CN112300976A

CN112300976A - Recombinant lactobacillus plantarum for expressing newcastle disease virus antigen gene and fermentation process and application thereof

Info

Publication number: CN112300976A
Application number: CN202011185965.4A
Authority: CN
Inventors: 王春凤; 单宝龙; 刘乃芝; 亓秀晔; 郭杨丽; 姜延龙; 陈雷; 谷巍; 徐海燕; 张建梅; 程福亮; 李丹; 王红; 宋翔; 宁扬; 侯玉凤; 李鹏; 陈晓雯
Original assignee: Shandong Boly Lely Bioengineering Co ltd
Current assignee: SHANDONG BOLY-LELY BIOENGINEERING Co.,Ltd.; Jilin Agricultural University
Priority date: 2020-10-29
Filing date: 2020-10-29
Publication date: 2021-02-02
Anticipated expiration: 2040-10-29
Also published as: CN112300976B

Abstract

The invention provides a recombinant lactobacillus plantarum for expressing newcastle disease virus antigen genes, and a fermentation process and application thereof, belonging to the technical field of microorganisms. The invention successfully constructs a recombinant lactobacillus plantarum NC8-pSIP 409-pgsA' (ata) -HN-DCpep. Experiments prove that the recombinant lactobacillus plantarum obtained by the invention not only can efficiently express HN antigen protein, but also has immunogenicity. Compared with the original starting strain NC8, the lactobacillus plantarum freeze-dried powder has better growth, fermentation and storage performances and the like, and meanwhile, the recombinant lactobacillus plantarum freeze-dried powder is adopted to immunize SPF chicks, so that the safety performance is good, and large-dose immunization has no abnormal reaction to chickens. The immune performance of the mucous membrane of the organism can be obviously improved by adopting low-dose immunization, the anti-NDV-VII strain effect is achieved, the survival rate of the chickens after challenge is 71.6%, and therefore the anti-NDV-VII strain has good practical application value.

Description

Recombinant lactobacillus plantarum for expressing newcastle disease virus antigen gene and fermentation process and application thereof

Technical Field

The invention relates to the technical field of microorganisms, in particular to a recombinant lactobacillus plantarum for expressing newcastle disease virus antigen genes and a fermentation process and application thereof.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Newcastle Disease (ND) is a highly contagious disease, also called pseudo-fowl plague or asian fowl plague, which is caused by Newcastle Disease Virus (NDV) and can cause various poultry to have febrile, acute and septic symptoms and has extremely high mortality, and is one of important diseases seriously harming poultry industry all over the world, and the Newcastle Disease (ND) causes huge loss to the poultry industry since the first discovery in 1926.

The main sources of infection of ND are viral or diseased chicken feces, oral mucus, and birds are also important transmitters. The virus can be transmitted through digestive tract and respiratory tract, and also can invade into organism through eye conjunctiva, cloaca mucosa, skin wound, etc. Mammals are resistant to NDV, but humans may develop ocular conjunctivitis after exposure to the virus. The incubation period of ND is 2-15 days or longer, with an average of 5-6 days. Symptoms after infection are mainly manifested as fever, listlessness, disharmony of feather, dark red cockscomb, drooping wing, decreased food intake, increased drinking water, dyspnea, accompanied by respiratory rale, yellow green and thin stool; the nerve symptoms of head distortion, neck distortion, starry sight, unstable standing or circling, lying and standing difficulty and the like appear in the parts after a long time. After the laying hens are infected, the egg yield is reduced or stopped, the number of soft-shell eggs, sand-shell eggs, faded eggs and malformed eggs is increased, the follicles are deformed, and the blood vessels of the follicles are congested or bleed. The sick chicken dissects and inspects that the larynx has a large amount of mucus and the trachea mucosa bleeds; bleeding spots are formed on the papilla of the glandular stomach, the muscular stomach is swollen and rotten, and bleeding spots at the junction of the glandular stomach and the muscular stomach are particularly abundant; the mucous membrane of small intestine and cloaca has bleeding point or necrosis point, enlarged cecum tonsil and bursa of fabricius.

To reduce the loss of ND to the poultry industry, attention must be paid to the prevention and control of ND. Currently, no approved drug for effectively treating ND is mainly inoculated by vaccines besides strictly controlling the feeding environment, so that the prevention and control are mainly performed in advance. The common newcastle disease vaccines include attenuated vaccine, inactivated vaccine and genetic engineering vaccine. Currently, inactivated vaccines, attenuated vaccines and the like are the most commonly used, but the disadvantages of these vaccines are not questionable, such as: strong toxicity, large injection stress and the like.

In recent years, newcastle disease of different genotypes has spread in our country, with genotype VII being the major epidemic strain. Because the genotype of the vaccine strain antigen is not matched with that of the epidemic strain antigen, the clinical symptoms of the current Newcastle disease are atypical and difficult to eradicate. Based on this, it is important to develop vaccines that can be used for the prevention of type VII NDV strains. NDV belongs to Paramyxoviridae (Paramyxoviridae), mumps virus or avian paramyxovirus (Avulavirus), is a single-stranded negative-strand RNA virus, and has a membrane. NDV has six specific structural proteins: nucleoprotein (NP), hemagglutinin-neuraminidase (HN), Fusion protein (F), polymerase protein (L), Phosphoprotein (P) and Matrix protein (M). Of these, HN and F are important host protective antigens.

With the development of genetic engineering techniques, researchers have attempted to develop novel genetically engineered vaccines using a variety of expression systems. As lactic acid bacteria are common bacteria in the intestinal tract of humans and most animals, the use of lactic acid bacteria expression systems is becoming more and more mature. The pSIP409 series plasmid is a shuttle plasmid vector specific to lactobacillus plantarum, and can be replicated in Escherichia coli and express foreign proteins in lactobacillus plantarum because of the two replicons of pUC (Escherichia coli) and 256rep (Lactobacillus plantarum). However, the traditional pSIP409 series plasmids use erythromycin resistance genes as screening markers, and have serious biological safety hazards. D-alanine is a constituent of the peptidoglycan structure in bacterial cell walls, and in prokaryotes D-alanine is predominantly converted from L-alanine by alanine racemase, which is the only source of D-alanine. The research shows that the deletion of the alanine racemase gene alr on the expression vector genome presents a stable auxotroph on a minimal medium, and the plasmid complementation of the auxotroph proves that the deletion can provide enough strong selection pressure for the plasmid. The auxotrophy screening marker is used for replacing an antibiotic screening marker, so that the biological potential safety hazard caused by the drift of antibiotic genes is avoided.

With the rapid development of immunological research, novel vaccines developed by using genetic engineering technology continuously appear, but the defects of weak immunogenicity, incapability of inducing an organism to generate effective immune response and the like generally exist, so that an adjuvant is needed to enhance the immunogenicity to induce strong immune response. Dendritic Cells (DCs) play a central role in the initiation and polarization of antigen-specific immune responses, internalize and process antigens via MHC class I and class II pathways to form adaptive immune responses, and present processed antigenic peptides to CD4⁺And CD8⁺T lymphocytes. The dendritic cell induction peptide (DCpep) can be specifically targeted and combined with Dendritic Cells (DCs), is helpful for the DCs to recognize antigens, induces immune response and plays an important role in immune homeostasis.

Lactic acid bacteria are used as an expression vector of foreign proteins, most of the expressed proteins are secreted in cytoplasm, and the cell walls of the strains prevent the foreign proteins from playing a role outside cells to a great extent. Poly-gamma-Glutamic Acid synthetase A (Poly-gamma-Glutamic Acid syntthetase A, pgsA) is derived from Bacillus subtilis and can anchor exogenous protein on the surface of host bacteria, but the inventor finds that the construction of recombinant bacteria and the expression of exogenous protein are influenced to a certain extent by a longer gene sequence (1143bp) of the protein.

Disclosure of Invention

The invention aims to provide a recombinant lactobacillus plantarum for expressing a newcastle disease virus antigen gene and a fermentation process and application thereof, wherein lactobacillus plantarum NC8 is used as an original strain, a VII-series NDV strain (NDV-VII) sequence which is popular in recent years is used as a basis, related protective antigen site fragments are connected with a surface display element and dendritic cell induction peptide in series according to the research of protective antigen sites, and manual optimization is carried out according to the codon preference of lactobacillus plantarum, so that an NC8-pSIP 409-pgsA' (ata) -HN-DCpep strain is successfully constructed and obtained. Experiments prove that the recombinant lactobacillus plantarum obtained by the invention not only can efficiently express HN antigen protein, but also has immunogenicity. Meanwhile, compared with the original starting strain NC8, the strain has better growth, fermentation and storage performances and the like, thereby having good practical application value.

Specifically, the technical scheme of the invention is as follows:

in a first aspect of the invention, the invention provides a recombinant lactobacillus plantarum expressing newcastle disease virus antigen genes, in particular a lactobacillus plantarum comprising HN and DCpep gene segments.

Wherein, HN is a sequence of a gene (HN) of a coding hemagglutinin-neuraminidase in a VII strain of the Newcastle disease virus; the DCpep is a DC cell targeting peptide sequence.

Preferably, in order to improve the function of the protein coded by the exogenous gene outside the recombinant lactobacillus plantarum cell, the recombinant lactobacillus plantarum of the invention is also introduced with a pgsA' gene fragment; further preferably, the nucleotide sequence of pgsA' is shown in SEQ ID NO. 1. pgsA 'is a truncated anchor gene for pgsA, and the truncated anchor gene pgsA' does not reduce the expression of the foreign protein of interest.

Thus, in a particular embodiment of the invention, the recombinant lactobacillus plantarum is lactobacillus plantarum comprising pgsA', HN and DCpep gene segments.

More specifically, the pgsA ', HN and DCpep gene fragments are expressed in tandem, so that the nucleotide sequence of pgsA' -HN-DCpep is shown in SEQ ID NO. 2; furthermore, the amino acid sequence of the pgsA' -HN-DCpep coding protein is shown as SEQ ID NO. 3.

In a second aspect of the present invention, there is provided a method for constructing the above recombinant lactobacillus plantarum, comprising:

s1, inserting the HN-DCpep fragment into an anchoring expression vector pSIP409-pgsA 'to construct a recombinant plasmid pSIP 409-pgsA' -HN-DCpep;

s2, transferring the recombinant plasmid of the step S1 into lactobacillus plantarum.

In the step S1, the nucleotide sequence of pgsA' -HN-DCpep is shown as SEQ ID NO. 2; furthermore, the amino acid sequence of the pgsA' -HN-DCpep coding protein is shown as SEQ ID NO. 3.

In the step S2, the lactobacillus plantarum is specifically lactobacillus plantarum NC8 Δ alr, and the strain is an alanine racemase gene (alr) deficient lactobacillus plantarum, is a food-grade lactic acid bacteria expression system, and is safe and reliable.

The recombinant lactobacillus plantarum obtained by the construction method is named as BLCC2-0394, and the characteristics of the recombinant lactobacillus plantarum BLCC2-0394 are as follows:

short rods, medium size, convex and slightly white edges are regular, gram staining is positive, and catalase test is negative, so that the lactobacillus plantarum shape is met.

The recombinant lactobacillus plantarum BLCC2-0394 is identified by enzyme digestion, and the recombinant plasmid thereof can be used for enzyme excision of a vector with about 6.2kb and a target band with 1.8kb and has a protective antigen HN fragment.

SDS-PAGE electrophoresis and Western blot detection show that the optimal inducer adding concentration in a laboratory is 100ng/mL, and the protein expression quantity of the added inducer is the highest when the inducer is cultured for 4.5 h; the optimal induction time is 6-8 h; the optimum induction temperature is 30 ℃.

Experiments prove that the recombinant lactobacillus plantarum BLCC2-0394 has strong acid resistance, and the survival rate of the recombinant lactobacillus plantarum treated for 3.5 hours under the condition of pH2.0 is more than 98%; has stronger bile salt resistance, the survival rate of the treated animal is 59.58 percent after being treated for 2 hours under 0.1 percent of bile salt, and the viable count is increased to 1.25 times after being treated for 6 hours. The acid and bile salt resistance is better than that of the original strain, namely lactobacillus plantarum NC 8. Meanwhile, experiments prove that the growth and fermentation performance of the recombinant lactobacillus plantarum BLCC2-0394 is also superior to that of lactobacillus plantarum NC8, so that the application of the recombinant lactobacillus plantarum BLCC2-0394 in actual industrial production is facilitated.

In a third aspect of the present invention, there is provided a fermentation production method of the above recombinant lactobacillus plantarum, comprising the step of supplementing sugar and alkali to a fermentation broth during fermentation of the above recombinant lactobacillus plantarum.

Specifically, in the liquid fermentation process, an inducer is added 4 hours after inoculation, alkali is supplemented 4-10 hours after inoculation, the pH value is adjusted to 4.5-6.0 by alkali supplementation, glucose is added, so that the final concentration of the glucose in the fermentation liquid is 1.0% -5.0%, and then natural fermentation is carried out. Under the fermentation condition, compared with a blank control group, the viable count of the small test production (20L) is increased by 47.56 percent; the viable count of the fermentation liquor produced in large scale (5 tons) is increased by 73.75%, and the expression of the target protein is more facilitated under the condition.

The optimal culture medium for the production of the recombinant lactobacillus plantarum is an MRS culture medium.

Preferably, the MRS medium consists of: 20g/L of glucose, 10g/L of peptone, 10g/L of beef extract, 5g/L of yeast extract, 0.5g/L of magnesium sulfate, 0.2g/L of manganese sulfate, 2g/L of ammonium citrate, 5g/L of sodium acetate, 801 ml/L of tween-801, pH value of 6.0 +/-0.05 and sterilization at 121 ℃ for 20 min.

In a fourth aspect of the present invention, there is provided a microbial preparation comprising the recombinant lactobacillus plantarum described in the first aspect above, or a fermentation product thereof, or a metabolite thereof.

The metabolite of the invention comprises a thallus intracellular metabolite and/or an extracellular metabolite.

The term "fermentate" is used to refer to a fermentation product. The corresponding fermentation product may be a liquid obtained from the process of fermentative culture of recombinant Lactobacillus plantarum BLCC2-0394 bacteria, and thus, may also be referred to as fermentation broth; the liquid may contain bacteria (bacteria cells), but does not necessarily need to contain bacteria. The liquid preferably contains metabolites produced by the recombinant Lactobacillus plantarum BLCC2-0394 bacteria of the invention.

And, in embodiments of the invention, the bacterial cells grown in the fermentation broth or culture broth are separated from the liquid by centrifugation, filtration, sedimentation, or other means known in the art, and the liquid remaining when the bacterial cells are removed is a "supernatant" (in embodiments of the invention, the supernatant is labeled as CFS), and in embodiments of the invention, the supernatant contains extracellular metabolites of BLCC 2-0394. In the embodiment of the present invention, the microbial agent may also contain the supernatant.

And, in the present embodiment, the fermentation liquid or culture liquid containing the bacterial cells is centrifuged, filtered, settled or separated from the liquid to obtain the bacterial cells, the bacterial cells can be disrupted by ultrasound (such as ultrasonic cell disruption in ice bath) or other means known in the art to obtain disrupted bacterial cells, or, further, the disrupted bacterial cells are centrifuged to collect the supernatant, which is referred to as cell-free extract (in the present embodiment, cell-free extract is referred to as CFE), and the disrupted bacterial cells or cell-free extract contains intracellular metabolites of the recombinant lactobacillus plantarum BLCC 2-0394. In the embodiment of the present invention, the microbial agent may contain a disrupted product or a cell-free extract of the microbial agent.

And, in the embodiment of the present invention, the microbial inoculum may also be a solid, and more preferably a freeze-dried powder, for the convenience of storage, transportation, improvement of the survival rate of the strain, and the like. The recombinant lactobacillus plantarum BLCC2-0394 or the fermentation product or the metabolite thereof is further subjected to freeze drying, and the freeze drying technology (including vacuum freeze drying technology) can be performed by adopting a conventional method, and is not described again.

Preferably, the lyophilization protecting agent is added during the lyophilization process to prevent denaturation of the protein or disruption of the membrane structure during the lyophilization process.

In an embodiment of the present invention, the lyoprotectant includes skim milk powder, sucrose, glycerin and water.

More specifically, the freeze-drying protective agent is composed of the following raw materials in parts by weight: 20-25 parts of skimmed milk powder, 5-10 parts of cane sugar, 0.5-2 parts of glycerol and 65-70 parts of water; preferably 22.5 parts of skimmed milk powder, 9 parts of cane sugar, 1 part of glycerol and 67.5 parts of water.

The recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder prepared by the method has the viable count of more than or equal to 58.00 multiplied by 10¹⁰cfu/g。

The freeze-dried bacterial powder has excellent normal-temperature storage performance and stronger storability, can be stored for 180 days at the temperature of minus 20 ℃, and has the survival rate of 86.64 percent; the survival rate is 66.60 percent after being stored for 180 days at 4 ℃; the survival rate is 66.07 percent after being stored for 60 days at 37 ℃; the survival rate is 59.60% after being stored for 90 days at normal temperature. The powder prepared from lactobacillus plantarum NC8 is stored at-20 deg.C for more than 90 days, 4 deg.C for more than 60 days, 37 deg.C for more than 15 days, and room temperature for more than 30 days, and the survival rate is reduced to below 50%. Therefore, the recombinant lactobacillus plantarum BLCC2-0394 has excellent storage performance.

In a fifth aspect of the present invention, the present invention provides the use of the recombinant lactobacillus plantarum described in the first aspect above and/or the microbial inoculum described in the fourth aspect above in the preparation of an antiviral product.

In a sixth aspect of the present invention, there is provided an antiviral product comprising the recombinant lactobacillus plantarum described in the first aspect above and/or the microbial inoculum described in the fourth aspect above.

The product may be an animal vaccine, feed additive or feed.

Further, the animal vaccine is a chicken vaccine, and the vaccine dosage form can be oral freeze-dried powder.

The virus may be a newcastle disease virus.

In a seventh aspect of the present invention, there is provided a use of the recombinant lactobacillus plantarum described in the first aspect, the microbial inoculum described in the fourth aspect, and/or the antiviral product described in the sixth aspect, in any one of:

1) activating immune cells of a body and/or preparing a product for activating the immune cells of the body;

2) inducing the body to generate higher HI antibody level and/or preparing a product for inducing the body to generate higher HI antibody level;

3) increasing serum IgG levels and/or preparing a product that increases serum IgG levels;

4) stimulating the intestinal mucosa and the tracheal mucosa to produce sIgA and/or preparing a product for stimulating the intestinal mucosa and the tracheal mucosa to produce sIgA.

The beneficial technical effects of one or more technical schemes are as follows:

the technical scheme successfully constructs the recombinant lactobacillus plantarum NC8-pSIP 409-pgsA' (ata) -HN-DCpep. Experiments prove that the recombinant lactobacillus plantarum obtained by the technical scheme can efficiently express the HN antigen protein and has immunogenicity. Compared with the original starting strain NC8, the lactobacillus plantarum freeze-dried powder has better growth, fermentation and storage performances and the like, and meanwhile, the recombinant lactobacillus plantarum freeze-dried powder is adopted to immunize SPF chicks, so that the safety performance is good, and large-dose immunization has no abnormal reaction to chickens. The immune performance of the mucous membrane of the organism can be obviously improved by adopting low-dose immunization, the anti-NDV-VII strain effect is achieved, the survival rate of the chickens after challenge reaches 71.6%, and therefore the anti-NDV-VII strain anti-virus live vaccine has good practical application value.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this application, illustrate embodiments of the application and, together with the description, serve to explain the application and are not intended to limit the application. Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 is a diagram showing the result of the digestion of the plasmid of Lactobacillus plantarum BLCC2-0394 according to one embodiment of the present invention; wherein, M: DL 10000; 1: recombinant lactobacillus plantarum BLCC2-0394 plasmid; 2: the recombinant lactobacillus plantarum BLCC2-0394 plasmid restriction identification result.

FIG. 2 is an under-view (10X 100) of a gram-stained ordinary optical microscope according to the second embodiment of the present invention.

FIG. 3 is a graph showing the effect of different inducer concentrations on the expression of a protein of interest in example two of the present invention; wherein, M: protein marker; protein expression of NC8 delta alr empty vector under the condition that the concentration of an inducer is 50 ng/mL; and the seventh step is the protein expression condition of the recombinant lactobacillus plantarum BLCC2-0394 under the condition that the concentration of the inducer is 0, 10, 25, 50, 100 and 200ng/mL respectively.

FIG. 4 is a graph showing the effect of different inducer addition times on the expression of a target protein in example two of the present invention; wherein, M: protein marker; sixthly, protein expression conditions are respectively expressed after the recombinant lactobacillus plantarum BLCC2-0394 is cultured for 3.0, 3.5, 4.0, 4.5, 5.0 and 5.5 hours after inoculation; and seventhly, NC8 delta alr empty vector is cultured for 3 hours after inoculation, and an inducer protein is added for expression.

FIG. 5 is a graph of the effect of two different induction periods on the expression of a protein of interest in accordance with the present invention; wherein, M: protein marker; (ninthly) the recombinant lactobacillus plantarum BLCC2-0394 induces the expression conditions of 16, 14, 12, 10, 8, 6, 4, 2 and 0h respectively.

FIG. 6 is a graph showing the effect of different culture temperatures on the expression of a target protein in the second embodiment of the present invention; wherein, M: protein marker; protein expression of NC8 delta alr empty vector at 30 deg.c inducing temperature; ② the protein expression condition of the recombinant lactobacillus plantarum BLCC2-0394 at 30 ℃ without induction; and the expression conditions of the recombinant lactobacillus plantarum BLCC2-0394 protein at the induction temperatures of 28, 30, 33 and 37 ℃ respectively.

FIG. 7 is a Western blot analysis chart of recombinant Lactobacillus plantarum BLCC2-0394 expression protein in example II of the present invention; wherein, 1: western blot analysis chart of recombinant lactobacillus plantarum BLCC2-0394 expression protein; 2: western blot analysis chart of NC8 delta alr empty vector expression protein; m: and (3) protein Marker.

FIG. 8 is a graph showing the survival rate of the recombinant Lactobacillus plantarum BLCC2-0394 in example III of the present invention at pH 2.0.

FIG. 9 is a graph showing the effect of different media on the growth performance of Lactobacillus plantarum NC8 and Lactobacillus plantarum BLCC2-0394 in example four.

FIG. 10 shows the fermentation liquid OD of the fourth example of the present invention, the recombinant Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8₆₀₀And (5) a value change trend graph.

FIG. 11 is a graph showing the trend of the pH value of the fermentation broth of the recombinant Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8 in the fourth embodiment of the present invention.

FIG. 12 is a graph showing the variation of viable count of fermentation broth of Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8 in the fourth embodiment of the present invention.

FIG. 13 shows the addition of an inducing agent to the fermentation broth OD of the recombinant Lactobacillus plantarum BLCC2-0394 at different times in the fourth embodiment of the present invention₆₀₀Influence graph of the values.

FIG. 14 is a graph showing the effect of one alkali supplementation on the viable count of the fermentation broth of Lactobacillus plantarum BLCC2-0394 in example four.

FIG. 15 is a graph showing the effect of alkali and sugar supplementation on the viable count of the fermentation broth of Lactobacillus plantarum BLCC2-0394 in example four.

FIG. 16 is a graph showing the effect of 5 ton fermentor alkali and sugar supplementation on the growth of recombinant Lactobacillus plantarum BLCC2-0394 in example four.

FIG. 17 is a graph showing the effect of alkali and sugar supplementation on the expression of target proteins of Lactobacillus plantarum BLCC2-0394 in example four of the present invention.

FIG. 18 is a graph showing the results of temperature storage test of the recombinant Lactobacillus plantarum BLCC2-0394 in example V of the present invention.

FIG. 19 is a diagram showing the results of the NCBI BLAST alignment in the sixth embodiment of the present invention.

FIG. 20 is a graph of the HI antibody levels in different chicks of example seven.

FIG. 21 is a graph showing serum IgG levels in groups of chickens in accordance with example seven of the present invention.

FIG. 22 is a graph showing sIgA levels in trachea and intestine mucus according to example seven of the present invention.

FIG. 23 is a diagram showing the results of the NCBI BLAST alignment in example eight of the present invention.

FIG. 24 is a graph of HI antibody titers (log2) for various groups of chickens in example eight of the present invention.

Detailed Description

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out according to conventional conditions or according to conditions recommended by the manufacturers.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. The reagents or starting materials used in the present invention can be purchased from conventional sources, and unless otherwise specified, the reagents or starting materials used in the present invention can be used in a conventional manner in the art or in accordance with the product specifications. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Example I construction of recombinant Lactobacillus plantarum BLCC2-0394

1 materials and methods

1.1 materials

1.1.1 Strain, plasmid vector

The virus strain VII of the Newcastle disease virus (NDV-VII NA-1) allantoic fluid, Lactobacillus plantarum NC8(Lactobacillus plantarum NC8), PUC Vector (pMD18-T Simple Vector), shuttle expression Vector (Escherichia coli/lactic acid bacteria) pSIP409, E.coli chi 6212 and plasmid pSIP 409-pgsA' -EGFP (ata) containing alanine racemase gene alr are constructed or stored in the laboratory of the King spring professor of Jilin agriculture university, so that the materials can be obtained from the laboratory of the King spring professor of Jilin agriculture university.

1.1.2 enzymes and Primary test reagents

Restriction enzymes (XbaI and Hind III), SppIP from Bao bioengineering Dalian, Inc.; t4 DNA ligase, DNA Marker (DL-2000,. lamda. -HindIII) purchased from Takara Bio Inc.; plasmid miniprep kit and DNA gel recovery and purification kit were purchased from Omega Bio-Tek, USA; 10 XM buffer, 10 XT 4 buffer, D-alanine and 2% Gly, formulated and stored by the Jilin university of agriculture laboratory.

1.1.3 culture Medium

LB E.coli liquid Medium: sodium chloride 10.0g/L, tryptone 10.0g/L, yeast extract 5.0g/L, 121 deg.C sterilization for 20 min. The solid culture medium needs 1.5% agar.

MRS culture medium: 20g/L of glucose, 10g/L of peptone, 10g/L of beef extract, 5g/L of yeast extract, 0.5g/L of magnesium sulfate, 0.2g/L of manganese sulfate, 2g/L of ammonium citrate, 5g/L of sodium acetate, 801 ml/L of tween-801, pH value of 6.0 +/-0.05 and sterilization at 121 ℃ for 20 min. The solid culture medium needs 1.2% agar.

1.1.4 electrotransformation solution

And (3) electric shock buffer solution: MgCl₂0.029g, sucrose 34.21g, dH₂O80 mL, adjusting the pH of the solution to 7.4 with dilute hydrochloric acid, adding distilled water to a constant volume of 100mL, sterilizing at 121 ℃ for 20min, and storing at-20 ℃ for later use.

Washing buffer solution: na (Na)₃PO₄ 0.19g、MgCl₂ 0.009g；dH₂Adjusting pH to 7.4 with diluted hydrochloric acid (O80 mL), adding distilled water to 100mL, sterilizing at 121 deg.C for 20min, and storing at-20 deg.C for use.

1.1.5 SDS-PAGE reagents

5 × electrophoresis buffer (pH 8.3): 94.0g of glycine, 15.1g of Tris base, 50.0mL of 10% SDS, dH₂O600 mL, adjusting the pH to 8.3, adding distilled water to a constant volume of 1000mL, subpackaging for later use, and diluting by 5 times.

1.5mol/L Tris. Cl (pH 8.8): and (3) fully dissolving 18.15g of Tris alkali by using a proper amount of distilled water, adjusting the pH value to 8.8, adding distilled water to a constant volume of 100mL, sterilizing at 121 ℃ for 20min, and storing at 4 ℃ for later use.

1.0mol/L Tris. Cl (pH 6.8): tris alkali 6.0g, fully dissolved with a proper amount of distilled water, pH adjusted to 6.8, added with distilled water to constant volume to 100mL, sterilized at 121 ℃ for 20min, and stored at 4 ℃ for later use.

1 × SDS loading buffer: 10.0mL of glycerin, 2.0g of SDS, 1.0mL of DTT, 0.1g of bromophenol blue and 0.6055g of Tris alkali are fully dissolved by proper amount of distilled water, the pH value is adjusted to 6.8, the distilled water is added to the solution until the volume is 100mL, and the solution is subpackaged for standby application.

Dyeing liquid: 500mL of isopropanol, R-2502.5 g of Coomassie brilliant blue, 100mL of glacial acetic acid, adding distilled water to reach the constant volume of 1000mL, and subpackaging for later use.

1mol/L Dithiothreitol (DTT): 3.09g of DTT and 20mL of NaAc were dissolved sufficiently, and then they were sterilized by filtration through a filter (0.22 μm), and then they were stored at-20 ℃ for further use after being dispensed.

Decoloring liquid: 50mL of absolute ethyl alcohol and 100mL of glacial acetic acid, adding distilled water to reach the constant volume of 1000mL, and subpackaging for later use.

Gel preservation solution: 7mL of glacial acetic acid, adding distilled water to a constant volume of 100mL, storing at normal temperature, and subpackaging for later use.

Sealing liquid: PBS 20mL and BSA 0.3g, can be used after being fully dissolved, and is prepared as before.

1.1.6 other solutions

Agarose gel (0.8%): 1 XTAE 100mL, agarose 0.8g, microwave oven heating until completely dissolved, cooling to about 70 deg.C, adding EB 5 μ L, mixing, pouring into gel plate, and completely solidifying.

20mg/mL SppIP：SppIP 0.1g、ddH₂O4 mL, adding distilled water to a constant volume of 5mL, filtering and sterilizing with a filter (0.22 μm), subpackaging, and storing at-20 ℃.

1.2 methods

1.2.1 selection and optimized Synthesis of protective antigen fragments

The invention takes NDV-VII strain NA-1 as a reference sequence, selects a hemagglutinin-neuraminidase gene (HN) sequence in the NA-1 strain, and is optimally synthesized by Jinzhi corporation of Suzhou according to the expression codon of lactobacillus plantarum. Simultaneously, a DC cell targeting peptide (DCpep) sequence (TTCTACCCATCATACCATTCAACTCCACAACGTCCA, SEQ ID NO.4) is placed at the 3' end of the HN optimized gene, and the HN-DCpep sequence is synthesized and then inserted into a cloning vector pUC to obtain pUC-HN-DCpep;

1.2.2 digestion and recovery of HN-DCpep fragment

Carrying out PCR on plasmid pUC-HN-DCpep containing HN gene of NDV-VII strain NA-1 of target fragment gene by using primer HN-XbaI-F/HN-Hind III-DCpep-R, recovering the product by using a glue recovery kit after electrophoresis, carrying out double digestion on the recovered product by using XbaI/Hind III, and recovering the digested product by using a DNA purification kit to obtain the target fragment HN-DCpep.

The primer sequence is as follows:

HN-XbaI-F：ATATCTAGAATGGACCGCGCCGTTAGCC(SEQ ID NO.5)

HN-HindⅢ-DCpep-R：

ATTAAGCTTCTATGGACGTTGTGGAGTTGAATGGTATGATGGGTAGAAGCCAGACCTGGCTTCTCT(SEQ ID NO.6)

the PCR system was as follows: prime STAR Max 50 μ L, ddH₂O44. mu.L, forward primer F2. mu.L, reverse primer R2. mu.L, template 2. mu.L (10X). The reaction conditions are as follows: pre-denaturation at 98 deg.C for 20s, denaturation at 98 deg.C for 10s, and annealing at 50 deg.C5s, extension at 72 ℃ for 30s for 30 cycles.

The enzyme digestion system is as follows: PCR recovery product 40. mu.L, 10 XM buffer 5. mu. L, Hind III 2.5. mu. L, XbaI 2.5.5. mu.L, enzyme digestion overnight in water bath at 37 ℃, and recovery of the carrier after product electrophoresis by using gel recovery kit.

1.2.3 digestion and recovery of the vector fragment containing pSIP 409-pgsA' (ata)

A plasmid pSIP409-pgsA '(ata) containing the expression vector pSIP 409-pgsA' (ata) was used as a base plasmid, and HindIII and XbaI were used for double digestion. The enzyme digestion system is as follows: pSIP 409-pgsA' -EGFP (ata)40 mu L and 10 XM buffer 5 mu L, Hind III 2.5 mu L, XbaI 2.5.5 mu L are put into a water bath kettle at 37 ℃ for enzyme digestion overnight, and the carrier is recovered by using a gel recovery kit after electrophoresis.

1.2.4 ligation of the HN-DCpep fragment and the pSIP 409-pgsA' (ata) vector fragment

Connecting an antibiotic-free label expression vector pSIP 409-pgsA' (ata) with a target fragment HN-DCpep by using T4, wherein the DNA connection reaction system is as follows: vector 1.5. mu. L, HN fragment 7. mu. L, T4 ligase 0.5. mu.L, 10 XT 4 buffer 1. mu.L, placed in a 16 ℃ metal bath for ligation overnight.

1.2.5 transformation of ligation products into E.coli chi 6212 competent

Transforming the connecting product into an escherichia coli chi 6212 electrotransformation competence, and coating 100 mu L of bacterial liquid on an LB flat plate after transformation; the colonies were picked the next day and subjected to sequencing verification of the upgraded plasmid, and the resulting positive plasmid was named pSIP 409-pgsA' (ata) -HN-DCpep.

1.2.6 obtaining and identifying the competence of Lactobacillus plantarum

(1) Inoculating lactobacillus plantarum NC8 delta alr frozen at-80 ℃ into 5mL of MRS culture solution containing D-alanine (0.2mg/mL), and culturing overnight under anaerobic condition at 30 ℃;

(2) inoculating a proper amount of bacterial liquid on an MRS solid culture medium containing D-alanine (0.2mg/mL), and culturing at 30 ℃ under an anaerobic condition until a single colony with a good growth state grows out for about 36-48 h;

(3) inoculating 5mL of MRS liquid medium (containing 2% Gly) containing D-alanine (0.2mg/mL) to the well-grown single colony, and culturing at 30 deg.C under anaerobic conditionUntil the OD of the bacterial liquid₆₀₀A value of 0.6;

(4) inoculating 20mL MRS liquid culture medium (containing 2% Gly) containing D-alanine (0.2mg/mL) to culture 30 μ L of the above bacterial liquid, and culturing at 30 deg.C under anaerobic condition until bacterial liquid OD₆₀₀A value of 0.4;

(5) OD was incubated in ice bath₆₀₀Centrifuging the bacterial solution with the value of 0.4 for 10min at the temperature of 4 ℃ at the speed of 5000r/min, and collecting bacterial precipitation;

(6) resuspending the thallus precipitate with ice-cold 2mL of washing buffer solution, centrifuging at 4 deg.C for 10min at 5000r/min, washing twice, and collecting thallus precipitate;

(7) the pellet was resuspended in ice-cold 400. mu.L shock buffer and then 100. mu.L/tube was dispensed for use after 10min in ice bath.

1.2.7 electrotransformation of Lactobacillus plantarum NC8 Δ alr

(1) Adding 5 mu L of recombinant plasmid pSIP 409-pgsA' (ata) -HN-DCpep into 100 mu L of lactobacillus infected state in two-tube ice bath, gently mixing uniformly, transferring into an electric shock cup precooled in advance at a distance of 0.2cm, standing for 5min in ice bath, and then placing into an electric converter (2.5Kv,6ms) for electric shock;

(2) immediately standing and ice-bathing for 5min after the electric conversion is finished, adding the liquid in an electric shock cup into 800mL of MRS culture solution preheated at 30 ℃, and culturing for 3h under the anaerobic condition at 30 ℃;

(3) and uniformly coating 100 mu L of the bacterial liquid on an MRS solid culture medium, and culturing at 30 ℃ under an anaerobic condition until a single colony with a good growth state grows out for about 36-48 h.

1.2.8 extraction and identification of recombinant lactobacillus plantarum plasmid

Inoculating lactobacillus single colony with good state into MRS culture solution, culturing overnight at 30 deg.C under anaerobic condition, and performing plasmid extraction with plasmid miniprep kit (gram positive bacteria). And carrying out double enzyme digestion and PCR identification on the extracted grains respectively. The extracted plasmid was digested with Hind III and XbaI to determine whether it contained the desired band.

1.2.9 recombinant Lactobacillus plantarum Glycerol tube preservation

Selecting a single colony of the recombinant lactobacillus plantarum with positive identification, inoculating the single colony to a fresh sterilized MRS liquid culture medium, standing and culturing at 30 ℃ overnight, carrying out microscopic examination on the bacteria liquid without mixed bacteria, adding 30% of glycerol at a ratio of 1:1, and storing at-80 ℃.

2 results

2.1 pgsA' nucleotide sequence (SEQ ID NO.1)

ATGGGCAAGAAAGAATTAAGTTTCCACGAGAAGTTATTAAAATTGACTAAACAACAAAAAAAGAAGACTAACAAGCATGTGTTTATTGCTATTCCAATTGTTTTCGTTTTAATGTTTGCTTTTATGTGGGCAGGTAAAGCTGAGACTCCAAAAGTTAAGACTTATAGTGATGACGTTTTGAGTGCTTCATTTGTCGGCGACATTATGATGGGTCGTTACGTTGAGAAAGTCACGGAACAAAAGGGTGCAGATAGTATTTTCCAATATGTTGAACCGATTTTCCGTGCTAGTGATTATGTTGCTGGCAATTTTGAAAATCCTGTTACTTATCAGAAAAACTACAAACAAGCTGATAAAGAGATTCATTTACAGACTAATAAGGAAAGTGTTAAAGTTTTAAAGGATATGAATTTTACTGTCTTAAATAGTGCTAATAATCATGCTATGGATTATGGTGTTCAAGGTATGAAAGATACGTTAGGTGAGTTTGCTAAACAGAATTTAGATATTGTTGGTGCTGGTTATTCATTAAGTGACGCTAAGAAGAAAATTAGTTACCAGAAAGTGTCTAGA

2.2 pgsA' -HN-DCpep nucleotide sequence (SEQ ID NO.2)

ATGGGCAAGAAAGAATTAAGTTTCCACGAGAAGTTATTAAAATTGACTAAACAACAAAAAAAGAAGACTAACAAGCATGTGTTTATTGCTATTCCAATTGTTTTCGTTTTAATGTTTGCTTTTATGTGGGCAGGTAAAGCTGAGACTCCAAAAGTTAAGACTTATAGTGATGACGTTTTGAGTGCTTCATTTGTCGGCGACATTATGATGGGTCGTTACGTTGAGAAAGTCACGGAACAAAAGGGTGCAGATAGTATTTTCCAATATGTTGAACCGATTTTCCGTGCTAGTGATTATGTTGCTGGCAATTTTGAAAATCCTGTTACTTATCAGAAAAACTACAAACAAGCTGATAAAGAGATTCATTTACAGACTAATAAGGAAAGTGTTAAAGTTTTAAAGGATATGAATTTTACTGTCTTAAATAGTGCTAATAATCATGCTATGGATTATGGTGTTCAAGGTATGAAAGATACGTTAGGTGAGTTTGCTAAACAGAATTTAGATATTGTTGGTGCTGGTTATTCATTAAGTGACGCTAAGAAGAAAATTAGTTACCAGAAAGTGTCTAGAATGGACCGCGCCGTTAGCCAAGTTGCGTTAGAGAATGATGAAAGAGAGGCAAAAAATACATGGCGCTTGATATTCCGGATTGCAATCTTATTCTTAACAGTAGTGACCTTGGCTATATCTGTAGCCTCCCTTTTATATAGCATGGGGGCTAGCACACCTAGCGATCTTGTAGGCATACCGACTAGGATTTCCAGGGCAGAAGAAAAGATTACATCTACACTTGGTTCCAATCAAGATGTAGTAGATAGGATATATAAGCAAGTGGCCCTTGAGTCTCCGTTGGCATTGTTAAAAACTGAGACCACAATTATGAACGCAATAACATCTCTCTCTTATCAGATTAATGGAGCTGCAAACAACAGTGGGTGGGGGGCACTTATCCATGACCCAGATTATATAGGGGGGATAGGCAAAGAACTCATTGTAGATGATGCTAGTGATGTCACATCATTCTATCCCTCTGCATTTCAAGAACATCTGAATTTTATCCCGGCGCCTACTACAGGATCAGGTTGCACTCGAATACCCTCATTTGACATGAGTGCTACCCATTACTGCTACACCCATAATGTAATATTGTCTGGATGCAGAGATCACTCACATTCATATCAGTATTTAGCACTTGGTGTGCTCCGGACATCTGCAACAGGGAGGGTATTCTTTTCTACTCTGCGTTCCATCAACCTGGACGACACCCAAAATCGGAAGTCTTGCAGTGTGAGTGCAACTCCCCTGGGTTGTGATATGCTGTGCTCGAAAGTCACGGAGACAGAGGAAGAAGATTATAACTCAGCTGTCCCTACGCGGATGGTACATGGGAGGTTAGGGTTCGACGGCCAGTACCACGAAAAGGACCTAGATGTCACAACATTATTCGGGGACTGGGTGGCCAACTACCCAGGAGTAGGGGGTGGATCTTTTATTGACAGCCGCGTATGGTTCTCAGTCTACGGAGGGTTAAAACCCAATTCACCCAGTGACACTGTACAGGAAGGGAAATATGTGATATACAAGCGATACAATGACACATGCCCAGATGAGCAAGACTACCAGATTCGAATGGCCAAGTCTTCGTATAAGCCTGGACGGTTTGGTGGGAAACGCATACAGCAGGCTATCTTATCTATCAAGGTGTCAACATCCTTAGGCGAAGACCCGGTACTGACTGTACCGCCCAACACAGTCACACTCATGGGGGCCGAAGGCAGAATTCTCACAGTAGGGACATCTCATTTCTTGTATCAACGAGGGTCATCATACTTCTCTCCCGCGTTATTATATCCTATGACAGTCAGCAACAAAACAGCCACTCTTCATAGTCCTTATACATTCAATGCCTTCACTCGGCCAGGTAGTATCCCTTGCCAGGCTTCAGCAAGATGCCCCAACCCGTGTGTTACTGGAGTCTATACAGATCCATATCCCCTAATCTTCTATAGAAACCACACCTTGCGAGGGGTATTCGGGACAATGCTTGATGGTGTACAAGCAAGACTTAACCCTGCGTCTGCAGTATTCGATAGCACATCCCGCAGTCGCATTACTCGAGTGAGTTCAAGCAGTACCAAAGCAGCATACACAACATCAACTTGTTTTAAAGTGGTCAAGACTAATAAGACCTATTGTCTCAGCATTGCTGAAATATCTAATACTCTCTTCGGAGAATTCAGAATCGTCCCGTTACTAGTTGAGATCCTCAAAGATGACGGGGTTAGAGAAGCCAGGTCTGGCTTCTACCCATCATACCATTCAACTCCACAACGTCCATTCTACCCATCATACCATTCAACTCCACAACGTCCATAG

2.3 pgsA' -HN-DCpep amino acid sequence (SEQ ID NO.3)

MGKKELSFHEKLLKLTKQQKKKTNKHVFIAIPIVFVLMFAFMWAGKAETPKVKTYSDDVLSASFVGDIMMGRYVEKVTEQKGADSIFQYVEPIFRASDYVAGNFENPVTYQKNYKQADKEIHLQTNKESVKVLKDMNFTVLNSANNHAMDYGVQGMKDTLGEFAKQNLDIVGAGYSLSDAKKKISYQKVSRMDRAVSQVALENDEREAKNTWRLIFRIAILFLTVVTLAISVASLLYSMGASTPSDLVGIPTRISRAEEKITSTLGSNQDVVDRIYKQVALESPLALLKTETTIMNAITSLSYQINGAANNSGWGALIHDPDYIGGIGKELIVDDASDVTSFYPSAFQEHLNFIPAPTTGSGCTRIPSFDMSATHYCYTHNVILSGCRDHSHSYQYLALGVLRTSATGRVFFSTLRSINLDDTQNRKSCSVSATPLGCDMLCSKVTETEEEDYNSAVPTRMVHGRLGFDGQYHEKDLDVTTLFGDWVANYPGVGGGSFIDSRVWFSVYGGLKPNSPSDTVQEGKYVIYKRYNDTCPDEQDYQIRMAKSSYKPGRFGGKRIQQAILSIKVSTSLGEDPVLTVPPNTVTLMGAEGRILTVGTSHFLYQRGSSYFSPALLYPMTVSNKTATLHSPYTFNAFTRPGSIPCQASARCPNPCVTGVYTDPYPLIFYRNHTLRGVFGTMLDGVQARLNPASAVFDSTSRSRITRVSSSSTKAAYTTSTCFKVVKTNKTYCLSIAEISNTLFGEFRIVPLLVEILKDDGVREARSGFYPSYHSTPQRPFYPSYHSTPQRP.

2.4 enzyme digestion identification of recombinant Lactobacillus plantarum

The plasmid extracted from the recombinant lactobacillus plantarum can be used for enzyme digestion of a vector with about 6.2kb and a target band with 1.8kb, and the result is consistent with the expectation and is shown in figure 1, which proves that the strain contains a protective antigen HN fragment.

2.5 recombinant Lactobacillus plantarum Glycerol tube preservation

The single colony of the recombinant lactobacillus plantarum with positive identification is named as the recombinant lactobacillus plantarum BLCC 2-0394.

EXAMPLE two morphological analysis and immunogenicity analysis of recombinant Lactobacillus plantarum BLCC2-0394

1 materials and methods

1.1 materials

The strain is as follows: the recombinant lactobacillus plantarum BLCC2-0394 obtained in the first embodiment of the invention.

Culture medium: MRS culture medium: 20g/L of glucose, 10g/L of peptone, 10g/L of beef extract, 5g/L of yeast extract, 0.5g/L of magnesium sulfate, 0.2g/L of manganese sulfate, 2g/L of ammonium citrate, 5g/L of sodium acetate, 801 ml/L of tween-801, pH value of 6.0 +/-0.05 and sterilization at 121 ℃ for 20 min. The solid culture medium needs 1.2% agar.

1.2 methods

1.2.1 morphological analysis

10 μ L of recombinant Lactobacillus plantarum BLCC2-0394 glycerol tube stock solution was spread on MRS agar plates and cultured at 30 ℃ for 48 h. Typical single colonies of lactobacilli (short rods, medium size, raised, slightly white with regular edges) grown on the plates were picked for gram staining and catalase testing.

1.2.2 recombinant Lactobacillus plantarum BLCC2-0394 optimal inducer concentration screening

Inoculating 0.5mL of positive recombinant Lactobacillus plantarum BLCC2-0394 glycerol tube stock solution into 100mL of MRS culture medium, culturing at 30 deg.C overnight, inoculating 2% of the stock solution into fresh sterilized MRS culture medium, and culturing for 3 hr (OD₆₀₀About 0.3) adding different amounts of inducer, the final concentration of the inducer is 0,10. 25, 50, 100 and 200 ng/mL. Meanwhile, the induction culture of empty vector lactobacillus plantarum NC8 Δ alr without antigen gene added under the condition of inducer concentration of 50ng/mL was used as a control. After 16h of induction, the bacterial pellets of each group were collected and resuspended in PBS to adjust the OD of each group of bacterial suspensions₆₀₀When the values were uniform, 20mL of the solution was subjected to ultrasonication and the like.

The concrete conditions are as follows: ultrasonic power is 300W, ultrasonic is 2s, the interval is 5s, each sample is subjected to ultrasonic treatment for 20min, ammonium sulfate with final concentration of 0.35g/mL is added after the ultrasonic treatment is finished, the mixture is kept stand at 4 ℃ overnight, 12000g is centrifuged for 10min at 4 ℃ the next day, the supernatant is discarded, the precipitate is resuspended by 300 mu L PBS, 12000g is centrifuged for 10min at 4 ℃, the supernatant is uniformly mixed with 4 Xprotein loading buffer solution, the mixture is boiled for 10min, rapidly ice-bathed for 5min, and then is centrifuged for 3min at 12000g, 20 mu L of supernatant is loaded, and the protein standard molecular weight is used as a reference for electrophoretic analysis on 12% SDS-PAGE.

1.2.3 recombinant Lactobacillus plantarum BLCC2-0394 optimal inducer addition time Screen

Inoculating 0.5mL of positive recombinant Lactobacillus plantarum BLCC2-0394 glycerol tube stock solution in 100mL of MRS culture medium, culturing at 30 deg.C overnight, inoculating 2% of the stock solution in fresh sterilized MRS culture medium, standing at 30 deg.C, and culturing for 3 hr (OD)₆₀₀≈0.489)、3.5h(OD₆₀₀≈0.545)、4.0h(OD₆₀₀≈0.630)、4.5h(OD₆₀₀≈0.793)、5.0h(OD₆₀₀≈0.981)、5.5h(OD₆₀₀Approximatively 1.274), adding the same amount of inducer (final concentration 100ng/mL), and taking a sample after inducing for 6h by taking a group without the inducer as a control, and carrying out pretreatment such as centrifugation and ultrasonic disruption, and the treatment and detection conditions are the same as those of example two 1.2.2.

1.2.4 screening for optimal Induction Length for recombinant Lactobacillus plantarum BLCC2-0394

Inoculating 0.5mL of positive recombinant lactobacillus plantarum BLCC2-0394 glycerol tube storage solution into 100mL of MRS culture medium, culturing overnight at constant temperature of 30 ℃, inoculating 2% of the inoculation amount into a fresh sterilized MRS culture medium, performing static culture at 30 ℃, adding the same amount of inducer (the final concentration is 100ng/mL) after culturing for 3h, sampling once every 2h, co-culturing for 16h, performing centrifugation, ultrasonic disruption and other treatment, wherein the treatment and detection conditions are the same as those in example II 1.2.2.

1.2.5 screening of optimal Induction temperature for recombinant Lactobacillus plantarum BLCC2-0394

Inoculating 0.5mL of positive recombinant lactobacillus plantarum BLCC2-0394 glycerol tube storage solution into 100mL of MRS culture medium, culturing at 30 ℃ for overnight at constant temperature, transferring 2% of inoculum size to the fresh sterilized MRS culture medium, performing static culture at 30 ℃, adding the same amount of inducer (final concentration of 100ng/mL) after culturing for 3h, respectively culturing at 28 ℃, 30 ℃, 33 and 37 ℃ statically, continuing to culture and induce for 6h, sampling, performing pretreatment such as centrifugation and ultrasonic disruption, and performing treatment and detection under the same conditions as example two 1.2.2.

SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) electrophoresis and Western blot detection method for 1.2.6 target protein

Soaking PAGE gel for dyeing in Coomassie brilliant blue dyeing solution, dyeing on a shaking table for 30-45min, soaking the gel in a decolorizing solution, decolorizing for 2-4h, and changing the decolorizing solution for several times until clear bands appear. The PAGE gel used for transfer was transferred by a transfer system as described above, and transferred by a Biorad 1645050 transfer apparatus at a constant current of 300mA for 60min, and the transferred film was taken out. Transferring the transferred PVDF membrane into a sealing solution to seal for 1h at 37 ℃; then, diluting the rabbit anti-newcastle disease hemagglutinin-neuraminidase antibody according to the ratio of 1:100 to be used as a primary antibody, and reacting at 4 ℃ overnight; washing membrane with PBST for 10min 3 times; diluting a secondary antibody HRP-labeled goat anti-rabbit IgG at a ratio of 1:5000, and shaking for 1h in a shaking table at room temperature; washing membrane with PBST for 10min 3 times; observations were made using a hypersensitivity ECL chemiluminescence kit (available from bi yun sky biotechnology limited) and a day-energy chemiluminescence imaging system.

2 results

2.1 morphological analysis

Gram staining is positive, a microscopic examination picture (figure 2) shows that the bacterial body is rod-shaped or chain rod-shaped, and a catalase test is negative, which accords with the shape of the lactobacillus plantarum.

2.2 recombinant Lactobacillus plantarum BLCC2-0394 optimal inducer concentration Screen

Protein electrophoresis of an expression sample of the recombinant lactobacillus plantarum BLCC2-0394 with positive enzyme digestion identification shows that a BLCC2-0394 strain has a band near the 90kDa size, and an NC8 delta alr empty vector strain does not have a corresponding band. The result shows that the recombinant lactobacillus plantarum BLCC2-0394 can express HN antigen protein and the protein has immunogenicity. As can be seen from FIG. 3, the optimal inducer addition concentration was 100 ng/mL.

2.3 recombinant Lactobacillus plantarum BLCC2-0394 optimal inducer addition time Screen

As can be seen from FIG. 4, the recombinant Lactobacillus plantarum BLCC2-0394 can successfully express the target protein when cultured for 3.0-5.5h after inoculation after addition of the inducer, and the difference of the protein expression level at each time point is not significant from the expression protein band, so that the protein expression level when the recombinant Lactobacillus plantarum BLCC2-0394 is cultured for 4.5h (near the middle of logarithmic growth phase) is relatively high when the recombinant Lactobacillus plantarum BLCC is cultured for 4.5 h.

2.4 screening for optimal Induction Length of recombinant Lactobacillus plantarum BLCC2-0394

As can be seen from FIG. 5, the recombinant Lactobacillus plantarum BLCC2-0394 can successfully express the target protein 2-16h after the addition of the inducer, and the optimal induction time is 6-8h from the viewpoint of protein expression, and the protein expression level is relatively high.

2.5 screening of optimal Induction temperature for recombinant Lactobacillus plantarum BLCC2-0394

As can be seen from FIG. 6, the optimal induction temperature of the recombinant Lactobacillus plantarum BLCC2-0394 is 30 ℃.

2.6 Western blot detection result of target protein

The recombinant lactobacillus plantarum expression sample with positive enzyme digestion identification is subjected to membrane transfer and then is specifically combined with a rabbit anti-newcastle disease hemagglutinin-neuraminidase antibody (figure 7), and the further demonstration that the recombinant lactobacillus plantarum BLCC2-0394 can express HN antigen protein and the protein has immunogenicity is provided.

EXAMPLE III analysis of the biological Properties of recombinant Lactobacillus plantarum BLCC2-0394

1 materials and methods

1.1 materials

1.2 methods

1.2.1 acid resistance test of recombinant Lactobacillus plantarum BLCC2-0394

Inoculating 0.5mL of recombinant lactobacillus plantarum BLCC2-0394 glycerol tube storage solution into 100mL of MRS culture medium, culturing at 30 ℃ for overnight at constant temperature, transferring 2% of inoculum size to fresh sterilized MRS culture medium, standing at 30 ℃ for culturing for overnight, taking 5mL of bacterial solution, centrifuging at 3000r/min under aseptic condition for 15min, discarding supernatant, washing thallus with sterilized normal saline for 3 times, adding 5mL of sterilized normal saline, fully suspending, inoculating into sterilized normal saline with pH values of 1.24 and 2.0 respectively according to 1% (v/v) inoculum size, standing at 30 ℃ for 0, 1, 2 and 3.5h, taking bacterial suspension, detecting viable count of bacterial suspension by using a gradient dilution plate counting method, and taking sterilized normal saline with natural pH as a reference. Meanwhile, the acid resistance of the plasmid-free Lactobacillus plantarum NC8 was examined under the same conditions and compared with that of the recombinant Lactobacillus plantarum BLCC 2-0394.

The survival rate is the viable count of bacteria solution with the pH to be measured/the viable count of physiological saline with natural pH multiplied by 100.

1.2.2 recombinant Lactobacillus plantarum BLCC2-0394 bile salt resistance test

Taking fresh activated recombinant lactobacillus plantarum BLCC2-0394, inoculating the strain into MRS culture media with pig bile salt concentrations of 0.1% and 0.2% (w/v) respectively according to the inoculation amount of 5% (v/v), standing and culturing at 30 ℃, uniformly mixing and sampling at different times, performing viable count on a treated sample by using a gradient dilution plate counting method, and calculating the tolerance condition of the strain to bile salts with different concentrations by using the viable count before adding the bile salts as a base number. Meanwhile, the tolerance of the plasmid-free lactobacillus plantarum NC8 to different concentrations of bile salts was tested under the same conditions and compared with the recombinant lactobacillus plantarum BLCC 2-0394.

2 results

2.1 acid resistance results

TABLE 1 Lactobacillus plantarum NC8 acid resistance test

As can be seen from Table 1, the viable count of the lactobacillus plantarum NC8 can not be detected under the acidic environment with the pH value of 1.24, the survival rate of the lactobacillus plantarum NC8 after being treated under the acidic environment with the pH value of 2.0 for 3.5 hours is over 80 percent, and the lactobacillus plantarum NC8 has better acid resistance.

TABLE 2 recombinant Lactobacillus plantarum BLCC2-0394 acid resistance test

As can be seen from Table 2 and FIG. 8, the recombinant Lactobacillus plantarum BLCC2-0394 was sensitive to an acidic environment at pH 1.24 and was substantially non-viable. The strain has strong adaptability to an acid environment with the pH of 2.0, the viable count after inoculation for 1h tends to be reduced, but the viable count gradually increases along with the prolonging of time, and the survival rate of the strain reaches more than 98 percent after the strain is treated under the condition of the pH of 2.0 for 3.5h, so that the strain is proved to have better acid resistance, and the acid resistance is better than that of lactobacillus plantarum NC 8.

2.2 results against bile salts

The viable count of Lactobacillus plantarum NC8 before the bile salt is added is 2.47x10⁸cfu/mL, the viable count of the recombinant lactobacillus plantarum BLCC2-0394 before the bile salt is added is 2.87 multiplied by 10⁸cfu/mL。

TABLE 3 Lactobacillus plantarum NC8 and Lactobacillus plantarum BLCC2-0394 bile salt tolerance assay

As can be seen from Table 3, the Lactobacillus plantarum NC8 has poor tolerance under 0.2% bile salt environment, has certain tolerance under 0.1% bile salt environment, and has the survival rate of 50% -99%. The tolerance of the recombinant lactobacillus plantarum BLCC2-0394 to bile salts is stronger than that of lactobacillus plantarum NC8, the survival rate of the lactobacillus plantarum is 59.58% after the lactobacillus plantarum is treated for 2 hours in a 0.1% bile salt environment, the viable count of the strain tends to increase after the lactobacillus plantarum is treated for 6 hours, and the viable count of the lactobacillus plantarum 6 hours is 1.25 times of the viable count of the lactobacillus plantarum during inoculation.

EXAMPLE four determination of fermentation Process for recombinant Lactobacillus plantarum BLCC2-0394

1 Effect of different media on the growth Performance of recombinant Lactobacillus plantarum BLCC2-0394

1.1 materials and methods

1.1.1 materials

The strain is as follows: the recombinant lactobacillus plantarum BLCC2-0394 obtained in the first embodiment of the invention; lactobacillus plantarum NC8, stored in the laboratory of professor's group Wangchunfeng, Jilin university of agriculture.

MRS culture medium: 20g/L of glucose, 10g/L of peptone, 10g/L of beef extract, 5g/L of yeast extract, 0.5g/L of magnesium sulfate, 0.2g/L of manganese sulfate, 2g/L of ammonium citrate, 5g/L of sodium acetate, 801 ml/L of tween-801, pH value of 6.0 +/-0.05 and sterilization at 121 ℃ for 20 min.

Improving MRS culture medium: 39.2g/L glucose, 18.7g/L peptone, 7.5g/L yeast extract, 0.09g/L magnesium sulfate, 0.05g/L manganese sulfate, 4.6g/L sodium acetate, 2.0g/L dipotassium hydrogen phosphate, 10g/L light calcium carbonate and 803.4 g/L Tween, the pH value is natural, and the sterilization is carried out for 20min at 121 ℃.

1.1.2 methods

Respectively inoculating the activated recombinant lactobacillus plantarum BLCC2-0394 into 200mL of MRS culture medium and improved MRS culture medium according to the inoculation amount of 4%, culturing at 30 deg.C, sampling at regular intervals, and detecting viable count and OD of lactobacillus in the MRS and improved MRS culture medium₆₀₀Values, pH values, and growth curves were plotted.

At the same time, the growth curves of Lactobacillus plantarum NC8 in both media were examined and compared with that of recombinant Lactobacillus plantarum BLCC 2-0394.

1.2 analysis of results

TABLE 4 Effect of different media on NC8 and BLCC2-0394 growth Performance (cfu/mL)

As can be seen from table 4 and fig. 9, the MRS medium is more suitable for the growth of lactobacillus plantarum NC8 and recombinant lactobacillus plantarum BLCC2-0394 than the modified MRS medium. The growth conditions are basically consistent in the first 8h after inoculation, but after 8h, the two culture media gradually enter a stable period and show larger difference. The viable count of the lactobacillus plantarum NC8 bacterial liquid in the stationary phase is (2.4-4.5) multiplied by 10⁹cfu/mL (MRS formulation), (1.2-1.4). times.10⁹cfu/mL (modified MRS formulation). The viable count of the recombinant lactobacillus plantarum BLCC2-0394 bacterial liquid in the stationary phase is (2.8-5.0) × 10⁹cfu/mL (MRS formulation), (1.4-1.6). times.10⁹cfu/mL (modified MRS formulation). The viable count of the recombinant lactobacillus plantarum BLCC2-0394 bacterial liquid is higher than that of lactobacillus plantarum NC 8.

2 determination of the growth Curve of the recombinant Lactobacillus plantarum BLCC2-0394

2.1 materials and methods

2.1.1 materials

2.1.2 methods

Inoculating 0.5mL of recombinant lactobacillus plantarum BLCC2-0394 glycerol tube storage solution into 100mL of MRS culture medium, culturing at 30 ℃ for overnight at constant temperature, inoculating into a thin-mouth glass bottle filled with 500mL of MRS culture medium according to 1% of inoculum size, standing at 30 ℃ for overnight at constant temperature, fermenting for 46h, sampling at different intervals during the period, and detecting OD (optical density) of fermentation liquor₆₀₀Value, pH and viable count. Growth curves were plotted as mean values for 2 replicates. Meanwhile, the growth curve of Lactobacillus plantarum NC8 was examined under the same conditions and compared with that of recombinant Lactobacillus plantarum BLCC 2-0394.

2.2 analysis of results

TABLE 5 laboratory growth curves of Lactobacillus plantarum NC8 and Lactobacillus plantarum BLCC2-0394

As can be seen from Table 5, FIG. 10, FIG. 11 and FIG. 12, the number of viable bacteria increased faster when the log phase was reached 2h after inoculation of the recombinant Lactobacillus plantarum BLCC 2-0394. Gradually entering a stationary phase 8h after inoculation, wherein the number of viable bacteria is not changed greatly during 8-28h, and the maximum number of viable bacteria in the stationary phase is 5.55x10⁹cfu/mL. After 28h, the living bacteria gradually enter the decline period, and the number of the living bacteria is rapidly reduced. The maximum viable count of the lactobacillus plantarum NC8 in stationary phase is 5.00x10⁹cfu/mL is slightly lower than that of the recombinant lactobacillus plantarum BLCC2-0394, and the decay speed of the viable count in the later period of stabilization is faster than that of the recombinant lactobacillus plantarum BLCC 2-0394.

3 Effect of adding inducer at different times on recombinant Lactobacillus plantarum BLCC2-0394

3.1 materials and methods

3.1.1 materials

3.1.2 methods

Inoculating the activated fresh seed liquid of the recombinant lactobacillus plantarum BLCC2-0394 into 12 bottles of MRS culture medium according to the inoculation amount of 7.5%, wherein the liquid loading amount of each bottle is 200mL, standing and culturing at 30 ℃ after inoculation, respectively adding an

inducer

2, 4 and 6 hours after inoculation, repeating 3 times at each time point, the final concentration of the inducer is 100ng/mL, simultaneously taking no inducer as a control, and detecting the fermentation of each group at different time points by using an ultraviolet spectrophotometerOD of liquid₆₀₀Value, analyzing the influence of adding inducer at different times on the growth performance of the recombinant lactobacillus plantarum BLCC 2-0394.

3.2 results

TABLE 6 addition of inducer to OD of BLCC2-0394 fermentation broth at different times₆₀₀Influence of value and viable count

As can be seen from Table 6 and FIG. 13, OD of fermentation broths of 6-12h, 2 h-decoy and 4 h-decoy after inoculation₆₀₀The values are all lower than those of the blank control group, and the fermentation liquor OD of the 6 h-induced group and the blank control group₆₀₀The values are substantially uniform. The viable count difference between the 2 h-induced group, the 4 h-induced group and the 6 h-induced group is not large at 12h and 24h after inoculation, and is slightly lower than that of the blank control group. Combining the results of example two 1.3.3 (the expression level of the inducer protein added in the middle logarithmic growth phase is relatively highest), 4h of inducer is selected in subsequent experiments.

Effect of 4-time alkali supplementation on fermentation of recombinant Lactobacillus plantarum BLCC2-0394

Respectively inoculating 2 bottles of activated recombinant lactobacillus plantarum BLCC2-0394 seed liquid into 2 groups of 20L small pots (containing 13L MRS culture medium, the inoculation amount is 3.8%), culturing at 30 ℃, adding an inducer 4h after inoculation, wherein the final concentration of the inducer is 100ng/mL, and naturally fermenting in a blank control group; the alkali supplement group supplements alkali once 6h after inoculation, adjusts the pH value to 5.5, and then naturally ferments. Sampling every 2h, detecting viable count and OD of fermentation liquor₆₀₀And pH value, and the fermentation is finished when the pH value is not continuously reduced.

TABLE 7 Effect of one alkali supplementation on the growth Performance of recombinant Lactobacillus plantarum BLCC2-0394

As can be seen from Table 7 and FIG. 14, the viable count of the two groups of fermentation processes is compared, the viable count of the alkali supplement primary group during the fermentation period of 6-12h after alkali supplement is not obviously higher than that of the blank control group, and even at 8h, the viable count of the alkali supplement primary group is slightly lower than that of the fermentation broth of the blank control group. The result shows that the alkali supplement once has no obvious effect on improving the viable count of the fermentation liquor.

Influence of 5-sugar and alkali supplementation on fermentation of recombinant lactobacillus plantarum BLCC2-0394

Respectively inoculating 2 bottles of activated recombinant lactobacillus plantarum BLCC2-0394 seed liquid into 2 groups of 20L small pots (containing 13L MRS culture medium, the inoculation amount is about 7%), culturing at 30 ℃, adding an inducer 4h after inoculation, wherein the final concentration of the inducer is 100ng/mL, and naturally fermenting in a blank control group; adding alkali for 6h after inoculation, adjusting pH to 5.5, adding sterilized glucose solution into fermentation broth to obtain final concentration of 2.5%, and naturally fermenting. Sampling every 2h, detecting viable count and OD in two groups of fermentation liquor₆₀₀And (4) ending the fermentation if the pH value is not continuously reduced.

TABLE 820L Effect of alkali and sugar supplementation in the canister on the growth of Lactobacillus plantarum BLCC2-0394

As can be seen from Table 8 and FIG. 15, the number of viable bacteria in the alkali-supplementing and sugar-supplementing group increased to a certain extent at 6h (about 1L), and then gradually increased with the increase of the fermentation time, and the number of viable bacteria in the alkali-supplementing and sugar-supplementing group exceeded that in the late stage of fermentation. Proves that the alkali and sugar supplementation has certain promotion effect on the viable count of the fermentation liquor of the recombinant lactobacillus plantarum BLCC2-0394, and the viable count of the alkali and sugar supplementation reaches 1.21x10 when the fermentation is carried out for 16 hours¹⁰cfu/mL, 47.56% increase compared to the blank control.

Influence of sugar and alkali supplementation on viable count of fermentation liquor of recombinant lactobacillus plantarum BLCC2-0394 under 6-scale fermentation condition

Inoculating 6L of activated fresh recombinant lactobacillus plantarum BLCC2-0394 seed liquid into a 500L seed tank (the liquid loading amount is about 300L), culturing at 30 ℃ for 10-12h, transferring into a 5-ton fermentation tank (the liquid loading amount is about 4 ton), culturing at 30 ℃, adding an inducer 4h after inoculation, supplementing alkali 4-10h after inoculation, adjusting the pH value to 4.5-6.0, adding sterile glucose solution once 8-10h, adding glucose according to the final concentration of 1.0-5.0%, and ending fermentation if the pH value of fermentation liquor is not continuously reduced. Meanwhile, a fermentation group without sugar and alkali supplementation is used as a blank control.

TABLE 95 influence of alkali and sugar supplementation on growth of recombinant Lactobacillus plantarum BLCC2-0394 in a ton fermentor

As can be seen from Table 9 and FIG. 16, 10h after inoculation, the number of viable bacteria in 10h is slightly lower than that in 8h due to a certain amount of glucose solution supplemented in the fermentation broth of the alkali-supplementing and sugar-supplementing group, the number of viable bacteria in 10h is gradually increased and higher than that in the blank control group along with the extension of the fermentation time, and the number of viable bacteria in the fermentation broth of the alkali-supplementing and sugar-supplementing group is 1.39x10 at 14h¹⁰The cfu/mL is 73.75% higher than the highest viable count in the stationary phase of the blank control group. After the fermentation liquor is treated by centrifugal freeze-drying and the like, 31.97kg of freeze-dried bacterial powder is obtained from 4 tons of fermentation liquor in the blank control group, and the viable count is 4.3 multiplied by 10¹¹cfu/g. Obtaining 40.75kg of freeze-dried bacterial powder with the viable count of 5.9 multiplied by 10 by 4 tons of fermentation liquor of alkali and sugar supplementing groups¹¹cfu/g, total yield (weight of bacterial powder multiplied by viable count) is increased by 74.89% compared with that of a blank control group.

Influence of alkali and sugar supplementation on expression of target protein of lactobacillus plantarum BLCC2-0394 in 7-scale fermentation

Respectively taking the fermentation liquid of the blank control group for 6h, 8h and 10h and the fermentation liquid of the alkali-supplementing and sugar-supplementing group for 8h, 10h, 12h and 14h, centrifuging at 5000r/min for 10min, collecting thallus precipitate, resuspending with normal saline, and adjusting the bacterial suspension to reach uniform OD₆₀₀And centrifuging the resuspended bacteria liquid with the same volume at 5000r/min for 10min, discarding the supernatant, resuspending the precipitate with a certain amount of PBS buffer solution, and ultrasonically crushing the ring under the ice bath condition. Then adding ammonium sulfate and shakingMixing, standing at 4 deg.C overnight, centrifuging at 12000g for 10min, resuspending the precipitate with PBS, packaging, and freezing. And detecting the target protein of the fermentation liquor by using Western blot.

As can be seen from FIG. 17, the expression level of the target protein in the fermentation broth of the blank control group was lower than 6h and 8h, i.e., the expression level of the target protein tended to decrease with time. After the alkali and sugar supplementing group is supplemented with glucose for 10 hours, the expression levels of the target protein are gradually increased for 12 hours and 14 hours, which indicates that the alkali and sugar supplementing group is favorable for the expression of the target protein.

Example five, obtaining of lyophilized powder of recombinant Lactobacillus plantarum BLCC2-0394 and stability testing

1 preparation of recombinant Lactobacillus plantarum BLCC2-0394 lyophilized powder

1.1 materials and methods

1.1.1 materials

The strain is as follows: recombinant lactobacillus plantarum BLCC2-0394, obtained in accordance with the first embodiment of the present invention; lactobacillus plantarum NC8, stored in the laboratory of professor's group Wangchunfeng, Jilin university of agriculture.

1.1.2 methods

(1) Preparation of first-order seed liquid

Respectively inoculating 0.5mL of recombinant lactobacillus plantarum BLCC2-0394 and lactobacillus plantarum NC8 glycerol tube storage solution into 100mL of MRS culture medium, after culturing overnight at the constant temperature of 30 ℃, transferring 2 percent of inoculum size into fresh sterilized 100mL of MRS culture medium, and performing standing culture at the temperature of 30 ℃ overnight to respectively prepare first-grade seed solutions;

(2) preparation of Secondary seed liquid

The culture medium is MRS culture medium, and the formula is the same as above. The loading capacity is 30L.

Sterilizing at 121 deg.C for 30 min;

actual elimination: heating the interlayer, and sterilizing at 121 deg.C for 30min to complete the actual digestion.

Inoculation: inoculating the culture medium at 30 deg.C, and inoculating the first-stage seed solution according to 3% (volume percentage).

Fermentation: inoculating, culturing at 30 deg.C under 0.05MPa for about 10 hr to obtain secondary seed liquid.

(3) Fermenting in a fermentation tank

The culture medium is MRS culture medium, and the formula is the same as above. The loading capacity is 300L.

Sterilizing at 121 deg.C for 30 min;

Inoculation: inoculating the culture medium at 30 deg.C, and inoculating the second-stage seed liquid according to the inoculum size of 10% (volume percentage).

Inoculating an inducer: respectively adding an inducer 4h after inoculation;

sugar and alkali supplement: adding alkali for 4-10h after inoculation to adjust the pH value to 4.5-6.0, adding sterile glucose solution for 8-10h, wherein the addition amount of glucose is 1.0% -5.0% of the final concentration;

fermentation and fermentation process control: culturing at 30 deg.C after inoculation, and standing under 0.05 MPa. Sampling every 2h during fermentation, performing microscopic examination, and stopping fermentation when pH is not reduced any more.

(4) Post-treatment

After fermentation, respectively centrifugally collecting thalli, 1:1 adding a freeze-drying protective agent, and preparing freeze-dried fungus powder by using a conventional vacuum freeze-drying technology. The freeze-drying protective agent consists of the following raw materials in percentage by weight: 22.5 percent of skimmed milk powder, 9.0 percent of sucrose, 1.0 percent of glycerin and 67.5 percent of water.

1.2 results

TABLE 10 preparation of recombinant Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8 powder Trace

The results show that when the recombinant lactobacillus plantarum BLCC2-0394 is fermented for 16h, the pH value is reduced to the minimum value of 3.78, and the number of viable bacteria at the end point of fermentation is 1.45x10¹⁰cfu/mL, and freeze-drying to obtain 3.15kg of freeze-dried bacterial powder, wherein the viable count of the freeze-dried bacterial powder is 5.80×10¹¹cfu/g; the fermentation performance of the lactobacillus plantarum NC8 is slightly weaker than that of the lactobacillus plantarum BLCC2-0394, the pH value at the fermentation end point is 4.01, and the viable count at the fermentation end point is 8.5x10⁹cfu/mL, freeze-drying to obtain 2.00kg of freeze-dried powder with viable count of 3.60 × 10¹¹cfu/g。

The product can be obtained by multiple times of fermentation tests: the viable count of the recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder is not less than 5.80 multiplied by 10¹¹cfu/g, the viable count of the lactobacillus plantarum NC8 freeze-dried powder is not less than 3.00 multiplied by 10¹¹cfu/g. The freeze-dried powder is stored at-20 ℃, and the viable count is determined before use.

2 detection of stability of recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder

2.1 materials and methods

2.1.1 materials

2.1.2 methods

2.1.2.1 temperature tolerance test

In order to simulate the influence of storage and transportation on the freeze-dried bacterial powder under the normal temperature condition, water bath treatment at two temperatures is carried out: accurately weighing 1.000g of bacterial powder in a triangular flask with glass beads and 99mL of sterilized normal saline, and treating in water bath at 35 ℃ and 45 ℃ for 4h respectively, wherein the bacterial powder and the sterile normal saline are uniformly mixed at irregular time; in addition, the control group was left at room temperature for 4 hours. Each set was 3 in parallel. And finally shaking up and counting.

2.1.2.2 determination of environmental temperature and humidity stability of bacterial powder

In order to verify the storage stability of the recombinant lactobacillus plantarum BLCC2-0394, the lyophilized powder of the recombinant lactobacillus plantarum BLCC2-0394 was stored continuously at-20 ℃, 4 ℃, 37 ℃ and room temperature (11 months-5 months the next year, average air temperature 20 ℃) for 6 months, respectively, and the change of viable count was detected.

2.2 results

2.2.1 temperature tolerance test results

TABLE 11 temperature tolerance test for recombinant Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8 lyophilized powder

As can be seen from Table 11, the viable count of the recombinant Lactobacillus plantarum BLCC2-0394 lyophilized powder after being respectively subjected to water bath at 35 ℃ and 45 ℃ for 4 hours does not change greatly, and still remains at 10¹¹The level of survival was 96.82% and 90.14%, respectively. The lactobacillus plantarum NC8 has weaker storage performance, and the survival rates of the lactobacillus plantarum NC8 after being subjected to water bath for 4 hours at 35 ℃ and 45 ℃ are 82.06% and 54.00%, respectively. The result shows that the recombinant lactobacillus plantarum BLCC2-0394 has better tolerance than the original strain lactobacillus plantarum NC8, and has little loss of viable count during normal-temperature storage and transportation.

2.2.2 determination of environmental temperature stability of fungal powder

TABLE 12 Effect of storage at different temperatures on the viable count of recombinant Lactobacillus plantarum BLCC2-0394 and Lactobacillus plantarum NC8

As can be seen from Table 12 and FIG. 18, the number of viable bacteria of the lyophilized powder was lost to various degrees at each temperature as the storage time was prolonged. The survival rate is more than 50 percent, and the standard that the storage effect reaches the standard is that the lactobacillus plantarum NC8 can be stored only for 90 days at the temperature of minus 20 ℃, 60 days at the temperature of 4 ℃, 15 days at the temperature of 37 ℃ and 30 days at normal temperature. In contrast, the recombinant lactobacillus plantarum BLCC2-0394 is stored for 180 days at the temperature of-20 ℃, the influence of the viable count is small, and the survival rate is 86.64%; secondly, the survival rate is 66.60 percent when the temperature is 4 ℃ and the storage time is 180 days; the survival rate is 66.07% after being stored for 60 days at 37 ℃, and the survival rate is reduced to below 50% after 90 days; the survival rate is 59.60% when the product is stored for 90 days at normal temperature, and the survival rate is reduced to below 50% when the product is stored for 120 days. Therefore, the recombinant lactobacillus plantarum BLCC2-0394 can be stored for 180 days at the temperature of-20 ℃, and the survival rate is 86.64%; the survival rate is 66.60 percent after being stored for 180 days at 4 ℃; the survival rate is 66.07 percent after being stored for 60 days at 37 ℃; the survival rate is 59.60% after being stored for 90 days at normal temperature. The storage performance of the recombinant lactobacillus plantarum BLCC2-0394 is superior to that of lactobacillus plantarum NC 8.

EXAMPLE six NDV-VII strains propagation and detection

Test materials and methods

1.1 materials

1.1.1 strains: NDV-VII strain, which is a gift from the Wangchunfeng team of Jilin agriculture university.

1.1.2 test animals: 9-day-old SPF chick embryos; SPF egg chicks 1 day old.

1.2 test methods

1.2.1 acquisition and detection of NDV-VII allantoic fluid

The strain NDV-VII is diluted with proper concentration and inoculated with 30 SPF (specific pathogen free) chick embryos of 9 days old, 0.2 mL/egg, and the cells are incubated in a thermostat at 37 ℃. Dead chick embryos are discarded within 24h, after which they are candled twice daily. Allantoic fluid of chick embryos for 24-72h is collected, centrifuged at 3000r/min for 15min to remove impurities, then total RNA of NDV is extracted according to a Trizol method, in order to avoid RNA enzyme pollution in the environment in the extraction process, the extraction is carried out when fewer people exist, and all used articles also need to be ensured to be free of RNA enzyme pollution. The specific operation steps are as follows:

a. adding 500 mu L of recovered virus liquid into a clean centrifugal tube, adding equivalent Trizol, fully and uniformly mixing, and standing at room temperature for 10 min;

b. adding 200 μ L chloroform, shaking with strong force to emulsify the solution thoroughly until the solution is milky and has no phase separation, and standing at room temperature for 10 min. Due to the characteristics of low boiling point and easy volatilization of chloroform, attention needs to be paid to whether a centrifugal tube cover expands or not in the oscillation process at any moment;

c. 12000g, 4 ℃ low temperature centrifugation for 10min, putting the upper liquid phase into another clean centrifugal tube, and never absorbing the middle white liquid phase;

d. adding isopropanol with the same volume, slightly and slowly reversing to uniformly mix the liquid in the centrifuge tube, and standing at room temperature for 10 min;

e. 12000g, centrifuging at 4 ℃ for 10min, discarding the supernatant, and taking care not to suck a little white precipitate at the bottom of the centrifuge tube;

f. washing the precipitate with 1mL of pre-prepared ice-cold 75% ethanol, centrifuging at 8000r/min and 4 deg.C for 10min, carefully sucking off all supernatant with a pipette, washing once again according to the above method, and standing and drying in a super clean bench for 5 min;

g. a small amount of DEPC water was added to dissolve nucleic acid and reverse transcription was carried out. For the next RT-PCR assay.

1.2.2 Synthesis of viral c DNA

The following operations were performed with reference to Prime Script TM 1st Strand cDNA Synthesis Kit instructions:

(1) taking a new PCR reaction tube, taking the extracted total RNA as a template, configuring a 20 mu L reverse transcription system, and sequentially adding the following components:

(2) RT reaction procedure: water bath at 65 deg.c for 5min and ice bath for 3 min.

(3) The following components are sequentially added into a PCR reaction tube:

(4) water bath at 42 deg.c for 1 hr and then 70 deg.c for 15 min.

1.2.3 amplification of viral genes

The obtained reverse transcription product cDNA was used as a template for conventional PCR amplification with the following primers:

upstream: 5'-ATCCATGGACCGCGCCGTTAGCC-3' (SEQ ID NO.7),

downstream: 5'-CGGGTACCTTAACCTGACCTGGCTTCTCTA-3' (SEQ ID NO.8),

then, the following components were sequentially added to a 20. mu.L RT-PCR reaction system:

the PCR reaction conditions were as follows:

for a total of 35 cycles. Finally, extension was carried out at 72 ℃ for 10 min. The target band size of the amplified product is 1500bp, 5mL of PCR reaction product is taken and added with 1 uL of 6 × Loading Buffer for electrophoresis detection (1% agarose gel), and the result is observed according to a gel imaging system.

1.2.4 acquisition and detection of the allantoic fluid NDV-VII

Diluting the stored allantoic fluid of NDV-VII type strain with 10 times of sterile physiological saline treated with double antibody (adding penicillin 100IU and streptomyces 500IU into 1mL physiological saline, storing at room temperature for 1h or refrigerator for 12-24h), and diluting to 10 times^-5-10^-12A total of 8 dilutions were made ready for use.

Each dilution was inoculated with 5 9-day-old chick embryos at an inoculation dose of 0.2 mL/chick. No anti-saline was used as a blank control. Sealing the injection small hole with melted paraffin after injecting the inoculum; placing the chicken embryo with upward air chamber in 37.5 deg.C incubator for incubation; eggs were turned 2 times a day, and the dead eggs were discarded within 24 hours of the day. Recording the number of dead chick embryos within 24-72h, and calculating chick embryo ELD by a Reed-Muench method₅₀。

1.2.5 establishment of model for attacking NDV-VII Strain on 37-day-old SPF Chicken

Diluting allantoic fluid collected in 1.2.4 with sterile physiological saline solution treated with double antibody 10 times, and diluting to 10 times^-3-10^-8A total of 6 dilutions were made ready for use.

150 feather SPF (specific pathogen free) egg chicks of 1 day old and uniform in weight and good in health condition are pre-fed to 3 days old, the eggs are randomly divided into 7 groups at the age of 4 days, each group is repeated for 2 times, and each group is repeated for 10 times. Feeding to 37 days old normally, and counteracting toxic substance according to 6 dilution gradients, wherein the counteracting toxic substance mode is nasal drop and eye drop, and the counteracting toxic substance dosage is 0.1 mL/mouse. Continuously observing for 10 days after challenge, recording death number, and calculating ELD of NDV-VII strain on SPF chicken of 37 days old₅₀。

2 results

2.1 RT-PCR identification of NDV-VII strains

NDV-VII allantoic fluid was subjected to RT-PCR and 1.0% agarose gel electrophoresis, and a fragment of about 1500bp was observed, which was consistent with the expected result, and the result was 100% by NCBI BLAST (see FIG. 19), and was determined to be NDV virus.

2.2 ELD of NDV-VII strains on chick embryos₅₀

TABLE 13 NDV-VII Strain ELD₅₀Measurement result of (2)

Distance ratio (higher than 50% -50%)/(higher than 50% -lower than 50%)

＝(75％-50％)/(75％-0)＝0.33.

LogELD₅₀Logarithm of dilution factor x logarithm of dilution factor + distance ratio ═ 50%

＝-7+0.33×(-1)＝-7.33

I.e., the NDV-VII strain ELD₅₀＝10^-7.33。

2.3 establishment of model for attacking virus of NDV-VII strain in 37-day-old SPF chicks

TABLE 14 establishment of challenge model

2.3.1 clinical symptoms

The chickens had no typical symptoms in the first 3d after challenge, and typical newcastle disease symptoms appeared in individual groups from 4d, particularly in

groups

1 and 2, and the symptoms are more severe and mainly expressed as: listlessness, reluctance to walk, eye closure, neck reduction, dislocating, slow standing, weakness and drooping of tails and wings; legs are in a paresis state, even in a state of night sleep; the secretion in the oral cavity and the nasal cavity is increased, a large amount of mucus is accumulated and flows out of the oral cavity to be hung at the beak end, and the drinking water is reduced; the severe patient gives a "chuck" sound at the throat, and gets yellow, green and grey foul smells; the mortality rate increases. With the reduction of the challenge dose, the symptoms were reduced, and 5, 6, and 7 groups of chickens were mentally active with few typical symptoms observed.

2.3.2 Caesarean syndrome

The majority of dead chickens are subjected to autopsy, and typical visceral lesion and glandular gastric papillary hemorrhage are observed; swelling, bleeding, congestion or necrotic ulceration of the mucosa at the lymphatic follicles of the duodenum, jejunum, ileum; congestion, hemorrhage and necrosis of cecum tonsil; the rectal mucosa is in a stripe shape and bleeds punctiform; congestion and hemorrhage of larynx and trachea, mucus in trachea; the air sac is turbid and thick with cheese-like substances; other organs also have bleeding to varying degrees. Are typical symptoms of newcastle disease.

2.3.3 mortality statistics

TABLE 15 statistics of mortality

As can be seen from the table:

(1) the incubation period of the Newcastle disease NDV-VII strain on the chicken is 3 d;

(2) the mortality rate and the challenge dose are in a linear relation, and the mortality rate is reduced along with the reduction of the challenge dose, which shows that the infection capacity of the NDV-VII strain is increased along with the increase of the challenge concentration;

(3) the dose of the antidote is 10^-3And 10^-4In the case of (3), the mortality rate at 4d after challenge averaged 20%, the average mortality rate at 5d was 90%, and 100% of deaths at 6 d; mortality dropped to below 50% from group 3.

Distance ratio (higher than 50% -50%)/(higher than 50% -lower than 50%)

＝(100％-50％)/(100％-47.62％)＝0.95.

＝-4+0.95×(-1)＝-4.95

I.e., ELD of NDV-VII strain on 37-day-old chicks₅₀＝10^-4.95。

Example test of the immunological Effect of the seven recombinant Lactobacillus plantarum BLCC2-0394 on SPF-hens

Test materials and methods

1.1 materials

1.1.1 test strains: recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder with viable count of 5.80 multiplied by 10¹¹cfu/g. Obtained from example five.

1.1.2 test animals: SPF egg chicks 1 day old. Feeding basal diet without antibiotic.

1.1.3 test design

The SPF egg chicks with the age of 260 feathers and 1 day are pre-fed to the age of 3 days, 240-feather chicks with uniform weight and good health condition are selected at the age of 4 days and randomly divided into 6 groups, each group has 2 repetitions, and each repetition has 20 repetitions. Wherein 1 group is control group, and the other 5 groups are test groups, and are separately administered by intragastric administration at 0.2 × 10⁸cfu/feather, 2X 10⁸cfu/feather, 20X 10⁸cfu/feather, 200 × 10⁸cfu/feather sum 2000X 10⁸cfu/feather freeze-dried bacterial powder diluent.

1.1.4 immunization

The immunization mode is gastric lavage, and water is forbidden in advance during immunization for 2 h. The contrast group is 0.3mL of the gavage sterilized 0.9% normal saline, and the other 5 test groups are respectively gavage sterilized 0.9% normal saline diluted freeze-dried bacterial powder diluent. Immunization was continued for 3d weekly, 3 weeks, 4 weeks without immunization, and 5 weeks for 3 d. Closely observing for 2h after each immunization, regularly eating after 2h, continuously observing for 10d after immunization, and regularly observing and recording every day.

1.1.5 detection index

(1) State observable by naked eye

Recording defecation conditions and excrement characters in detail; observing the posture behavior, the feeding condition and the mental state of the chicken; whether the doctor blade casts, sleeps, twitches and the like is noticed; touching the chicken fullness of the chicken, and observing the falling condition of the main wing feather and the feather damage condition of the chicken; the caesarean section is used for observing whether the viscera (liver, kidney and spleen) have lesions, whether the intestinal tract has bleeding spots, mucous membrane swelling and other lesions, whether the larynx and the trachea have bleeding spots, mucus increase and the like.

(2) Determination of beta-method HI antibody titer

Serum HI antibody titers were determined for 4, 10, 17, 24, 31, 38 and 45 day old chickens.

a. And randomly selecting a 4-feather chick in each group, collecting 2mL of blood through a subplantar vein, separating serum, and preparing NDV (Newcastle disease virus) solution with 4 hemagglutination units for later use.

b. A clean disposable 96-well V-shaped microtiter plate was prepared, and 50. mu.L of 0.9% physiological saline was added to each of the 1st to 12 th wells.

c. 50 mu L of serum to be detected is taken from each group, added into the 1st hole for repeated suction and beating for 10 times, evenly mixed, then diluted to the 10 th hole in turn by times, and 50 mu L is discarded.

d. Add NDV solution of 4 hemagglutination units 50. mu.L to each of wells 1 to 11, mix well, add 0.9% physiological saline 50. mu.L to well 12, and culture at 37 ℃ for 30min while standing, virus control and physiological saline control are

wells

11 and 12, respectively.

e. Adding 50 μ L of newly prepared 1% chicken red blood cell suspension into each hole, mixing, placing in a micro-oscillator, oscillating for 5min, standing at room temperature for about 30min, and judging and recording the result when the 12 th hole is completely precipitated.

f. And (6) judging the result. The HI titer of the serum was determined as the result of complete inhibition of erythrocyte agglutination at the highest dilution. When the 11 th well was completely agglutinated and the 12 th well was not agglutinated at all, the test result was confirmed, whereas the result was not confirmed.

(3) ELISA kit method for detecting serum IgG level

Serum IgG levels were determined in 4, 10, 17, 24, 31, 38 and 45 day old chickens. And randomly selecting 2mL of 4 feather chick infrawing vein blood collection, separating serum, and determining serum IgG by adopting a chick serum IgG ELISA kit.

(4) ELISA for detection of sIgA levels

After the immunization is finished, tracheal mucus and intestinal mucus of each group of chicks are taken and treated according to the following method, and the antibody level of sIgA is detected by adopting indirect ELISA.

a. And (5) obtaining tracheal mucus. Clamping two ends of the whole trachea with hemostatic forceps, gently inserting the tail end of an infusion apparatus into the laryngeal position of the trachea, repeatedly flushing the lumen for 4 times with 6mL of cold 0.9% physiological saline, taking a trachea with the length of 5cm for each sample, shearing, weighing, adding 0.9% physiological saline with the volume of 2 times, fully shaking and uniformly mixing for 30min at low temperature, centrifuging for 20min at 12000g and 4 ℃, and then completely flushing the obtained liquid at-20 ℃ and freezing and storing the supernatant for later use.

b. And (5) obtaining intestinal canal mucus. Removing jejunum and duodenum with length of about 20cm, respectively washing with 60mL of 0.9% physiological saline for 4 times, cutting open intestinal sections under aseptic condition, gently washing residual chyme and liquid dung with absorbent paper, gently scraping intestinal mucus with a blade into a 10mL centrifuge tube, adding 2 times volume of 0.9% physiological saline, sufficiently shaking and mixing for 30min at low temperature, centrifuging at 12000g and 4 ℃ for 20min to obtain all supernatants, and freezing and storing the supernatants at-20 ℃ for later use.

c. And (3) determining the sIgA antibody level of the trachea and the intestinal mucosa by adopting a chicken secretory immunoglobulin A (sIgA) ELISA detection kit.

2 results

2.1 apparent characteristics and anatomical conditions of the groups of chicks

TABLE 16 apparent characteristics and anatomy of the recombinant Lactobacillus plantarum BLCC2-0394 for each group of chicks

2.2 comparison of HI antibody titers in groups of chicks

TABLE 17 comparison of HI antibody titers (log2) of recombinant Lactobacillus plantarum BLCC2-0394 for various groups of chicks

As can be seen from table 17 and fig. 20: compared with the control group, except group II- (0.2X 10)⁸cfu/feather) immune dose is lower, HI antibody increases slowly, HI antibody levels of other immune groups increase obviously and increase along with the increase of immune dose. Day 7 after immunization, i.e., 10 days of age, except group II- (0.2X 10)⁸cfu/feather), of each dose groupHI antibody titer shows an ascending trend until 21d (24 days old) after immunization is stable, then the HI antibody titer is normally raised for one week, due to external influence factors such as environment and the like, the HI level of partial chicks is slightly reduced, the HI antibody level of each immunization group is obviously improved after the boosting immunization until 11d (45 days old) after the last immunization is finished, and the HI level is still up to 2⁸And (4) horizontal. It can be seen that the recombinant lactobacillus plantarum BLCC2-0394 can activate immune cells of the body, induce the body to generate high HI antibody level, and last 41 days from the first immunization.

2.3 comparison of serum IgG levels in groups of chicks

TABLE 18 comparison of serum IgG levels (pg/mL) of various groups of chicks by recombinant Lactobacillus plantarum BLCC2-0394

As can be seen from table 18 and fig. 21: with increasing age in days, the serum IgG levels of the chicks of each group showed a tendency to increase. Except for the control group and the group II- (0.2X 10)⁸cfu/feather) increased slowly, the IgG levels in the remaining immune groups increased significantly (P < 0.05) and increased with increasing immune dose. The antibody change trend is consistent with that of serum HI antibody, the antibody rises slowly at 31d, is obviously improved after the boosting immunization, and can last for 41d at most from the first immunization.

2.4 detection of sIgA levels

TABLE 19 comparison of sIgA levels of recombinant Lactobacillus plantarum BLCC2-0394 for various groups of chicks

The indirect ELISA was used to measure sIgA levels in tracheal and intestinal mucus, and the results are shown in table 19 and fig. 22. From the results, it can be seen that: after the lactobacillus plantarum BLCC2-0394 is immunized, II groups are removed (0.2X 10)⁸cfu/feather) has low immune dose and no obvious effect, and the sIgA water average of other groups, namely trachea, duodenum and jejunum mucus is obviousHigher than the control group (P < 0.05), and the sIgA level shows a rising trend along with the increase of the immune dose. The result shows that the immunization of the BLCC2-0394 stimulates the generation of sIgA of intestinal mucosa and tracheal mucosa and has a promoting effect on the humoral immune response of chicks.

EXAMPLE eightfold recombinant Lactobacillus plantarum BLCC2-0394 challenge protection test for SPF-chickens

Test materials and methods

1.1 materials

1.1.1 test strains: recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder with viable count of 5.8 multiplied by 10¹¹cfu/g. Lactobacillus plantarum NC8 lyophilized powder with viable count of 3.2 × 10¹¹cfu/g. Obtained from example five of the present invention.

And (3) virus challenge strains: allantoic fluid of NDV-VII strain obtained from inventive example six.

1.1.2 test animals: 1 day-old SPF egg chicks are fed with basal ration without antibiotics.

1.2 methods

The SPF egg chicks with the 260 feathers and the 1 day age are pre-fed to the 3 day age, 240 feathers with uniform weight and good health condition are randomly selected to be divided into 4 groups at the 4 th day age, each group has 2 repetitions, and each repetition has 30 feathers. Wherein group 1 is a blank control group: no immunity and no toxic attack; group 2 is the challenge group: gavage 0.9% physiological saline 0.3mL, and then counteracting toxic substances;

groups

3 and 4 were immune challenge groups: counteracting toxic substances after immunization. Of which 3 groups were immunized 20X 10⁸cfu/feather recombinant lactobacillus plantarum BLCC2-0394 freeze-dried powder diluent, 4 groups of immunity 20 x10⁸cfu/feather lactobacillus plantarum NC8 freeze-dried powder.

The immunization method is the same as the seventh embodiment. Immunization was continued for 3d weekly, 3 weeks, 4 weeks without immunization, and 5 weeks for 3 d. After each immunization, 2 hours of close observation are carried out, after 2 hours, the diet is normal, and after 3d (37 days old) of immunization, all chickens are given the NDV-VII strain in the sixth embodiment of the invention and are ELD for 37 days old chicks₅₀Dose counteracting toxic substance. The observation was continued for 11d, and the recording was observed regularly every day.

1.3 detection index

(1) Clinical symptoms

The state of the immunized chicken is shown in the seventh embodiment, and no abnormality exists, and the index mainly refers to the state observed after virus attack. Recording defecation conditions and excrement characters in detail; observing the posture behavior, the feeding condition and the mental state of the chicken; whether the doctor blade casts, sleeps, twitches and the like is noticed; touching the chicken fullness of the chicken, and observing the falling condition of the main wing feather and the feather damage condition of the chicken; the caesarean section is used for observing whether the viscera (liver, kidney and spleen) have lesions, whether the intestinal tract has bleeding spots, mucous membrane swelling and other lesions, whether the larynx and the trachea have bleeding spots, mucus increase and the like.

(2) Symptoms of caesarean examination

After the excision, the visceral lesions and the lesions of glandular stomach papilla, intestine, tonsil, larynx and trachea are observed.

(3) Molecular identification

Extracting whole genome RNA from trachea mucus and intestinal mucosa of infected chicken, reverse transcribing into cDNA with random primer, amplifying HN gene segment with national standard specific primer, and determining whether positive band appears by agarose gel electrophoresis.

(4) Death situation

And (5) recording the death condition of the chickens every day in detail, and counting the toxicity attack protection rate.

(5) HI antibodies

Serum HI antibody titers were determined for 10, 17, 24, 31, 38, 41, 44 and 47 day old chickens. The determination method is the same as the seventh embodiment.

(6) Detoxification conditions

After 3, 5, 7, 9 and 11 days of challenge, the oropharynx and cloaca cotton swabs of 20 chickens in each group are collected, the samples are placed in sterile physiological saline containing double-antibody treatment, and the antibiotic concentration of the cloaca cotton swab preservation solution is increased by 5 times. Then the pH value is adjusted to 7.0-7.4.

Incubating at room temperature for 1-2h, centrifuging at 4 deg.C and 3000r/min for 5min, taking supernatant, inoculating allantoic cavity of chick embryo, inoculating 3 SPF chick embryos of 9-11 days old to each sample, inoculating 0.2mL each, incubating at 37 deg.C, and observing death condition of chick embryo every 12 h. Chick embryos that died within 24h were considered as bacterial infection and were not considered for the test results. And taking out the dead chick embryos after 24 hours at any time, and storing the chick embryos in a refrigerator at 4 ℃. After 120h post inoculation, all chick embryos were removed, all live embryos harvested and the allantoic fluid of dead embryos after 24h and assayed for Hemagglutination (HA) titer.

And (3) extracting whole genome RNA aiming at chick embryo allantoic fluid with HA titer less than or equal to 3log2, and detecting whether a positive band exists by using the molecular identification method in step (3).

2 results

2.1 clinical symptoms

All chickens did not die in 3 days after challenge, feces were normal, and feed intake was reduced in 3 days after challenge. Typical symptoms of newcastle disease begin to appear from post-challenge 4 d: reduced or waste food; listlessness, reluctance to walk, general weakness, loose feathers, eye-closed necking, dislocated and slow standing, slow reaction, drooping head or extending under the wing, weakness and drooping tail and wing; legs are in a paresis state, even in a state of night sleep; the secretion in the oral cavity and the nasal cavity is increased, a large amount of mucus is accumulated and flows out from the oral cavity to be hung at the beak end, and in order to discharge the mucus, the chicken shakes the head constantly to do continuous swallowing action; when the chicken is lifted upside down, mucus flows out of the mouth in a large amount; dyspnea, usually stretching the head and neck, breathing open; in severe cases, the throat emits "chuck" sound, often yellow, green and gray, with thin stools and increased mortality gradient.

2.2 anatomical symptoms

Most of the typical visceral lesions, papillary hemorrhage of the glandular stomach; swelling, bleeding, congestion or necrotic ulceration of the mucosa at the lymphatic follicles of the duodenum, jejunum, ileum; congestion, hemorrhage and necrosis of cecum tonsil; the rectal mucosa is in a stripe shape and bleeds punctiform; congestion and hemorrhage of larynx and trachea, mucus in trachea; the air sac is turbid and thick with cheese-like substances; other organs also have bleeding to varying degrees.

2.3 molecular characterization

Extracting RNA from trachea mucus and mucosa of infected chicken, amplifying and sequencing the fragments, wherein the sequencing result is consistent with the expected amplified fragment length of the designed primer, and the comparison result is the fragment of the Newcastle disease virus (figure 23).

2.4 mortality statistics

TABLE 20 Chicken mortality statistics

As can be seen from table 20: (1) in view of the combined mortality and mental status, no obvious adverse symptoms can be seen in the first 3d after the attack, and the symptoms are obvious in the beginning of the 4 d. The incubation period of the NDV-VII strain of the Newcastle disease is 3 d; (2) the attacking group died from the 4 th day after attacking, while 1 chicken died from the 5 th day after attacking in the BLCC2-0394 immune attacking group, the number of died chickens per day was all less than that in the BLCC2-0394 immune attacking group, and at the 10 th day after attacking, the death rate of the BLCC2-0394 immune attacking group is obviously lower than that of the attacking group, and the survival rate is 71.6%; and in the NC8 immune group, dead chickens are higher than the BLCC2-0394 immune group but lower than the challenge group at 4d and 5d after challenge, and the death rate is gradually increased, which shows that even simple immune probiotics (lactobacillus plantarum NC8) can enhance the resistance of the chickens to a certain degree, and the recombinant lactobacillus plantarum BLCC2-0394 obviously enhances the anti-infection capacity of the chickens, and the survival rate is higher than 30% of the challenge group and higher than 20% of the NC8 immune group.

2.5 HI antibodies

TABLE 21 Chicken HI antibody titers (log2)

As can be seen from the results of table 21 and fig. 24: blank control group HI antibodies were consistently at lower levels; the challenge group rapidly rose to 7.0 within 4 days after challenge (37 days old) and then rapidly dropped to 3.0; NC8 immune challenge group: compared with the blank control group, the HI antibody is slightly increased and reaches 2 at the maximum at the age of 38 days^4.5After challenge, 4d is reduced and then increased to 2^4.0(ii) a The BLCC2-0394 immunity counteracting group is continuously increased at the age of 10-31 days and counteracts the toxic substanceThe rear 4d is lowered, and then is raised rapidly and becomes stable. This shows that the antibody generated by the recombinant lactobacillus plantarum BLCC2-0394 can neutralize certain viruses and then quickly stimulate the body to generate immune response, and the immune response effect is obviously better than that of lactobacillus plantarum NC 8.

2.6 detoxification conditions

Surface 22 toxin-eliminating detection result of cotton swab for larynx and cloaca after toxin attack

The length of detoxification time is also an index for evaluating the immune effect of the vaccine, and the results are shown in table 22. 3-5d after the virus attack, the virus elimination rate of the virus attacking group and the virus immunity attacking group is 100 percent no matter in oropharynx or cloaca; at 7d after challenge, the virus discharge rate of the BLCC2-0394 immune challenge group begins to decrease, and at 11d after challenge, the virus discharge rate of oropharynx and cloaca of the BLCC2-0394 immune challenge group is 25%, while the virus discharge rate of the challenge group is always continuous and is almost 100%, and the virus discharge rate of the NC8 immune challenge group is higher than that of the BLCC2-0394 immune challenge group and lower than that of the challenge group. The recombinant lactobacillus plantarum BLCC2-0394 can form an antibody on the surface of the mucous membrane to neutralize part of viruses, enhance the immunity of the mucous membrane and effectively prevent the viruses from entering the body to propagate; the virus attacking group only stimulates the organism to generate antibody reaction for a short time to neutralize part of viruses, but cannot effectively prevent the viruses from entering the organism to propagate continuously until the viruses die; the NC8 immune toxicity counteracting group can also enhance the mucosa immunity to a certain extent and block the invasion of a small part of viruses due to the continuous intake of early probiotics, but the effect is obviously weaker than that of the recombinant lactobacillus plantarum BLCC 2-0394.

Although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Shandong Baolaili Bio-engineering Ltd

<120> recombinant lactobacillus plantarum for expressing Newcastle disease virus antigen gene, and fermentation process and application thereof

<130>

<160> 8

<170> PatentIn version 3.3

<210> 1

<211> 573

<212> DNA

<213> pgsA' nucleotide sequence

<400> 1

atgggcaaga aagaattaag tttccacgag aagttattaa aattgactaa acaacaaaaa 60

aagaagacta acaagcatgt gtttattgct attccaattg ttttcgtttt aatgtttgct 120

tttatgtggg caggtaaagc tgagactcca aaagttaaga cttatagtga tgacgttttg 180

agtgcttcat ttgtcggcga cattatgatg ggtcgttacg ttgagaaagt cacggaacaa 240

aagggtgcag atagtatttt ccaatatgtt gaaccgattt tccgtgctag tgattatgtt 300

gctggcaatt ttgaaaatcc tgttacttat cagaaaaact acaaacaagc tgataaagag 360

attcatttac agactaataa ggaaagtgtt aaagttttaa aggatatgaa ttttactgtc 420

ttaaatagtg ctaataatca tgctatggat tatggtgttc aaggtatgaa agatacgtta 480

ggtgagtttg ctaaacagaa tttagatatt gttggtgctg gttattcatt aagtgacgct 540

aagaagaaaa ttagttacca gaaagtgtct aga 573

<210> 2

<211> 2379

<212> DNA

<213> pgsA' -HN-DCpep nucleotide sequence

<400> 2

atgggcaaga aagaattaag tttccacgag aagttattaa aattgactaa acaacaaaaa 60

aagaagacta acaagcatgt gtttattgct attccaattg ttttcgtttt aatgtttgct 120

tttatgtggg caggtaaagc tgagactcca aaagttaaga cttatagtga tgacgttttg 180

agtgcttcat ttgtcggcga cattatgatg ggtcgttacg ttgagaaagt cacggaacaa 240

aagggtgcag atagtatttt ccaatatgtt gaaccgattt tccgtgctag tgattatgtt 300

gctggcaatt ttgaaaatcc tgttacttat cagaaaaact acaaacaagc tgataaagag 360

attcatttac agactaataa ggaaagtgtt aaagttttaa aggatatgaa ttttactgtc 420

ttaaatagtg ctaataatca tgctatggat tatggtgttc aaggtatgaa agatacgtta 480

ggtgagtttg ctaaacagaa tttagatatt gttggtgctg gttattcatt aagtgacgct 540

aagaagaaaa ttagttacca gaaagtgtct agaatggacc gcgccgttag ccaagttgcg 600

ttagagaatg atgaaagaga ggcaaaaaat acatggcgct tgatattccg gattgcaatc 660

ttattcttaa cagtagtgac cttggctata tctgtagcct cccttttata tagcatgggg 720

gctagcacac ctagcgatct tgtaggcata ccgactagga tttccagggc agaagaaaag 780

attacatcta cacttggttc caatcaagat gtagtagata ggatatataa gcaagtggcc 840

cttgagtctc cgttggcatt gttaaaaact gagaccacaa ttatgaacgc aataacatct 900

ctctcttatc agattaatgg agctgcaaac aacagtgggt ggggggcact tatccatgac 960

ccagattata taggggggat aggcaaagaa ctcattgtag atgatgctag tgatgtcaca 1020

tcattctatc cctctgcatt tcaagaacat ctgaatttta tcccggcgcc tactacagga 1080

tcaggttgca ctcgaatacc ctcatttgac atgagtgcta cccattactg ctacacccat 1140

aatgtaatat tgtctggatg cagagatcac tcacattcat atcagtattt agcacttggt 1200

gtgctccgga catctgcaac agggagggta ttcttttcta ctctgcgttc catcaacctg 1260

gacgacaccc aaaatcggaa gtcttgcagt gtgagtgcaa ctcccctggg ttgtgatatg 1320

ctgtgctcga aagtcacgga gacagaggaa gaagattata actcagctgt ccctacgcgg 1380

atggtacatg ggaggttagg gttcgacggc cagtaccacg aaaaggacct agatgtcaca 1440

acattattcg gggactgggt ggccaactac ccaggagtag ggggtggatc ttttattgac 1500

agccgcgtat ggttctcagt ctacggaggg ttaaaaccca attcacccag tgacactgta 1560

caggaaggga aatatgtgat atacaagcga tacaatgaca catgcccaga tgagcaagac 1620

taccagattc gaatggccaa gtcttcgtat aagcctggac ggtttggtgg gaaacgcata 1680

cagcaggcta tcttatctat caaggtgtca acatccttag gcgaagaccc ggtactgact 1740

gtaccgccca acacagtcac actcatgggg gccgaaggca gaattctcac agtagggaca 1800

tctcatttct tgtatcaacg agggtcatca tacttctctc ccgcgttatt atatcctatg 1860

acagtcagca acaaaacagc cactcttcat agtccttata cattcaatgc cttcactcgg 1920

ccaggtagta tcccttgcca ggcttcagca agatgcccca acccgtgtgt tactggagtc 1980

tatacagatc catatcccct aatcttctat agaaaccaca ccttgcgagg ggtattcggg 2040

acaatgcttg atggtgtaca agcaagactt aaccctgcgt ctgcagtatt cgatagcaca 2100

tcccgcagtc gcattactcg agtgagttca agcagtacca aagcagcata cacaacatca 2160

acttgtttta aagtggtcaa gactaataag acctattgtc tcagcattgc tgaaatatct 2220

aatactctct tcggagaatt cagaatcgtc ccgttactag ttgagatcct caaagatgac 2280

ggggttagag aagccaggtc tggcttctac ccatcatacc attcaactcc acaacgtcca 2340

ttctacccat cataccattc aactccacaa cgtccatag 2379

<210> 3

<211> 792

<212> PRT

<213> pgsA' -HN-DCpep amino acid sequence

<400> 3

Met Gly Lys Lys Glu Leu Ser Phe His Glu Lys Leu Leu Lys Leu Thr

1 5 10 15

Lys Gln Gln Lys Lys Lys Thr Asn Lys His Val Phe Ile Ala Ile Pro

20 25 30

Ile Val Phe Val Leu Met Phe Ala Phe Met Trp Ala Gly Lys Ala Glu

35 40 45

Thr Pro Lys Val Lys Thr Tyr Ser Asp Asp Val Leu Ser Ala Ser Phe

50 55 60

Val Gly Asp Ile Met Met Gly Arg Tyr Val Glu Lys Val Thr Glu Gln

65 70 75 80

Lys Gly Ala Asp Ser Ile Phe Gln Tyr Val Glu Pro Ile Phe Arg Ala

85 90 95

Ser Asp Tyr Val Ala Gly Asn Phe Glu Asn Pro Val Thr Tyr Gln Lys

100 105 110

Asn Tyr Lys Gln Ala Asp Lys Glu Ile His Leu Gln Thr Asn Lys Glu

115 120 125

Ser Val Lys Val Leu Lys Asp Met Asn Phe Thr Val Leu Asn Ser Ala

130 135 140

Asn Asn His Ala Met Asp Tyr Gly Val Gln Gly Met Lys Asp Thr Leu

145 150 155 160

Gly Glu Phe Ala Lys Gln Asn Leu Asp Ile Val Gly Ala Gly Tyr Ser

165 170 175

Leu Ser Asp Ala Lys Lys Lys Ile Ser Tyr Gln Lys Val Ser Arg Met

180 185 190

Asp Arg Ala Val Ser Gln Val Ala Leu Glu Asn Asp Glu Arg Glu Ala

195 200 205

Lys Asn Thr Trp Arg Leu Ile Phe Arg Ile Ala Ile Leu Phe Leu Thr

210 215 220

Val Val Thr Leu Ala Ile Ser Val Ala Ser Leu Leu Tyr Ser Met Gly

225 230 235 240

Ala Ser Thr Pro Ser Asp Leu Val Gly Ile Pro Thr Arg Ile Ser Arg

245 250 255

Ala Glu Glu Lys Ile Thr Ser Thr Leu Gly Ser Asn Gln Asp Val Val

260 265 270

Asp Arg Ile Tyr Lys Gln Val Ala Leu Glu Ser Pro Leu Ala Leu Leu

275 280 285

Lys Thr Glu Thr Thr Ile Met Asn Ala Ile Thr Ser Leu Ser Tyr Gln

290 295 300

Ile Asn Gly Ala Ala Asn Asn Ser Gly Trp Gly Ala Leu Ile His Asp

305 310 315 320

Pro Asp Tyr Ile Gly Gly Ile Gly Lys Glu Leu Ile Val Asp Asp Ala

325 330 335

Ser Asp Val Thr Ser Phe Tyr Pro Ser Ala Phe Gln Glu His Leu Asn

340 345 350

Phe Ile Pro Ala Pro Thr Thr Gly Ser Gly Cys Thr Arg Ile Pro Ser

355 360 365

Phe Asp Met Ser Ala Thr His Tyr Cys Tyr Thr His Asn Val Ile Leu

370 375 380

Ser Gly Cys Arg Asp His Ser His Ser Tyr Gln Tyr Leu Ala Leu Gly

385 390 395 400

Val Leu Arg Thr Ser Ala Thr Gly Arg Val Phe Phe Ser Thr Leu Arg

405 410 415

Ser Ile Asn Leu Asp Asp Thr Gln Asn Arg Lys Ser Cys Ser Val Ser

420 425 430

Ala Thr Pro Leu Gly Cys Asp Met Leu Cys Ser Lys Val Thr Glu Thr

435 440 445

Glu Glu Glu Asp Tyr Asn Ser Ala Val Pro Thr Arg Met Val His Gly

450 455 460

Arg Leu Gly Phe Asp Gly Gln Tyr His Glu Lys Asp Leu Asp Val Thr

465 470 475 480

Thr Leu Phe Gly Asp Trp Val Ala Asn Tyr Pro Gly Val Gly Gly Gly

485 490 495

Ser Phe Ile Asp Ser Arg Val Trp Phe Ser Val Tyr Gly Gly Leu Lys

500 505 510

Pro Asn Ser Pro Ser Asp Thr Val Gln Glu Gly Lys Tyr Val Ile Tyr

515 520 525

Lys Arg Tyr Asn Asp Thr Cys Pro Asp Glu Gln Asp Tyr Gln Ile Arg

530 535 540

Met Ala Lys Ser Ser Tyr Lys Pro Gly Arg Phe Gly Gly Lys Arg Ile

545 550 555 560

Gln Gln Ala Ile Leu Ser Ile Lys Val Ser Thr Ser Leu Gly Glu Asp

565 570 575

Pro Val Leu Thr Val Pro Pro Asn Thr Val Thr Leu Met Gly Ala Glu

580 585 590

Gly Arg Ile Leu Thr Val Gly Thr Ser His Phe Leu Tyr Gln Arg Gly

595 600 605

Ser Ser Tyr Phe Ser Pro Ala Leu Leu Tyr Pro Met Thr Val Ser Asn

610 615 620

Lys Thr Ala Thr Leu His Ser Pro Tyr Thr Phe Asn Ala Phe Thr Arg

625 630 635 640

Pro Gly Ser Ile Pro Cys Gln Ala Ser Ala Arg Cys Pro Asn Pro Cys

645 650 655

Val Thr Gly Val Tyr Thr Asp Pro Tyr Pro Leu Ile Phe Tyr Arg Asn

660 665 670

His Thr Leu Arg Gly Val Phe Gly Thr Met Leu Asp Gly Val Gln Ala

675 680 685

Arg Leu Asn Pro Ala Ser Ala Val Phe Asp Ser Thr Ser Arg Ser Arg

690 695 700

Ile Thr Arg Val Ser Ser Ser Ser Thr Lys Ala Ala Tyr Thr Thr Ser

705 710 715 720

Thr Cys Phe Lys Val Val Lys Thr Asn Lys Thr Tyr Cys Leu Ser Ile

725 730 735

Ala Glu Ile Ser Asn Thr Leu Phe Gly Glu Phe Arg Ile Val Pro Leu

740 745 750

Leu Val Glu Ile Leu Lys Asp Asp Gly Val Arg Glu Ala Arg Ser Gly

755 760 765

Phe Tyr Pro Ser Tyr His Ser Thr Pro Gln Arg Pro Phe Tyr Pro Ser

770 775 780

Tyr His Ser Thr Pro Gln Arg Pro

785 790

<210> 4

<211> 36

<212> DNA

<213> DCpep nucleotide sequence

<400> 4

ttctacccat cataccattc aactccacaa cgtcca 36

<210> 5

<211> 28

<212> DNA

<213> HN-XbaI-F primer

<400> 5

atatctagaa tggaccgcgc cgttagcc 28

<210> 6

<211> 66

<212> DNA

<213> HN-HindIII-DCpep-R primer

<400> 6

attaagcttc tatggacgtt gtggagttga atggtatgat gggtagaagc cagacctggc 60

ttctct 66

<210> 7

<211> 23

<212> DNA

<213> artificially synthesized sequence

<400> 7

atccatggac cgcgccgtta gcc 23

<210> 8

<211> 30

<212> DNA

<213> artificially synthesized sequence

<400> 8

cgggtacctt aacctgacct ggcttctcta 30

Claims

1. A recombinant lactobacillus plantarum for expressing Newcastle disease virus antigen genes is characterized in that the recombinant lactobacillus plantarum is a lactobacillus plantarum containing HN and DCpep gene segments;

wherein, HN is a gene sequence of a coding hemagglutinin-neuraminidase in a VII strain of the Newcastle disease virus; the DCpep is a DC cell targeting peptide sequence.

2. The recombinant lactobacillus plantarum of claim 1, wherein a pgsA' gene fragment is also introduced into the recombinant lactobacillus plantarum; preferably, the nucleotide sequence of pgsA' is shown in SEQ ID NO. 1.

3. The recombinant lactobacillus plantarum of claim 2, wherein in said recombinant lactobacillus plantarum, said pgsA', HN and DCpep gene segments are expressed in tandem;

preferably, the nucleotide sequence of pgsA' -HN-DCpep is shown in SEQ ID NO. 2;

the amino acid sequence of the pgsA' -HN-DCpep coding protein is shown in SEQ ID NO. 3.

4. A method of constructing a recombinant Lactobacillus plantarum strain according to any one of claims 1-3, comprising:

5. The method according to claim 4, wherein in step S1, the nucleotide sequence of pgsA' -HN-DCpep is shown in SEQ ID NO. 2; the amino acid sequence of the pgsA' -HN-DCpep coding protein is shown in SEQ ID NO. 3;

in the step S2, the lactobacillus plantarum is specifically lactobacillus plantarum NC 8.

6. A fermentation production method of the recombinant lactobacillus plantarum of any one of claims 1-3, comprising the steps of supplementing sugar and alkali to fermentation liquor during fermentation of the recombinant lactobacillus plantarum;

preferably, in the liquid fermentation process, an inducer is added 4h after inoculation, alkali is supplemented 4-10h after inoculation, the pH value is adjusted to 4.5-6.0 by alkali supplementation, glucose is added 8-10h, so that the final concentration of the glucose in the fermentation liquor is 1.0% -5.0%, and then natural fermentation is carried out;

preferably, the optimal culture medium for the production of the recombinant lactobacillus plantarum is an MRS medium.

7. A microbial preparation comprising the recombinant lactobacillus plantarum strain according to any one of claims 1 to 3, or a fermentation product thereof, or a metabolite thereof;

the microbial inoculum is liquid or solid, preferably solid, and further preferably freeze-dried powder.

8. Use of the recombinant lactobacillus plantarum of any one of claims 1-3 and/or the microbial inoculum of claim 7 in the preparation of an antiviral product.

9. An antiviral product comprising the recombinant Lactobacillus plantarum strain of any one of claims 1 to 3 and/or the microbial inoculum of claim 7;

preferably, the product is an animal vaccine, feed additive or feed;

further preferably, the animal vaccine is a chicken vaccine, and the dosage form of the vaccine can be oral freeze-dried powder;

the virus includes newcastle disease virus.

10. Use of the recombinant lactobacillus plantarum of any one of claims 1-3, the bacterial agent of claim 7 and/or the antiviral product of claim 9 in any one of: