108

<212> DNA

<213>Artificial sequence

<400> 360

gactacatgg gacatcctgt tgagaatagt gcatttgatg atgtaactga aaatgttctt 60

ctttagtcac tttaggtggc cttggcaaca ttttacgtcg taggttcc 108

<210> 361

<211> 108

<212> DNA

<213>Artificial sequence

<400> 361

gactacatgg gacataattt accaaccttc aggatcgagt agtttctcta tgcctaattg 60

atatctggcg atgttgaatg catgttccag tcgtacgtcg taggttcc 108

<210> 362

<211> 108

<212> DNA

<213>Artificial sequence

<400> 362

gactacatgg gacatcctat gactatggat gagagcattc aaagccaggc catcagacca 60

gctggtggtg aagttgatta cattaacctg tggtacgtcg taggttcc 108

<210> 363

<211> 108

<212> DNA

<213>Artificial sequence

<400> 363

gactacatgg gacatgaaac cattcatcag gattcttacc tgccagtgga ggattatatt 60

ccaaatcaaa ccaagagtca gtttatgatt tcctacgtcg taggttcc 108

<210> 364

<211> 108

<212> DNA

<213>Artificial sequence

<400> 364

gactacatgg gacatagcat ccagaccttg tccagggtac tacttacatt attgttctgc 60

aaaacccgca gtgccttgtt gacattgttc aggtacgtcg taggttcc 108

<210> 365

<211> 108

<212> DNA

<213>Artificial sequence

<400> 365

gactacatgg gacatctttc ttaaaaataa gtcacatacc agtttttgcc ctgtcaggcc 60

ttcgaggagg tctaggaggc gcctcccatc ctgtacgtcg taggttcc 108

<210> 366

<211> 108

<212> DNA

<213>Artificial sequence

<400> 366

gactacatgg gacatcaact tagatcttaa aagtaaagta acaaaccatt cttaccttag 60

aaaattgtgc atttacccat tttgtgaatg ttttacgtcg taggttcc 108

<210> 367

<211> 108

<212> DNA

<213>Artificial sequence

<400> 367

gactacatgg gacattgctt gtggaattta tcattcttct gaatggctgt tgcatttatc 60

tgcagctttt actcaccaga tgagacctca gactacgtcg taggttcc 108

<210> 368

<211> 108

<212> DNA

<213>Artificial sequence

<400> 368

gactacatgg gacatcacaa actaaacgtt atgccacagt aaaatatatt tttagttact 60

ttgtacttac aacagtcctc tacttcttcc cactacgtcg taggttcc 108

<210> 369

<211> 108

<212> DNA

<213>Artificial sequence

<400> 369

gactacatgg gacattgtgt gccgccgggg ctgcccagcc atgctgtgct gcctgctggt 60

gagggccagc aacctcccca gtgcgaagaa ggatacgtcg taggttcc 108

<210> 370

<211> 108

<212> DNA

<213>Artificial sequence

<400> 370

gactacatgg gacatggcgg gatgtgtctc tccattctcc cttttgtgtc tcttgtaggg 60

gtgaagaaga gaaccaaagt catcaagaac agctacgtcg taggttcc 108

<210> 371

<211> 108

<212> DNA

<213>Artificial sequence

<400> 371

gactacatgg gacatgatgc cttttctctt tttcttccag ggatttgaat gggacctcaa 60

gggcatcccc ctggaccagg gctctgagct tcatacgtcg taggttcc 108

<210> 372

<211> 108

<212> DNA

<213>Artificial sequence

<400> 372

gactacatgg gacatacttc tctctcctct caggttcctg ggggaagcca aggtcccact 60

ccgagaggtc ctcgccaccc ctagtctgtc cgctacgtcg taggttcc 108

<210> 373

<211> 108

<212> DNA

<213>Artificial sequence

<400> 373

gactacatgg gacattcatc tcttccaggc ctcgctggtc ctgcaggtgt cctacacacc 60

gctgcctgga gctgtgcccc tgttcccgcc ccctacgtcg taggttcc 108

<210> 374

<211> 108

<212> DNA

<213>Artificial sequence

<400> 374

gactacatgg gacatggtta tgccctgccc acaagacagg cgggggacag agccgggccg 60

agacttggtc cctgctcagt gacagcacca tggtacgtcg taggttcc 108

<210> 375

<211> 108

<212> DNA

<213>Artificial sequence

<400> 375

gactacatgg gacatgacac aggaggagag gaagacacag aggaccaggg actcactgga 60

gatgaggcgg agccattcct ggatcaaagc ggatacgtcg taggttcc 108

<210> 376

<211> 108

<212> DNA

<213>Artificial sequence

<400> 376

gactacatgg gacattttca gatcagggtc caggtgatcg aggggcgcca gctgccgggg 60

gtgaacatca agcctgtggt caaggttacc gcttacgtcg taggttcc 108

<210> 377

<211> 108

<212> DNA

<213>Artificial sequence

<400> 377

gactacatgg gacatgcagg cactgatatg tctctctttg ctctgaacca acagactctt 60

ttcttcaact tgtttgactc tcctggggag ctgtacgtcg taggttcc 108

<210> 378

<211> 108

<212> DNA

<213>Artificial sequence

<400> 378

gactacatgg gacatcacat gttccctgtg aatgtgagtt tccatgatct ttctctgcag 60

gtggtagact ctcgttctct caggacagat gcttacgtcg taggttcc 108

<210> 379

<211> 108

<212> DNA

<213>Artificial sequence

<400> 379

gactacatgg gacatgcttt ggcggcaaga gtttgatttg tgtctcctct cattgattgc 60

agatggacgt gggcaccatt tacagagagc ccctacgtcg taggttcc 108

<210> 380

<211> 108

<212> DNA

<213>Artificial sequence

<400> 380

gactacatgg gacatttgtc tctcttaggg cacgcctatc tcaggaagtg gctgctgctc 60

tcagaccctg atgacttctc tgctggggcc agatacgtcg taggttcc 108

<210> 381

<211> 108

<212> DNA

<213>Artificial sequence

<400> 381

gactacatgg gacattttgt agctggagag aaaagacccc tctgaagaca aggaggacat 60

tgaaagcaac ctgctccggc ccacaggcgt agctacgtcg taggttcc 108

<210> 382

<211> 108

<212> DNA

<213>Artificial sequence

<400> 382

gactacatgg gacatggtgt gtccctcttc ccagtggacg atgccgtgat ggacaacgtg 60

aaacagatct ttggcttcga gagtaacaag aagtacgtcg taggttcc 108

<210> 383

<211> 108

<212> DNA

<213>Artificial sequence

<400> 383

gactacatgg gacatagctt gatcaacttg tcccctccct gtgtcttcta gctgtgcagc 60

aagatcttgg agaagacggc caaccctcag tggtacgtcg taggttcc 108

<210> 384

<211> 108

<212> DNA

<213>Artificial sequence

<400> 384

gactacatgg gacatctatc ttcaaaagga ctcttctccc aacacgcctc tattccttcc 60

tcagtttccc tccatgtgcg aaaaaatgag gattacgtcg taggttcc 108

<210> 385

<211> 108

<212> DNA

<213>Artificial sequence

<400> 385

gactacatgg gacatttcag gccctctctg ctcccttgct ctagggaccg cctgactcac 60

aatgacatcg tggctaccac ctacctgagt atgtacgtcg taggttcc 108

<210> 386

<211> 108

<212> DNA

<213>Artificial sequence

<400> 386

gactacatgg gacattctcc cagccatgcc caccctaacc ccttttccat ttctttacgc 60

ttcagaggag cctgcaggtg ctgtcaagcc ttctacgtcg taggttcc 108

<210> 387

<211> 108

<212> DNA

<213>Artificial sequence

<400> 387

gactacatgg gacatttgtg tctcccagtg gatgactacc tgggcttcct ccccactttt 60

gggccctgct acatcaacct ctatggcagt ccctacgtcg taggttcc 108

<210> 388

<211> 108

<212> DNA

<213>Artificial sequence

<400> 388

gactacatgg gacatgacct ccctggcagg gggaaggtgt ggcttatcgt ggccggcttc 60

tgctctccct ggagaccaag ctggtggagc acatacgtcg taggttcc 108

<210> 389

<211> 108

<212> DNA

<213>Artificial sequence

<400> 389

gactacatgg gacatgaagt accttaggag gcgcaagtac tccctgtttg cggccttcta 60

ctcagccacc atgctgcagg atgtggatga tgctacgtcg taggttcc 108

<210> 390

<211> 108

<212> DNA

<213>Artificial sequence

<400> 390

gactacatgg gacatcattc cagggtgcca ctactactac ctaccctggg gtaacgtgaa 60

acctgtggtg gtgctgtcat cctactggga ggatacgtcg taggttcc 108

<210> 391

<211> 108

<212> DNA

<213>Artificial sequence

<400> 391

gactacatgg gacatgcctg cccattccac aggaagctgg cctggagcag gtccacctgg 60

ccctgaaggc gcagtgctcc acggaggacg tggtacgtcg taggttcc 108

<210> 392

<211> 108

<212> DNA

<213>Artificial sequence

<400> 392

gactacatgg gacatgccag cctctgggtg acatccatga gacaccctct gccacccacc 60

tggaccagta cctgtaccag ctgcgcaccc atctacgtcg taggttcc 108

<210> 393

<211> 108

<212> DNA

<213>Artificial sequence

<400> 393

gactacatgg gacatgcccc agaacagcct gccggacatc gtcatctgga tgctgcaggg 60

agacaagcgt gtggcatacc agcgggtgcc cgctacgtcg taggttcc 108

<210> 394

<211> 108

<212> DNA

<213>Artificial sequence

<400> 394

gactacatgg gacatcccag tatccgatgg agaaggtgcc tggcgcccgg atgccagtgc 60

agatacgggt caagctgtgg tttgggctct cagtacgtcg taggttcc 108

<210> 395

<211> 108

<212> DNA

<213>Artificial sequence

<400> 395

gactacatgg gacatgtatg agaacgagac taagttggcc cttgttggga actggggcac 60

aacgggcctc acctacccca agttttctga cgttacgtcg taggttcc 108

<210> 396

<211> 108

<212> DNA

<213>Artificial sequence

<400> 396

gactacatgg gacatccctc ctccacagtc tgctccatga catggacgcc ggtcacctga 60

gcttcgtgga agaggtgttt gagaaccaga ccctacgtcg taggttcc 108

<210> 397

<211> 108

<212> DNA

<213>Artificial sequence

<400> 397

gactacatgg gacatgttcg gttttgtcct tagaacgggg agaaggtgct tcccaaggat 60

gacattgagt gcccactggg ctggaagtgg gaatacgtcg taggttcc 108

<210> 398

<211> 108

<212> DNA

<213>Artificial sequence

<400> 398

gactacatgg gacatggctg ggagtatagc atcaccatcc ccccggagcg gaagccgaag 60

cactgggtcc ctgctgagaa gatgtactac acatacgtcg taggttcc 108

<210> 399

<211> 108

<212> DNA

<213>Artificial sequence

<400> 399

gactacatgg gacatgcaca ggcaggcgga ggcggagggc gagggctggg agtacgcctc 60

tctttttggc tggaagttcc acctcgagta ccgtacgtcg taggttcc 108

<210> 400

<211> 108

<212> DNA

<213>Artificial sequence

<400> 400

gactacatgg gacatccata accagcttcg tgtctccagg gcggcgtgat ggatgacaag 60

agtgaagatt ccatgtccgt ctccaccttg agctacgtcg taggttcc 108

<210> 401

<211> 108

<212> DNA

<213>Artificial sequence

<400> 401

gactacatgg gacatctctg gcacctctgt tttttccctt ggtgaagatg ggaaccgcta 60

ccatctacgc tgctacatgt accaggcccg ggatacgtcg taggttcc 108

<210> 402

<211> 108

<212> DNA

<213>Artificial sequence

<400> 402

gactacatgg gacatgatcc ctatgccatc gtctccttcc tgcaccagag ccagaagacg 60

gtggtggtga agaacaccct taaccccacc tggtacgtcg taggttcc 108

<210> 403

<211> 108

<212> DNA

<213>Artificial sequence

<400> 403

gactacatgg gacatgggtg cagacgagtt tatgggtcgc tgcatctgtc aaccgagtct 60

ggaacggatg ccacggctgg cctggttccc acttacgtcg taggttcc 108

<210> 404

<211> 108

<212> DNA

<213>Artificial sequence

<400> 404

gactacatgg gacattgatg ggggccttag gtgacaagca catgaccaga gctctctttt 60

cttcactcca gccggccatc caccatattc ctgtacgtcg taggttcc 108

<210> 405

<211> 108

<212> DNA

<213>Artificial sequence

<400> 405

gactacatgg gacatcttcc aacccctctc accatctcct ggatgtgcca catcccatgg 60

ctgtgggcca ggtgcaggag acatcaagga tcctacgtcg taggttcc 108

<210> 406

<211> 108

<212> DNA

<213>Artificial sequence

<400> 406

gactacatgg gacatctacc tgctgtccac tgcagtctga ggacacagac ctgccctacc 60

caccacccca gagggaggcc aacatctaca tggtacgtcg taggttcc 108

<210> 407

<211> 108

<212> DNA

<213>Artificial sequence

<400> 407

gactacatgg gacatgatcc tggcatgggg cctgcggaac atgaagagtt accagctggc 60

caacatctcc tcccccagcc tcgtggtaga gtgtacgtcg taggttcc 108

<210> 408

<211> 108

<212> DNA

<213>Artificial sequence

<400> 408

gactacatgg gacatgatgc tgcccaggga ggagctctac tgccccccca tcaccgtcaa 60

ggtcatcgat aaccgccagt ttggccgccg gcctacgtcg taggttcc 108

<210> 409

<211> 108

<212> DNA

<213>Artificial sequence

<400> 409

gactacatgg gacatctctc aggcctggat ggctccctcc cctgcagacg atgtgagcct 60

actcagtcct ggggaagacg tgctcatcga cattacgtcg taggttcc 108

<210> 410

<211> 108

<212> DNA

<213>Artificial sequence

<400> 410

gactacatgg gacattctct aatcctgttg ctaaccagca tgtttcattt gtagcttgca 60

gacggtctgt cgagcttggc ccccactaac acgtacgtcg taggttcc 108

<210> 411

<211> 108

<212> DNA

<213>Artificial sequence

<400> 411

gactacatgg gacattcttt ctttctaccc actcaggagg aagagttcat cgattggtgg 60

agcaaattct ttgcctccat aggggagagg gaatacgtcg taggttcc 108

<210> 412

<211> 108

<212> DNA

<213>Artificial sequence

<400> 412

gactacatgg gacattggca ggtctatgac acacagctgg agaatgtgga ggcctttgag 60

ggcctgtctg acttttgtaa caccttcaag ctgtacgtcg taggttcc 108

<210> 413

<211> 108

<212> DNA

<213>Artificial sequence

<400> 413

gactacatgg gacatgggcc tcttcaaaat ttatcccctc ccagaagacc cagccatccc 60

catgccccca agacagttcc accagctggc cgctacgtcg taggttcc 108

<210> 414

<211> 108

<212> DNA

<213>Artificial sequence

<400> 414

gactacatgg gacatagaag tgttttgtct cctcctccag tgtgatcctt acatcaagat 60

ctccataggg aagaaatcag tgagtgacca ggatacgtcg taggttcc 108

<210> 415

<211> 108

<212> DNA

<213>Artificial sequence

<400> 415

gactacatgg gacatggatg ttcgagctga cctgcactct gcctctggag aaggacctaa 60

agatcactct ctatgactat gacctcctct ccatacgtcg taggttcc 108

<210> 416

<211> 108

<212> DNA

<213>Artificial sequence

<400> 416

gactacatgg gacatgctct ggaccgaacc agtggcggga ccagctccgc ccctcccagc 60

tcctccacct cttctgccag cagcatagag tcatacgtcg taggttcc 108

<210> 417

<211> 108

<212> DNA

<213>Artificial sequence

<400> 417

gactacatgg gacatgaggc tggcaggatc ccaaacccac acctgggccc agtggaggag 60

cgtctggctc tgcatgtgct tcagcagcag ggctacgtcg taggttcc 108

<210> 418

<211> 108

<212> DNA

<213>Artificial sequence

<400> 418

gactacatgg gacatggaga gaacggaccc tgtctccgca ggggaagctg cagatgtggg 60

tcgacctatt tccgaaggcc ctggggcggc ctgtacgtcg taggttcc 108

<210> 419

<211> 108

<212> DNA

<213>Artificial sequence

<400> 419

gactacatgg gacatattag agtgatacct ttccccaggt ttttcctgcg ttgtattatc 60

tggaatacca gagatgtgat cctggatgac ctgtacgtcg taggttcc 108

<210> 420

<211> 108

<212> DNA

<213>Artificial sequence

<400> 420

gactacatgg gacatgttgg atgattggct ttgaagaaca caagcaaaag acagacgtgc 60

attatcgttc cctgggaggt gaaggcaact tcatacgtcg taggttcc 108

<210> 421

<211> 108

<212> DNA

<213>Artificial sequence

<400> 421

gactacatgg gacattctgt tcctcttccg ggtcaggatg ccttctggag gctggacaag 60

actgagagca aaatcccagc acgagtggtg ttctacgtcg taggttcc 108

<210> 422

<211> 108

<212> DNA

<213>Artificial sequence

<400> 422

gactacatgg gacatggctc cctgcagctc gatctcaacc gcatgcccaa gccagccaag 60

acagccaaga agtgctcctt ggaccagctg gattacgtcg taggttcc 108

<210> 423

<211> 108

<212> DNA

<213>Artificial sequence

<400> 423

gactacatgg gacatctctc tgtcccctca gggcaagctg gaaatgacct tggagattgt 60

agcagagagt gagcatgagg agcggcctgc tggtacgtcg taggttcc 108

<210> 424

<211> 108

<212> DNA

<213>Artificial sequence

<400> 424

gactacatgg gacatggcgc cccgacacct ccttcctgtg gtttacctcc ccatacaaga 60

ccatgaagtt catcctgtgg cggcgtttcc ggttacgtcg taggttcc 108

<210> 425

<211> 108

<212> DNA

<213>Artificial sequence

<400> 425

gactacatgg gacattgcct gccccagtgg gatcaccatg ggtccctgtc tcctccctcc 60

ctccagaact atgctgccat gaagctggtg aagtacgtcg taggttcc 108

<210> 426

<211> 108

<212> DNA

<213>Artificial sequence

<400> 426

gactacatgg gacatagcag cggacagtcc tcctgttgtg tccgaccgag agtcctggtg 60

actttgaaca tgctggtgcc gctagccaag ctgtacgtcg taggttcc 108

<210> 427

<211> 108

<212> DNA

<213>Artificial sequence

<400> 427

gactacatgg gacatgcata tcagtgcttt catgccttaa aaattaagaa aaattatcta 60

cctctatgtg ctacaagatg gtcttcaact tcttacgtcg taggttcc 108

<210> 428

<211> 108

<212> DNA

<213>Artificial sequence

<400> 428

gactacatgg gacatggagt gaacatggaa aggtttgcag aagaagcaga tgttgtaata 60

gttggtgcag gccctgcagg gctctctgca gcttacgtcg taggttcc 108

<210> 429

<211> 108

<212> DNA

<213>Artificial sequence

<400> 429

gactacatgg gacataaaca tttctttttc ttcttttatt tctaggctcc acttaacact 60

cctgtaacag aagacagatt tggaatttta acatacgtcg taggttcc 108

<210> 430

<211> 108

<212> DNA

<213>Artificial sequence

<400> 430

gactacatgg gacattatat ttatagggct tccaatgaat aatcatggca attacattgt 60

acgcttggga catttagtga gctggatggg cgatacgtcg taggttcc 108

<210> 431

<211> 108

<212> DNA

<213>Artificial sequence

<400> 431

gactacatgg gacatgtatt aataaatttg ttttttatca tttttaggtc ctttttcatg 60

atgatggtag tgtaaaagga attgccacta acgtacgtcg taggttcc 108

<210> 432

<211> 108

<212> DNA

<213>Artificial sequence

<400> 432

gactacatgg gacatggcaa catttgagag aggactggaa ctacatgcta aagtcacaat 60

ttttgcagaa ggttgccatg gacatctagc caatacgtcg taggttcc 108

<210> 433

<211> 108

<212> DNA

<213>Artificial sequence

<400> 433

gactacatgg gacatgttat gggttattga tgaaaagaac tggaaacctg ggagagtaga 60

tcacactgtt ggttggccct tggacagaca tactacgtcg taggttcc 108

<210> 434

<211> 108

<212> DNA

<213>Artificial sequence

<400> 434

gactacatgg gacatggttg gtctagacta tcagaatcca tacctgagtc catttagaga 60

gttccaaagg tggaaacacc atcctagcat tcgtacgtcg taggttcc 108

<210> 435

<211> 108

<212> DNA

<213>Artificial sequence

<400> 435

gactacatgg gacatgtcta taccaaaact cacctttcct ggtggtttac taattggttg 60

tagtcctggt tttatgaatg ttcccaagat caatacgtcg taggttcc 108

<210> 436

<211> 108

<212> DNA

<213>Artificial sequence

<400> 436

gactacatgg gacatggact ccatgtaact gaatatgagg acaatttgaa gaactcatgg 60

gtatggaaag agctatattc tgttagaaat atatacgtcg taggttcc 108

<210> 437

<211> 108

<212> DNA

<213>Artificial sequence

<400> 437

gactacatgg gacatggttc tgactttgaa cggctcaagc cagccaagga ttgcacacct 60

attgagtatc caaaacccga tggacagatc agttacgtcg taggttcc 108

<210> 438

<211> 108

<212> DNA

<213>Artificial sequence

<400> 438

gactacatgg gacatggagt ttatgaattt gtacctgtgg aacaaggtga tggatttcgg 60

ttacagataa atgctcagaa ctgtgtacat tgttacgtcg taggttcc 108

<210> 439

<211> 108

<212> DNA

<213>Artificial sequence

<400> 439

gactacatgg gacattgcag tggcaggtcc cgtcagaaga gatgaggctc ctgggacagg 60

tcagcgtcag gggcagcctg ctgtctgctc tggtacgtcg taggttcc 108

<210> 440

<211> 108

<212> DNA

<213>Artificial sequence

<400> 440

gactacatgg gacatccaag gtgggcatct tgacgttacc tctgccacgt gtgagaagct 60

ctttttcggg caccgaggta ttaactgcag cagtacgtcg taggttcc 108

<210> 441

<211> 108

<212> DNA

<213>Artificial sequence

<400> 441

gactacatgg gacatcctgc ctgacccttg agctccaggc tcctgccagc tggaggtgaa 60

actgtgcttg tatccccagc cacgaagagc tggtacgtcg taggttcc 108

<210> 442

<211> 108

<212> DNA

<213>Artificial sequence

<400> 442

gactacatgg gacatcccag ccctgaccag ccctgtgggt ggaggtacct gtaaaaagcg 60

aaaggcagca gcctggtgtg ctgatccggg gcctacgtcg taggttcc 108

<210> 443

<211> 108

<212> DNA

<213>Artificial sequence

<400> 443

gactacatgg gacatcagca gcgtgtttct taccactctc tgtcaactga aagagtgcca 60

gccaggatat cttcctcttc tctaaacact cgatacgtcg taggttcc 108

<210> 444

<211> 108

<212> DNA

<213>Artificial sequence

<400> 444

gactacatgg gacatagtgg gagaggacac cttggctggt aaggtctgac ttacatttga 60

ggtcagatgt gacgacagca ggcccatcaa ggatacgtcg taggttcc 108

<210> 445

<211> 108

<212> DNA

<213>Artificial sequence

<400> 445

gactacatgg gacatcctcc tctctctcgc agtccagctt ctttagctgc ttcctgatgt 60

tttcttccct gacttgttga atcgcaaagt gcatacgtcg taggttcc 108

<210> 446

<211> 108

<212> DNA

<213>Artificial sequence

<400> 446

gactacatgg gacatccacc cacacgtact cgctggcaaa ctgccggcct tcttgtagct 60

tctgcagttc ccggggcagc gggctctggc agttacgtcg taggttcc 108

<210> 447

<211> 108

<212> DNA

<213>Artificial sequence

<400> 447

gactacatgg gacatacaag acagctgacc caccagagca gaggtcaaaa ttaaggggca 60

tttcgtctgg cacttggcca gtatgaagtc gactacgtcg taggttcc 108

<210> 448

<211> 108

<212> DNA

<213>Artificial sequence

<400> 448

gactacatgg gacatgttct gagaaggcca cgagaggggc tgagggagca tctcaccctg 60

aagaagtggg cagtgatgtc ctgtgtcagg gcatacgtcg taggttcc 108

<210> 449

<211> 108

<212> DNA

<213>Artificial sequence

<400> 449

gactacatgg gacatcacac ggggcaccta ccatctcaga gttgaccaag tggaagaact 60

gctcgcatct ggcagtgatg ggctgttctg ccttacgtcg taggttcc 108

<210> 450

<211> 108

<212> DNA

<213>Artificial sequence

<400> 450

gactacatgg gacatccgtt tgtacattag cagctccctc tgtctctgaa ggctggcagc 60

cacgctccac ccgcttgtca gagcctggag ccgtacgtcg taggttcc 108

<210> 451

<211> 108

<212> DNA

<213>Artificial sequence

<400> 451

gactacatgg gacatcactg agttgtggca ccctcaaact cacctgcaat ctggaaataa 60

tatcctcatt tcctgtgcgg ccaccaaaga ccatacgtcg taggttcc 108

<210> 452

<211> 108

<212> DNA

<213>Artificial sequence

<400> 452

gactacatgg gacatgctaa cctttggtgg aaatccatca gtgcgttgac aagaatggta 60

cacgcagcct gcaggtctcc gtcacagccc ccttacgtcg taggttcc 108

<210> 453

<211> 108

<212> DNA

<213>Artificial sequence

<400> 453

gactacatgg gacatagggt agctcttttc aacacttacc gttcagtatc tgaaagagca 60

tcagcttcag gttgaatttc cagctccagg tgttacgtcg taggttcc 108

<210> 454

<211> 108

<212> DNA

<213>Artificial sequence

<400> 454

gactacatgg gacatcgtga acatcttcct ctttcaacac ctctcggaag gttctgtgtg 60

tccagagaga gagggcagct ctctgccagt ctgtacgtcg taggttcc 108

<210> 455

<211> 108

<212> DNA

<213>Artificial sequence

<400> 455

gactacatgg gacataatag gaaaagagtg aacctacctt tttaataagg cctggagata 60

agcagctgca caaagtatct cgtgactggg aagtacgtcg taggttcc 108

<210> 456

<211> 108

<212> DNA

<213>Artificial sequence

<400> 456

gactacatgg gacatcttca ggcagaagaa caaggaatcc ctcgtcctac aggtcaggag 60

gctgtcaaag agcgcaggga caggaaggcc agctacgtcg taggttcc 108

<210> 457

<211> 108

<212> DNA

<213>Artificial sequence

<400> 457

gactacatgg gacatggccc ccatgaagga gagcctcacc tggtgacgga gcagctggca 60

gagccgggtg agcactgcag ggagcacacg tcctacgtcg taggttcc 108

<210> 458

<211> 108

<212> DNA

<213>Artificial sequence

<400> 458

gactacatgg gacatagccc caccactcag ggagctgccc gcgccttcac ctctccgggg 60

gagcgacact ggaggcagcc atcaggttct gactacgtcg taggttcc 108

<210> 459

<211> 108

<212> DNA

<213>Artificial sequence

<400> 459

gactacatgg gacataccat gtgttcccgt ggctccagtc tcggcgtgtt gatgctgagc 60

tgaatctttg atatctcaac gctgctgtca tcctacgtcg taggttcc 108

<210> 460

<211> 108

<212> DNA

<213>Artificial sequence

<400> 460

gactacatgg gacatccatc catcctcacc atcacgctgg ctggggtctg tcatggaggc 60

tctcagctct cccagtgcag ctgtgagctg tcctacgtcg taggttcc 108

<210> 461

<211> 108

<212> DNA

<213>Artificial sequence

<400> 461

gactacatgg gacatagtcc cagagtggac aagcggccca ggaacttacc ttctggcttc 60

tcttcagcag cagagcaggc ctggcagtag gtgtacgtcg taggttcc 108

<210> 462

<211> 108

<212> DNA

<213>Artificial sequence

<400> 462

gactacatgg gacatgaaga aacctggaag tagtcatccc cttctaaccg ttgctgcata 60

cctcttcaga gactctataa acgccacacg ggatacgtcg taggttcc 108

<210> 463

<211> 108

<212> DNA

<213>Artificial sequence

<400> 463

gactacatgg gacatctaca caactggtca caaactcatg gagacgcata ctgaccactc 60

gaggtgtgag cagggcgggg aggaagtggg acatacgtcg taggttcc 108

<210> 464

<211> 108

<212> DNA

<213>Artificial sequence

<400> 464

gactacatgg gacatgaggc cttttcggca gcccagccta cctggcctcc atgacggtga 60

ctgggatgtt ccccgtatgc tcaaacacca tgatacgtcg taggttcc 108

<210> 465

<211> 108

<212> DNA

<213>Artificial sequence

<400> 465

gactacatgg gacatgcgtg actggctgag accctgcagg gctcaagcaa cattacctca 60

gtaatgtccc cagctgatga caaatcctcg tagtacgtcg taggttcc 108

<210> 466

<211> 108

<212> DNA

<213>Artificial sequence

<400> 466

gactacatgg gacatgtggg catggaggga cagcttgcct tgaggtcggc cagccgtgtc 60

ttggccaatg agatgtagtc tgtgaggagg gagtacgtcg taggttcc 108

<210> 467

<211> 108

<212> DNA

<213>Artificial sequence

<400> 467

gactacatgg gacatcagcc agcttctcac ctgcaggtac cggggagact caaaaggcac 60

gagttctgac aagaacgtaa acaggaagac cagtacgtcg taggttcc 108

<210> 468

<211> 108

<212> DNA

<213>Artificial sequence

<400> 468

gactacatgg gacatttacc ttgaaccagt ctgcatatga caggaacgca gaggggccct 60

ccagtgctgc ctggcgcaca accaggaacg cagtacgtcg taggttcc 108

<210> 469

<211> 108

<212> DNA

<213>Artificial sequence

<400> 469

gactacatgg gacatccttc aagcagctgc tgcgcttctg gaaagcagac aaccagggca 60

gacacaaagg agagcactct ctgccagtga acctacgtcg taggttcc 108

<210> 470

<211> 108

<212> DNA

<213>Artificial sequence

<400> 470

gactacatgg gacattcaga agcaggtata ataccacatc cactcaccct gcggtacagt 60

gaggtgagca gagggtgtgt ccgcgcaaag ctctacgtcg taggttcc 108

<210> 471

<211> 108

<212> DNA

<213>Artificial sequence

<400> 471

gactacatgg gacatcacac tgggcctacc tttcagcaca gggctgtgag tgagtatctg 60

agtcagggta tgactgaaga acctcttcag aggtacgtcg taggttcc 108

<210> 472

<211> 108

<212> DNA

<213>Artificial sequence

<400> 472

gactacatgg gacatggtcg cctcctcctc acgcacgtta tcgtaactgg cagaggaagt 60

gtgctcagga gcgggctgct gaagctctgg aagtacgtcg taggttcc 108

<210> 473

<211> 108

<212> DNA

<213>Artificial sequence

<400> 473

gactacatgg gacattgctg cacactcagg caggccaccc tcaggaacat accagcacct 60

cacgatcttg tgagtggagg actcctcctg tactacgtcg taggttcc 108

<210> 474

<211> 108

<212> DNA

<213>Artificial sequence

<400> 474

gactacatgg gacatgctaa taagcaaact aagtcattta cagtctgggc tgcagtgcaa 60

ttaacttaca aatcagcatt ctctgcagta cattacgtcg taggttcc 108

<210> 475

<211> 108

<212> DNA

<213>Artificial sequence

<400> 475

gactacatgg gacattaaac tcttcacttg acttttcctc ctacctgcgg cattttttca 60

ggctccacag ttcttctcag atctgagttt ttctacgtcg taggttcc 108

<210> 476

<211> 108

<212> DNA

<213>Artificial sequence

<400> 476

gactacatgg gacattgtca tgaacgcacc agaaagcatg gccctggcga cgtcagcatg 60

ctggcaggat gcttccatct gttcacaaag gcatacgtcg taggttcc 108

<210> 477

<211> 108

<212> DNA

<213>Artificial sequence

<400> 477

gactacatgg gacataaaca gtaacactga atcatcatta gcacgctacc tttccagcag 60

ctcttgcagg ctcacaatgc cttgtacgtg aagtacgtcg taggttcc 108

<210> 478

<211> 108

<212> DNA

<213>Artificial sequence

<400> 478

gactacatgg gacatagacg ggagaacata ctgtgtgcca ataaatactg agcaaactct 60

aacagggaag acagcttctt ctgaaaagag agatacgtcg taggttcc 108

<210> 479

<211> 108

<212> DNA

<213>Artificial sequence

<400> 479

gactacatgg gacatctctc tgctccacag tcagcagcac agggtgactg gtctccgctg 60

gagccgtgca gatctgtccc acgctagagg caatacgtcg taggttcc 108

<210> 480

<211> 108

<212> DNA

<213>Artificial sequence

<400> 480

gactacatgg gacatagaga aaatgaagct ataacttacc tataaatgaa ctagaatgat 60

tagcataggc ctcagaactg tcacagtcaa tcatacgtcg taggttcc 108

<210> 481

<211> 108

<212> DNA

<213>Artificial sequence

<400> 481

gactacatgg gacataccag cttcctctta cctcaagcaa aagggcattc aggtcctgat 60

ggcttcgcag gaggcgcaca gctgattcct ttatacgtcg taggttcc 108

<210> 482

<211> 108

<212> DNA

<213>Artificial sequence

<400> 482

gactacatgg gacatcccac tcccgcggcc tgccgcgccc acctacccag cagctcggcc 60

caggccctcc ggcggccccc tgggtcctgg ccctacgtcg taggttcc 108

<210> 483

<211> 108

<212> DNA

<213>Artificial sequence

<400> 483

gactacatgg gacatatggg cgcccctgcc tgcgccctcg cgctctgcgt ggccgtggcc 60

atcgtggccg gcgcctcctc ggagtccttg gggtacgtcg taggttcc 108

<210> 484

<211> 108

<212> DNA

<213>Artificial sequence

<400> 484

gactacatgg gacatgaagt cccgggccca gagcccggcc agcaggagca gttggtcttc 60

ggcagcgggg atgctgtgga gctgagctgt ccctacgtcg taggttcc 108

<210> 485

<211> 108

<212> DNA

<213>Artificial sequence

<400> 485

gactacatgg gacatcaggt tgggcattgg ttgcggccat ctctgccttg cagacgctcc 60

atcctcggga gatgacgaag acggggagga cgatacgtcg taggttcc 108

<210> 486

<211> 108

<212> DNA

<213>Artificial sequence

<400> 486

gactacatgg gacatggggc cccttactgg acacggcccg agcggatgga caagaagctg 60

ctggccgtgc cggccgccaa caccgtccgc ttctacgtcg taggttcc 108

<210> 487

<211> 108

<212> DNA

<213>Artificial sequence

<400> 487

gactacatgg gacatccggt gcagctgcgg catcagcagt ggagcctggt catggaaagc 60

gtggtgccct cggaccgcgg caactacacc tgctacgtcg taggttcc 108

<210> 488

<211> 108

<212> DNA

<213>Artificial sequence

<400> 488

gactacatgg gacatgagcg ctccccgcac cggcccatcc tgcaggcggg gctgccggcc 60

aaccagacgg cggtgctggg cagcgacgtg gagtacgtcg taggttcc 108

<210> 489

<211> 108

<212> DNA

<213>Artificial sequence

<400> 489

gactacatgg gacatgtcct ggatcagtga gagtgtggag gccgacgtgc gcctccgcct 60

ggccaatgtg tcggagcggg acgggggcga gtatacgtcg taggttcc 108

<210> 490

<211> 108

<212> DNA

<213>Artificial sequence

<400> 490

gactacatgg gacatgacgg cgggcgctaa caccaccgac aaggagctag aggttctctc 60

cttgcacaac gtcacctttg aggacgccgg ggatacgtcg taggttcc 108

<210> 491

<211> 108

<212> DNA

<213>Artificial sequence

<400> 491

gactacatgg gacatgccga ggaggagctg gtggaggctg acgaggcggg cagtgtgtat 60

gcaggcatcc tcagctacgg ggtgggcttc ttctacgtcg taggttcc 108

<210> 492

<211> 108

<212> DNA

<213>Artificial sequence

<400> 492

gactacatgg gacatggtgt ccctggagtc caacgcgtcc atgagctcca acacaccact 60

ggtgcgcatc gcaaggctgt cctcagggga gggtacgtcg taggttcc 108

<210> 493

<211> 108

<212> DNA

<213>Artificial sequence

<400> 493

gactacatgg gacatccact gccaggctga ccctgggcaa gccccttggg gagggctgct 60

tcggccaggt ggtcatggcg gaggccatcg gcatacgtcg taggttcc 108

<210> 494

<211> 108

<212> DNA

<213>Artificial sequence

<400> 494

gactacatgg gacatgggcc cctgtacgtg ctggtggagt acgcggccaa gggtaacctg 60

cgggagtttc ttggactact ccttcgacac ctgtacgtcg taggttcc 108

<210> 495

<211> 108

<212> DNA

<213>Artificial sequence

<400> 495

gactacatgg gacataatgt gctggtgacc gaggacaacg tgatgaagat cgcagacttc 60

gggctggccc gggacgtgca caacctcgac tactacgtcg taggttcc 108

<210> 496

<211> 108

<212> DNA

<213>Artificial sequence

<400> 496

gactacatgg gacattttgg ggtcctgctc tgggagatct tcacgctggg gggctccccg 60

taccccggca tccctgtgga ggagctcttc aagtacgtcg taggttcc 108

<210> 497

<211> 108

<212> DNA

<213>Artificial sequence

<400> 497

gactacatgg gacatgtgct ggcatgccgc gccctcccag aggcccacct tcaagcagct 60

ggtggaggac ctggaccgtg tccttaccgt gactacgtcg taggttcc 108

<210> 498

<211> 108

<212> DNA

<213>Artificial sequence

<400> 498

gactacatgg gacatggacc tgtcggcgcc tttcgagcag tactccccgg gtggccagga 60

cacccccagc tccagctcct caggggacga ctctacgtcg taggttcc 108

<210> 499

<211> 108

<212> DNA

<213>Artificial sequence

<400> 499

gactacatgg gacatcttat accacagtct cactgccttt tccaggcttc acccaaccat 60

ttcctctctt ctctctcttt acctttccag aattacgtcg taggttcc 108

<210> 500

<211> 108

<212> DNA

<213>Artificial sequence

<400> 500

gactacatgg gacatgtgtg aaagttgtca gctgcagctc ggcgtccgtc tgcagctcgt 60

gcccaaccag gttgggcatc ttggtcacgt tgttacgtcg taggttcc 108

<210> 501

<211> 108

<212> DNA

<213>Artificial sequence

<400> 501

gactacatgg gacatgatgg aggaaggaat gaatgttctc catgactttg ggatccagtc 60

aacacattac ctccaggtga attaccaaga ctctacgtcg taggttcc 108

<210> 502

<211> 108

<212> DNA

<213>Artificial sequence

<400> 502

gactacatgg gacatttctg tttttccata ggattctctt tggacagcgt ccatactggt 60

gggttttgga tactgactac tacagcaaca ctttacgtcg taggttcc 108

<210> 503

<211> 108

<212> DNA

<213>Artificial sequence

<400> 503

gactacatgg gacatctctt tcctgccctt tagggagccc ctctggccat gccatgggca 60

cagcaggtgt atactacgtg atggtcacat ctatacgtcg taggttcc 108

<210> 504

<211> 108

<212> DNA

<213>Artificial sequence

<400> 504

gactacatgg gacattcttc tgttgcaggt gcttgaatgt cattttgtgg ttgggattct 60

gggctgtgca gctgaatgtc tgtctgtcac gaatacgtcg taggttcc 108

<210> 505

<211> 108

<212> DNA

<213>Artificial sequence

<400> 505

gactacatgg gacatggcat tgctgttgca gaaactttca gccacatcca cagcatctat 60

aatgccagcc tcaagaaata ttttctcatt acctacgtcg taggttcc 108

<210> 506

<211> 108

<212> DNA

<213>Artificial sequence

<400> 506

gactacatgg gacatcatgg gagtgaggca cccgccctgc tcccaccggc tcctggccgt 60

ctgcgccctc gtgtccttgg caaccgctgc acttacgtcg taggttcc 108

<210> 507

<211> 108

<212> DNA

<213>Artificial sequence

<400> 507

gactacatgg gacatgatca aagatccagc taacaggcgc tacgaggtgc ccttggagac 60

cccgcatgtc cacagccggg caccgtcccc acttacgtcg taggttcc 108

<210> 508

<211> 108

<212> DNA

<213>Artificial sequence

<400> 508

gactacatgg gacatggctg aacacgacgg tggcgcccct gttctttgcg gaccagttcc 60

ttcagctgtc cacctcgctg ccctcgcagt atatacgtcg taggttcc 108

<210> 509

<211> 108

<212> DNA

<213>Artificial sequence

<400> 509

gactacatgg gacatcgccg tctcctgcat gtcccagccc ggtgcgaacc tctacgggtc 60

tcaccctttc tacctggcgc tggaggacgg cggtacgtcg taggttcc 108

<210> 510

<211> 108

<212> DNA

<213>Artificial sequence

<400> 510

gactacatgg gacatttccc ttccagatgt ggtcctgcag ccgagccctg cccttagctg 60

gaggtcgaca ggtgggatcc tggatgtcta cattacgtcg taggttcc 108

<210> 511

<211> 108

<212> DNA

<213>Artificial sequence

<400> 511

gactacatgg gacatttggc ctgcaggata cccgttcatg ccgccatact ggggcctggg 60

cttccacctg tgccgctggg gctactcctc cactacgtcg taggttcc 108

<210> 512

<211> 108

<212> DNA

<213>Artificial sequence

<400> 512

gactacatgg gacattgcag gacgtccagt ggaacgacct ggactacatg gactcccgga 60

gggacttcac gttcaacaag gatggcttcc gggtacgtcg taggttcc 108

<210> 513

<211> 108

<212> DNA

<213>Artificial sequence

<400> 513

gactacatgg gacattttcc ctcttcccag gatcctgcca tcagcagctc gggccctgcc 60

gggagctaca ggccctacga cgagggtctg cggtacgtcg taggttcc 108

<210> 514

<211> 108

<212> DNA

<213>Artificial sequence

<400> 514

gactacatgg gacatctctc gttgtccagg tatggcccgg gtccactgcc ttccccgact 60

tcaccaaccc cacagccctg gcctggtggg aggtacgtcg taggttcc 108

<210> 515

<211> 108

<212> DNA

<213>Artificial sequence

<400> 515

gactacatgg gacattcacc taccagcagc gcttctcttg caggacatga acgagccttc 60

caacttcatc aggggctctg aggacggctg ccctacgtcg taggttcc 108

<210> 516

<211> 108

<212> DNA

<213>Artificial sequence

<400> 516

gactacatgg gacatcgcct cttccagggg tggttggggg gaccctccag gcggccacca 60

tctgtgcctc cagccaccag tttctctcca cactacgtcg taggttcc 108

<210> 517

<211> 108

<212> DNA

<213>Artificial sequence

<400> 517

gactacatgg gacatccagg gcgctggtga aggctcgggg gacacgccca tttgtgatct 60

cccgctcgac ctttgctggc cacggccgat acgtacgtcg taggttcc 108

<210> 518

<211> 108

<212> DNA

<213>Artificial sequence

<400> 518

gactacatgg gacatgaaat cctgcagttt aacctgctgg gggtgcctct ggtcggggcc 60

gacgtctgcg gcttcctggg caacacctca gagtacgtcg taggttcc 108

<210> 519

<211> 108

<212> DNA

<213>Artificial sequence

<400> 519

gactacatgg gacatgcccc aggagccgta cagcttcagc gagccggccc agcaggccat 60

gaggaaggcc ctcaccctgc gctacgcact ccttacgtcg taggttcc 108

<210> 520

<211> 108

<212> DNA

<213>Artificial sequence

<400> 520

gactacatgg gacatggttc cccaaggact ctagcacctg gactgtggac caccagctcc 60

tgtgggggga ggccctgctc atcaccccag tgctacgtcg taggttcc 108

<210> 521

<211> 108

<212> DNA

<213>Artificial sequence

<400> 521

gactacatgg gacatggtgc cagtagaggc ccttggcagc ctcccacccc cacctgcagc 60

tccccgtgag ccagccatcc acagcgaggg gcatacgtcg taggttcc 108

<210> 522

<211> 108

<212> DNA

<213>Artificial sequence

<400> 522

gactacatgg gacatgggcc ctggcctcac aaccacagag tcccgccagc agcccatggc 60

cctggctgtg gccctgacca agggtgggga ggctacgtcg taggttcc 108

<210> 523

<211> 108

<212> DNA

<213>Artificial sequence

<400> 523

gactacatgg gacatgaaca cgatcgtgaa tgagctggta cgtgtgacca gtgagggagc 60

tggcctgcag ctgcagaagg tgactgtcct gggtacgtcg taggttcc 108

<210> 524

<211> 108

<212> DNA

<213>Artificial sequence

<400> 524

gactacatgg gacattggga tctcgggctg ctccatttgt gctctctctt ttccaggtcc 60

tggacatctg tgtctcgctg ttgatgggag agctacgtcg taggttcc 108

<210> 525

<211> 108

<212> DNA

<213>Artificial sequence

<400> 525

gactacatgg gacatgttaa actggctttt ttgacttccc agaacaatat ctaattagca 60

aataacacaa ttcagtgaca ttcagcagga tgctacgtcg taggttcc 108

<210> 526

<211> 108

<212> DNA

<213>Artificial sequence

<400> 526

gactacatgg gacatcatgg actggaagac actccaggcc ctactgagcg gtgtgaacaa 60

gtactccaca gcgttcgggc gcatctggct gtctacgtcg taggttcc 108

<210> 527

<211> 108

<212> DNA

<213>Artificial sequence

<400> 527

gactacatgg gacatcacac cagccaccac tttctgatag gcagcctgca ctggtggggt 60

gaattctttg ccaaagtgat gggccagcac acatacgtcg taggttcc 108

<210> 528

<211> 108

<212> DNA

<213>Artificial sequence

<400> 528

gactacatgg gacatttcag gtttcaggct ttagggtgta acatgggggg gcccagtagg 60

ggctatgctg gttgcatggg gaggccccag gcctacgtcg taggttcc 108

<210> 529

<211> 108

<212> DNA

<213>Artificial sequence

<400> 529

gactacatgg gacattgata gactgcagca tgcttatgac agcgttctca ccgaaaagtt 60

cccgtggtat tcagtaacaa gatcctctag gtttacgtcg taggttcc 108

<210> 530

<211> 108

<212> DNA

<213>Artificial sequence

<400> 530

gactacatgg gacattctgg gcttctccaa atctcaccgt tccagccaga aatacacaca 60

gagaaggctg ataatcaatc ccatggagcc aactacgtcg taggttcc 108

<210> 531

<211> 108

<212> DNA

<213>Artificial sequence

<400> 531

gactacatgg gacatccttt tgaagtattg ctcccccagt ggattgggtg gctccattca 60

ctccaatgct gagcacttcc acagagtggg ttatacgtcg taggttcc 108

<210> 532

<211> 108

<212> DNA

<213>Artificial sequence

<400> 532

gactacatgg gacatcagtc cagctgtggt cccagtcagt ccggtactgc accaagtgct 60

ccaaacagtg gttcaagaat ctgttgttcc agttacgtcg taggttcc 108

<210> 533

<211> 108

<212> DNA

<213>Artificial sequence

<400> 533

gactacatgg gacatcccag attctgcagt tttagcatct gtgtggcctg tctcctgggt 60

tcccgtgggt cctggagctg aacaacaaat gtttacgtcg taggttcc 108

<210> 534

<211> 108

<212> DNA

<213>Artificial sequence

<400> 534

gactacatgg gacatccaat aatgcagagt gaggttggta ggctggggct cagagctgct 60

gttccaagtg caattcatgt actcgacatt gaatacgtcg taggttcc 108

<210> 535

<211> 108

<212> DNA

<213>Artificial sequence

<400> 535

gactacatgg gacatccaga tttcccacca gctgtggtgt cttcattccc attgggcgtc 60

agaattgtcg tgttcagccc cactcccagc aggtacgtcg taggttcc 108

<210> 536

<211> 108

<212> DNA

<213>Artificial sequence

<400> 536

gactacatgg gacatgctat acgatgtact ccattcggtt taagctctgg gcactttcca 60

agtctctgtt gtcctgtttg tttgtccagt ttgtacgtcg taggttcc 108

<210> 537

<211> 108

<212> DNA

<213>Artificial sequence

<400> 537

gactacatgg gacatcctgt tctgttcttc agaggccgcc tctgaactct tacttctgca 60

acggcagcaa tcagcgagct gtttccatca cgttacgtcg taggttcc 108

<210> 538

<211> 108

<212> DNA

<213>Artificial sequence

<400> 538

gactacatgg gacatcttac aatggccaca tgtatttcat tgttcgctga aggggaaggc 60

tcgcaagcga tgtagattga atattcagcg gaatacgtcg taggttcc 108

<210> 539

<211> 108

<212> DNA

<213>Artificial sequence

<400> 539

gactacatgg gacatctggt gacatcatct ccttgttaaa ggtaaatgtg atgttcgcac 60

agttatcctg gtaataggag tcagaggtgc acttacgtcg taggttcc 108

<210> 540

<211> 108

<212> DNA

<213>Artificial sequence

<400> 540

gactacatgg gacatagcca tcatgtccta cctttgagca ggcgatccgt ccattcaggc 60

actggcaggt attacagtca tcatcccatt tggtacgtcg taggttcc 108

<210> 541

<211> 108

<212> DNA

<213>Artificial sequence

<400> 541

gactacatgg gacatcctgg cacacatacc ttcctggcac ttggcaccac tgtgccctgg 60

agggcagaca caccggtagc cattgatctc atctacgtcg taggttcc 108

<210> 542

<211> 108

<212> DNA

<213>Artificial sequence

<400> 542

gactacatgg gacatgggaa aaccagacgg agacagtcct tacttattct gcagtcgggc 60

ccagcaaaac ccggggcaca ttcgcaccgg tactacgtcg taggttcc 108

<210> 543

<211> 108

<212> DNA

<213>Artificial sequence

<400> 543

gactacatgg gacatgatag tggatgagtg ctggcttaaa aggatgtcac acttaccagg 60

gatgagggct gcagtcattg gtatctgcaa agatacgtcg taggttcc 108

<210> 544

<211> 108

<212> DNA

<213>Artificial sequence

<400> 544

gactacatgg gacatgagga cactcactct gagcacagat gggcccctcc cagccttcct 60

tgcagacgca cgtaaaggac tcgccgttga ccatacgtcg taggttcc 108

<210> 545

<211> 108

<212> DNA

<213>Artificial sequence

<400> 545

gactacatgg gacatgggca taaagttacc tatgttacag gttgttcctt cccagccgcc 60

aggacacatg cacttaaaag catccccctc atctacgtcg taggttcc 108

<210> 546

<211> 108

<212> DNA

<213>Artificial sequence

<400> 546

gactacatgg gacatcaact accacttacg tgagtggcag gtctttcctt tccacccatt 60

tttacagtca cagtagaagt cattgaccag gtctacgtcg taggttcc 108

<210> 547

<211> 108

<212> DNA

<213>Artificial sequence

<400> 547

gactacatgg gacatagtgg cagactcact ggtttcacag taggccccct cccagccgtc 60

actacagatg cacttgtagg agttgacacc atctacgtcg taggttcc 108

<210> 548

<211> 108

<212> DNA

<213>Artificial sequence

<400> 548

gactacatgg gacatctttc atggcagtat gttcccgtga agcctttgtt acagtcacag 60

gtgaatttgc ctcccgactg actcttgcac ttctacgtcg taggttcc 108

<210> 549

<211> 108

<212> DNA

<213>Artificial sequence

<400> 549

gactacatgg gacatccttc acagggggtc gtgcggcagt ggtctttcag gtgtgagcag 60

ttcttgccct catagtcctc ggggcacttg cagtacgtcg taggttcc 108

<210> 550

<211> 108

<212> DNA

<213>Artificial sequence

<400> 550

gactacatgg gacatcctga cagaggtttc cagagaaacc agtgggacac agacactgga 60

atctgttgat ttcattctga cagtgacccc cattacgtcg taggttcc 108

<210> 551

<211> 108

<212> DNA

<213>Artificial sequence

<400> 551

gactacatgg gacattttgt tgtcaattgt caaagttttg atttaagcaa agatttacat 60

acccgacagg aggcgtcatt ctgacactgg ccatacgtcg taggttcc 108

<210> 552

<211> 108

<212> DNA

<213>Artificial sequence

<400> 552

gactacatgg gacatacaaa gtcactcact tatgtcacaa ttctgaccca tccagccggg 60

aagacagtcg cagtagtagc tggcaatgag atttacgtcg taggttcc 108

<210> 553

<211> 108

<212> DNA

<213>Artificial sequence

<400> 553

gactacatgg gacataggga tgttcttacc taactggcac gttttcccag tccactgtgg 60

ggggcacaca cacttaaatc cgttaaccag gtctacgtcg taggttcc 108

<210> 554

<211> 108

<212> DNA

<213>Artificial sequence

<400> 554

gactacatgg gacataaaat tggacttact tgtagagcat gtggggccgg tccagcctgg 60

ggaacactca cactcaaagc ccagggaggt ctctacgtcg taggttcc 108

<210> 555

<211> 108

<212> DNA

<213>Artificial sequence

<400> 555

gactacatgg gacatggacc acttaccaat ttcacagttg ggtcctgaat acccctcagg 60

gcaggaacac tgatatttgt cagggcctgt gtttacgtcg taggttcc 108

<210> 556

<211> 108

<212> DNA

<213>Artificial sequence

<400> 556

gactacatgg gacatccagt tggtctcaca gaggcactgc cagggctcat tacagatgcc 60

gtggacgcat cccgggtgtg ggatgcactt atctacgtcg taggttcc 108

<210> 557

<211> 108

<212> DNA

<213>Artificial sequence

<400> 557

gactacatgg gacatgaaaa ttaaaagaaa tctcacaaaa gaccagttga tttacctgca 60

gtcacctggg agtttgcaag acccatgctt aggtacgtcg taggttcc 108

<210> 558

<211> 108

<212> DNA

<213>Artificial sequence

<400> 558

gactacatgg gacatcctct gttacattcg gggcccatcc agccttccat gcaagttttg 60

ttgccattct ggtcacaggc atagtgtcca aagtacgtcg taggttcc 108

<210> 559

<211> 108

<212> DNA

<213>Artificial sequence

<400> 559

gactacatgg gacatacttc cacgtgtgtt tagagaaaag tccacagaag cgatacttac 60

gaacggtgtc attactggaa tcccacgcct ccatacgtcg taggttcc 108

<210> 560

<211> 108

<212> DNA

<213>Artificial sequence

<400> 560

gactacatgg gacatccggc caggcgaaac tgaaaggcag cacgatgcgg ttgcggtcgt 60

tgccgcggct ggccttgagg ttgaaggtgt tgctacgtcg taggttcc 108

<210> 561

<211> 108

<212> DNA

<213>Artificial sequence

<400> 561

gactacatgg gacattggga gggaggcccg gagaagggct cctaccttgg ctcgcagggc 60

acagagcagg gcgagcagga ggcttagggg gcgtacgtcg taggttcc 108

<210> 562

<211> 108

<212> DNA

<213>Artificial sequence

<400> 562

gactacatgg gacatgtcag ctaactctct cggtcacggg cgtccggctg tccacaggct 60

cctctctgtt tggccttggc atggaggatg aaatacgtcg taggttcc 108

<210> 563

<211> 108

<212> DNA

<213>Artificial sequence

<400> 563

gactacatgg gacatcttga tcaaatacac atcatacttc ccagcagagc ggccagattt 60

cctttgctta agcttccgtg tccagccttc aggtacgtcg taggttcc 108

<210> 564

<211> 108

<212> DNA

<213>Artificial sequence

<400> 564

gactacatgg gacatttacc tgagccctaa catcccagct accatggaat cctgttggag 60

ctggtctaca gaagcaaggt gtattctggg gagtacgtcg taggttcc 108

<210> 565

<211> 108

<212> DNA

<213>Artificial sequence

<400> 565

gactacatgg gacatggcaa gggtccccgc ccgcggccac ggcggtccca ctcacagtct 60

ctcctcctcg cctcctcctc ctcctccgct cggtacgtcg taggttcc 108

<210> 566

<211> 108

<212> DNA

<213>Artificial sequence

<400> 566

gactacatgg gacatcccca gcaagctcag cgtgtaacgt gcgctatgga gccgaaagtc 60

gcagagctga agcagaagat cgaggacacg ctatacgtcg taggttcc 108

<210> 567

<211> 108

<212> DNA

<213>Artificial sequence

<400> 567

gactacatgg gacatggtgg catggtacaa tgaactcttg cctccagcct tccacctacc 60

gctgccagga cctaccctgg ccttcctggt acttacgtcg taggttcc 108

<210> 568

<211> 108

<212> DNA

<213>Artificial sequence

<400> 568

gactacatgg gacatgagcc tcccagagct gcagatagaa atcattgctg actacgaggt 60

gcaccccaac cgacgcccca agatcctggc ccatacgtcg taggttcc 108

<210> 569

<211> 108

<212> DNA

<213>Artificial sequence

<400> 569

gactacatgg gacatgcgca tatcaggtgt gtgcatacac ccccgatttg ggggctggtt 60

tgccatccga ggggtagtgc tgctgccagg gattacgtcg taggttcc 108

<210> 570

<211> 108

<212> DNA

<213>Artificial sequence

<400> 570

gactacatgg gacataggat attatacaga ttgctgcttc ttttccaaac acttctcaat 60

atcatcaagc acctgaacgg cagcctttgg aattacgtcg taggttcc 108

<210> 571

<211> 108

<212> DNA

<213>Artificial sequence

<400> 571

gactacatgg gacatcctga ggtggtatca cccctccaca catgacaaga atatctggcc 60

gtccaaggga gttaagttct ttgatgagtt cagtacgtcg taggttcc 108

<210> 572

<211> 108

<212> DNA

<213>Artificial sequence

<400> 572

gactacatgg gacatcctgg aaaagagggc ctatgtccac atcaaaacca agatcagcaa 60

atcctgtagc aataactttt gctcctctgt cattacgtcg taggttcc 108

<210> 573

<211> 108

<212> DNA

<213>Artificial sequence

<400> 573

gactacatgg gacatattac ctcttgatag cagatgttat ctctttactt tctccaaatt 60

cctggcgata tgctccactc accattcgat cattacgtcg taggttcc 108

<210> 574

<211> 108

<212> DNA

<213>Artificial sequence

<400> 574

gactacatgg gacattatat atcttcacct tgcccgagat gcatccactg caagagccag 60

gatatttcca tctccgctag cagcacattc ggttacgtcg taggttcc 108

<210> 575

<211> 108

<212> DNA

<213>Artificial sequence

<400> 575

gactacatgg gacataagct attaatacct tcttaagttt ttcaatctgc ctgtttcgca 60

ctgaagtatt atcaattgcc agaacttcta cagtacgtcg taggttcc 108

<210> 576

<211> 108

<212> DNA

<213>Artificial sequence

<400> 576

gactacatgg gacatttctc actatcttac cagaatctat tctagcttgt cttcgggcag 60

cacattcttc aattcgaagt ttaggtattc ccttacgtcg taggttcc 108

<210> 577

<211> 108

<212> DNA

<213>Artificial sequence

<400> 577

gactacatgg gacatccttt aaagcagcat cataaacatc atttgtgaga cattccatca 60

tgtaagaacc tccccaagga tcagccactt tggtacgtcg taggttcc 108

<210> 578

<211> 108

<212> DNA

<213>Artificial sequence

<400> 578

gactacatgg gacatcctgc tcagtaagtg accatccaga tgtctgacag tgtgctctta 60

gaagaagaga ttttgagttt ttaggctgaa acatacgtcg taggttcc 108

<210> 579

<211> 108

<212> DNA

<213>Artificial sequence

<400> 579

gactacatgg gacatccttg gtgcaaattc atcaattgtc aggccagcct ggagtccagt 60

tctagagtac tccaatccat ctgctaaagt atatacgtcg taggttcc 108

<210> 580

<211> 108

<212> DNA

<213>Artificial sequence

<400> 580

gactacatgg gacatccttt gctgtatatt caaatatgtc agcaataatt ttcatggatg 60

gttctggagg aaaaatgtat gtatttcgaa ccatacgtcg taggttcc 108

<210> 581

<211> 108

<212> DNA

<213>Artificial sequence

<400> 581

gactacatgg gacatccctt aatgttgtcc ttatagaact tattgctttc ttccacagta 60

ctaaaaccag catactggcg gatggtccag ggctacgtcg taggttcc 108

<210> 582

<211> 108

<212> DNA

<213>Artificial sequence

<400> 582

gactacatgg gacatgcggg gaggacatgg ccgcgcacag gccggtggaa tgggtccagg 60

ccgtggtcag ccgcttcgac gagcaggtaa ccgtacgtcg taggttcc 108

<210> 583

<211> 108

<212> DNA

<213>Artificial sequence

<400> 583

gactacatgg gacatgcttc caataaaaac aggacagcag aacacacata ccaaagtcag 60

tactgagcac aacaaggaat gtctaatcaa tattacgtcg taggttcc 108

<210> 584

<211> 108

<212> DNA

<213>Artificial sequence

<400> 584

gactacatgg gacattttta tgttctgaat atcttttctg ttagagaata tttggagaag 60

ctgctgaaaa aaatttatat ctctctcagt tgatacgtcg taggttcc 108

<210> 585

<211> 108

<212> DNA

<213>Artificial sequence

<400> 585

gactacatgg gacatgcaac caaaggacac aatgagatta gatgaaacga tgctggtcaa 60

acagttgctg ccagaaatct gccattttct tcatacgtcg taggttcc 108

<210> 586

<211> 108

<212> DNA

<213>Artificial sequence

<400> 586

gactacatgg gacattggtt tttacttttt aggttacagg aattaactgt ttgttcagaa 60

gacaatgttg atgttcatga tatagaattg ttatacgtcg taggttcc 108

<210> 587

<211> 108

<212> DNA

<213>Artificial sequence

<400> 587

gactacatgg gacatttcta gagttaattt ttaaaaattg tgttttttcc agaaacagca 60

tttaaattta aagccctaaa gaaggttgcg cagtacgtcg taggttcc 108

<210> 588

<211> 108

<212> DNA

<213>Artificial sequence

<400> 588

gactacatgg gacattcact gtaaagacat gtggttcttt atttataggc attttggaac 60

tgggtagaaa attatccaga tgaatttaca aaatacgtcg taggttcc 108

<210> 589

<211> 108

<212> DNA

<213>Artificial sequence

<400> 589

gactacatgg gacatgaatg tgcagaaaag ctatttgact tggtggatgg ttttgctgaa 60

agcaccaaac gtaaagcagc agtttggcca ctatacgtcg taggttcc 108

<210> 590

<211> 108

<212> DNA

<213>Artificial sequence

<400> 590

gactacatgg gacattctag tccgcattgg attggtggcc taagattgat gctgtgtatt 60

gtcactcggt tgaacttcga aatatgtttg gtgtacgtcg taggttcc 108

<210> 591

<211> 108

<212> DNA

<213>Artificial sequence

<400> 591

gactacatgg gacatttttt tccttgcaga atccaagaaa acaggggccc gaaacccaag 60

gcagtacagc agaattaatt acagggctcg tcctacgtcg taggttcc 108

<210> 592

<211> 108

<212> DNA

<213>Artificial sequence

<400> 592

gactacatgg gacattagtg gaaataccag tcaaatgtcc atggatcatg aagaattact 60

acgtactcct ggagcctctc tccggaaggg aaatacgtcg taggttcc 108

<210> 593

<211> 108

<212> DNA

<213>Artificial sequence

<400> 593

gactacatgg gacattttga cacacttgca gaaacagtat tggctgatcg gtttgagaga 60

ttggtggaac tggtcacaat gatgggtgat caatacgtcg taggttcc 108

<210> 594

<211> 108

<212> DNA

<213>Artificial sequence

<400> 594

gactacatgg gacatagaag tagaattggc agactccatg cagactctct tccgaggcaa 60

cagcttggcc agtaaaataa tgacattctg ttttacgtcg taggttcc 108

<210> 595

<211> 108

<212> DNA

<213>Artificial sequence

<400> 595

gactacatgg gacattaggt tagaaccatc agagagcctt gaggaaaacc agcggaacct 60

ccttcagatg actgaaaagt tcttccatgc cattacgtcg taggttcc 108

<210> 596

<211> 108

<212> DNA

<213>Artificial sequence

<400> 596

gactacatgg gacatcggtg ctgtgacttg tttgtgctca tctctgttct gtaggcaact 60

tgccactccc tactgaataa agctacagta aaatacgtcg taggttcc 108

<210> 597

<211> 108

<212> DNA

<213>Artificial sequence

<400> 597

gactacatgg gacatgtgat gcagtaaatc atagtctttc cttcataagt gacggcaatg 60

tgcttgcttt acatcgtcta ctctggaaca atctacgtcg taggttcc 108

<210> 598

<211> 108

<212> DNA

<213>Artificial sequence

<400> 598

gactacatgg gacatggttc aaaactggtc aaatcaatgg tgatttgctg atataccatg 60

tcttactgac tttaaagcca tattatgcaa agctacgtcg taggttcc 108

<210> 599

<211> 108

<212> DNA

<213>Artificial sequence

<400> 599

gactacatgg gacatggttg gttctactgc tgtccaagta acttcagcag agcgaacaaa 60

agtcctaggg caatcagtct ttctaaatga cattacgtcg taggttcc 108

<210> 600

<211> 108

<212> DNA

<213>Artificial sequence

<400> 600

gactacatgg gacatggtca gctgcctata atcttctgtg tgccttaact tgtaccttta 60

atttaaaaat cgagggccag ttactagaga cattacgtcg taggttcc 108

<210> 601

<211> 108

<212> DNA

<213>Artificial sequence

<400> 601

gactacatgg gacatggtat tgaattgaaa cacctttgtt tggaatacat gactccatgg 60

ctgtcaaatc tagttcgttt ttgcaagcat aattacgtcg taggttcc 108

<210> 602

<211> 108

<212> DNA

<213>Artificial sequence

<400> 602

gactacatgg gacatgatta cagatctgct tgatgttgta ctagacagtt tcatcaaaac 60

cagtgcaaca ggtggcttgg gatcaataaa agctacgtcg taggttcc 108

<210> 603

<211> 108

<212> DNA

<213>Artificial sequence

<400> 603

gactacatgg gacatggtta ttggaaggat gtgcaaaata attgacaaga catgcttatc 60

tccaactcct actttagaac aacatcttat gtgtacgtcg taggttcc 108

<210> 604

<211> 108

<212> DNA

<213>Artificial sequence

<400> 604

gactacatgg gacatgaaga gaccaagcaa gttttgagac tcagtctgac agagttctca 60

ttacccaaat tttacttgct gtttggcatt agctacgtcg taggttcc 108

<210> 605

<211> 108

<212> DNA

<213>Artificial sequence

<400> 605

gactacatgg gacatattta tgtacaatat gtattcagag tatccccttt tttaggcatg 60

catgagagat attccaacgt gcaagtggct ggatacgtcg taggttcc 108

<210> 606

<211> 108

<212> DNA

<213>Artificial sequence

<400> 606

gactacatgg gacatctttt aattgcagat ttgcattcca atataatcca tccctgcaac 60

caagagctct tgttgtcttt gggtgtatta gcatacgtcg taggttcc 108

<210> 607

<211> 108

<212> DNA

<213>Artificial sequence

<400> 607

gactacatgg gacataaatt ctgttttcct aaaaggcact tgagagttgc ttaaaaggac 60

ctgacactta caacagtcaa gttctgatag aagtacgtcg taggttcc 108

<210> 608

<211> 108

<212> DNA

<213>Artificial sequence

<400> 608

gactacatgg gacatggact cgcctctgca caaagccctc ttttgggtag ctgtggctgt 60

gctgcagctt gatgaggtca acttgtattc agctacgtcg taggttcc 108

<210> 609

<211> 108

<212> DNA

<213>Artificial sequence

<400> 609

gactacatgg gacatttaat agagtccaga ggaagtattt atggcaatcc ggaatcctct 60

ggagtggcac tgcaagcaaa tggatcattt tgttacgtcg taggttcc 108

<210> 610

<211> 108

<212> DNA

<213>Artificial sequence

<400> 610

gactacatgg gacatagggt acaggcatcc ttcacctgct attgttgcaa gaacagtcag 60

aattttacat acactactaa ctctggttaa caatacgtcg taggttcc 108

<210> 611

<211> 108

<212> DNA

<213>Artificial sequence

<400> 611

gactacatgg gacattagct ttacttacag tgtctgaaga agttcgaagt cgctgcagcc 60

taaaacatag aaagtcactt cttcttactg atatacgtcg taggttcc 108

<210> 612

<211> 108

<212> DNA

<213>Artificial sequence

<400> 612

gactacatgg gacatggaca ctaaaggaga ctcagccatg gtcctctccc aaaggttctg 60

aaggatacct tgcagccacc tatccaactg tcgtacgtcg taggttcc 108

<210> 613

<211> 108

<212> DNA

<213>Artificial sequence

<400> 613

gactacatgg gacattgttt ataggaacaa ggaaaagttt tgatcacttg atatcagaca 60

caaaggctcc taaaaggcaa gaaatggaat cagtacgtcg taggttcc 108

<210> 614

<211> 108

<212> DNA

<213>Artificial sequence

<400> 614

gactacatgg gacattgcag aaactcagag gatttcctca tcacaacagc acccacattt 60

acgtaaagtt tcagtgtctg aatcaaatgt tcttacgtcg taggttcc 108

<210> 615

<211> 108

<212> DNA

<213>Artificial sequence

<400> 615

gactacatgg gacatacttt tttgcatctt ggcaggctac actggtaaaa tataccacag 60

atgagtttga tcaacgaatt ctttatgaat acttacgtcg taggttcc 108

<210> 616

<211> 108

<212> DNA

<213>Artificial sequence

<400> 616

gactacatgg gacatggcat aatttgttgg actctaagat caacaccctg ttatcattgt 60

gccaagatcc aaatttgtta aatccaatcc atgtacgtcg taggttcc 108

<210> 617

<211> 108

<212> DNA

<213>Artificial sequence

<400> 617

gactacatgg gacattaaaa gataccttgc ttgttataag agtaaaattt gatttgttgc 60

aggttttggt tttaatggct tgtggcggtt tgctacgtcg taggttcc 108

<210> 618

<211> 108

<212> DNA

<213>Artificial sequence

<400> 618

gactacatgg gacatgcaaa cacaaattcc agactatgct gagcttattg ttaagtttct 60

tgatgccttg attgacacgt acctgcctgg aattacgtcg taggttcc 108

<210> 619

<211> 108

<212> DNA

<213>Artificial sequence

<400> 619

gactacatgg gacatggaat cgacaaggag aacgttgaac tctcccctac cactggccac 60

tgtaacagtg gacgaactcg ccacggatcc gcatacgtcg taggttcc 108

<210> 620

<211> 108

<212> DNA

<213>Artificial sequence

<400> 620

gactacatgg gacattagtc ttcgagcaat agatggatgt ctattaattc catcccacca 60

ccacatgagc cacaaggaga taacacatcc caatacgtcg taggttcc 108

<210> 621

<211> 108

<212> DNA

<213>Artificial sequence

<400> 621

gactacatgg gacataattt aaagggaatt taaaagtacc tgaaaaattc catgaaggag 60

aacccatatc catgctgttc tgcaatccct gcatacgtcg taggttcc 108

<210> 622

<211> 108

<212> DNA

<213>Artificial sequence

<400> 622

gactacatgg gacatcccat gcagtcagca gccccttacc tcccaggcaa gcaccgaagg 60

ccagggcata catgagcggc ggtgcgggca ggctacgtcg taggttcc 108

<210> 623

<211> 108

<212> DNA

<213>Artificial sequence

<400> 623

gactacatgg gacattggac atgtgcaact caccatggta gcagtgaacg ggatgttgtc 60

aatcagggac gacgccaggg ctgagaccca cactacgtcg taggttcc 108

<210> 624

<211> 108

<212> DNA

<213>Artificial sequence

<400> 624

gactacatgg gacataacag tggctggagt gccttctatt atagcattta ttttaccttt 60

attagcaaag cagtttgttc tccaacatat tcttacgtcg taggttcc 108

<210> 625

<211> 108

<212> DNA

<213>Artificial sequence

<400> 625

gactacatgg gacatatctt acctccatca gaacaaagag cgctgcaaaa aacagaaggg 60

ttgcccattc cactctgtgt agaattatct caatacgtcg taggttcc 108

<210> 626

<211> 108

<212> DNA

<213>Artificial sequence

<400> 626

gactacatgg gacatgctaa attagactca ccaagatcaa gatgaatgcc agggacaaac 60

gaattgagga aaaacatgaa gataacaaat ccctacgtcg taggttcc 108

<210> 627

<211> 108

<212> DNA

<213>Artificial sequence

<400> 627

gactacatgg gacatgagaa gtgaatcaga aatccctgag gaaagaaagc tgggtacctt 60

tttttggagt tcttggatat tggtctccca atttacgtcg taggttcc 108

<210> 628

<211> 108

<212> DNA

<213>Artificial sequence

<400> 628

gactacatgg gacatcctgt ggaaggtgtg cagcctccgg gcgagcaggt gctccagtgc 60

cagcaccttc cccagcagca ggcggcgcac agctacgtcg taggttcc 108

<210> 629

<211> 108

<212> DNA

<213>Artificial sequence

<400> 629

gactacatgg gacattcacc aacaatctca ctgggttcct tgttataaag ctttctgttc 60

cagtaaagga gtctgaggag cggaaagcag acctacgtcg taggttcc 108

<210> 630

<211> 108

<212> DNA

<213>Artificial sequence

<400> 630

gactacatgg gacatccatc ttcctcagct cttggttgga aacaataatg acatttggag 60

ggtccccgat ggcagtggca gctcctccaa tgttacgtcg taggttcc 108

<210> 631

<211> 108

<212> DNA

<213>Artificial sequence

<400> 631

gactacatgg gacatttgcg taccttatgg tcacaggcgt gaagaggagc atggtggtga 60

cgttgtccaa gaaggcagag aggacggccg cgatacgtcg taggttcc 108

<210> 632

<211> 108

<212> DNA

<213>Artificial sequence

<400> 632

gactacatgg gacataatta atcaggatag aattattaaa tgcaacatca tacctacctt 60

tacagcacaa taatcgaaaa atcccgtttc tgatacgtcg taggttcc 108

<210> 633

<211> 108

<212> DNA

<213>Artificial sequence

<400> 633

gactacatgg gacatggcgt ggagcccagt cccacgggga gagctgtaat taccatgcca 60

aacagcaggg ccagcgtctc aaaatcaatc cactacgtcg taggttcc 108

<210> 634

<211> 108

<212> DNA

<213>Artificial sequence

<400> 634

gactacatgg gacatgtggt aagccaggga ttgggactgt gacaacttac atcgccaatc 60

acagccagtg ctgccagtgc tgcaagggaa ccctacgtcg taggttcc 108

<210> 635

<211> 108

<212> DNA

<213>Artificial sequence

<400> 635

gactacatgg gacatcctca aatatgatca gcgcgtagac gcccgcgagg atggccgtcg 60

cgatggtcac ctgggtttct acacttccgc ggatacgtcg taggttcc 108

<210> 636

<211> 108

<212> DNA

<213>Artificial sequence

<400> 636

gactacatgg gacatcccca acacctcact cactgagaac tcacctggtc agtacctcaa 60

aggtcctgct catcactgag tgctcgcttc tcctacgtcg taggttcc 108

<210> 637

<211> 108

<212> DNA

<213>Artificial sequence

<400> 637

gactacatgg gacatcctgc tgtggccgcc gccacctgga gcccaaagcg tcagcctggg 60

tcagctccac cacgatgtgc tcttccctcc cagtacgtcg taggttcc 108

<210> 638

<211> 108

<212> DNA

<213>Artificial sequence

<400> 638

gactacatgg gacatggcgg ctggccatct cagagtggat tttggataca gtagttctcc 60

agcggtgata aggccaacag ctgccagagc ttttacgtcg taggttcc 108

<210> 639

<211> 108

<212> DNA

<213>Artificial sequence

<400> 639

gactacatgg gacatccacg gacccaacag tagtgctggg gcagctaagg tactcacaga 60

acacagcacc acaaaggcaa acaggcccat gactacgtcg taggttcc 108

<210> 640

<211> 108

<212> DNA

<213>Artificial sequence

<400> 640

gactacatgg gacatcctca gcttggaaag acggagtcgg atgtgcgggc tgtccagaag 60

gtctcccttc tcggaggagg cagatgcaga cagtacgtcg taggttcc 108

<210> 641

<211> 108

<212> DNA

<213>Artificial sequence

<400> 641

gactacatgg gacatatgag ggggaaaata tctcaccctt tctcctgtaa ggaattcctc 60

agcaaaggag tgttttctgt aaagcaggaa tcttacgtcg taggttcc 108

<210> 642

<211> 108

<212> DNA

<213>Artificial sequence

<400> 642

gactacatgg gacatcctcc cttttgtgag gaatgaagca aactcctggc ctgcaggagc 60

ccaagagctc tgcccggcag cccccctggg gcatacgtcg taggttcc 108

<210> 643

<211> 108

<212> DNA

<213>Artificial sequence

<400> 643

gactacatgg gacatttcat gccccaagga gctttttgac catgtagcca gggaggctgt 60

agaggaagag ccccaacatg agcagcccca acatacgtcg taggttcc 108

<210> 644

<211> 108

<212> DNA

<213>Artificial sequence

<400> 644

gactacatgg gacatctcag gccccgagga ttttcttgac caggtagcca ggcacagagt 60

agaggaacag ggcgaggagg aggagcagca gcatacgtcg taggttcc 108

<210> 645

<211> 108

<212> DNA

<213>Artificial sequence

<400> 645

gactacatgg gacattgggc cggcagggca ctcacttggg tttctctagg gggtcaggtt 60

cattgcgggc caggcccact gggttcttct ctgtacgtcg taggttcc 108

<210> 646

<211> 108

<212> DNA

<213>Artificial sequence

<400> 646

gactacatgg gacatccgtg agctcaaact catcgttctc attgcgggcc aggaggggcc 60

accagccttt gacgcgcttt tgcttgaaga tggtacgtcg taggttcc 108

<210> 647

<211> 108

<212> DNA

<213>Artificial sequence

<400> 647

gactacatgg gacatcccag gaagtcgtca gcggagaagt ggtccgcatc ccagatctgc 60

agggtgagcc gcgcggggat cttgtactcg gtctacgtcg taggttcc 108

<210> 648

<211> 108

<212> DNA

<213>Artificial sequence

<400> 648

gactacatgg gacatatgca gggactgctc acccaccccc tcacgaagat gtcactggac 60

ttctcccctg tgaagaagtc gtcgtcctcc aagtacgtcg taggttcc 108

<210> 649

<211> 108

<212> DNA

<213>Artificial sequence

<400> 649

gactacatgg gacatgtagc gctgggcccc aggccgctca cttcttgggc ttccgaggtg 60

agatgtccag aggcgtccca ggggctggca tgttacgtcg taggttcc 108

<210> 650

<211> 108

<212> DNA

<213>Artificial sequence

<400> 650

gactacatgg gacatcctgc tcgatgcccg gcttgtcggg gttgagcagc ggcctcgtct 60

ccacatgctc tggcaccagg cggcagcctg cgctacgtcg taggttcc 108

<210> 651

<211> 108

<212> DNA

<213>Artificial sequence

<400> 651

gactacatgg gacatccgtt ctcgtcctca atctcagagg gcccagtgaa gacgcggttg 60

gccaccttca ctctcccagg gggcccaaag tggtacgtcg taggttcc 108

<210> 652

<211> 108

<212> DNA

<213>Artificial sequence

<400> 652

gactacatgg gacatgttct ccaggtcgat cttggtttcc ccaatgaggt catcagtgcc 60

caccaggtcc cagtcataca cagccaccgt cagtacgtcg taggttcc 108

<210> 653

<211> 108

<212> DNA

<213>Artificial sequence

<400> 653

gactacatgg gacatgcctt acttcccaaa gacagggttg agctgcttgg agatgtagtt 60

ctccttgtcg cggatgtcag tcttgcctag ccgtacgtcg taggttcc 108

<210> 654

<211> 108

<212> DNA

<213>Artificial sequence

<400> 654

gactacatgg gacatacccg gaccacatag actcggacca gcacattgat ggggtcattg 60

ctcgggatgc cctggaacat gccgtaggtg gagtacgtcg taggttcc 108

<210> 655

<211> 108

<212> DNA

<213>Artificial sequence

<400> 655

gactacatgg gacatgacct tgaagcgtcc cacaatgcgc tcctcctcgg tggagccatc 60

ctcatcatcc ccggtcttgc cccgaagcaa gtttacgtcg taggttcc 108

<210> 656

<211> 108

<212> DNA

<213>Artificial sequence

<400> 656

gactacatgg gacatacctt aagctcatca atcttgggtt tcttcttctc gggggcctcg 60

gacccctggc cagagccaga gctctgagtt ttctacgtcg taggttcc 108

<210> 657

<211> 108

<212> DNA

<213>Artificial sequence

<400> 657

gactacatgg gacatgggag gaggaggcag agttccaggt tccagggctc accctcggta 60

ttgtccactt cctccttctc ctccaagtca atttacgtcg taggttcc 108

<210> 658

<211> 108

<212> DNA

<213>Artificial sequence

<400> 658

gactacatgg gacattctca cctccttcat ggtgtcaatg gaggcaaagt acttggacca 60

ccagtccagc atgctctcgt ctggctcctc ctctacgtcg taggttcc 108

<210> 659

<211> 108

<212> DNA

<213>Artificial sequence

<400> 659

gactacatgg gacataccac atccaccttg acaacagctt cagaagtctg cagaggaacc 60

aaggagacag gggcagaatc agccactggg gcctacgtcg taggttcc 108

<210> 660

<211> 108

<212> DNA

<213>Artificial sequence

<400> 660

gactacatgg gacatcttac cgcgtccagc ttcaccatgg tctccagttt cttgatgggt 60

acctctggct ccatagtcac cacaacctcc ccttacgtcg taggttcc 108

<210> 661

<211> 108

<212> DNA

<213>Artificial sequence

<400> 661

gactacatgg gacatcggtc tgggggccgg tagatgaagc gtcgcaggga gctgacggca 60

tgggagccca ccagtgtgta gcgaccgaag gcctacgtcg taggttcc 108

<210> 662

<211> 108

<212> DNA

<213>Artificial sequence

<400> 662

gactacatgg gacatccact tcaaaccact tgacgagggt gttgaagttg gggttcttct 60

tataattgtg gatcagggac gactgcaccc ccttacgtcg taggttcc 108

<210> 663

<211> 108

<212> DNA

<213>Artificial sequence

<400> 663

gactacatgg gacatagccc tcgcacctcc actcggtact tgctgagcac gggccggatg 60

cccatgggca cgggcatgat gggacctcgg tcctacgtcg taggttcc 108

<210> 664

<211> 108

<212> DNA

<213>Artificial sequence

<400> 664

gactacatgg gacatcctgc agcagctcga aggccgccag caggtctcca gctgtggcgt 60

tgccacggta gatctggtag tactcgagct gagtacgtcg taggttcc 108

<210> 665

<211> 108

<212> DNA

<213>Artificial sequence

<400> 665

gactacatgg gacattacca tggaatcctg gtcatagatt tcaatgacaa tgatgggcgg 60

atcgtccctc agctcatgag cttcaccata gagtacgtcg taggttcc 108

<210> 666

<211> 108

<212> DNA

<213>Artificial sequence

<400> 666

gactacatgg gacatgccct cacctctgtg cactgactct gattgatgaa gaagacgcgg 60

gcaaaggggt ctgagagtcc gctgctgtcg gcgtacgtcg taggttcc 108

<210> 667

<211> 108

<212> DNA

<213>Artificial sequence

<400> 667

gactacatgg gacatctggt gtagaccagg ctgacgggtg ggaaggcatg caggcccagg 60

ccctgggctg ccttgacctc ctggaagcca cagtacgtcg taggttcc 108

<210> 668

<211> 108

<212> DNA

<213>Artificial sequence

<400> 668

gactacatgg gacatcctta aggaagagcg tcttgacctt ggcgcagtcc ttgccagtct 60

cctcctccac gatggagaag agcaggtcct tggtacgtcg taggttcc 108

<210> 669

<211> 108

<212> DNA

<213>Artificial sequence

<400> 669

gactacatgg gacatcttgg gccgcacctc gtccgccagg aagcgcagct tctgcaggaa 60

gttctggcac agcctcagct tgtcccgcac cgttacgtcg taggttcc 108

<210> 670

<211> 108

<212> DNA

<213>Artificial sequence

<400> 670

gactacatgg gacatccccg ccgtccagtt gcgtcctcac cagctccctc atgcaggact 60

tgaggcgctc ccggtcaagc ctggtgcggg atgtacgtcg taggttcc 108

<210> 671

<211> 108

<212> DNA

<213>Artificial sequence

<400> 671

gactacatgg gacatccagc agccacagct cagctcctcc aggacgcccc gcaggcgacg 60

ctcagggtag gacttctccg ttttgatcat ctctacgtcg taggttcc 108

<210> 672

<211> 108

<212> DNA

<213>Artificial sequence

<400> 672

gactacatgg gacatatcag gagtgtgggt gatgctgggc cacagccccg cctccccagc 60

ctccccaaat gcctcctccc tgttgatcag gggtacgtcg taggttcc 108

<210> 673

<211> 108

<212> DNA

<213>Artificial sequence

<400> 673

gactacatgg gacatccagc ttgtcggcaa tgtggtccat gatgttggca ttgtagaggc 60

ggcggcgctg gtccggccac cagctcttga tgttacgtcg taggttcc 108

<210> 674

<211> 108

<212> DNA

<213>Artificial sequence

<400> 674

gactacatgg gacatcctgt cggtgacctg gggccgcatt ggtggagtgg aggagactga 60

ggccaggtcc ccggcatcac cggcctcgtc atctacgtcg taggttcc 108

<210> 675

<211> 108

<212> DNA

<213>Artificial sequence

<400> 675

gactacatgg gacattgggc ccagcactca cctatggtga cctcaaaggt gatgggcttg 60

tctccgtttc tccggtcgat cattgaggcc tcctacgtcg taggttcc 108

<210> 676

<211> 108

<212> DNA

<213>Artificial sequence

<400> 676

gactacatgg gacatcctcc gagatgggcg tggcctgctc cacctgcacc tctgtggagc 60

tggtgagctc agggttggag gtgtctacga tcttacgtcg taggttcc 108

<210> 677

<211> 108

<212> DNA

<213>Artificial sequence

<400> 677

gactacatgg gacatccttt gtctccgtca ttagaaatct tgcgcaggtc aatgaagtgg 60

gtgccgatgg ccacgtcgtt gaccttgtcc gagtacgtcg taggttcc 108

<210> 678

<211> 108

<212> DNA

<213>Artificial sequence

<400> 678

gactacatgg gacatccttc tggccagcaa agaagacttg cacgtagggg tccacgaggt 60

ccttgttttc accgatgaaa gccttcttta cattacgtcg taggttcc 108

<210> 679

<211> 108

<212> DNA

<213>Artificial sequence

<400> 679

gactacatgg gacatcccct caatgtcatc ttcgtcggtc tcattggcct tgtggggcgt 60

cttgatgttg tcccctttgc ccaccacggc aactacgtcg taggttcc 108

<210> 680

<211> 108

<212> DNA

<213>Artificial sequence

<400> 680

gactacatgg gacatgactg actggccatg cgcaggtact cacctggctg cgagtacacg 60

gttcccacgt ccattttgaa ggagcccacc aggtacgtcg taggttcc 108

<210> 681

<211> 108

<212> DNA

<213>Artificial sequence

<400> 681

gactacatgg gacatccggc caggggctgc tccccactca ccgaaatctt gatgatcttg 60

tcaaacatga catccggaga gacatggaag tcgtacgtcg taggttcc 108

<210> 682

<211> 108

<212> DNA

<213>Artificial sequence

<400> 682

gactacatgg gacatgggca gttagtggac tccttcatgg atgtgtactt cttgtcgtca 60

cccacctcca cgcacaccac agggtccatg ttctacgtcg taggttcc 108

<210> 683

<211> 108

<212> DNA

<213>Artificial sequence

<400> 683

gactacatgg gacatccagg tgcccaccta cctggtaatc catgggccgc ccagcacttg 60

gctccatctt aatgtctggc ttagatctga ggatacgtcg taggttcc 108

<210> 684

<211> 108

<212> DNA

<213>Artificial sequence

<400> 684

gactacatgg gacatggtga gagctgtgac tgaggctaga gacaccgagt cgggatccag 60

tccatctcct agccgaatgg ccagatggtc aagtacgtcg taggttcc 108

<210> 685

<211> 108

<212> DNA

<213>Artificial sequence

<400> 685

gactacatgg gacatgtcct acctggtctt tggggctcct ccttgtgaga ccggtttttg 60

ccgagcttca tggcggagaa cacgctcctc ccgtacgtcg taggttcc 108

<210> 686

<211> 108

<212> DNA

<213>Artificial sequence

<400> 686

gactacatgg gacatcctcc ggaagctctt ctctcctggg ggccgggagc tgggccggga 60

gcctgggagc agtccatccg tctcttggct gtctacgtcg taggttcc 108

<210> 687

<211> 108

<212> DNA

<213>Artificial sequence

<400> 687

gactacatgg gacataactc cgtggggcat acccaccttg atgatagcat tgttgtcatc 60

aatcagcgtg tcagtcacct ccacatggct ctctacgtcg taggttcc 108

<210> 688

<211> 108

<212> DNA

<213>Artificial sequence

<400> 688

gactacatgg gacatcccct cctgccccat cccacactta cttgttgctg aagactttgc 60

tgtagttgaa aacctgaatc tccagcatct cattacgtcg taggttcc 108

<210> 689

<211> 108

<212> DNA

<213>Artificial sequence

<400> 689

gactacatgg gacatgggct cagggctgag ggagggggga gtcttgggcc tcctacctca 60

tcaaagtcag ccacatcctc acagttctcc aggtacgtcg taggttcc 108

<210> 690

<211> 108

<212> DNA

<213>Artificial sequence

<400> 690

gactacatgg gacattggcg tccctctgag acagcggctt ccctacctcg gaaagtcact 60

ttggcgatcc ggtcgcccct gccccgcagc tcctacgtcg taggttcc 108

<210> 691

<211> 108

<212> DNA

<213>Artificial sequence

<400> 691

gactacatgg gacatatctc catcaacaga ttcacagctg acagaccaca ttctgtccat 60

ggctttactt tattttctgg agggcactgc aaatacgtcg taggttcc 108

<210> 692

<211> 108

<212> DNA

<213>Artificial sequence

<400> 692

gactacatgg gacatgtaaa ttacttactg ttaatggaat cagccaaaat cttaagctgc 60

tgggtattgt ccaagacctc aatcctttgg gtgtacgtcg taggttcc 108

<210> 693

<211> 108

<212> DNA

<213>Artificial sequence

<400> 693

gactacatgg gacattcacc ttactttctc cttggcatca ttaaaactct ctgccacgta 60

atagaggggc tggaactccg tgacagtgta atttacgtcg taggttcc 108

<210> 694

<211> 108

<212> DNA

<213>Artificial sequence

<400> 694

gactacatgg gacatcttgg ttcctgtgaa ggtcatacct gtaattcacc aaaggatgac 60

aggagcccag caccatatgc ctttatggag tcttacgtcg taggttcc 108

<210> 695

<211> 108

<212> DNA

<213>Artificial sequence

<400> 695

gactacatgg gacatctata gcactccacc atccacccag ggagagaagg gacttactgt 60

ggcgagcttt tcaatgtatt catcaggtgc acctacgtcg taggttcc 108

<210> 696

<211> 108

<212> DNA

<213>Artificial sequence

<400> 696

gactacatgg gacataccta taactagaag gctaaaaaat ccattcctta cctgggaaaa 60

ctgggcaaag ctgcgatctg aaaacaaggg cactacgtcg taggttcc 108

<210> 697

<211> 108

<212> DNA

<213>Artificial sequence

<400> 697

gactacatgg gacatcacgg ttcgggggta tacatgggct tggatccatg tctgatgtac 60

tgtgtgcagt ggaagactcg gaaggccagg ccatacgtcg taggttcc 108

<210> 698

<211> 108

<212> DNA

<213>Artificial sequence

<400> 698

gactacatgg gacatctctg caggaactga gaaacgtctt ccagctgggg aatgttatct 60

tcatggaagc cacagtactt ttcaagaagt ggatacgtcg taggttcc 108

<210> 699

<211> 108

<212> DNA

<213>Artificial sequence

<400> 699

gactacatgg gacatttttc tctcttcccc tcaacaagca aggcagactt actggcggta 60

gttgtaggca atgtcagcaa actgcttccg tcttacgtcg taggttcc 108

<210> 700

<211> 108

<212> DNA

<213>Artificial sequence

<400> 700

gactacatgg gacattctca tcctacgggc catggactca cagggtggtc agcatccagt 60

tccgctccat agctgagaat ctgattggca aattacgtcg taggttcc 108

<210> 701

<211> 108

<212> DNA

<213>Artificial sequence

<400> 701

gactacatgg gacatcctgt gtctttcttc ttatctcgtg aaagctcatg gacagtggca 60

ccaatgtcat gcctcaagat cttgatgatg ttttacgtcg taggttcc 108

<210> 702

<211> 108

<212> DNA

<213>Artificial sequence

<400> 702

gactacatgg gacatatgat tgtagcactg acctcaaata agcgcaatac tttggccaat 60

gcaccaactt cttctttgag tgagaagatc agttacgtcg taggttcc 108

<210> 703

<211> 108

<212> DNA

<213>Artificial sequence

<400> 703

gactacatgg gacatcaaat tcccctaact gagcagctca ggctgccgtg gctcacctgt 60

ccaaagtcag agagtttcct gcccaagcct gggtacgtcg taggttcc 108

<210> 704

<211> 108

<212> DNA

<213>Artificial sequence

<400> 704

gactacatgg gacatcctat tgcatctggc agcccgaatt gggcaacaat tcctgcaaat 60

aagaagccac tgctcttgtt aggtaggtca tcgtacgtcg taggttcc 108

<210> 705

<211> 108

<212> DNA

<213>Artificial sequence

<400> 705

gactacatgg gacatcctgg tcctgcaaga acagctgact ggccatctgc acgatctggt 60

ccacgtggat gatgcccccg atgctggtca tcttacgtcg taggttcc 108

<210> 706

<211> 108

<212> DNA

<213>Artificial sequence

<400> 706

gactacatgg gacatgtgaa cccacagagg ggcccgcctc tgcgtttttc tcatcgtacc 60

tctcgggtcg tcgaggatgg gaggacataa ccatacgtcg taggttcc 108

<210> 707

<211> 108

<212> DNA

<213>Artificial sequence

<400> 707

gactacatgg gacatccttc tggaggatct tccacaccct ctggtagaat cccacgggga 60

ccctgttgat ggccccatcc agccttctcc tgctacgtcg taggttcc 108

<210> 708

<211> 108

<212> DNA

<213>Artificial sequence

<400> 708

gactacatgg gacatgagga ggagcgggga cggacacaat aatcccgagg cactgttacc 60

gcagacttgg aggaatgcgc actgctggac gcgtacgtcg taggttcc 108

<210> 709

<211> 108

<212> DNA

<213>Artificial sequence

<400> 709

gactacatgg gacatacatt caagccagaa agaacaggaa gtaaaggacg aacaaggcaa 60

aggggtgtca cctgttcatc agcactaaac cgctacgtcg taggttcc 108

<210> 710

<211> 108

<212> DNA

<213>Artificial sequence

<400> 710

gactacatgg gacatggtgt tcttacctgt ttcatttcac tcctcagtct gttaatgcca 60

ctcctctcag ttttggtgac tccggtatgg ccctacgtcg taggttcc 108

<210> 711

<211> 108

<212> DNA

<213>Artificial sequence

<400> 711

gactacatgg gacataacag gagcatggaa cttaccactt ctttcaacgc caaactcttt 60

cccacttaga atatggtgca ggagattttt cattacgtcg taggttcc 108

<210> 712

<211> 108

<212> DNA

<213>Artificial sequence

<400> 712

gactacatgg gacattctca cctgagcagt tcaggctccg tgccagctcc gtggccatca 60

cctgaatgat cagtccaatc cggagtctca gcatacgtcg taggttcc 108

<210> 713

<211> 108

<212> DNA

<213>Artificial sequence

<400> 713

gactacatgg gacattggcc cgacccctcc cacaccagcc ccagacctgc gtgaggacgg 60

caatgctgat gtcctgccca ctggcctcgt agatacgtcg taggttcc 108

<210> 714

<211> 108

<212> DNA

<213>Artificial sequence

<400> 714

gactacatgg gacataaacc tgaggtcccc aaggctgagg acttacgcag agatgatctt 60

ctcccggggc tcgggcggca ggcccacggt gagtacgtcg taggttcc 108

<210> 715

<211> 108

<212> DNA

<213>Artificial sequence

<400> 715

gactacatgg gacatcctca gccaggacct ccactttctt cctgagaagg cctgagatgt 60

agcgaatcag accccactcc tggttcaagc cggtacgtcg taggttcc 108

<210> 716

<211> 108

<212> DNA

<213>Artificial sequence

<400> 716

gactacatgg gacatttact ttatgacata aagaatgtac agaatgtctg cttggtcctg 60

taggttcgaa caatctttta gctgctcaac cagtacgtcg taggttcc 108

<210> 717

<211> 108

<212> DNA

<213>Artificial sequence

<400> 717

gactacatgg gacataaaaa aagctgttcc atatacttta ccttttctag gagtggctga 60

ggagaatcaa caagattcag tgatttacgg tggtacgtcg taggttcc 108

<210> 718

<211> 108

<212> DNA

<213>Artificial sequence

<400> 718

gactacatgg gacatcatgg aacttccaaa ccctttgctt ttgccatcac agaaagtatg 60

tcccgcgtgg agtggatagc actgaagaca tggtacgtcg taggttcc 108

<210> 719

<211> 108

<212> DNA

<213>Artificial sequence

<400> 719

gactacatgg gacatccttg attacaggtg tcttccagat atcctaccaa atctgaatca 60

ctatcaggac tgaaagtccc ttcgctggca ttgtacgtcg taggttcc 108

<210> 720

<211> 108

<212> DNA

<213>Artificial sequence

<400> 720

gactacatgg gacattctta tattttttaa aaaaatcaca aattacctgg ctcctccaaa 60

atatccatcc tctagttttc taattgtgga gagtacgtcg taggttcc 108

<210> 721

<211> 108

<212> DNA

<213>Artificial sequence

<400> 721

gactacatgg gacatctgag catggtgcga ctgatgggga aggtgagtgt gggtctgccc 60

gtcatcctcc agcaggtgca caggtaggcc agctacgtcg taggttcc 108

<210> 722

<211> 108

<212> DNA

<213>Artificial sequence

<400> 722

gactacatgg gacatggcct gctctcctca cctggggtgt aaaagtaaag atttggttcc 60

taatcacata tagtttagag gttccaagga cactacgtcg taggttcc 108

<210> 723

<211> 108

<212> DNA

<213>Artificial sequence

<400> 723

gactacatgg gacattacca agcttggcat atatgtgact aagaatccgg cccggctgga 60

cttgaattgg atgaatgtcc gcgatactct ggatacgtcg taggttcc 108

<210> 724

<211> 108

<212> DNA

<213>Artificial sequence

<400> 724

gactacatgg gacatttaaa tatgaacagt aaacacgctc acaaaccttg tactacaaca 60

tcaggtttga ctgaagtgga aaatcttcta ttttacgtcg taggttcc 108

<210> 725

<211> 108

<212> DNA

<213>Artificial sequence

<400> 725

gactacatgg gacatggcca ctaagcccct acctctgcca acagcgagct gaggatgtac 60

aaggattggc cccacagatg aggcaccttc ccctacgtcg taggttcc 108

<210> 726

<211> 108

<212> DNA

<213>Artificial sequence

<400> 726

gactacatgg gacatagggc cctctgccac tgggttacct tgttaggcgg gacagcgtag 60

agttcaggca ccaggcggat cccattcttg ccttacgtcg taggttcc 108

<210> 727

<211> 108

<212> DNA

<213>Artificial sequence

<400> 727

gactacatgg gacatttttc tcacctgaac agcatcacca ctgaagactc catctattat 60

aaaatatgtc caaaacacag gccactcaca ttctacgtcg taggttcc 108

<210> 728

<211> 108

<212> DNA

<213>Artificial sequence

<400> 728

gactacatgg gacatatgaa acagttgagg aaagataaga aacaatattt aaatacaacc 60

tctcttggag ttttataacc atctcgaagg aagtacgtcg taggttcc 108

<210> 729

<211> 108

<212> DNA

<213>Artificial sequence

<400> 729

gactacatgg gacatcctgg agcttagaaa taatttcatt tttggtcaca tttacaaggt 60

ttacatcttc cactgcaaag gccgggaagg aaatacgtcg taggttcc 108

<210> 730

<211> 108

<212> DNA

<213>Artificial sequence

<400> 730

gactacatgg gacattgaaa tgcaagaggc tattacctgg cagtgctcga cctcatctgg 60

cagaacatga atcactgact tgcgtcctcc atgtacgtcg taggttcc 108

<210> 731

<211> 108

<212> DNA

<213>Artificial sequence

<400> 731

gactacatgg gacatagaag gaagaacaaa caggacaact gtcaccttgg ccattcctac 60

ggagcttgca ttcaattccg ggatgccctg atttacgtcg taggttcc 108

<210> 732

<211> 108

<212> DNA

<213>Artificial sequence

<400> 732

gactacatgg gacatctgaa aagactacca gggttgatac ttacagcgac tttatatgca 60

gcttctatgt aaaagacaag attctgtatg aagtacgtcg taggttcc 108

<210> 733

<211> 108

<212> DNA

<213>Artificial sequence

<400> 733

gactacatgg gacatcctga ggcggtcatc tgggccagga acaggaggaa gagagaggtg 60

gcatccacct ggaggtggcc ccactggtcg tcgtacgtcg taggttcc 108

<210> 734

<211> 108

<212> DNA

<213>Artificial sequence

<400> 734

gactacatgg gacattgaca tggaatgccc acttggcaaa cacgtgtgtg ggttctgcct 60

acctgtctca tcatgcactg gagaagacct cgctacgtcg taggttcc 108

<210> 735

<211> 108

<212> DNA

<213>Artificial sequence

<400> 735

gactacatgg gacatcctgc tccagctcgt aggccttggc cttgtcctca tcgcggtctg 60

cattcttacg gtaggccatg cccaggcccc acatacgtcg taggttcc 108

<210> 736

<211> 108

<212> DNA

<213>Artificial sequence

<400> 736

gactacatgg gacatccctg ggggcggtcc ctccttacct ggtaacacag gatggtttgc 60

tgcaccagcc gcgcgtaccc gtccaagcgg acctacgtcg taggttcc 108

<210> 737

<211> 108

<212> DNA

<213>Artificial sequence

<400> 737

gactacatgg gacatgatgg cagccagcag ctctgagatc tctgagatga agggggttga 60

ggagagtccc aaggttccag gcgaagggcc tggtacgtcg taggttcc 108

<210> 738

<211> 108

<212> DNA

<213>Artificial sequence

<400> 738

gactacatgg gacatttcaa tttccattga ctttgttaga ttcattggat agagaaatct 60

ttagatctga aggttccacg ttccagatgt ttttacgtcg taggttcc 108

<210> 739

<211> 108

<212> DNA

<213>Artificial sequence

<400> 739

gactacatgg gacataactg gttttcttta taaatcttgg caatttactc accatgtaca 60

gctgactcac tttatcttga cacttgacat aggtacgtcg taggttcc 108

<210> 740

<211> 108

<212> DNA

<213>Artificial sequence

<400> 740

gactacatgg gacatcacct gtcatgataa aatagcatgt tgatgatatc tttgaagagg 60

tcaggctgct tgggagaaaa aaagccattg tcatacgtcg taggttcc 108

<210> 741

<211> 108

<212> DNA

<213>Artificial sequence

<400> 741

gactacatgg gacatccctt tcttgtccaa agcagccaca tcatctatcc tcatgccaaa 60

gatgaacagg ttctcttccc cagcttcttc tgctacgtcg taggttcc 108

<210> 742

<211> 108

<212> DNA

<213>Artificial sequence

<400> 742

gactacatgg gacatccttt ttcagcaaga gatactctgt agttctccaa gaagatgact 60

ttcaacttgc ttccaaccat agggtcattg ttctacgtcg taggttcc 108

<210> 743

<211> 108

<212> DNA

<213>Artificial sequence

<400> 743

gactacatgg gacatgatta gagccctcaa gtccccattg aatagattca acttacttta 60

ccaccaatga taactgtcct tggcacgaat aactacgtcg taggttcc 108

<210> 744

<211> 108

<212> DNA

<213>Artificial sequence

<400> 744

gactacatgg gacatcggtt gtacatcgtg atcacatgca gacagttcaa gagctgtcgc 60

ttgtactcat gtatcctctt cacctggaca tcatacgtcg taggttcc 108

<210> 745

<211> 108

<212> DNA

<213>Artificial sequence

<400> 745

gactacatgg gacatcccac acctggaagg ctcacctgct tcaccttggc gagttcccgg 60

aggaagacat catcacccag gaagctgtgg agctacgtcg taggttcc 108

<210> 746

<211> 108

<212> DNA

<213>Artificial sequence

<400> 746

gactacatgg gacatacttc ccagttacct ctgctatgag ctctgcaagt cctgggttgc 60

agagtaggag ccagcgcctt ggagtgatcc cattacgtcg taggttcc 108

<210> 747

<211> 108

<212> DNA

<213>Artificial sequence

<400> 747

gactacatgg gacatcactt tagtcttcac gatgtctgag tggattttag ccacgccatt 60

cacagcatgg gaaccgacaa tgcagagatg ggctacgtcg taggttcc 108

<210> 748

<211> 108

<212> DNA

<213>Artificial sequence

<400> 748

gactacatgg gacatcatct aaatgcttct gatttatctc ataaatgatt tccaaatgtc 60

gagggagcag cttctccacc aggtccacgg gcctacgtcg taggttcc 108

<210> 749

<211> 108

<212> DNA

<213>Artificial sequence

<400> 749

gactacatgg gacataaaaa gaagccaaac tatccagacc ttggaccagg gcagtttttc 60

aatatccaca aaaatcctca tcagctcagg gattacgtcg taggttcc 108

<210> 750

<211> 108

<212> DNA

<213>Artificial sequence

<400> 750

gactacatgg gacatcctga tccgggaagg catcaaacac agttcctgca ccacgggtgg 60

agccaaactt ggaggctttg aaacggcgga tgatacgtcg taggttcc 108

<210> 751

<211> 108

<212> DNA

<213>Artificial sequence

<400> 751

gactacatgg gacatccact aagaaagcaa ccttgatcac tcacattgtc attgggatag 60

aggacccggg agatgttctc ggccaggttt cggtacgtcg taggttcc 108

<210> 752

<211> 108

<212> DNA

<213>Artificial sequence

<400> 752

gactacatgg gacatctgtg ctgtactcac agtctctgag gttaaagtca tttggtgccc 60

gagcagacca gaggcgcatg gtgttgacag tgttacgtcg taggttcc 108

<210> 753

<211> 108

<212> DNA

<213>Artificial sequence

<400> 753

gactacatgg gacataatac ttgagtgtca atccacttgg tcccggtgtt ggtgtgttct 60

acttttccat agaagtgcac aggcagcatg aattacgtcg taggttcc 108

<210> 754

<211> 108

<212> DNA

<213>Artificial sequence

<400> 754

gactacatgg gacataaaaa gatggctcac acacctgcca tccatctcgg atcttctgat 60

tgaaaatccc atattcatac cgaatgccgt atctacgtcg taggttcc 108

<210> 755

<211> 108

<212> DNA

<213>Artificial sequence

<400> 755

gactacatgg gacatgacaa tataatacac tcacaatgtc acttaccagc aagtctccca 60

agaccaccat tgccaagtcc agcatcttct tcatacgtcg taggttcc 108

<210> 756

<211> 108

<212> DNA

<213>Artificial sequence

<400> 756

gactacatgg gacatgaaat ctaggaacaa tgtacctggt aaatggcctc atcacaggca 60

ttttgcagac cgaggttgat catggtgttc tgttacgtcg taggttcc 108

<210> 757

<211> 108

<212> DNA

<213>Artificial sequence

<400> 757

gactacatgg gacatgcgtg aagtgcaggt gccggttgaa actcttcttc agctctgcca 60

cgttctccac gcccacgatg ccgcggatgc tgatacgtcg taggttcc 108

<210> 758

<211> 108

<212> DNA

<213>Artificial sequence

<400> 758

gactacatgg gacattcatg ccgcccaaaa ccccccgaaa aacgccctcc tgaggaggac 60

ccagagcagg acagcggccc ggaggacctg ccttacgtcg taggttcc 108

<210> 759

<211> 108

<212> DNA

<213>Artificial sequence

<400> 759

gactacatgg gacatttggt aggcttgagt ttgaagaaac agaagaacct gattttactg 60

cattatgtca gaaattaaag ataccagatc atgtacgtcg taggttcc 108

<210> 760

<211> 108

<212> DNA

<213>Artificial sequence

<400> 760

gactacatgg gacatttttt gttcccaggg aggttatatt caaaagaaaa aggaactgtg 60

gggaatctgt atctttattg cagcagttga ccttacgtcg taggttcc 108

<210> 761

<211> 108

<212> DNA

<213>Artificial sequence

<400> 761

gactacatgg gacatttcct ttgtagtgtc cataaattct ttaacttact aaaagaaatt 60

gataccagta ccaaagttga taatgctatg tcatacgtcg taggttcc 108

<210> 762

<211> 108

<212> DNA

<213>Artificial sequence

<400> 762

gactacatgg gacatacttc taaattacga aaaaatgtta aaaagtcata atgtttttct 60

tttcaggaca tgtgaactta tatatttgac acatacgtcg taggttcc 108

<210> 763

<211> 108

<212> DNA

<213>Artificial sequence

<400> 763

gactacatgg gacattttcc tgtttttttt ctgctttcta tttgtttaat aggatatcta 60

ctgaaataaa ttctgcattg gtgctaaaag ttttacgtcg taggttcc 108

<210> 764

<211> 108

<212> DNA

<213>Artificial sequence

<400> 764

gactacatgg gacatacatt tttttttcag gggaagtatt acaaatggaa gatgatctgg 60

tgatttcatt tcagttaatg ctatgtgtcc ttgtacgtcg taggttcc 108

<210> 765

<211> 108

<212> DNA

<213>Artificial sequence

<400> 765

gactacatgg gacatgaaac agctgttata cccattaatg gttcacctcg aacacccagg 60

cgaggtcaga acaggagtgc acggatagca aaatacgtcg taggttcc 108

<210> 766

<211> 108

<212> DNA

<213>Artificial sequence

<400> 766

gactacatgg gacattaatg atcatgttgt aacttcatct ttttcaggtg aaaaatgttt 60

atttcaaaaa ttttatacct tttatgaatt ctctacgtcg taggttcc 108

<210> 767

<211> 108

<212> DNA

<213>Artificial sequence

<400> 767

gactacatgg gacatacttt tttctttcaa ggttgaaaat ctttctaaac gatacgaaga 60

aatttatctt aaaaataaag atctagatgc aagtacgtcg taggttcc 108

<210> 768

<211> 108

<212> DNA

<213>Artificial sequence

<400> 768

gactacatgg gacatgtatg tgaatgactt cacttattgt tatttagttt tgaaacacag 60

agaacaccac gaaaaagtaa ccttgatgaa gagtacgtcg taggttcc 108

<210> 769

<211> 108

<212> DNA

<213>Artificial sequence

<400> 769

gactacatgg gacatacatt ttcctatttt tatcccctct aggactgtta tgaacactat 60

ccaacaatta atgatgattt taaattcagc aagtacgtcg taggttcc 108

<210> 770

<211> 108

<212> DNA

<213>Artificial sequence

<400> 770

gactacatgg gacattacct cctaaagaac tgcacagtga atccaaaaga aagtatactg 60

aaaagagtga aggatatagg atacatcttt aaatacgtcg taggttcc 108

<210> 771

<211> 108

<212> DNA

<213>Artificial sequence

<400> 771

gactacatgg gacatctaaa atagcaggct cttatttttc tttttgtttg tttgtagcga 60

tacaaacttg gagttcgctt gtattaccga gtatacgtcg taggttcc 108

<210> 772

<211> 108

<212> DNA

<213>Artificial sequence

<400> 772

gactacatgg gacataaata aggtttcaat taaacaactt cttttttttt ttttaaatta 60

tctgtttcag gaagaagaac gattatccat tcatacgtcg taggttcc 108

<210> 773

<211> 108

<212> DNA

<213>Artificial sequence

<400> 773

gactacatgg gacattgtct ttattggcgt gcgctcttga ggttgtaatg gccacatata 60

gcagtaagtt aaattttcat aaataaacac ttttacgtcg taggttcc 108

<210> 774

<211> 108

<212> DNA

<213>Artificial sequence

<400> 774

gactacatgg gacatggaag tacatctcag aatcttgatt ctggaacaga tttgtctttc 60

ccatggattc tgaatgtgct taatttaaaa gcctacgtcg taggttcc 108

<210> 775

<211> 108

<212> DNA

<213>Artificial sequence

<400> 775

gactacatgg gacatgtttc atataggatt cacctttatt tgatcttatt aaacaatcaa 60

aggaccgaga aggaccaact gatcaccttg aattacgtcg taggttcc 108

<210> 776

<211> 108

<212> DNA

<213>Artificial sequence

<400> 776

gactacatgg gacatggtat ctttctcctg taagatctcc aaagaaaaaa ggttcaacta 60

cgcgtgtaaa ttctactgca aatgcagaga cactacgtcg taggttcc 108

<210> 777

<211> 108

<212> DNA

<213>Artificial sequence

<400> 777

gactacatgg gacatgtgta tcggctagcc tatctccggc taaatacact ttgtgaacgc 60

cttctgtctg agcacccaga attagaacat atctacgtcg taggttcc 108

<210> 778

<211> 108

<212> DNA

<213>Artificial sequence

<400> 778

gactacatgg gacatcatca atttatttac tagattatga tgtgttccat gtatggcata 60

tgcaaagtga agaatataga ccttaaattc aaatacgtcg taggttcc 108

<210> 779

<211> 108

<212> DNA

<213>Artificial sequence

<400> 779

gactacatgg gacatctgtt cttcctcaga cattcaaacg tgttttgatc aaagaagagg 60

agtatgattc tattatagta ttctataact cggtacgtcg taggttcc 108

<210> 780

<211> 108

<212> DNA

<213>Artificial sequence

<400> 780

gactacatgg gacatgcccc ctaccttgtc accaatacct cacattcctc gaagccctta 60

caagtttcct agttcaccct tacggattcc tggtacgtcg taggttcc 108

<210> 781

<211> 108

<212> DNA

<213>Artificial sequence

<400> 781

gactacatgg gacatgcaaa attgtatatg gttttttatt actaattggt atttcatctt 60

aacttgacag aatcttagta tcaattggtg aattacgtcg taggttcc 108

<210> 782

<211> 108

<212> DNA

<213>Artificial sequence

<400> 782

gactacatgg gacatgactt ctgagaagtt ccagaaaata aatcagatgg tatgtaacag 60

cgaccgtgtg ctcaaaagaa gtgctgaagg aagtacgtcg taggttcc 108

<210> 783

<211> 108

<212> DNA

<213>Artificial sequence

<400> 783

gactacatgg gacatcattt ataaatacac atgaaatgtt ttgcattttt ttaatctgca 60

gtaaacatct cccaggagag tccaaatttc agctacgtcg taggttcc 108

<210> 784

<211> 108

<212> DNA

<213>Artificial sequence

<400> 784

gactacatgg gacatcaatg ctgttaacag ttcttcatcc tttttccagc ttctactcga 60

acacgaatgc aaaagcagaa aatgaatgat agctacgtcg taggttcc 108

<210> 785

<211> 108

<212> DNA

<213>Artificial sequence

<400> 785

gactacatgg gacatatcag gcacacttgc tgacgcactc cagcagctcc atccggatgg 60

caatgcggac gtgccagccc agcgggatga ggctacgtcg taggttcc 108

<210> 786

<211> 108

<212> DNA

<213>Artificial sequence

<400> 786

gactacatgg gacatcccgg ttgtttccag tctggtcctt gtagtaaatc cagttcaggc 60

gctcatcggt cctgtactgc acgctgtact tggtacgtcg taggttcc 108

<210> 787

<211> 108

<212> DNA

<213>Artificial sequence

<400> 787

gactacatgg gacatcccaa agccttgact gttgagccgg gccttgtttg cagtccacga 60

agaataccag cccacatact gctccgggtt agatacgtcg taggttcc 108

<210> 788

<211> 108

<212> DNA

<213>Artificial sequence

<400> 788

gactacatgg gacataggac aggggatact cacctggtat acagtccaag gaggtggcac 60

ctgcagacca cagagcattg ggtcctcctt ggctacgtcg taggttcc 108

<210> 789

<211> 108

<212> DNA

<213>Artificial sequence

<400> 789

gactacatgg gacattagga aaattttcaa aagtactatg catgtacatt acagccttct 60

tactgttaca tacctcggta gacgataatc ccatacgtcg taggttcc 108

<210> 790

<211> 108

<212> DNA

<213>Artificial sequence

<400> 790

gactacatgg gacatatgta ttaagtatgc aatgaatgtc aatggttgaa tagcacatac 60

cttcatagcc aaagagaagt aataacaaaa agctacgtcg taggttcc 108

<210> 791

<211> 108

<212> DNA

<213>Artificial sequence

<400> 791

gactacatgg gacatccctt tggctttttc atctttgcct tcttgctcat gtttttccac 60

aattggcttt gtcacccggt cataggaagg tggtacgtcg taggttcc 108

<210> 792

<211> 108

<212> DNA

<213>Artificial sequence

<400> 792

gactacatgg gacataaatc aaaaatattc catccaatgg taaaataata atggcgtaga 60

gagatgagtt tcagtacaca ctctccagta aattacgtcg taggttcc 108

<210> 793

<211> 108

<212> DNA

<213>Artificial sequence

<400> 793

gactacatgg gacattcatt tgatacttct tactcctggt cgaggtatag gcttttgcgg 60

ttttttcgat cctaattttt tcattgcatt atatacgtcg taggttcc 108

<210> 794

<211> 108

<212> DNA

<213>Artificial sequence

<400> 794

gactacatgg gacattctat gatgacacca ataaacaggt tcaaggtgaa gaaggaccca 60

aagatgatga aaataacaaa gtaaagatac atgtacgtcg taggttcc 108

<210> 795

<211> 108

<212> DNA

<213>Artificial sequence

<400> 795

gactacatgg gacatctgat caatattgta aaaagactta gaatacaagg aatacttaca 60

tttctggaat caactgctgc atacattata tcctacgtcg taggttcc 108

<210> 796

<211> 108

<212> DNA

<213>Artificial sequence

<400> 796

gactacatgg gacatcaact tgaagcaaag agagataccc aaatcctaca ttatcaaagt 60

ttactttcac atttttccat cgagcagtct cattacgtcg taggttcc 108

<210> 797

<211> 108

<212> DNA

<213>Artificial sequence

<400> 797

gactacatgg gacatttttc ttaccctcat cccttcaaat cgagataagg ctcttagagg 60

tctcagagct cttagtgtcc tgagagattt gattacgtcg taggttcc 108

<210> 798

<211> 108

<212> DNA

<213>Artificial sequence

<400> 798

gactacatgg gacatcaaac cagttatgtt caactattcg gaaacacgtc cttctcaggt 60

tccaccattg ttttcctctg ccttcttcca cattacgtcg taggttcc 108

<210> 799

<211> 108

<212> DNA

<213>Artificial sequence

<400> 799

gactacatgg gacatttttc tttaccttca gtgaaacaag cttctggttc aagagtttct 60

tcaggttcca ctacgggctg ttcttctaca ggttacgtcg taggttcc 108

<210> 800

<211> 108

<212> DNA

<213>Artificial sequence

<400> 800

gactacatgg gacatcctct ttgctttctt ccagatccga ttcactacta aagtcttccg 60

tgtttaaatt ttcaaagtca gattctccta cagtacgtcg taggttcc 108

<210> 801

<211> 108

<212> DNA

<213>Artificial sequence

<400> 801

gactacatgg gacataggag tggaagaagt cattcatgtg ccagcgtggg agttgacaat 60

cactggcgat cttgcagaca caatctttgt agctacgtcg taggttcc 108

<210> 802

<211> 108

<212> DNA

<213>Artificial sequence

<400> 802

gactacatgg gacatccaat cgaaatgaac ggagaacaga taatccttcc acattggcga 60

gtccaagttc taccaggcta agcgtcacaa taatacgtcg taggttcc 108

<210> 803

<211> 108

<212> DNA

<213>Artificial sequence

<400> 803

gactacatgg gacatccaag tttcctactg taagcacatt attgaaatgg tccgtcattg 60

gatagtgctc catggccatg aaaagagtat ttatacgtcg taggttcc 108

<210> 804

<211> 108

<212> DNA

<213>Artificial sequence

<400> 804

gactacatgg gacatcaacc ttctactgta tttgttagaa tgctggctat actcattgct 60

cgttgccttt gggaaggatc ttctagaaag tcctacgtcg taggttcc 108

<210> 805

<211> 108

<212> DNA

<213>Artificial sequence

<400> 805

gactacatgg gacatttatc acctctggca gaagctgtcc aacaggcgat gtaggaactg 60

aaggtccacc aaccaaggaa accacaccat tgctacgtcg taggttcc 108

<210> 806

<211> 108

<212> DNA

<213>Artificial sequence

<400> 806

gactacatgg gacatcctgg tgtggggagg agtacctctt ttcatatgtc aatcggttcc 60

cttcaatgga gaagcgaaaa cctttcctcc tgatacgtcg taggttcc 108

<210> 807

<211> 108

<212> DNA

<213>Artificial sequence

<400> 807

gactacatgg gacatccagt tgataaagat tttcccagaa gtcctgagtc attagtcgaa 60

acaaggacaa aaaagcccaa ctgaaggtat caatacgtcg taggttcc 108

<210> 808

<211> 108

<212> DNA

<213>Artificial sequence

<400> 808

gactacatgg gacataatta ttgacttacc ctgcatcaga gctatttcca catagtagtg 60

catctaaaaa accctccagg aaataatgat atctacgtcg taggttcc 108

<210> 809

<211> 108

<212> DNA

<213>Artificial sequence

<400> 809

gactacatgg gacatcttga atcttgaata tatgacttcc agtcaaactc aaagacagtt 60

tcatttataa gtgtaccatt ataattcaca gtttacgtcg taggttcc 108

<210> 810

<211> 108

<212> DNA

<213>Artificial sequence

<400> 810

gactacatgg gacatactta cgcaaatgta atgacagtga aatcgagcca gttccatgga 60

tcccgaagga aagtaaaatc ttctaaacag aattacgtcg taggttcc 108

<210> 811

<211> 108

<212> DNA

<213>Artificial sequence

<400> 811

gactacatgg gacatgttat taaaaatata agttgaactt actctacatt ctttgtccaa 60

tcaggagggt tactcattgt cataaacaca cagtacgtcg taggttcc 108

<210> 812

<211> 108

<212> DNA

<213>Artificial sequence

<400> 812

gactacatgg gacatttaat agctattttc ctaagaggat tgaagggagt taaaatgtac 60

agggcagagg tggcactgaa ccggaagatg gcctacgtcg taggttcc 108

<210> 813

<211> 108

<212> DNA

<213>Artificial sequence

<400> 813

gactacatgg gacatccaag tcactatttg gctttgggcc attttcgtcg tcatcttttt 60

tgtctggttt gggattcttt gccttttctt ctgtacgtcg taggttcc 108

<210> 814

<211> 108

<212> DNA

<213>Artificial sequence

<400> 814

gactacatgg gacataatgg cagaactgcc cacaacagag acgcctgggg acgccacttt 60

gtgcagcggg cgcttcacca tcagcacact gcttacgtcg taggttcc 108

<210> 815

<211> 108

<212> DNA

<213>Artificial sequence

<400> 815

gactacatgg gacatgcagg aaggcagaca cctgcatgcc ctggcctttg acagccggcc 60

cagccacgag atgactgatg ggctggtgga gggtacgtcg taggttcc 108

<210> 816

<211> 108

<212> DNA

<213>Artificial sequence

<400> 816

gactacatgg gacatcccag gtggcctctg acccccctgt cctcccagat tcgttgcatg 60

ctcaacattt ggggcgtgat cctctacctg cggtacgtcg taggttcc 108

<210> 817

<211> 108

<212> DNA

<213>Artificial sequence

<400> 817

gactacatgg gacattaagc tttgggtgcc ccctgcagtc ctgacctgga tcatcatcct 60

gctgtcggtc acggtgacct ccatcacagg ccttacgtcg taggttcc 108

<210> 818

<211> 108

<212> DNA

<213>Artificial sequence

<400> 818

gactacatgg gacatggtgg cacctacttc ctcatctccc ggagtctggg cccagagctt 60

gggggctcca tcggcctcat tttcgctttc gcctacgtcg taggttcc 108

<210> 819

<211> 108

<212> DNA

<213>Artificial sequence

<400> 819

gactacatgg gacatatttt ccctccccag gagtatgggg cacccatcgt ggaccccatt 60

aacgacatcc gcatcattgc cgtggtctcg gtctacgtcg taggttcc 108

<210> 820

<211> 108

<212> DNA

<213>Artificial sequence

<400> 820

gactacatgg gacatcttcg ccccctccag gcccaggtgc tgttcttcct tgtcatcatg 60

gtctcctttg ccaactattt agtggggacg ctgtacgtcg taggttcc 108

<210> 821

<211> 108

<212> DNA

<213>Artificial sequence

<400> 821

gactacatgg gacattccag cggacatttt tgtccagaac ttggtgcctg actggcgggg 60

tccagatggc accttcttcg gaatgttctc cattacgtcg taggttcc 108

<210> 822

<211> 108

<212> DNA

<213>Artificial sequence

<400> 822

gactacatgg gacataggac cctgctatag ccatccccaa ggggaccctc atggccattt 60

tctggacgac catttcctac ctggccatct cagtacgtcg taggttcc 108

<210> 823

<211> 108

<212> DNA

<213>Artificial sequence

<400> 823

gactacatgg gacatggctc ctgcgtggtg cgtgatgcct ctggggtcct gaatgacaca 60

gtgacccctg gctggggtgc ctgcgagggg ctgtacgtcg taggttcc 108

<210> 824

<211> 108

<212> DNA

<213>Artificial sequence

<400> 824

gactacatgg gacatgcccc aaatccccac agaccatgag catggtgtca ggcttcgcgc 60

ccctgatcac ggctggcatc ttcggggcca ccctacgtcg taggttcc 108

<210> 825

<211> 108

<212> DNA

<213>Artificial sequence

<400> 825

gactacatgg gacatgtgct gcagtgcctt tgcgaggacc agctgtaccc actgatcggc 60

ttcttcggca aaggctatgg caagaacaag gagtacgtcg taggttcc 108

<210> 826

<211> 108

<212> DNA

<213>Artificial sequence

<400> 826

gactacatgg gacattccct gggtccccga agctgagctc aacaccatag cccccatcat 60

ttccaacttc ttcctctgct cctatgccct cattacgtcg taggttcc 108

<210> 827

<211> 108

<212> DNA

<213>Artificial sequence

<400> 827

gactacatgg gacatgggtg gagaccttca ttccaatact acaacaagtg ggcggcgctg 60

tttggggcta tcatctccgt ggtcatcatg ttctacgtcg taggttcc 108

<210> 828

<211> 108

<212> DNA

<213>Artificial sequence

<400> 828

gactacatgg gacatgttgc tcccttgctc tcccagaggt aaattggggc tcctcggtac 60

aggctggctc ctacaacctg gccctcagct acttacgtcg taggttcc 108

<210> 829

<211> 108

<212> DNA

<213>Artificial sequence

<400> 829

gactacatgg gacatccctt ccctcctcag cccccagtgc ctggtgctca cggggccccc 60

caacttccgc ccggccctgg tggactttgt gggtacgtcg taggttcc 108

<210> 830

<211> 108

<212> DNA

<213>Artificial sequence

<400> 830

gactacatgg gacatgggac cccacaagca gaggatgcct gagctccagc tcatcgccaa 60

cgggcacacc aagtggctga acaagaggaa gattacgtcg taggttcc 108

<210> 831

<211> 108

<212> DNA

<213>Artificial sequence

<400> 831

gactacatgg gacatcccct atcccctggc aggccgcagg tctcgggaga atgaagccca 60

acattctggt ggttgggttc aagaagaact ggctacgtcg taggttcc 108

<210> 832

<211> 108

<212> DNA

<213>Artificial sequence

<400> 832

gactacatgg gacataagct ggacctcacc tcctctcttt ccagtgatgc ctttgatttc 60

aactatggcg tgtgtgtcat gaggatgcgg gagtacgtcg taggttcc 108

<210> 833

<211> 108

<212> DNA

<213>Artificial sequence

<400> 833

gactacatgg gacatgcctg tgaacaaagc tgcctcttct tttgcagtta accccgtgtt 60

tgacccagcg gaggacggga aggaagccag cgctacgtcg taggttcc 108

<210> 834

<211> 108

<212> DNA

<213>Artificial sequence

<400> 834

gactacatgg gacatcccgc ccccacctcc tgcagtggac cccaaggccc tggtgaagga 60

ggagcaggcc accaccatct tccagtcgga gcatacgtcg taggttcc 108

<210> 835

<211> 108

<212> DNA

<213>Artificial sequence

<400> 835

gactacatgg gacatgactc tccttgccag gcctcaccct cctcattccc tatctccttg 60

gccgcaagag gaggtggagc aaatgcaaga tcctacgtcg taggttcc 108

<210> 836

<211> 108

<212> DNA

<213>Artificial sequence

<400> 836

gactacatgg gacatccctc catgtgtcct ccaggatcat ttctctgctg agcaagttcc 60

gactgggatt ccatgaagtc cacatcctcc ctgtacgtcg taggttcc 108

<210> 837

<211> 108

<212> DNA

<213>Artificial sequence

<400> 837

gactacatgg gacatcagca ccaagaggtt tgaggacatg attgcaccct tccgtctgaa 60

tgatggcttc aaggatgagg ccactgtcaa cgatacgtcg taggttcc 108

<210> 838

<211> 108

<212> DNA

<213>Artificial sequence

<400> 838

gactacatgg gacatgatat gggaagtgac cactcggctt tctcccgccc agtcccttcg 60

gcaggtgagg ctgaatgaga ttgtgctgga ttatacgtcg taggttcc 108

<210> 839

<211> 108

<212> DNA

<213>Artificial sequence

<400> 839

gactacatgg gacatgcact ttgcccatag ggaggaaggg gaagtgcccc agctcgctgt 60

acatggcctg gctggagacc ctgtcccagg acctacgtcg taggttcc 108

<210> 840

<211> 108

<212> DNA

<213>Artificial sequence

<400> 840

gactacatgg gacatgctca gcgccagcat catccccaat ggcttcaccg gcctgtcctc 60

cgtgttcctg atagcgaccc cggagcaccg ctgtacgtcg taggttcc 108

<210> 841

<211> 108

<212> DNA

<213>Artificial sequence

<400> 841

gactacatgg gacattactc tctgcctgtc tctcctcctc aaaatggaag caagacagtg 60

gggcctacaa tgctatgaaa aacaggatgg gaatacgtcg taggttcc 108

<210> 842

<211> 108

<212> DNA

<213>Artificial sequence

<400> 842

gactacatgg gacatccctt tgctcatctt gcagtggaac ctggtgtgtg aggacgactg 60

gaaggcccca ctcacaatct ccttgttctt cgttacgtcg taggttcc 108

<210> 843

<211> 108

<212> DNA

<213>Artificial sequence

<400> 843

gactacatgg gacatggttt ggccggaaga atgtgctgtt cgtgaccatg ggcatgcaga 60

caggcttcag cttcctgcag atcttctcga agatacgtcg taggttcc 108

<210> 844

<211> 108

<212> DNA

<213>Artificial sequence

<400> 844

gactacatgg gacataagtc agttcgtata atattctcta cgttaggagt gtgcatattt 60

tatgcatttg gctacatggt gctgccactg ttttacgtcg taggttcc 108

<210> 845

<211> 108

<212> DNA

<213>Artificial sequence

<400> 845

gactacatgg gacataagag gcagaggtga tcatccgcaa ggctgccaaa gccaatggga 60

ttgttgtgcc ttccactatc tttgacccga gtgtacgtcg taggttcc 108

<210> 846

<211> 108

<212> DNA

<213>Artificial sequence

<400> 846

gactacatgg gacatttatg atgttgttcc tgcagttaca agacctaagt tccaagaagc 60

agcagtccca caacattctg gatctgcttc gaatacgtcg taggttcc 108

<210> 847

<211> 108

<212> DNA

<213>Artificial sequence

<400> 847

gactacatgg gacatggatg accatatcag tgggctattt tgggctttcg cttgatactc 60

ctaacttgca tggggacatc tttgtgaact gcttacgtcg taggttcc 108

<210> 848

<211> 108

<212> DNA

<213>Artificial sequence

<400> 848

gactacatgg gacatgactt gtattatttg gctacagtcc tggtgatggt gggcaagttt 60

ggagtcacgg ctgccttttc catggtctac gtgtacgtcg taggttcc 108

<210> 849

<211> 108

<212> DNA

<213>Artificial sequence

<400> 849

gactacatgg gacattaggt gcctacgacc gcttcctgcc ctacattctc atgggaagtc 60

tgaccatcct gacagccatc ctcaccttgt ttctacgtcg taggttcc 108

<210> 850

<211> 108

<212> DNA

<213>Artificial sequence

<400> 850

gactacatgg gacatctgac atatttttgc ttgtttttat agaatgaaac acagaaaaac 60

tccaagtcac acaaggatgt taaaagatgg tcatacgtcg taggttcc 108

<210> 851

<211> 108

<212> DNA

<213>Artificial sequence

<400> 851

gactacatgg gacatcctat gggcctccac caatagcctt tgaggtagat actgatggct 60

tgaagagagg taggtaaagt ccaaatttgt ttttacgtcg taggttcc 108

<210> 852

<211> 108

<212> DNA

<213>Artificial sequence

<400> 852

gactacatgg gacatgcagc agatttagca tgatacttac actcctccaa aatcaatgta 60

gaaccatcgc tgtagcaatt cgtaagtcag caatacgtcg taggttcc 108

<210> 853

<211> 108

<212> DNA

<213>Artificial sequence

<400> 853

gactacatgg gacatccacc agctcccttc cacagagctt ttggtccttc ttcacgcagt 60

atctttctaa agcagtctat cactccgctg taatacgtcg taggttcc 108

<210> 854

<211> 108

<212> DNA

<213>Artificial sequence

<400> 854

gactacatgg gacatccagc tatggcacca gctaagagca ggcttcctgg gctaacctgc 60

ccatcttcat ttgcaaagga agccttcaca tgatacgtcg taggttcc 108

<210> 855

<211> 108

<212> DNA

<213>Artificial sequence

<400> 855

gactacatgg gacatccttg tagatcccaa aaaaccccag gtcccgcacg acagacagag 60

cactgactcg aggaccagtg gtgatttctc ctgtacgtcg taggttcc 108

<210> 856

<211> 108

<212> DNA

<213>Artificial sequence

<400> 856

gactacatgg gacattcaat gaagagagct tcaaaaggta cttacgcagc ctccagcaag 60

aatttctgct gcaagtggga ccgaaccatc ttttacgtcg taggttcc 108

<210> 857

<211> 108

<212> DNA

<213>Artificial sequence

<400> 857

gactacatgg gacattgtac aaaatccctt aataagaagc accaactcaa aagacttact 60

gtaagtttta tggccttctc tggggcaact ccctacgtcg taggttcc 108

<210> 858

<211> 108

<212> DNA

<213>Artificial sequence

<400> 858

gactacatgg gacatcctct atacagtcca aagaagcctt catagcgtag cactttctta 60

aaacagtcaa agctgttttt atacatgagt tcttacgtcg taggttcc 108

<210> 859

<211> 108

<212> DNA

<213>Artificial sequence

<400> 859

gactacatgg gacataaaat ttttctctca tccatgacta acctccagca acagaaccca 60

gaccaaacct gtaggccgac tctgcaactt gtatacgtcg taggttcc 108

<210> 860

<211> 108

<212> DNA

<213>Artificial sequence

<400> 860

gactacatgg gacatgaatg caagtttgct cctctttgct cacctgcctc tgggcctcag 60

ccaagttaaa gggcagagtt ccctcttcca gagtacgtcg taggttcc 108

<210> 861

<211> 108

<212> DNA

<213>Artificial sequence

<400> 861

gactacatgg gacataaaaa aaaaaaaaag ccaacttacc cccttggctc atataaatct 60

gctaactgaa acaagatgtc aacttccatg ggttacgtcg taggttcc 108

<210> 862

<211> 108

<212> DNA

<213>Artificial sequence

<400> 862

gactacatgg gacatccctt agtcacttca acatctttcc tggtgccagc cagagtgcta 60

tagatctttc taatgagttc catgttgtta aggtacgtcg taggttcc 108

<210> 863

<211> 108

<212> DNA

<213>Artificial sequence

<400> 863

gactacatgg gacatcagct actagacatt cttctacaaa aggagtcaag acatgggggc 60

ggatggtgac catgatgtct cggaagtcga tggtacgtcg taggttcc 108

<210> 864

<211> 108

<212> DNA

<213>Artificial sequence

<400> 864

gactacatgg gacatccaat aaaaactgag taaattccgc atatgtcagg tgtctttttc 60

tttcttttcc aaaatgtagt tgcacaaatt ctgtacgtcg taggttcc 108

<210> 865

<211> 108

<212> DNA

<213>Artificial sequence

<400> 865

gactacatgg gacatgcttt gtcaaacagc tgaaaggcta ccataaacaa agcatcaggg 60

gcacacagga cagattcaaa ggcaacaaat tcttacgtcg taggttcc 108

<210> 866

<211> 108

<212> DNA

<213>Artificial sequence

<400> 866

gactacatgg gacatttctc caaaaatgtt caagtatcga gtgacaaagt cattggggga 60

catgaaaaat tcaccgtttt tctcaatgct tgctacgtcg taggttcc 108

<210> 867

<211> 108

<212> DNA

<213>Artificial sequence

<400> 867

gactacatgg gacataacac aaatcaaaca agaaacaaaa tagattcctt tatactgacc 60

ttcaaaaata ttgttctaag ctcagctgga tcttacgtcg taggttcc 108

<210> 868

<211> 108

<212> DNA

<213>Artificial sequence

<400> 868

gactacatgg gacatgcctc tcgcaccccc aggctgatcc ggcaggcgcg ctccccccgg 60

cctcgggccc gcggttacct tggcggccgc cattacgtcg taggttcc 108

<210> 869

<211> 108

<212> DNA

<213>Artificial sequence

<400> 869

gactacatgg gacatcatgg cagcgccagg cggcaggtcg gagccgccgc agctccccga 60

gtacagctgc agctacatgg tgtcgcggcc ggttacgtcg taggttcc 108

<210> 870

<211> 108

<212> DNA

<213>Artificial sequence

<400> 870

gactacatgg gacatgttgt tcaagaaaga gagcctttgg tgtgctaaag actcttgtgc 60

ccatcttgga gtggctcccc aaataccgag tcatacgtcg taggttcc 108

<210> 871

<211> 108

<212> DNA

<213>Artificial sequence

<400> 871

gactacatgg gacattgcat gtgctttcag ggatggcata tgccctacta gctgcagttc 60

ctgtcggata tggtctctac tctgcttttt tcctacgtcg taggttcc 108

<210> 872

<211> 108

<212> DNA

<213>Artificial sequence

<400> 872

gactacatgg gacatggacc ttttccagtg gtgagtttaa tggtgggatc tgttgttctg 60

agcatggccc ccgacgaaca ctttctcgta tcctacgtcg taggttcc 108

<210> 873

<211> 108

<212> DNA

<213>Artificial sequence

<400> 873

gactacatgg gacatgttga tatttggtgg cttgcagatt ggattcatag tgaggtactt 60

ggcagatcct ttggttggtg gcttcacaac agctacgtcg taggttcc 108

<210> 874

<211> 108

<212> DNA

<213>Artificial sequence

<400> 874

gactacatgg gacatgacgc tggttgagat ttttcaaaat attggtgata ccaatcttgc 60

tgatttcact gctggattgc tcaccattgt cgttacgtcg taggttcc 108

<210> 875

<211> 108

<212> DNA

<213>Artificial sequence

<400> 875

gactacatgg gacatagttt ttaacatctt ttgttttatt tcagacgata attgctactg 60

ccatttcata tggagccaac ctggaaaaaa atttacgtcg taggttcc 108

<210> 876

<211> 108

<212> DNA

<213>Artificial sequence

<400> 876

gactacatgg gacatggttt ttgcctcctg aacttccacc tgtgagcttg ttctcggaga 60

tgctggctgc atcattttcc atcgctgtgg tggtacgtcg taggttcc 108

<210> 877

<211> 108

<212> DNA

<213>Artificial sequence

<400> 877

gactacatgg gacatagtct cttccttagg aattcattgc ctttgggatc agcaacatct 60

tctcaggatt cttctcttgt tttgtggcca ccatacgtcg taggttcc 108

<210> 878

<211> 108

<212> DNA

<213>Artificial sequence

<400> 878

gactacatgg gacataatcc ttttcatagg aggtgtgtgt cttccaggtt gctggcatca 60

tctctgctgc gattgtgatg atcgccattc ttgtacgtcg taggttcc 108

<210> 879

<211> 108

<212> DNA

<213>Artificial sequence

<400> 879

gactacatgg gacatgcctt ctctgtctct cttggcagtc ggtcttggca gctgttgtaa 60

ttgccaacct gaaagggatg tttatgcagc tgttacgtcg taggttcc 108

<210> 880

<211> 108

<212> DNA

<213>Artificial sequence

<400> 880

gactacatgg gacattctat ttttttccct aggttatctg ggtgtttacg tgtatagtgt 60

ccatcattct ggggctggat ctcggtttac tagtacgtcg taggttcc 108

<210> 881

<211> 108

<212> DNA

<213>Artificial sequence

<400> 881

gactacatgg gacattccaa aaaatcttga ccttgatatt ttttcttcta gtccttcttg 60

gaatggcctt ggaagcatcc ctagcacaga tattacgtcg taggttcc 108

<210> 882

<211> 108

<212> DNA

<213>Artificial sequence

<400> 882

gactacatgg gacatccaga caatttcttt taatgccaga ttgaagaacc tcaaggagtg 60

aagattctta gattttccag tcctattttc tattacgtcg taggttcc 108

<210> 883

<211> 108

<212> DNA

<213>Artificial sequence

<400> 883

gactacatgg gacattaact tgacatttat ttccaaaggt tggatttgat gccattagag 60

tatataataa gaggctgaaa gcgctgagga aaatacgtcg taggttcc 108

<210> 884

<211> 108

<212> DNA

<213>Artificial sequence

<400> 884

gactacatgg gacatgaatg gcatcataag tgatgctgtt tcaacaaata atgcttttga 60

gcctgatgag gatattgaag atctggagga acttacgtcg taggttcc 108

<210> 885

<211> 108

<212> DNA

<213>Artificial sequence

<400> 885

gactacatgg gacatataag gttgttaatt gttacaaact ctcctttttt atttttagat 60

tgtcaaagaa ttccaaagaa ttgatgtgaa tgttacgtcg taggttcc 108

<210> 886

<211> 108

<212> DNA

<213>Artificial sequence

<400> 886

gactacatgg gacatgatta tgtgatagaa aagctggagc aatgcgggtt ctttgacgac 60

aacattagaa aggacacatt ctttttgacg gtctacgtcg taggttcc 108

<210> 887

<211> 108

<212> DNA

<213>Artificial sequence

<400> 887

gactacatgg gacattattt ctaccctgtg ttctcttttt caagatcact ctcattcagg 60

attgtaaaga tacccttgaa ttaatagaaa cagtacgtcg taggttcc 108

<210> 888

<211> 108

<212> DNA

<213>Artificial sequence

<400> 888

gactacatgg gacatatgca gacttaagga gaattcagtt gtatcaacac tttgttttcc 60

ccttgcttcc acaggctatg cgtacacttg cattacgtcg taggttcc 108

<210> 889

<211> 108

<212> DNA

<213>Artificial sequence

<400> 889

gactacatgg gacatggggg agggtctagg gcctgggccc gcccctcaca caggcatggc 60

cacttcgtcg tattcatccc gaccttcctc ctctacgtcg taggttcc 108

<210> 890

<211> 108

<212> DNA

<213>Artificial sequence

<400> 890

gactacatgg gacatcacac tgaagctcca cgttcctgaa gatgagcggc agcaggacgc 60

gccgcagcgg cacagtgagg atgaggacga aggtacgtcg taggttcc 108

<210> 891

<211> 108

<212> DNA

<213>Artificial sequence

<400> 891

gactacatgg gacatcccgc ttgacgtagg gcacatctgg gtgatacttg ggtggcttga 60

acagaagcaa gatgcggtca aagagctgga tgctacgtcg taggttcc 108

<210> 892

<211> 108

<212> DNA

<213>Artificial sequence

<400> 892

gactacatgg gacatcccac aagcacagcg accaggagtc cactgatccg ctgctctttg 60

acctcctgga tctgggctgc agcccctggg gtgtacgtcg taggttcc 108

<210> 893

<211> 108

<212> DNA

<213>Artificial sequence

<400> 893

gactacatgg gacatcgtgg tgatctgaga ctccaggaat atgaggatga agaccagcag 60

agcaggcagg gcggaggcaa acatcatcca gattacgtcg taggttcc 108

<210> 894

<211> 108

<212> DNA

<213>Artificial sequence

<400> 894

gactacatgg gacatgtctg agggctggga ggaggggtca cctgggtgta ggtatcctga 60

atgaagaaat ccaccaggac catgatcagg atgtacgtcg taggttcc 108

<210> 895

<211> 108

<212> DNA

<213>Artificial sequence

<400> 895

gactacatgg gacatccttg ccagggaaat aggagctgtt cttgaacttg cgcagcatca 60

tggcaaagaa gaaggtaccg gccatgagca caatacgtcg taggttcc 108

<210> 896

<211> 108

<212> DNA

<213>Artificial sequence

<400> 896

gactacatgg gacatccttg atcagcttgg agaaagtctc atagatgaag atgagggaaa 60

tgaggaagga gaagatctcc tgggtatagc gggtacgtcg taggttcc 108

<210> 897

<211> 108

<212> DNA

<213>Artificial sequence

<400> 897

gactacatgg gacatccgag aagaaggctt cctcaaacac cagcaggggt cctgagaagc 60

cgaccacaag caggggctga gcccccagca gggtacgtcg taggttcc 108

<210> 898

<211> 108

<212> DNA

<213>Artificial sequence

<400> 898

gactacatgg gacatcccag gaggccgccg aaggtgatgg cgggtgacag tgcagcaaag 60

tagatgaaga tgacggcagc caggacctgg gggtacgtcg taggttcc 108

<210> 899

<211> 108

<212> DNA

<213>Artificial sequence

<400> 899

gactacatgg gacatcctag gcccttgtag aagctggagt ctggcttggc agggctggac 60

tgatagcgcc ttcgaagtag ctccctctgc acatacgtcg taggttcc 108

<210> 900

<211> 108

<212> DNA

<213>Artificial sequence

<400> 900

gactacatgg gacatccctc tctgacatga gggtggcagc agcccggcca agctgggtgt 60

aatcgatgtg gggggcctca ggtcccagca acatacgtcg taggttcc 108

<210> 901

<211> 108

<212> DNA

<213>Artificial sequence

<400> 901

gactacatgg gacatggctg agggtagaga tgcctgttct tacccactag caccaacgtg 60

gcctctgaat ccgggggaat cttttccaga atttacgtcg taggttcc 108

<210> 902

<211> 108

<212> DNA

<213>Artificial sequence

<400> 902

gactacatgg gacatctgac tcacctgctc acagaagagc tgtgtctcca gtgaggagtg 60

ttgggggagc agaggctgtg aaggatcccc agatacgtcg taggttcc 108

<210> 903

<211> 108

<212> DNA

<213>Artificial sequence

<400> 903

gactacatgg gacatcacct gtgtttaagc agcagggccc ggagcagctc ctctcggtcc 60

tgaggccgga tctggtcttc aaagataaac ctgtacgtcg taggttcc 108

<210> 904

<211> 108

<212> DNA

<213>Artificial sequence

<400> 904

gactacatgg gacatccctt ggtgaagact ctacgcagct ctaggaggct ccagaaggtg 60

aggtgagaga ggtgcgggcg gccccaggcc ccatacgtcg taggttcc 108

<210> 905

<211> 108

<212> DNA

<213>Artificial sequence

<400> 905

gactacatgg gacataggca gcatgggaaa gaacggagga ggctggggtc ctcaccttgt 60

gggtacccgg gtgtgatgtg gtgtggtagt ctgtacgtcg taggttcc 108

<210> 906

<211> 108

<212> DNA

<213>Artificial sequence

<400> 906

gactacatgg gacatagctg agggagggag aggggctcac ctgccggctc ctccatctgg 60

gactcgggga tgtctgggtc ttcatattcc tcctacgtcg taggttcc 108

<210> 907

<211> 108

<212> DNA

<213>Artificial sequence

<400> 907

gactacatgg gacatagtct aggaccaggt ccccagagcc tccaggtggg agcactgctg 60

atgccaggga acacccacct gcagctcctc cattacgtcg taggttcc 108

<210> 908

<211> 108

<212> DNA

<213>Artificial sequence

<400> 908

gactacatgg gacatggccc cacgctgcgc acccgcgggt ttgctatggc gatgagcagc 60

ggcggcagtg gtggcggcgt cccggagcag gagtacgtcg taggttcc 108

<210> 909

<211> 108

<212> DNA

<213>Artificial sequence

<400> 909

gactacatgg gacatgaaca tgagttgttt ttatttctta ccctttccag agcgatgatt 60

ctgacatttg ggatgataca gcactgataa aagtacgtcg taggttcc 108

<210> 910

<211> 108

<212> DNA

<213>Artificial sequence

<400> 910

gactacatgg gacattattt tcgtagcatg ctctaaagaa tggtgacatt tgtgaaactt 60

cgggtaaacc aaaaaccaca cctaaaagaa aactacgtcg taggttcc 108

<210> 911

<211> 108

<212> DNA

<213>Artificial sequence

<400> 911

gactacatgg gacatgtgga aagttgggga caaatgttct gccatttggt cagaagacgg 60

ttgcatttac ccagctacca ttgcttcaat tgatacgtcg taggttcc 108

<210> 912

<211> 108

<212> DNA

<213>Artificial sequence

<400> 912

gactacatgg gacattgaga actccaggtc tcctggaaat aaatcagata acatcaagcc 60

caaatctgct ccatggaact cttttctccc tcctacgtcg taggttcc 108

<210> 913

<211> 108

<212> DNA

<213>Artificial sequence

<400> 913

gactacatgg gacatttcct ttgaaatatt ccttatagcc aggtctaaaa ttcaatggcc 60

cacttactat catgctggct gcctccattt ccttacgtcg taggttcc 108

<210> 914

<211> 108

<212> DNA

<213>Artificial sequence

<400> 914

gactacatgg gacatgatga tgctgatgct ttgggaagta tgttaatttc atggtacatg 60

agtggctatc atactggcta ttatatggta agttacgtcg taggttcc 108

<210> 915

<211> 108

<212> DNA

<213>Artificial sequence

<400> 915

gactacatgg gacattatct atatagctat tttttttaac ttcctttatt ttccttacag 60

ggttttagac aaaatcaaaa agaaggaagg tgctacgtcg taggttcc 108

<210> 916

<211> 108

<212> DNA

<213>Artificial sequence

<400> 916

gactacatgg gacatcttag ctgtgttcat gatgagtctc attgtagtcc atgatatgta 60

gctgtccaac actgtccggg gtcgggggag acgtacgtcg taggttcc 108

<210> 917

<211> 108

<212> DNA

<213>Artificial sequence

<400> 917

gactacatgg gacatccttt cttctgctgc ttcagctgct tctgcttttt cttcttcaag 60

ttttttcagg aggccatctt tctccaacct gcctacgtcg taggttcc 108

<210> 918

<211> 108

<212> DNA

<213>Artificial sequence

<400> 918

gactacatgg gacatccttg cctggagttt gacatcctct agatatttct tctgttccaa 60

aagaaggtgg tctttcttgg ccaggtgaga ttctacgtcg taggttcc 108

<210> 919

<211> 108

<212> DNA

<213>Artificial sequence

<400> 919

gactacatgg gacatctggc atacctttgt ggtatctgag tgcttgttct gcagttgttc 60

caaatagagc tcgttgacct ccccaagaac caatacgtcg taggttcc 108

<210> 920

<211> 108

<212> DNA

<213>Artificial sequence

<400> 920

gactacatgg gacatctcat ttcttcttac cttttgggaa acctgactga gcagcagctc 60

agtgtgacac accttgttgt tggccttctt cagtacgtcg taggttcc 108

<210> 921

<211> 108

<212> DNA

<213>Artificial sequence

<400> 921

gactacatgg gacatcctgt aattcctggc tctggttgta gaattcctct cggtcatgct 60

gcagctgtct gatctggctg tggagcttgg ttatacgtcg taggttcc 108

<210> 922

<211> 108

<212> DNA

<213>Artificial sequence

<400> 922

gactacatgg gacatccatg gcagcattat gttcctccag agctgctgct ttgatcacct 60

tgcggaggag ccgcctgttc cggagggcat gcttacgtcg taggttcc 108

<210> 923

<211> 108

<212> DNA

<213>Artificial sequence

<400> 923

gactacatgg gacatcaagc aggaaccatg tgggctggat ttggagctaa agtaacaact 60

ttacctccaa agtgggtcca gtcgacagac ttgtacgtcg taggttcc 108

<210> 924

<211> 108

<212> DNA

<213>Artificial sequence

<400> 924

gactacatgg gacatcttgt tcagctcctt gctgtgcgcg tctgctccct gctgtatcag 60

tctgtccagc acttccattg gggaggtaga gggtacgtcg taggttcc 108

<210> 925

<211> 108

<212> DNA

<213>Artificial sequence

<400> 925

gactacatgg gacatcaatc ccacatacat taccttcttc tttatctttt tcaatactat 60

cttcttcaga ggccagatca cctaaaaacc ctgtacgtcg taggttcc 108

<210> 926

<211> 108

<212> DNA

<213>Artificial sequence

<400> 926

gactacatgg gacataggca agcaaggcct gtagtaacgc agaaatttta cctgatcctc 60

tgtcattcag aagatggtgt tgtctgtgta gactacgtcg taggttcc 108

<210> 927

<211> 108

<212> DNA

<213>Artificial sequence

<400> 927

gactacatgg gacattggat cgcaccttcc tggggggtgt gactgtggcc tgggggagtg 60

aaatgtgcac gtagtcatcc gaatgacaga gtgtacgtcg taggttcc 108

<210> 928

<211> 108

<212> DNA

<213>Artificial sequence

<400> 928

gactacatgg gacatctaag acatacatac cagttgtacc aaagacttta ctgtaagggt 60

gtgacagatc aggtgggaca tttccaggag aagtacgtcg taggttcc 108

<210> 929

<211> 108

<212> DNA

<213>Artificial sequence

<400> 929

gactacatgg gacatgttga caccatactt gtggtggttc agttatcagc cgtgtcgatg 60

gggaactcag agtctgaggt agctgccctg gcatacgtcg taggttcc 108

<210> 930

<211> 108

<212> DNA

<213>Artificial sequence

<400> 930

gactacatgg gacatccata gctattctgt gtgtcagcat aagggctggt ggtgacatcg 60

gctgaacgat gaggaaagcg ggctgagatt tggtacgtcg taggttcc 108

<210> 931

<211> 108

<212> DNA

<213>Artificial sequence

<400> 931

gactacatgg gacatagatt ctttaaaatt ttgacactag tttctatacc ttcgagggtc 60

cagttcatgg tccttggatc cagtcactaa ttctacgtcg taggttcc 108

<210> 932

<211> 108

<212> DNA

<213>Artificial sequence

<400> 932

gactacatgg gacatccttg accacttctt caaaagtctc caggttttct ttcatactgt 60

aatgagaacg caaaaaggag acgaagttgc aagtacgtcg taggttcc 108

<210> 933

<211> 108

<212> DNA

<213>Artificial sequence

<400> 933

gactacatgg gacatcctgg tttcttcagg caccatgatg acagacggcc aaaaatgtca 60

aagaaatcaa gaagatgctg tttcccagac tgttacgtcg taggttcc 108

<210> 934

<211> 108

<212> DNA

<213>Artificial sequence

<400> 934

gactacatgg gacatccttg agacatttta gtaaagaagg caaaagaggt gcttgagaga 60

gcttatgctt ccaagatggc tgcagtctta tgatacgtcg taggttcc 108

<210> 935

<211> 108

<212> DNA

<213>Artificial sequence

<400> 935

gactacatgg gacatatgat atttcagcca ttaccttgtc atgtggctct tgcaaggtgg 60

tcaggatgtg caatgccggc tgagagctgg ttttacgtcg taggttcc 108

<210> 936

<211> 108

<212> DNA

<213>Artificial sequence

<400> 936

gactacatgg gacatggata ttattttgct aaccagaatt gaggttctct ttaaagacag 60

ctgtcacgtc gtcccgcaca cccagcatgg gggtacgtcg taggttcc 108

<210> 937

<211> 108

<212> DNA

<213>Artificial sequence

<400> 937

gactacatgg gacattagtt ttaagtcatg gcgggtgcga acgggtctct gctgcaggcg 60

gctccgtgac agctcctgct tcacatgggt agatacgtcg taggttcc 108

<210> 938

<211> 108

<212> DNA

<213>Artificial sequence

<400> 938

gactacatgg gacatgaggg gttttctggt gcgtcctggt ccaccatggc caaaccaaca 60

agcaaagatt caggcttgaa ggagaagttt aagtacgtcg taggttcc 108

<210> 939

<211> 108

<212> DNA

<213>Artificial sequence

<400> 939

gactacatgg gacatccttt ttcttctttc atctctctcc aggaactgag catggaatgt 60

ggcctcaaca atcgcatccg gatgataggg cagtacgtcg taggttcc 108

<210> 940

<211> 108

<212> DNA

<213>Artificial sequence

<400> 940

gactacatgg gacatctctg ctggtgacag cacgcagtgg aagcactctg gaaggcggtc 60

gcggatctgt tgcagccgga gcggccgctg gagtacgtcg taggttcc 108

<210> 941

<211> 108

<212> DNA

<213>Artificial sequence

<400> 941

gactacatgg gacatgggcg agcgtttggg ggtcctcaga gccctcttct ttaaggtcat 60

caaggattac ccttccaacg aagaccttca cgatacgtcg taggttcc 108

<210> 942

<211> 108

<212> DNA

<213>Artificial sequence

<400> 942

gactacatgg gacataattc cttctggtgc tggtgaactt ggtcaaattc aatagctgtt 60

acctcgacga gtacatcgca aggatggttc agttacgtcg taggttcc 108

<210> 943

<211> 108

<212> DNA

<213>Artificial sequence

<400> 943

gactacatgg gacatgccat ccaggcagtg ctgccgggac tgagctcggt gctccctgca 60

ggatgatctg tctgctgtgc gtccggaccg cgttacgtcg taggttcc 108

<210> 944

<211> 108

<212> DNA

<213>Artificial sequence

<400> 944

gactacatgg gacattccac caggtctccc tgcaggtgct ggacgccgtg gtctgctaca 60

actgcctgcc ggctgagagc ctcccgctgt tcatacgtcg taggttcc 108

<210> 945

<211> 108

<212> DNA

<213>Artificial sequence

<400> 945

gactacatgg gacatcctgc cagcccctga cacgcattgt gtctcgcagc tgatgcggaa 60

cctccttggc acccacctgg gccacagcgc cattacgtcg taggttcc 108

<210> 946

<211> 108

<212> DNA

<213>Artificial sequence

<400> 946

gactacatgg gacatctttt agagcctaca tggaggacgc gcccctgctg agaggagccg 60

tgttttttgt gggcatggct ctctggggag ccctacgtcg taggttcc 108

<210> 947

<211> 108

<212> DNA

<213>Artificial sequence

<400> 947

gactacatgg gacatggcca tggcatgtcc gaacgaggtg gtgtcctatg agatcgtcct 60

gtccatcacc aggctcatca agaagtatag gaatacgtcg taggttcc 108

<210> 948

<211> 108

<212> DNA

<213>Artificial sequence

<400> 948

gactacatgg gacatagacc ttggacagcc cggagctcag gaccatcgtc catgacctgt 60

tgaccacggt ggaggagctg tgtgaccaga acgtacgtcg taggttcc 108

<210> 949

<211> 108

<212> DNA

<213>Artificial sequence

<400> 949

gactacatgg gacatccggc tcttcttttg acaggagtcc tccctcctga acctgatctc 60

ctatagagcg cagtccatcc acccggccaa ggatacgtcg taggttcc 108

<210> 950

<211> 108

<212> DNA

<213>Artificial sequence

<400> 950

gactacatgg gacatcaccc gccccagcag gctgccgtcc cgcaggagcg agtcccgagg 60

cgccgtgcgc atcaaggtgc tggacgtgct gtctacgtcg taggttcc 108

<210> 951

<211> 108

<212> DNA

<213>Artificial sequence

<400> 951

gactacatgg gacatggagg agctgattaa ctcagtggtc atctcgcagc tctcccacat 60

ccccgaggat aaagaccacc aggtccgaaa gcttacgtcg taggttcc 108

<210> 952

<211> 108

<212> DNA

<213>Artificial sequence

<400> 952

gactacatgg gacatttctc ttcaaaggtg atggcccgct ccctctcccc acccccggag 60

ctggaagaaa gggatgtggc cgcatactcg gcctacgtcg taggttcc 108

<210> 953

<211> 108

<212> DNA

<213>Artificial sequence

<400> 953

gactacatgg gacattctct gcagaccaag ctgtacaccc tgcctgcaag ccacgccacg 60

cgtgtgtatg agatgctggt cagccacatt cagtacgtcg taggttcc 108

<210> 954

<211> 108

<212> DNA

<213>Artificial sequence

<400> 954

gactacatgg gacatcatcc tcttcctgac aggcctttga cttcctgttg ctgctgcggg 60

ccgactcact gcaccgcctg ggcctgccca acatacgtcg taggttcc 108

<210> 955

<211> 108

<212> DNA

<213>Artificial sequence

<400> 955

gactacatgg gacatgggag ccagagagag gctctgagaa gaagaccagc ggcccccttt 60

ctcctcccac agggcctcct ggcccggcgc ctgtacgtcg taggttcc 108

<210> 956

<211> 108

<212> DNA

<213>Artificial sequence

<400> 956

gactacatgg gacattcctc gcaggagtct gactggaagg tgctgaagct ggttctgggc 60

aggctgcctg agtccctgcg ctataaagtg ctctacgtcg taggttcc 108

<210> 957

<211> 108

<212> DNA

<213>Artificial sequence

<400> 957

gactacatgg gacatcagct ttcaggccca aagacactgg agcggctccg aggcgcccca 60

gaaggcttct ccagaactga cttgcacctg gcctacgtcg taggttcc 108

<210> 958

<211> 108

<212> DNA

<213>Artificial sequence

<400> 958

gactacatgg gacatgcgcg agatggtcta ctgcctggag cagggcctca tccaccgctg 60

tgccagccag tgcgtcgtgg ccttgtccat ctgtacgtcg taggttcc 108

<210> 959

<211> 108

<212> DNA

<213>Artificial sequence

<400> 959

gactacatgg gacattgacc accctctcca ttaccgcagc tctggccagg ctgccgcacc 60

tctacaggaa ctttgccgcg gagcagtatg ccatacgtcg taggttcc 108

<210> 960

<211> 108

<212> DNA

<213>Artificial sequence

<400> 960

gactacatgg gacatagccc ccttctcatc tcaggtttaa tcagtacatc gtgtgtctgg 60

cccatcacgt catagccatg tggttcatca ggttacgtcg taggttcc 108

<210> 961

<211> 108

<212> DNA

<213>Artificial sequence

<400> 961

gactacatgg gacattctgg gtgtgctcac tctgccaggg cctgcggtcc aatgtcctct 60

tgtcttttga tgacaccccc gagaaggaca gcttacgtcg taggttcc 108

<210> 962

<211> 108

<212> DNA

<213>Artificial sequence

<400> 962

gactacatgg gacatcgata gtctgaggat agccagaccc cccaaacaag gcttgaataa 60

ctctccaccc gtgaaagaat tcaaggagag ctctacgtcg taggttcc 108

<210> 963

<211> 108

<212> DNA

<213>Artificial sequence

<400> 963

gactacatgg gacatgcagg atacagacgt ccctcaccag tgccagcttg gggtctgcag 60

atgagaactc cgtggcccag gctgacgata gcctacgtcg taggttcc 108

<210> 964

<211> 108

<212> DNA

<213>Artificial sequence

<400> 964

gactacatgg gacatggtct cctgtgggcg agttcctcct agcgggtggc aggaccaaaa 60

cctggctggt tgggaacaag cttgtcactg tgatacgtcg taggttcc 108

<210> 965

<211> 108

<212> DNA

<213>Artificial sequence

<400> 965

gactacatgg gacatgattc tcttctcagc tccagccccg gggtgcatgt gagacagacc 60

aaggaggcgc cggccaagct ggagtcccag gcttacgtcg taggttcc 108

<210> 966

<211> 108

<212> DNA

<213>Artificial sequence

<400> 966

gactacatgg gacatggggg ccatggtctt cgagttggcg ccctggacgt gccggcctcc 60

cagttcctgg gcagtgccac ttctccagga ccatacgtcg taggttcc 108

<210> 967

<211> 108

<212> DNA

<213>Artificial sequence

<400> 967

gactacatgg gacatgggaa caccagctgg ctgatgagcc tggagaaccc gctcagccct 60

ttctcctcgg acatcaacaa catgcccctg cagtacgtcg taggttcc 108

<210> 968

<211> 108

<212> DNA

<213>Artificial sequence

<400> 968

gactacatgg gacatcctgc tgacgtggcc gcacacggcc ttcccttgca gtggcctctt 60

tctcctccct gtaccagtcc agctgccaag gactacgtcg taggttcc 108

<210> 969

<211> 108

<212> DNA

<213>Artificial sequence

<400> 969

gactacatgg gacatgtcct cccagactcc gccgtggtca tggaggaggg aagtccgggc 60

gaggttcctg tgctggtgga gcccccaggg ttgtacgtcg taggttcc 108

<210> 970

<211> 108

<212> DNA

<213>Artificial sequence

<400> 970

gactacatgg gacatgtcgt cctcagtctc cagccaggag gagaagtcgc tccacgcgga 60

ggagctggtt ggcaggggca tccccatcga gcgtacgtcg taggttcc 108

<210> 971

<211> 108

<212> DNA

<213>Artificial sequence

<400> 971

gactacatgg gacatcacct gggtgcccac catcccctcc ctgtgcagtt tcgtgttcct 60

gcagctctac cattccccct tctttggcga cgatacgtcg taggttcc 108

<210> 972

<211> 108

<212> DNA

<213>Artificial sequence

<400> 972

gactacatgg gacatcaggc agggctctgt gtgccacagt cacagtcctt tgagcggtcg 60

gtgcagctcc tcgaccagat cccatcatac gactacgtcg taggttcc 108

<210> 973

<211> 108

<212> DNA

<213>Artificial sequence

<400> 973

gactacatgg gacatgagca acagcgagct cgccatcctg tccaatgagc atggctccta 60

caggtacacg gagttcctga cgggcctggg ccgtacgtcg taggttcc 108

<210> 974

<211> 108

<212> DNA

<213>Artificial sequence

<400> 974

gactacatgg gacatgccgt cttccacatc gccaccctga tgcccaccaa ggacgtggac 60

aagcaccgct gcgacaagaa gcgccacctg ggctacgtcg taggttcc 108

<210> 975

<211> 108

<212> DNA

<213>Artificial sequence

<400> 975

gactacatgg gacatgcggg gatgaccctt tctcttgtcc gggcagggcc agttcaactt 60

tgtccacgtg atcgtcaccc cgctggacta cgatacgtcg taggttcc 108

<210> 976

<211> 108

<212> DNA

<213>Artificial sequence

<400> 976

gactacatgg gacattggcg tgaccaccaa gtctccccag acatggaggg ccttgtggac 60

accagcgtgg ccaagatcgt gtctgaccgc aactacgtcg taggttcc 108

<210> 977

<211> 108

<212> DNA

<213>Artificial sequence

<400> 977

gactacatgg gacatacccc ctgcctacgt ccccagatgg cctcacaggt gcatcatagc 60

cgctccaacc ccaccgatat ctacccctcc aagtacgtcg taggttcc 108

<210> 978

<211> 108

<212> DNA

<213>Artificial sequence

<400> 978

gactacatgg gacatgatct gcgaggaagc cgcctactcc aaccccagcc tacctctggt 60

gcaccctccg tcccatagca aagcccctgc acatacgtcg taggttcc 108

<210> 979

<211> 108

<212> DNA

<213>Artificial sequence

<400> 979

gactacatgg gacataatgc tcctggctgt tttgtactgc ctgctgtgga gtttccagac 60

ctccgctggc catttcccta gagcctgtgt ctctacgtcg taggttcc 108

<210> 980

<211> 108

<212> DNA

<213>Artificial sequence

<400> 980

gactacatgg gacatgattg tctgtagccg attggaggag tacaacagcc atcagtcttt 60

atgcaatgga acgcccgagg gacctttacg gcgtacgtcg taggttcc 108

<210> 981

<211> 108

<212> DNA

<213>Artificial sequence

<400> 981

gactacatgg gacatggatt tgctagtcca cttactggga tagcggatgc ctctcaaagc 60

agcatgcaca atgccttgca catctatatg aattacgtcg taggttcc 108

<210> 982

<211> 108

<212> DNA

<213>Artificial sequence

<400> 982

gactacatgg gacatcatgg ctgtggagtc ccagggcgga cgcccacttg tcctgggcct 60

gctgctgtgt gtgctgggcc cagtggtgtc ccatacgtcg taggttcc 108

<210> 983

<211> 108

<212> DNA

<213>Artificial sequence

<400> 983

gactacatgg gacatttgtg gttttctctt tgggatcaat ggtctcagaa attccagaga 60

agaaagctat ggcaattgct gatgctttgg gcatacgtcg taggttcc 108

<210> 984

<211> 108

<212> DNA

<213>Artificial sequence

<400> 984

gactacatgg gacatggtca cccgatgacc cgtgccttta tcacccatgc tggttcccat 60

ggtgtttatg aaagcatatg caatggcgtt ccctacgtcg taggttcc 108

<210> 985

<211> 108

<212> DNA

<213>Artificial sequence

<400> 985

gactacatgg gacatacaag gaccgcccgg tggagccgct ggacctggcc gtgttctggg 60

tggagtttgt gatgaggcac aagggcgcgc cactacgtcg taggttcc 108

<210> 986

<211> 108

<212> DNA

<213>Artificial sequence

<400> 986

gactacatgg gacatgcacc atgagtgggg gcccaatggg aggaaggccc gggggccgag 60

gagcaccagc ggttcagcag aacataccct ccatacgtcg taggttcc 108

<210> 987

<211> 108

<212> DNA

<213>Artificial sequence

<400> 987

gactacatgg gacatgacgc tggccactgc agttgttcag ctgtacctgg cgctgccccc 60

tggagctgag cactggacca aggagcattg tggtacgtcg taggttcc 108

<210> 988

<211> 108

<212> DNA

<213>Artificial sequence

<400> 988

gactacatgg gacattgtgc ctcccaccct acacctctcc aggctggtcg gctgctctgg 60

gaacaggagc tgtactcaca gcttgtctac tcctacgtcg taggttcc 108

<210> 989

<211> 108

<212> DNA

<213>Artificial sequence

<400> 989

gactacatgg gacatgaccc caaggtatgt gcaggactgc caagcggggc tgaactttgc 60

agacgaggac gaggcccagg ccttccgggc ccttacgtcg taggttcc 108

<210> 990

<211> 108

<212> DNA

<213>Artificial sequence

<400> 990

gactacatgg gacatctaga aaagtcccct ctcatggtcc tggctcccaa tccatctatc 60

cacagacaga cgccagctac ccccaccacc aactacgtcg taggttcc 108

<210> 991

<211> 108

<212> DNA

<213>Artificial sequence

<400> 991

gactacatgg gacattgtgg cagggctgtg ataactctct acacattcca tcttcccaga 60

gagaagagga gggctcccac ccctgcccct gcatacgtcg taggttcc 108

<210> 992

<211> 108

<212> DNA

<213>Artificial sequence

<400> 992

gactacatgg gacatggccc tccagtgggt ccgctctccc tggggctggc gacagtggac 60

atccagaacc ctgacatcac gagttcacga tactacgtcg taggttcc 108

<210> 993

<211> 108

<212> DNA

<213>Artificial sequence

<400> 993

gactacatgg gacatgggaa ggaagggcag tgaggattca ctggagtctc ttcacctctc 60

ccaggcatgt cagccacgtg gggtgggacc ccctacgtcg taggttcc 108

<210> 994

<211> 108

<212> DNA

<213>Artificial sequence

<400> 994

gactacatgg gacatggtga acaacctcga cccagatctg cggagtctgt tctccagggc 60

aggaatcagc gaggcccagc tcaccgacgc cgatacgtcg taggttcc 108

<210> 995

<211> 108

<212> DNA

<213>Artificial sequence

<400> 995

gactacatgg gacatgagcc acttccgccg cccccaccgc catctcgagg agggaaccag 60

ctcccccggc cccctattgt ggggggtaac aagtacgtcg taggttcc 108

<210> 996

<211> 108

<212> DNA

<213>Artificial sequence

<400> 996

gactacatgg gacatctgcc tgctgcagac ccctggggcc ccagagagct cagcgctgca 60

gccaccacct cagagctcag agggactggt gggtacgtcg taggttcc 108

<210> 997

<211> 108

<212> DNA

<213>Artificial sequence

<400> 997

gactacatgg gacatccacc aacctcccag ggcatcttat ctttctcttt ccctccagac 60

gaaggggagg accaggctgg cgatgaagat gaatacgtcg taggttcc 108

<210> 998

<211> 108

<212> DNA

<213>Artificial sequence

<400> 998

gactacatgg gacatgttgc caatgtgcat tagctgtttg cagcctcacc ttctttcatg 60

gagtttaaga tatagtgtat tttcccaagg ttttacgtcg taggttcc 108

<210> 999

<211> 108

<212> DNA

<213>Artificial sequence

<400> 999

gactacatgg gacatatgtt ttaaatgcac tgacctccca cattcccttt ttagtaaaat 60

attcagaaat aatttaaata catcattgca atgtacgtcg taggttcc 108

<210> 1000

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1000

gactacatgg gacatcccag tttagtagtt ggacttaggg aacaaaggaa cctttaatag 60

aaattggaca gcaagaaagc gagcttagtg atatacgtcg taggttcc 108

<210> 1001

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1001

gactacatgg gacatgaaga taagaggtat gaacatgatt agcaaaaggg cctagcttgg 60

actcagaata atccagcctt atcccaacca taatacgtcg taggttcc 108

<210> 1002

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1002

gactacatgg gacattatcc ccttcctatg acatgaactt aaccatagaa aagaagggga 60

aagaaaacat caagcgtccc atagactcac ccttacgtcg taggttcc 108

<210> 1003

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1003

gactacatgg gacattctct gtctccacat gcccagtttc tattggtctc cttaaacctg 60

tcttgtaacc ttgataccaa cctgcccagg gcctacgtcg taggttcc 108

<210> 1004

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1004

gactacatgg gacattgaac acagttgtgt cagaagcaaa tgtaagcaat agatggctct 60

gccctgactt ttatgcccag ccctggctcc tgctacgtcg taggttcc 108

<210> 1005

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1005

gactacatgg gacatgccct gacttttatg cccagccctg gctcctgccc tccctgctcc 60

tgggagtaga ttggccaacc ctagggtgtg gcttacgtcg taggttcc 108

<210> 1006

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1006

gactacatgg gacattcccc acagactcag agagaaccca ccatggtgct gtctcctgcc 60

gacaagacca acgtcaaggc cgcctggggt aagtacgtcg taggttcc 108

<210> 1007

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1007

gactacatgg gacatggctc cctcccctgc tccgacccgg gctcctcgcc cgcccggacc 60

cacaggccac cctcaaccgt cctggccccg gactacgtcg taggttcc 108

<210> 1008

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1008

gactacatgg gacatcacgt ggacgacatg cccaacgcgc tgtccgccct gagcgacctg 60

cacgcgcaca agcttcgggt ggacccggtc aactacgtcg taggttcc 108

<210> 1009

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1009

gactacatgg gacatggcgg gccgggagcg atctgggtcg aggggcgaga tggcgccttc 60

ctcgcagggc agaggatcac gcgggttgcg ggatacgtcg taggttcc 108

<210> 1010

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1010

gactacatgg gacatgcggg aggtgtagcg caggcggcgg ctgcgggcct gggccctcgg 60

ccccactgac cctcttctct gcacagctcc taatacgtcg taggttcc 108

<210> 1011

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1011

gactacatgg gacatcctcg gtggccatgc ttcttgcccc ttgggcctcc ccccagcccc 60

tcctcccctt cctgcacccg tacccccgtg gtctacgtcg taggttcc 108

<210> 1012

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1012

gactacatgg gacatggcgc gctcgcgggc cggcactctt ctggtcccca cagactcaga 60

gagaacccac catggtgctg tctcctgccg acatacgtcg taggttcc 108

<210> 1013

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1013

gactacatgg gacatccgac aagaccaacg tcaaggccgc ctggggtaag gtcggcgcgc 60

acgctggcga gtatggtgcg gaggccctgg agatacgtcg taggttcc 108

<210> 1014

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1014

gactacatgg gacatccgac ccgggctcct cgcccgcccg gacccacagg ccaccctcaa 60

ccgtcctggc cccggaccca aaccccaccc ctctacgtcg taggttcc 108

<210> 1015

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1015

gactacatgg gacatcaccc tcaaccgtcc tggccccgga cccaaacccc acccctcact 60

ctgcttctcc ccgcaggatg ttcctgtcct tcctacgtcg taggttcc 108

<210> 1016

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1016

gactacatgg gacattcaag gtgagcggcg ggccgggagc gatctgggtc gaggggcgag 60

atggcgcctt cctctcaggg cagaggatca cgctacgtcg taggttcc 108

<210> 1017

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1017

gactacatgg gacattcctc tcagggcaga ggatcacgcg ggttgcggga ggtgtagcgc 60

aggcggcggc tgcgggcctg ggccgcactg acctacgtcg taggttcc 108

<210> 1018

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1018

gactacatgg gacattcacg cgggttgcgg gaggtgtagc gcaggcggcg gctgcgggcc 60

tgggccgcac tgaccctctt ctctgcacag ctctacgtcg taggttcc 108

<210> 1019

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1019

gactacatgg gacatcagct cctaagccac tgcctgctgg tgaccctggc cgcccacctc 60

cccgccgagt tcacccctgc ggtgcacgcc tcctacgtcg taggttcc 108

<210> 1020

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1020

gactacatgg gacatgacaa gttcctggct tctgtgagca ccgtgctgac ctccaaatac 60

cgttaagctg gagcctcggt agccgttcct ccttacgtcg taggttcc 108

<210> 1021

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1021

gactacatgg gacatggagc ctcggtagcc gttcctcctg cccgctgggc ctcccaacgg 60

gccctcctcc cctccttgca ccggcccttc ctgtacgtcg taggttcc 108

<210> 1022

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1022

gactacatgg gacattttga ataaagtctg agtgggcagc agcctgtgtg tgcctgggtt 60

ctctctatcc cggaatgtgc caacaatgga ggttacgtcg taggttcc 108

<210> 1023

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1023

gactacatgg gacatttaac tgcagcctaa taattgtttt ctttgggata acttttaaag 60

tacattaaaa gactatcaac ttaatttctg atctacgtcg taggttcc 108

<210> 1024

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1024

gactacatgg gacatataaa ataagtaaaa tgtcttgtga aacaaaatgc tttttaacat 60

ccatataaag ctatctatat atagctatct atgtacgtcg taggttcc 108

<210> 1025

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1025

gactacatgg gacatttttt tttaacttcc tttattttcc ttacagggtt tcagacaaaa 60

tcaaaaagaa ggaaggtgct cacattcctt aaatacgtcg taggttcc 108

<210> 1026

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1026

gactacatgg gacatacttt tgtaaaactt tatggtttgt ggaaaacaaa tgtttttgaa 60

catttaaaaa gttcagatgt taaaaagttg aaatacgtcg taggttcc 108

<210> 1027

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1027

gactacatgg gacatacaat caatattaaa gaattttgat gccaaaacta ttagataaaa 60

ggttaatcta catccctact agaattctca tactacgtcg taggttcc 108

<210> 1028

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1028

gactacatgg gacatactgg ttggttatgt ggaagaaaca tactttcaca ataaagagct 60

ttaggatatg atgccatttt atatcactag tagtacgtcg taggttcc 108

<210> 1029

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1029

gactacatgg gacattagta ggcagaccag cagacttttt tttattgtga tatgggataa 60

cctaggcata ctgcactgta cactctgaca tattacgtcg taggttcc 108

<210> 1030

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1030

gactacatgg gacatacata tgaagtgctc tagtcaagtt taactggtgt ccacagagga 60

catggtttaa ctggaattcg tcaagcctct ggttacgtcg taggttcc 108

<210> 1031

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1031

gactacatgg gacatcacag aggacatggt ttaactggaa ttcgtcaagc ctctggttct 60

aatttctcat ttgcaggaaa tgctggcata gagtacgtcg taggttcc 108

<210> 1032

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1032

gactacatgg gacattgacg ggcgtctcgc cagctggcgc ccgcctgctg tggaactggt 60

ggaagctccg gagcctccac ctcccgcctc ttgtacgtcg taggttcc 108

<210> 1033

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1033

gactacatgg gacatcttac ctgtaagggc cgggggcaaa gtgtgagcca cctttggggc 60

atccccaatc caggtccctg gaagctcttg gggtacgtcg taggttcc 108

<210> 1034

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1034

gactacatgg gacatccagg tccctggaag ctcttggggg ggcatatctg gtggggagaa 60

agcaggggtt ggggaggccg aagaaggtca ggctacgtcg taggttcc 108

<210> 1035

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1035

gactacatgg gacatcagcc cccacctcct cctgcagaca agctggtgtc taggaactac 60

ccggacctgt ccttgggaga ctactccctg ctctacgtcg taggttcc 108

<210> 1036

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1036

gactacatgg gacatcgtga ctccatggag ccagtggtgg agcagctgac ccaggagttc 60

tgtgaggtaa ggctgggctc ctgaggccac ctctacgtcg taggttcc 108

<210> 1037

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1037

gactacatgg gacattcctg aggccacctc gggtcagcct cgcctctcac agtagccccc 60

gccctgcccg ctgcacagcg gcctgctgaa ctctacgtcg taggttcc 108

<210> 1038

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1038

gactacatgg gacatgctgc acagcggcct gctgaactca cactgtttct ccacagcgca 60

tgagagccca gcccggcacc cctgtggcca ttgtacgtcg taggttcc 108

<210> 1039

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1039

gactacatgg gacatctgaa ctgaaagtac tccctccttt tctggcagga cgacaactta 60

atgcctgcct attacaaatg tatccaggag gtgtacgtcg taggttcc 108

<210> 1040

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1040

gactacatgg gacattatta caaatgtatc caggaggtgt taaaaacctg gagccactgg 60

tccatccaaa ttgtggacgt gattcccttt ctctacgtcg taggttcc 108

<210> 1041

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1041

gactacatgg gacatgtgat tccctttctc agggtgagga cctggagcct agacacccct 60

gggttgtagg ggagaggctg gggtggaggg agatacgtcg taggttcc 108

<210> 1042

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1042

gactacatgg gacatgggag aggctccttc ccacagctgc attctcatgc ttcctgccgc 60

agttcttccc caatccaggt ctccggaggc tgatacgtcg taggttcc 108

<210> 1043

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1043

gactacatgg gacattgcta ccggcctcag cattgctatg aggcgggttc ttttgcatac 60

cccagttatg ggcctgttgc cactctgtac tcctacgtcg taggttcc 108

<210> 1044

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1044

gactacatgg gacatcccca ggccagccgc tcagcccgct cctttcaccc tctgcaggag 60

agcctcgtgg caggccagtg gagggacatg atgtacgtcg taggttcc 108

<210> 1045

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1045

gactacatgg gacatgcagg ccagtggagg gacatgatgg actacatgct ccaaggggtg 60

gcgcagccga gcatggaaga gggctctgga cagtacgtcg taggttcc 108

<210> 1046

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1046

gactacatgg gacataacac cctctcctgg gccgtggttt ttttgcttca ccaccctgag 60

gtgcgtcctg gggacaagca aaaggctcct tcctacgtcg taggttcc 108

<210> 1047

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1047

gactacatgg gacatgggca ccctcactca gctctgagca ctgtgcggct ggggctgtgc 60

ttgcctcacc ggcactcagg ctcactgggt tgctacgtcg taggttcc 108

<210> 1048

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1048

gactacatgg gacatctggt gcctccagct cccgggtccc ctacaaggac cgtgcacggc 60

tgcccttgct caatgccacc atcgccgagg tgctacgtcg taggttcc 108

<210> 1049

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1049

gactacatgg gacatcctta gccttgcccc accgcaccac acggcccagc aggtgactcc 60

cgagggttgg ggatgagtga ggaaagcccg agctacgtcg taggttcc 108

<210> 1050

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1050

gactacatgg gacatgggag gtcctggcca gcctctaact ccagccccct tcagcatctc 60

cggctacgac atccctgagg gcacagtcat cattacgtcg taggttcc 108

<210> 1051

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1051

gactacatgg gacatgacgg tctgggagag gccacatgag ttctggcctg gtatgtgggg 60

ggccgggggc ctgccgtgaa aatgtggtgg aggtacgtcg taggttcc 108

<210> 1052

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1052

gactacatgg gacataccca cctgtccacc cgcccgcaga tcgcttcctg gagccaggca 60

agaactccag agctctggcc ttcggctgcg gtgtacgtcg taggttcc 108

<210> 1053

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1053

gactacatgg gacattcttc gtggtgctga cccgactgct gcaggccttc acgctgctgc 60

cctccgggga cgccctgccc tccctgcagc ccctacgtcg taggttcc 108

<210> 1054

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1054

gactacatgg gacatggggg atgggggccc acagcccggg ccagagccag tgatggggca 60

ggaccgatgc cagccgggta cctcagtttc tcctacgtcg taggttcc 108

<210> 1055

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1055

gactacatgg gacataagga cgtgtgttgg tccagccccc cggttccccg agacccacgc 60

ggccgggcaa ccgctctggg tctcgcggtc ccttacgtcg taggttcc 108

<210> 1056

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1056

gactacatgg gacatctggg gctcctgcgc tcctaggcgg gtcctgggcc gggcgccgcc 60

gaggggctcc gagtcgggga gaggagcgcg cggtacgtcg taggttcc 108

<210> 1057

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1057

gactacatgg gacatacccc gcctcttccc tcggagactg ggaaagttac ggatctgggt 60

cctcagagct tcccgggtcc gcgaaccccc gactacgtcg taggttcc 108

<210> 1058

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1058

gactacatgg gacatgttga acagggccct gaagcgcgta cacaccgccc gtcaccctcc 60

tcaagtatac ttcaaaggac atttaactaa aactacgtcg taggttcc 108

<210> 1059

<211> 108

<212> DNA

<213>Artificial sequence

<400> 1059

gactacatgg gacatcattt aactaaaacc cctacgcatt tatatagagg agacaagtcg 60

taacatggta agtgtactgg aaagtgcact tggtacgtcg taggttcc 108

<210> 1060

<211> 15

<212> DNA

<213>Artificial sequence

<400> 1060

gactacatgg gacat 15

<210> 1061

<211> 15

<212> DNA

<213>Artificial sequence

<400> 1061

ggaacctacg acgta 15

<210> 1062

<211> 50

<212> DNA

<213>Artificial sequence

<400> 1062

aatgatacgg cgaccaccga gatctacact ctttccctac acgacgatct 50

<210> 1063

<211> 50

<212> DNA

<213>Artificial sequence

<400> 1063

caagcagaag acggcatacg agatcggtct cggcattcct gctgaaccgc 50

<210> 1064

<211> 21

<212> DNA

<213>Artificial sequence

<400> 1064

aatgatacgg cgaccaccga g 21

<210> 1065

<211> 21

<212> DNA

<213>Artificial sequence

<400> 1065

caagcagaag acggcatacg a 21

<210> 1066

<211> 42

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (34)..(41)

<223> n is a, c, g, or t

<400> 1066

acactctttc cctacacgac gctcttccga tctnnnnnnn nt 42

<210> 1067

<211> 29

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<222> (1)..(8)

<223> n is a, c, g, or t

<400> 1067

nnnnnnnnag atcggaagag cacacgtct 29

Claims

1. A kit for detecting whether a subject or a fetus to be detected has a genetic disease single gene mutation comprises a probe set;

the probe set comprises 1059 specific probes; each specific probe comprises a DNA fragment 2;

；

the DNA fragment 2 is a single-stranded DNA molecule consisting of 78 nucleotides;

the nucleotide sequences of the DNA fragment 2 of the 1059 specific probes are shown as SEQ ID NO: 1 from position 16-93 from the 5' end to SEQ ID NO: 1059 is shown at positions 16-93 from the 5' end.

2. The kit of claim 1, wherein: each specific probe also comprises a DNA fragment 1 and a DNA fragment 3; the DNA segment 1 is positioned at the 5' end of the DNA segment 2; the DNA segment 3 is positioned at the 3' end of the DNA segment 2;

the nucleotide sequence of the DNA fragment 1 is shown as a sequence 1060 in a sequence table;

the nucleotide sequence of the DNA fragment 3 is shown as a sequence 1061 in a sequence table;

the DNA segment 1 and/or the DNA segment 3 has a biotin label.

3. The kit of claim 1, wherein: the kit also comprises a primer pair A; the primer pair A consists of a primer 1 and a primer 2; the primer 1 comprises the DNA fragment 1; the primer 2 comprises the DNA fragment 3;

the nucleotide sequence of the primer 1 is shown as a sequence 1060 in a sequence table;

the nucleotide sequence of the primer 2 is shown as a sequence 1061 in the sequence table;

the primer 1 and/or the primer 2 has a biotin label.

4. The kit of claim 1, wherein: the kit also comprises a joint 1, a joint 2, a primer 3, a primer 4, a primer 5 and a primer 6;

the nucleotide sequence of the linker 1 is shown as a sequence 1066 in a sequence table;

the nucleotide sequence of the linker 2 is shown as a sequence 1067 in the sequence table;

the nucleotide sequence of the primer 3 is shown as a sequence 1062 in the sequence table;

the nucleotide sequence of the primer 4 is shown as a sequence 1063 in the sequence table;

the nucleotide sequence of the primer 5 is shown as a sequence 1064 in the sequence table;

the nucleotide sequence of the primer 6 is shown as a sequence 1065 in the sequence table.

5. The kit of claim 4, wherein: the 3' ends of the joint 1, the primer 5 and the primer 6 are all subjected to thio modification; the 5' end of the linker 2 is modified by phosphorylation.

6. The kit of any one of claims 1 to 5, wherein: the kit also comprises a carrier recorded with a judgment standard A and/or a judgment standard B;

the judgment standard A is as follows: obtaining SNP indels of a person to be tested about 50 monogenic genetic disease mutant genes; counting the condition of mutation sites in each mutant gene;

(K1) preparing a genomic DNA library of a to-be-detected person; preparing the adaptor of the genomic DNA library of the subject as the adaptor 1 and the adaptor 2 in claim 4;

(K2) after the completion of step (K1), hybridizing the genomic DNA library of the subject with the probe set of claim 1 or 2 to obtain a hybridization product;

(K8) annotating sites reported by an HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if the SNP Indel of the person to be detected contains any point mutation in 6636 pathogenic mutation sites, the person to be detected carries the mutation site of the corresponding mutant gene; otherwise, the person to be detected does not carry the corresponding gene mutation site;

the "method of determining spinal muscular atrophy due to SMN1 gene mutation" and the "method of determining α thalassemia due to HBA1 gene and HBA2 gene mutation" were as follows:

(3) comparing the sequencing result with the SMN1 gene and the SMN2 gene in the human genome version Hg19, and calculating an f (Z) value of the SMN1 gene and an f (Z) value of the SMN2 gene in the sample to be detected to judge the copy number of the SMN1 gene and the SMN2 gene in the sample to be detected so as to determine whether the sample to be detected is a spinal muscular atrophy patient or a spinal muscular atrophy carrier, wherein the method comprises the following steps:

median of f (z) ═ B/all negative sample B values for SMN1 gene

B-sample sequencing depth D/alignment base number A of SMN1 gene

median of f (z) ═ B/all negative sample B values for SMN2 gene

B-sample sequencing depth D/alignment base number A of SMN2 gene

and (3) judging whether the sample to be detected is a spinal muscular atrophy patient or a spinal muscular atrophy carrier by using the f (Z) value of the SMN1 gene:

the judgment standard B is used for judging whether the fetus to be detected has 45 genetic disease single gene mutations; 45 genetic disease monogenes except CYP21A2, SMN1, HBA1, HBA2 and MT-RNR1 genes in the 150 genes in the table;

the judgment standard B is as follows:

(a2) obtaining the type, mutation frequency and sequencing depth of mutation sites of 45 monogenic genetic disease mutation genes of the father of the fetus;

(a4-1) when the father and mother of the fetus are both heterozygous mutations, the judgment method is as follows:

when the type of the mutation site is the first type, if the mutation site is detected in the third step, the fetus carries the mutation site and is heterozygous mutation; if the mutation site is detected to be free of mutation in step three, the fetus does not carry the mutation site;

dividing the types of the mutation sites of the pregnant woman to be detected and the fetus obtained in the step three, which relate to the 11 autosomal monogenic dominant hereditary diseases of the mutant genes, into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; in the third category: the same mutation site as both the fetal father and the fetal mother;

judging the gender of the fetus;

(a6-2) when the mother of fetus has heterozygous mutation and no mutation in father, the judgment method is as follows:

judging the gender of the fetus;

dividing the types of the X chromosome monogenic recessive genetic disease monogenic mutation sites of the pregnant woman to be detected and the fetus obtained in the step three into the following three types: the first type: a mutation site that is identical only to the fetal father; the second type: a mutation site that is identical only to the mother of the fetus; the third type: the same mutation site as both the fetal father and the fetal mother;

judging the gender of the fetus;

when the fetus is a male fetus, if the mutation frequency of the target gene mutation site in the step III is more than 0.57, the fetus carries the site mutation; if the mutation frequency of the target gene mutation site in the step three is less than 0.43, the fetus does not carry the site mutation;

the steps for obtaining the types of mutation sites, mutation frequencies and sequencing depths of the 44 single-gene genetic disease mutant genes of the fetal mother or fetal father per se are as follows:

(w1) preparing a genomic DNA library of the mother or father of the fetus; preparing the linker of genomic DNA library of mother or father of fetus as the linker 1 and the linker 2 in claim 4;

(w2) after completion of step (w1), hybridizing the genomic DNA library of the mother or father of the fetus with the probe set of claim 1 or 2 to obtain a hybridization product;

(w7) annotating the information obtained in the step (w6), and then screening to obtain the SNPINdel of the mother or father of the fetus;

(w8) annotating sites reported by an HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if the SNP Indel of the mother or father of the fetus contains any point mutation in 6636 pathogenic mutation sites, the mother or father of the fetus carries the mutation site of the corresponding mutant gene; otherwise, the fetal mother or the fetal father does not carry the corresponding gene mutation site; drawing a target gene deletion and repeat analysis graph according to the mutation sites of the mutant genes carried by the mother or father of the fetus to obtain the types, mutation frequencies and sequencing depths of the mutation sites of the 44 single-gene genetic disease mutant genes of the mother or father of the fetus;

the steps for obtaining the types of mutation sites, mutation frequencies and sequencing depths of the fetal mother and the fetus relative to the 44 single-gene genetic disease mutant genes are as follows:

(Q1) preparing a fetal maternal plasma free DNA library; preparing the linker of the fetal mother plasma free DNA library as the linker 1 and the linker 2 in claim 4;

(Q2) after completion of step (Q1), hybridizing the fetal maternal plasma free DNA library with the probe set of claim 1 or 2 to obtain a hybridization product;

(Q8) annotating the sites reported by the HGMD database, and then screening to obtain 6636 pathogenic mutation sites; if SNP Indel of 'fetal mother and fetus' contains any one point mutation in 6636 pathogenic mutation sites, then 'fetal mother and fetus' carry the mutation site of the corresponding mutant gene; otherwise, the 'fetal mother and fetus' do not carry the corresponding gene mutation site; according to the mutation sites of the mutant genes carried by the mother and the fetus, a target gene deletion and repeated analysis graph is drawn, and the types, the mutation frequencies and the sequencing depths of the mutation sites of the 44 single-gene genetic disease mutant genes of the mother and the fetus are obtained.

7. A set of probes as claimed in claim 1 or 2.

8. A kit for detecting whether a fetus to be tested is normal, heterozygous or homozygous mutated based on the 50 genes corresponding to the monogenic genetic disorders as set forth in claim 1, comprising the probe set of claim 1 or 2.

9. A kit for detecting whether a subject is normal, heterozygous or homozygous mutated based on the 50 genes corresponding to the monogenic genetic disorders set forth in claim 1, comprising the probe set forth in claim 1 or 2.

10. The kit of claim 8 or 9, wherein: the kit further comprises the primer 3, the primer 4, the linker 1 and the linker 2 in claim 4.

11. The kit of claim 10, wherein: the kit further comprises the primer 5 and/or the primer 6 of claim 4.