CN112239742B - Bacillus licheniformis for producing alkaline protease and application thereof - Google Patents
Bacillus licheniformis for producing alkaline protease and application thereof Download PDFInfo
- Publication number
- CN112239742B CN112239742B CN202010857565.7A CN202010857565A CN112239742B CN 112239742 B CN112239742 B CN 112239742B CN 202010857565 A CN202010857565 A CN 202010857565A CN 112239742 B CN112239742 B CN 112239742B
- Authority
- CN
- China
- Prior art keywords
- gene
- bacillus licheniformis
- apre
- positions
- upp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1077—Pentosyltransferases (2.4.2)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2451—Glucanases acting on alpha-1,6-glucosidic bonds
- C12N9/2457—Pullulanase (3.2.1.41)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/52—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
- C12N9/54—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea bacteria being Bacillus
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01016—Chitin synthase (2.4.1.16)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/02—Pentosyltransferases (2.4.2)
- C12Y204/02009—Uracil phosphoribosyltransferase (2.4.2.9)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01001—Alpha-amylase (3.2.1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01041—Pullulanase (3.2.1.41)
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the field of genetic engineering, and particularly relates to bacillus licheniformis for producing alkaline protease and application thereof. The host cell adopted by the strain is constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and deleting 9 genome islands on the basis of Bacillus licheniformis (Bacillus licheniformis) 2709 so as to realize genome simplification of the host cell. The aprE expression cassette is constructed and integrated in the transformed host strain, the enzyme activity of the double-copy recombinant strain is improved by 37.45 percent compared with that of the host, and the enzyme activity of the triple-copy recombinant strain is improved by 9.36 percent compared with that of the double-copy recombinant strain.
Description
The technical field is as follows:
the invention belongs to the field of genetic engineering, and particularly relates to bacillus licheniformis for producing alkaline protease and application thereof.
Background art:
licheniformis 2709 industrial microorganisms, derived from natural environments such as soil and the like, develop a series of unacclimated undesirable characteristics during evolution, including: 1) Foams are easily formed in the fermentation process, so that extremely high fermentation pollution risk is caused; 2) Spores are easily formed during the nutritional deficiency, further accumulation of target products is influenced, and the killing cost of fermentation equipment is increased; 3) A large amount of viscous substances are formed to hinder the growth of thalli and the synthesis of products, and the requirements of stirring and dissolved oxygen are increased in large-scale industrial production; 4) A large amount of extracellular proteins and the like are secreted and synthesized, which undoubtedly seriously influences the synthesis and accumulation of target products, increases the requirements and difficulty of industrial operation, and is not favorable for the overall benefit of industrial production.
In recent years, researchers have conducted intensive studies on genetic improvement of production strains in order to obtain industrial microbial cell factories having excellent performance. Zhang et al affect foam formation by knock-out of a lipidThe peptide coding gene srfA optimizes the production performance of an unacclimated wild strain B.subtilis ATCC 6051 a; illing et al increased the enzyme synthesis capacity by deleting the spore forming key control gene sigE; b. subtilis WB 800 Belongs to a strain deficient in multiple proteases, which obviously promotes the accumulation of other extracellular secreted proteins.
In addition, b.licheniformis could theoretically benefit more from genome simplification, since it is able to synthesize a large number of secondary metabolites that are not essential for cell life activities. Therefore, the molecular improvement of the industrial microorganism host from the molecular level has important significance for improving the production performance of the microorganism cells.
Genome simplification engineering is mainly carried out in prokaryotic cells, particularly model strains such as E.coli and B.subtilis and the like, and certain achievements are achieved, and reports aiming at genome simplification of an industrial strain B.licheniformis 2709 are not found. The analysis of the host genome shows that a large number of non-essential genes such as isolated island genes, redundant genes, pseudogenes and the like and genes for controlling the synthesis of secondary metabolites exist, so that the cell metabolism burden and energy consumption are greatly increased, the waste of nutrient resources is caused, and the growth and fermentation performance of cells are further influenced. Therefore, it is feasible and valuable to realize the construction of the basal plate cells in a specific culture medium by means of a minigenome technology.
At present, genome simplification engineering is mainly carried out in prokaryotic cells, and no report on genome simplification of an industrial strain B.licheniformis 2709 is found. The analysis of the host genome shows that a large number of nonessential genes such as isolated island genes, redundant genes, pseudogenes and the like and genes for controlling the synthesis of secondary metabolites exist, so that the cell metabolic burden and energy consumption are greatly increased, the waste of nutrient resources is caused, and the growth and fermentation performance of cells are influenced.
The invention determines related control genes by analyzing and identifying the bad performance affecting the host fermentation production, and efficiently deletes related coding genes by adopting the established genetic operation system so as to eliminate the bad production characteristics of host cells and improve the fermentation production performance; and the possible non-essential genes such as the island gene and the like are analyzed and determined by combining the genome information of the host cell, and the effective genome simplification is realized by adopting a small genome technology, thereby laying a foundation for constructing the chassis cell suitable for the industrial production of the enzyme preparation.
The invention content is as follows:
in order to achieve the above object, the present invention provides a Bacillus licheniformis host bacterium suitable for industrial production, wherein the Bacillus licheniformis host bacterium is constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC, upp genes and deleting 9 genome islands to realize genome simplification of host cells on the basis of Bacillus licheniformis (Bacillus licheniformis) 2709;
the eps gene is positioned at the 1967676-1983603 site of the whole genome sequence of Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP033218;
the pgs gene is positioned at positions 1805920-1808919 on the whole genome sequence of Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP033218;
the Genbank accession number of the sigF gene is CP033218.1 (located at positions 3898937-3899704 on the whole genome sequence);
the Genbank accession number of the chiA gene among the chiAB genes is WP _003178684.1, the Genbank accession number of the chiB gene is WP _003178682.1 (the chiAB gene is located at positions 909808-913767 on the whole genome sequence);
the Genbank number of the pulA gene is WP _009329394.1 (located at 2420607-2422739 on the whole genome sequence);
the Genbank accession number of the amyA gene is WP _025807921.1 (positions 582978-584516 on the whole genome sequence);
the lchAC gene has Genbank accession number WP _020450107.1 for lchA gene and WP _016886081.1 for lchA gene (the lchAC gene is positioned at 834378-849050 positions on the whole genome sequence);
the Genbank accession number of the upp gene is WP _026589089 (from 1714807 to 1715436 on the whole genome sequence);
the 9 genome islands are GI01 positioned at 3,429,766-3,435,147 positions on a genome of a Bacillus licheniformis (Bacillus licheniformis) 2709; GI02 at positions 3,671,385-3,675, 741; GI03 at positions 3,708,534 to 3,716, 479; GI04 at positions 4,292,644-4,304, 905; GI05 at positions 4,305,616-4,341,077; GI06 at positions 1,117,114-1,157,920; GI07 at position 3,560,703-3,567,132; GI08 at positions 4,071,504-4,088, 125; GI09 at positions 1,933,894-1,951,991, the position numbers correspond to the position codes of the whole genome sequence of Bacillus licheniformis (Bacillus licheniformis) 2709, namely TCCC11148 in GenBank CP033218.
The invention also provides application of the bacillus licheniformis host cell, in particular application in expressing the alkaline protease AprE.
The invention provides another technical scheme, which is a bacillus licheniformis for producing alkaline protease, and the bacillus licheniformis with eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes knocked out and 9 genome islands deleted is taken as a host cell, and the aprE is integrated at a chromosome position I (2419710-2422710 bp) of the genome at the central symmetric position of the aprE) to form a mutant strain GR15-2 carrying two expression cassettes; and on the basis of GR15-2, after integration of aprE at chromosomal site III (the central symmetric position of the replication initiation site of genome (3396863-3397860 bp)), a mutant strain GR15-3 carrying three expression cassettes was constructed.
The Genbank accession number of the aprE gene is CP033218;
the invention also provides a method for producing the alkaline protease aprE by the strain GR15-2 and the strain GR15-3, which comprises the following steps:
fermentation medium: 0.7g/L of Homoya amylase, 64g/L of corn flour, 40g/L of soybean meal, 4g/L of disodium hydrogen phosphate and 0.3g/L of potassium dihydrogen phosphate.
And (3) shake flask fermentation: the strain is streaked on an LB plate in three regions, inverted cultured at 37 ℃ overnight, a newly activated single colony is picked up to be placed in 5mL of LB culture medium, shaking cultured for 12 hours at 37 ℃ and 220r/min, the strain is transferred to 50mL of LB liquid culture medium with the inoculum size of 2 percent until the OD600 reaches 0.8-1.0, then the strain is transferred to a baffle bottle of 100mL of fermentation culture medium with the inoculum size of 2 percent, and shaking cultured for 40-60 hours at 37 ℃ and 220 r/min.
Fermentation in a fermentation tank: inoculating the strain into a shake flask filled with a liquid LB culture medium (50 mL/250 mL) and performing shaking culture at 37 ℃ for 8h, taking a bacterial liquid, streaking the bacterial liquid on a three-region of a skim milk plate, and performing standing culture at 37 ℃ for 36h; selecting a single clone with a relatively large transparent ring on a flat plate, placing the single clone into a shake flask filled with a liquid LB culture medium (50/250 mL), carrying out shake culture at 37 ℃ for 8h to obtain a seed solution, transferring the seed solution into the shake flask filled with a fermentation culture medium (100/500 mL) in an inoculation amount of 4%, and carrying out shake culture at 37 ℃ for 7-8h; inoculating the culture solution into 3/5L fermentation medium at an inoculum size of 5%, and supplementing material to control fermentation (when sugar concentration is less than 15%, supplementing 30% dextrin and 5% cottonseed protein); controlling the pH to be 7.3, the temperature to be 37 ℃, the residual sugar to be 15 percent and the dissolved oxygen to be 35 percent in the fermentation process, and fermenting for 40-72 hours.
Has the advantages that:
the invention provides a genetic modification method for B.licheniformis 2709 cells, which effectively improves the fermentation production performance and fermentation process control of the important industrial microorganisms. Taking the production of AprE as an example, eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and 9 genome island knockout bacteria GR15 have the enzyme activity of 32494 +/-1013U/mL on the fermentation liquor of AprE, the high-yield enzyme period is as long as 16h, and the enzyme activity is improved by 36% compared with that of a control bacterium. After 40h shake flask fermentation, the enzyme activity of GR15-2 is improved by 37.45% compared with GR15, and the enzyme activity of GR15-3 is improved by 9.36% compared with GR15-2, namely when the genome of GR15 expression host carries three aprE expression cassettes, the enzyme activity can reach 25736 +/-997U/mL at most, and is improved by 1.36 times compared with the original strain BL delta upp.
Description of the drawings:
FIG. 1 upp Gene knockout and validation
Wherein: a, constructing a knockout vector; b, screening process of upp mutant: wherein M is a nucleic acid Marker, lanes 1-3 are vector construction verification results, 1100bp;4-5 are single exchange verification results, 1300bp,6 are negative controls, no band; 7-8 is the double exchange verification result, 1250bp,9 is the negative control, 1900bp;
FIG. 2 upp Gene knockout procedure;
FIG. 3 upp reverse screening vector construction and validation
Wherein: a, constructing a upp reverse screening vector; and B, verifying a reverse screening vector: wherein, lanes 1-3 are the PCR verified results, and the size of the band is about 930bp; c is the result of the sensitivity analysis of the anaplerotic recombinant bacteria to 5-FU;
FIG. 4 construction of eps mutants
Wherein: a, knockout vector verification: wherein, M is Marker; lane 1 is a negative control, no band; 2-4 are positive clones, the band size is about 910bp; b, screening and verifying the mutant: wherein, lane 1 is the single-crossover screening control, 2-3 is the correct single-crossover recombinant bacteria, about 1840bp;4-6 are correctly double-exchanged mutants with a band size of about 1970bp;
FIG. 5 Effect of ChiAB deletion on AprE expression;
FIG. 6 impact of chiAB, pulA and amyA deletions on aprE expression;
FIG. 7 shows the change in cell morphology;
FIG. 8 growth and AprE synthesis of different strains;
FIG. 9 growth and enzyme production assays for BL Δ upp Δ eps Δ pgs;
FIG. 10 growth and enzyme production analysis of BL Δ upp Δ lch;
FIG. 11 enzyme-producing ability analysis of GR06;
FIG. 12 GR15 fermenter produces alkaline protease;
FIG. 13 insertion position of aprE expression cassette in the genome;
FIG. 14 Single and double crossover screening validation of integration mutants
Wherein: a, integrating an aprE expression cassette at a position I to construct a GR15-2 mutant verification result: wherein, M and the nucleic acid Marker are 250, 500, 750,1000, 1500, 2000, 2500, 3000, 3500, 4000, 5000, 6000, 8000 and 10000bp from bottom to top in sequence; lanes 1 and 2 are the correct single-crossover recombinant bacteria, 730bp,3 is the negative control, no band; 4 and 5 are double-exchange mutants verified by adopting a primer pair V-F1/A-R, 700bp;6 and 7 are double-exchange mutants verified by adopting a primer pair A-F/V-R1, and are 730bp; b, continuing to integrate the aprE expression cassette at the position III to construct a GR15-3 mutant verification result: wherein lanes 1 and 2 are correctly single-crossover recombinant bacteria, 700bp,3 are negative controls, no band; 4 and 5 are double-exchange mutants verified by adopting a primer pair V-F3/A-R, and are 750bp;6 and 7 are double-exchange mutants verified by adopting a primer pair A-F/V-R3, and are 750bp;
FIG. 15 Single and double exchange screening validation primer design;
FIG. 16 aprE expression levels of different gene copy number mutants.
The specific implementation mode is as follows:
in order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. The specific embodiments described herein are merely illustrative of the present patent and do not delimit the present invention.
The invention constructs a knockout vector by using shuttle plasmids pWH1520 and pTU; taking the expression and secretion condition of the alkaline protease AprE and the existence of the poor fermentation character as indexes, knocking out regulatory elements with adverse effect or nonsense, namely eps, pgs, sig, chi, pulA, amy, lch and upp genes and 9 genome islands to simplify the genome of a host cell. The relevant genome conditions are shown in tables 1 and 2.
TABLE 1 genetic information for improved deletion of host traits
Note: the upp gene encodes uracil phosphotransferase, the EPS gene encodes EPS synthetic protease, the pgs gene encodes polyglutamate synthesis-related enzyme, chiAB encodes chitinase synthase, pulA encodes pullulanase, amyA encodes alpha-amylase, lchAC encodes lichenin synthase, and sigF encodes Spo0IIAC protein.
TABLE 2 analysis of the invention to determine knock-out genomic islands
The primers of the present invention are shown in Table 3.
TABLE 3 Primary primers of the invention
Not underlined is a restriction enzyme
The fermentation method comprises the following steps:
fermentation medium: 0.7g/L of Homoya amylase, 64g/L of corn flour, 40g/L of soybean meal, 4g/L of disodium hydrogen phosphate and 0.3g/L of potassium dihydrogen phosphate.
And (3) shaking flask fermentation: carrying out three-zone streaking on a strain on an LB (lysogeny broth) plate, carrying out inverted culture at 37 ℃ overnight, selecting a newly activated single colony in 5mL of LB culture medium, carrying out shaking culture at 37 ℃ for 12h at 220r/min, transferring the newly activated single colony in 50mL of LB liquid culture medium until OD600 reaches 0.8-1.0, transferring the newly activated single colony in 2% of inoculum size in a baffle bottle of 100mL of fermentation culture medium, carrying out shaking culture at 37 ℃ at 220r/min, carrying out fixed-point sampling according to experiment requirements, centrifuging at 4 ℃ at 12000r/min for 2min, taking a supernatant, and properly diluting to determine the activity of alkaline protease.
Fermentation in a fermentation tank: the strain to be tested is inoculated in a shake flask filled with liquid LB culture medium (50 mL/250 mL) and is subjected to shake culture at 37 ℃ for 8h. Taking a bacterial liquid, marking on three zones of a skim milk plate, and performing static culture at 37 ℃ for 36 hours; the single clone with the relatively large transparent ring on the plate is picked up and put into a shake flask filled with liquid LB culture medium (50/250 mL), the shake culture is carried out for 8h at 37 ℃ to obtain seed liquid, the seed liquid is transferred into the shake flask filled with fermentation culture medium (100/500 mL) with the inoculum concentration of 4 percent, and the shake culture is carried out for 7-8h at 37 ℃. Inoculating the culture solution into 3/5L fermentation medium at an inoculum size of 5%, and feeding to control fermentation (when sugar concentration is less than 15%, feeding 30% dextrin and 5% cottonseed protein). During the fermentation process, the pH value is controlled to be 7.3, the temperature is controlled to be 37 ℃, the residual sugar content is 15 percent, and the dissolved oxygen content is 35 percent.
The method will be further explained by specific examples.
Example 1 construction of the Strain BL Δ upp Δ eps
1. Construction of upp reverse screening vectors
The coding gene upp of uracil phosphoribosyl transferase is selected as a reverse screening marker, host cells are required to delete the gene, and the construction of the upp gene knockout vector is shown in figure 1-A. The upstream and downstream homology arms of the uppLH-F/uppLH-R gene and uppRH-F/uppRH-R gene are respectively amplified by primer pairs uppRH-F/uppRH-R, recombined and connected with a T2 (2) -ori plasmid fragment (the plasmid and the construction method thereof are disclosed in Chinese patent CN201810898060.8, a malR-knocked bacillus licheniformis strain, the construction method and the application thereof), wherein the recovered T2 (2) -ori plasmid fragment is digested by BamHI/SacII to form a knocked-out vector pKSVT-delta upp, PCR verification is carried out by using the primer uppLH-F/uppRH-R, the size of a correct strip is about 1100bp (figure 1-B), after the sequencing verification, the correct strip is transferred to escherichia coli EC135 pM. Bam methylation modification, and finally the cell is electrically transferred to a host bacillus licheniformis 2709 competent cell, and a 25 mu g/mL Kan resistance plate is statically cultured at 37 ℃ for about 12h.
Picking the transformants on the plate to 5mL LB medium with the same resistance concentration, culturing for 10h at 45 ℃ (1 generation); 10 μ L of the suspension was aspirated and transferred to LB medium under the same conditions, and the culture was continued at 45 ℃ for about 10 hours. Diluting the culture solution, coating Kan plate, standing at 45 deg.C, and culturing to obtain single exchange strain. However, in order to avoid non-specific integration, the primer pair upp-VF/VR was used to perform colony PCR for single crossover verification, and the result is shown in FIG. 1-B, the size of the DNA band of the successful single crossover recombinant bacteria is about 1300bp, and the negative control using the competent genome as the template has no band, which indicates that specific single crossover occurs. Correctly single-crossed colonies were picked to 5mL of nonresistant LB medium for 2 passages of about 24h with shaking (1 intermediate transfer). After the subculture was completed, the culture solution was diluted and spread on an anti-LB-free plate, and incubated at 37 ℃ for about 12 hours. Colony PCR verification is carried out on a monoclonal on a flat plate by using a primer upp-VF/upp-VR, as shown in a figure 1-B, the size of a DNA strip of a wild strain is about 1900bp, the size of an amplified fragment of a mutant strain is about 1250bp due to the deletion of upp gene, the successful occurrence of double exchange is indicated, the strain subjected to the deletion of upp gene is further sequenced and verified to be named as B.licheniformis delta upp (hereinafter, referred to as BL delta upp) as a starting strain for subsequent molecular modification, and accordingly, a gene editing process marked as a basis by a temperature-sensitive vector and a reverse screening marker is induced, as shown in a figure 2.
The strong PS promoter screened in the laboratory (PS promoter gene sequence:
<xnotran> gtcacaatgcgccatcaaaccgttgacaagcgtccccgtcagatggccgggagccggatgaaccaccattccgcgcggcttgttgacgacaagaacgtcctgatcttattataatataagcaaaaaactcataaaaaggaaaagcattgacctgaaaacttatcggtaaagtatgatataatacaaaaagaccgattagaggggagagaggaaac) upp , uppPS-F/uppPS-R upp-F/upp-R, PS upp , KpnI/SalI pKSVT , EC135. </xnotran> PCR verification is carried out by using the primer uppPS-F/upp-R, the result is shown in figure 3-B, if the size of the constructed correct band is about 930bp, the vector is named pTU after further sequencing confirmation (the construction process is shown in figure 3-A), and the vector is the upp reverse screening vector. FIG. 3-C shows the results of the sensitivity analysis of the anaplerotic recombinant bacteria to 5-FU: respectively converting the methylation modified vectors pTU and pKSVT into BL delta upp to obtain transformants BL delta upp-U and BL delta upp-T, respectively selecting monoclonals of two recombinant bacteria to liquid culture media with Kan resistance of 25 mu g/mL, carrying out shake culture at 37 ℃ for 12h, detecting OD600 of the two recombinant bacteria, adjusting the OD600 to be the same, and respectively diluting and pouring three LB culture media containing 20 mu g/mL 5-FU, 25 mu g/mL Kan and 20 mu g/mL 5-FU +25 mu g/mL Kan. As shown in the graph C, the influence of pKSVT on the 5-FU sensitivity of BL delta upp is small, and the growth condition of the recombinant bacteria in the three culture media is not obvious. Complementation of pTU restored the sensitivity of BL Δ upp to 5-FU, but when Kan was not added to the medium, BL Δ upp-U was able to grow partially on the 5-FU plate, probably due to loss of plasmid in the absence of resistant stimuli. Plasmid complementation experiments show that the upp gene can be used as a reverse screening marker to be applied to BL delta upp.
2. eps Gene Cluster knockout
Respectively amplifying the upstream and downstream sequences of the eps gene by using primers eps-LF/LR and eps-RF/RR, recombining and connecting the sequences with a vector pTU recovered by enzyme digestion to further obtain a knockout vector pTU-delta eps, wherein the enzyme digestion verification result of the vector is shown in figure 4-A, and the plasmid with correct enzyme digestion verification is converted into BL delta upp after methylation modification. The result of colony PCR verification single-double exchange is shown in FIG. 4-B, and the size of a theoretical band is 1840bp because the plasmid of the successfully single-exchanged strain is integrated on the chromosome and PCR amplification is carried out by using a single-exchange verification primer eps-VF/VR; the strains which are subjected to double exchange and successfully lose plasmids can grow on a 5-FU plate, colony PCR is carried out by adopting primers eps-VF/eps-VR, the PCR band size of the successfully mutated strains is about 1970bp, the wild strains have no band, and the strains with positive PCR results are subjected to PCR and sequencing again to confirm that the correct knockout strains are named as BL delta upp delta eps.
The knockout methods of the chiAB, the pgs, the lchAC and the 9 genome islands are the same as the knockout of the eps gene cluster, only the homologous arm primers are replaced by the corresponding primers in the table 3 (the verification primers are also correspondingly replaced), and the knockout of the pulA, the amyA and the sigF is the CRISPR/Cas9 gene editing method, so that all strains in the table 1 are constructed.
Example 2 Effect of deletion of different genes on biosynthesis of alkaline protease AprE
1. Effect of major extracellular protein deletion on AprE biosynthesis
(1) In order to examine the influence of chitinase deletion on the secretion and expression of the host AprE, the aprE transcription level and the AprE enzyme activity of a chiaB deletion strain BL delta upp delta chi and a control strain BL delta upp fermented and cultured for 48h are respectively detected, and the result is shown in FIG. 5. The result shows that the deletion of chitinase has no obvious effect on the transcription level of aprE, but the enzyme activity (13952U/mL) is improved by 24.23 percent compared with that of control bacteria (11231U/mL).
(2) In order to examine the influence of deletion of pullulanase (PulA) and alpha-amylase (AmyA) on the secretion and expression of the host AprE, a pulA deletion strain BL delta upp delta chi delta pul delta amy is constructed on the basis of BL delta upp delta chi, and the aprE transcription level and the aprE enzyme activity of the BL delta upp delta pul delta amy and a control strain BL delta upp fermentation culture for 48 hours are respectively detected, and the result is shown in FIG. 6. The result shows that the protease activity (14792U/mL) of BL delta upp delta chi delta pul delta amy is improved by 34.10% compared with the control (11033U/mL) and is improved by 5.6% compared with BL delta upp delta chi (13952U/mL), however, the aprE transcription level is not obviously different from the control, which indicates that pulA and amyA are deleted, the synthesis and secretion of target protein aprE are promoted, and the aprE enzyme activity in fermentation liquor is obviously improved.
2. Effect of spore deficiency on AprE biosynthesis
In order to research the influence of spore initiation and spore formation on BL delta upp alkaline protease synthesis, the invention adopts a CRISPR/Cas9 gene editing method (a single-plasmid CRISPR/Cas9 genome editing system is utilized to realize high-efficiency editing on a B.licheniformis 2709 genome, sigF is selected as a target gene, a knockout vector is designed, related elements comprise a spcas9 gene and a promoter P43 thereof, a specific targeting sgRNA and a transcription promoter PS thereof (not containing RBS), homologous repair sequences HA formed by upstream and downstream homologous arms of about 500bp respectively synthesized by using sigF-LF, sigF-LR, sigF-RF and sigF-RR as primers are constructed to a shuttle vector pWH1520 one by one, related primers and functions are shown in tables 1-3), a spore initiation signal is knocked out to control gene spores to form a specific sigma factor coding gene sigF, and the sigma factor is activated and expressed in the front cell after asymmetric division signal transmission. Defective mutant, named BL Δ F.
(1) The bacterial morphology and spore formation rate of the mutant after different periods of LB liquid culture are shown in figure 7, and the diagram shows that BL delta F bacterial morphology changes similarly, the bacterial morphology does not have obvious difference with that of a contrast bacterium when the mutant is cultured for 12h, but the bacterial staining is not uniform after the mutant is cultured for 24h, some areas are not easy to be colored, but mature spores are not formed, which indicates that spores form a specific sigma factor and interrupt the signal of spore maturation. Importantly, spore counting results show that spore formation rates of the mutants are all 0, and further show that the mutants are successfully constructed.
(2) In order to verify the synthesis capability of alkaline protease of different mutant strains, synthesis conditions of AprE at different fermentation times are investigated, and enzyme activity changes at different times are detected (FIG. 8A); meanwhile, in order to analyze the cause of the differences in AprE expression levels, the viable counts at different enzyme production time points were counted, as shown in fig. 8B. The result shows that the maximum enzyme activity of the sigF deletion mutant is improved by 24.38 percent compared with that of a control, the maximum enzyme activity reaches a peak value after being cultured for 40 hours, the enzyme production stable period can be kept for about 12 hours, the enzyme activity reaches the peak value after the control bacteria are cultured for 46 hours, and the enzyme production stable period only lasts for about 6 hours. And analyzing the growth condition of the bacteria, and finding that the viable count of the BL delta F mutant in the growth stabilization phase is higher than that of the control bacteria, and the biomass is slowly reduced in the growth later phase. In conclusion, the mutant keeps good protease synthesis capability due to interruption of sporulation signals, the enzyme activity of the mutant is reduced, and the biomass of the mutant at the later growth stage is obviously higher than that of a control bacterium. This indicates that the synthesis of AprE is not affected by the deletion of sigF, and the synthesis cycle is greatly prolonged, which is beneficial to industrial production and can provide excellent strains for industrial enzyme preparation production.
3. Blocking the Effect of extracellular viscous substance Synthesis on AprE Synthesis
In order to investigate the influence of deletion of Exomucopolysaccharide (EPS) or polyglutamic acid (PGA) on the secretory expression of AprE of a host, a strain for knocking out an EPS gene cluster (epsA-epsO, genome position 1967676-1983603, about 16 kb) in BL delta upp is constructed, and the knocked-out strain is named as BL delta upp delta EPS; the about 3.0kb γ -PGA synthesis gene cluster pgs (genomic positions 1805920-1808919) was deleted on the basis of BL Δ upp Δ eps. The pgs knock-out mutant strain was named BL Δ upp Δ eps Δ pgs.
The results of detecting the viable count and the activity change of the alkaline protease of BL delta upp delta eps delta pgs and BL delta upp fermentation culture at different time are shown in FIG. 9. As can be seen from the figure, the biomass of BL delta upp delta eps delta pgs is obviously improved by 18.49 percent compared with that of a contrast bacterium, the dissolved oxygen level of fermentation liquor is obviously improved probably due to the elimination of viscous substances such as polyglutamic acid and the like, and the consumption of ATP (adenosine triphosphate) caused by the synthesis of a macromolecular polymer is reduced, so that the synthesis of AprE is further enhanced, the maximum enzyme activity is improved from 11320.7 +/-347U/mL to 14309.3 +/-386U/mL, and is improved by about 26.40 percent; in addition, the increase of the dissolved oxygen of the mutant bacteria fermentation liquor leads the biomass to be effectively accumulated, so that the time (42 h) of the peak value of the enzyme activity is 6h (48 h) earlier than that of the control bacteria. The viscosity of viscous substances in fermentation liquor, especially polyglutamic acid, is one of the bottlenecks in the efficient industrial production of target protein, and the viscous substances seriously obstruct the transfer of oxygen in the fermentation environment and further influence the intracellular available ATP concentration. Therefore, by deleting the coding gene for controlling the synthesis of the viscous substance, the secretory synthesis of the viscous substance can be effectively blocked, and the influence on the synthesis and accumulation of a target product caused by the adverse character in the production process can be avoided.
4. Effect of foam formation defects on AprE Synthesis
In order to examine the influence of the deletion of the lichenin encoding gene lchAC on the secretory expression of the host AprE, a knock-out vector pTU-delta lch is constructed, and a lchAC deletion mutant strain BL delta upp delta lch is further obtained. The change conditions of viable count and activity of alkaline protease of BL delta-upp delta-lch and BL delta-upp fermentation culture at different time are detected, and the result is shown in figure 10, wherein the growth and protease synthesis capacity of the lichenin deletion mutant and the control bacterium are not significantly different.
The effect of lch deletion on foam formation of the strain, as well as the changes in mutant growth and enzyme production levels were examined by separate fermentation in a 5-L fermentor. The result shows that the foam amount of the mutant is greatly reduced, about 30 mu L and 250 mu L of the defoaming agent are respectively added into the mutant and the mutant at one time under the same condition, and the using amount of the defoaming agent is reduced by 87.5 percent. This is enough to show that the lch deletion mutant greatly reduced the amount of foam formed, facilitating control of the fermentation process.
5. Stacked knockout of undesirable trait-encoding genes
And knocking out eps, pgs, sigF, chiAB, pulA, amyA and lchAC genes one by taking the host BL delta upp as an initial strain to obtain the strain BL delta upp delta eps delta pgs delta sig delta chi delta pulA delta amy delta lch, which is GR06 for short. In order to further compare the synthesis capacity of GR06 and the control bacterium BL delta upp protease, the enzyme activities of the two bacteria for synthesizing and secreting AprE are examined through shake flask fermentation, and the results are shown in figure 11, which shows that the alkaline protease activity (18473 +/-503U/mL) of GR06 is improved by about 64.57% compared with the control (11225U/mL), the appearance time of the enzyme production peak value is advanced by 6-8h, and the enzyme production stable period is prolonged by 1 time compared with the control. Therefore, the integration of undesirable traits affecting productivity is eliminated, and excellent fermentation performance is integrated into the same host cell, thereby greatly promoting the synthesis and secretion of protease.
Example 3 knock-out of genomic islands
And sequentially knocking out the determined isolated island genes by using GR06 as a starting strain and adopting the established temperature-sensitive gene editing system, knocking out and verifying by using T-F/T-R as a single-exchange recombinant bacterium verification primer, constructing strains GR07-GR15 as shown in Table 2, and realizing the genome simplification degree of 4.3%. In order to further compare the synthesis capacities of GR15 and the control bacterium BL delta upp protease, the enzyme activities of the GR15 and the control bacterium BL delta upp protease for synthesizing and secreting AprE are examined through fermentation in a 5L fermentation tank, and the results are shown in FIG. 12, which shows that the synthesis capacity of GR15 to AprE is enhanced through fermentation in the 5L fermentation tank, the enzyme activity can reach 32494 +/-1013U/mL, the high-yield enzyme period is as long as 16h, and the enzyme activity of the control bacterium BL delta upp protease is 23821 +/-635U/mL.
Example 4 construction of multiple copies of aprE Gene strains
In order to investigate the influence of the aprE gene concentration in the genome on the aprE biosynthesis, the constructed expression host GR15 is used as a starting strain, and the number of aprE expression cassettes on the chromosome is increased by one-by-one overlapping integration.
Three different genomic positions were determined analytically based on information such as genome function annotation (GenBank number: CP 033218), as shown in FIG. 13. The integration of aprE at chromosomal position I (central symmetric position of aprE genome number (2419710-2422710 bp)) constitutes a mutant strain GR15-2 carrying two expression cassettes; the mutant strain GR15-3 carrying three expression cassettes was then constructed after integration of aprE at chromosomal site III (location of the genome centrosymmetric to the replication initiation site (3396863-3397860 bp)).
The screening process of the two integrated mutants is respectively shown as a figure 14-A and a figure 14-B, a specific single-exchange recombinant strain and a mutant which correctly generates double-exchange are screened by PCR, primers at two ends of an expression cassette, a 5 'end A-R and a 3' end A-F are adopted, the design positions of the primers are shown as a figure 15, a single-exchange and double-exchange verification primer pair is formed, whether correct single-exchange and correct double-exchange occur is verified by colony PCR, two pairs of primers are required to be simultaneously adopted for amplification verification, only one pair of primers can amplify a strip when single-exchange occurs, a target strip 700-900 bp is required to be simultaneously amplified when double-exchange occurs, if single-exchange and double-exchange occur in error, PCR amplification fails, and the figure 14 shows that the construction of the two superposed integrated mutants is successful.
And (3) inspecting the AprE enzyme activity and the aprE gene transcription level of GR15, GR15-2 and GR15-3 after 40h of shake flask fermentation culture, and detecting the expression level of three strains of integration mutation bacteria aprE, wherein the result is shown in figure 16. As can be seen from the figure, the enzyme activity of GR15-2 (23594 +/-673U/mL, 40 h) is improved by 37.45 percent compared with that of GR15 (17231 +/-487U/mL, 40 h), and the enzyme activity of GR15-3 (25736 +/-997U/mL, 40 h) is improved by 9.36 percent compared with that of GR15 (17231 +/-487U/mL, 40 h), namely when the genome of a GR15 expression host carries three aprE expression cassettes, the enzyme activity can reach 25736 +/-997U/mL (40 h) to the maximum, and is improved by 1.36 times compared with the starting strain BL delta upp (11225 +/-387U/mL, 48 h).
The aprE transcription level in GR15 is set to be 1,GR15-2 and the aprE gene transcription level in GR15-3 is respectively improved by 1.6 times and 2.7 times compared with GR15, and the aprE transcription level in GR15-3 is improved by 4.05 times compared with the original strain. The method proves that the aprE gene concentration has obvious influence on the expression in the fermentation process, and the expression level of the aprE gene can be improved by reasonably increasing the gene copy number.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.
Claims (7)
1. The Bacillus licheniformis for producing the alkaline protease is characterized in that the adopted host bacteria are constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and deleting 9 genome islands simultaneously on the basis of Bacillus licheniformis 2709 so as to realize genome simplification of host cells;
the eps gene is positioned at the 1967676-1983603 site of the whole genome sequence of the bacillus licheniformis 2709, namely the TCCC11148 in GenBank CP033218;
the pgs gene is positioned at 1805920-1808919 on the whole genome sequence of Bacillus licheniformis 2709 (namely TCCC 11148) in GenBank CP033218;
the sigF gene is positioned on 3898937-3899704 positions on the whole genome sequence;
the chiAB gene is positioned at positions 909808-913767 in the whole genome sequence;
the pulA gene is positioned at 2420607-2422739 th site on the whole genome sequence;
the amyA gene is positioned at positions 582978-584516 in the whole genome sequence;
the lchAC gene is located at position 834378-849050 in the whole genome sequence;
the upp gene is positioned at 1714807-1715436 in the whole genome sequence;
the 9 genome islands are GI01 positioned at 3,429,766-3,435,147 positions on the genome of the bacillus licheniformis 2709; GI02 at positions 3,671,385-3,675, 741; GI03 at positions 3,708,534 to 3,716, 479; GI04 at positions 4,292,644-4,304, 905; GI05 at positions 4,305,616-4,341,077; GI06 at positions 1,117,114-1,157, 920; GI07 at position 3,560,703-3,567,132; GI08 at positions 4,071,504-4,088, 125; GI09 at positions 1,933,894-1,951,991;
the position numbers correspond to the position codes of the whole genome sequence of the Bacillus licheniformis (Bacillus licheniformis) 2709, namely TCCC11148 in GenBank CP033218.
2. The Bacillus licheniformis for producing alkaline protease according to claim 1, characterized in that the integration of aprE in the chromosomal location I of the host cell, i.e. in the genome at bp 2419710-2422710, results in the mutant strain GR15-2 carrying two aprE expression cassettes.
3. The Bacillus licheniformis for producing alkaline protease according to claim 2 characterized by the fact that after integration of aprE in chromosome position III, the central symmetry of the replication origin, in the genome at position 3396863-3397860bp, mutant strain GR15-3 carrying three expression cassettes is obtained.
4. Use of a Bacillus licheniformis strain for producing alkaline protease according to claim 2 or 3.
5. The use according to claim 4, wherein the alkaline protease aprE is produced by shake flask fermentation by:
after being activated, the strain is transferred to 50mL LB liquid culture medium with the inoculum size of 2 percent until the OD600 reaches 0.8-1.0, then transferred to 100mL fermentation culture medium with the inoculum size of 2 percent, and is subjected to shaking culture at 37 ℃ and 220r/min for 40-60h.
6. The use according to claim 4, wherein the alkaline protease aprE is produced by fermentation in a fermenter by:
transferring the strain seed liquid into a shake flask filled with a fermentation culture medium in an inoculation amount of 4%, and carrying out shake culture at 37 ℃ for 7-8h; inoculating the culture solution into a fermentation medium of a fermentation tank in an inoculation amount of 5%; controlling the pH value to be 7.3, the temperature to be 37 ℃, the residual sugar content to be 15 percent and the dissolved oxygen content to be 35 percent in the fermentation process, and fermenting for 40-72 hours.
7. The Bacillus licheniformis for producing alkaline protease according to claim 1, characterized in that the knockout of the chiaB, pgs, lchAC, eps, upp gene and 9 genomic islands is achieved by constructing knockout vector containing the homology arms upstream and downstream of the knockout gene;
the sigF, pulA and amyA genes are knocked out by a CRISPR/Cas9 gene editing method.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010857565.7A CN112239742B (en) | 2020-08-24 | 2020-08-24 | Bacillus licheniformis for producing alkaline protease and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010857565.7A CN112239742B (en) | 2020-08-24 | 2020-08-24 | Bacillus licheniformis for producing alkaline protease and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN112239742A CN112239742A (en) | 2021-01-19 |
CN112239742B true CN112239742B (en) | 2022-10-18 |
Family
ID=74170751
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010857565.7A Active CN112239742B (en) | 2020-08-24 | 2020-08-24 | Bacillus licheniformis for producing alkaline protease and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN112239742B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116240153A (en) * | 2022-10-09 | 2023-06-09 | 天津科技大学 | Bacillus licheniformis deleted in lanthionin gene cluster and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106755046A (en) * | 2016-11-30 | 2017-05-31 | 成都美溢德生物技术有限公司 | A kind of method for transforming bacillus gene group |
CN107779465A (en) * | 2017-10-30 | 2018-03-09 | 成都美溢德生物技术有限公司 | A kind of method for reducing fermentation of bacillus liquid viscosity |
CN109337855A (en) * | 2018-11-20 | 2019-02-15 | 成都美溢德生物技术有限公司 | A kind of efficient method for reducing fermentation of bacillus liquid viscosity |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DK3234143T3 (en) * | 2014-12-19 | 2023-09-04 | Novozymes As | COMPOSITIONS COMPRISING POLYPEPTIDES WITH XYLANASE ACTIVITY AND POLYPEPTIDES WITH ARABINOFURANOSIDASE ACTIVITY |
-
2020
- 2020-08-24 CN CN202010857565.7A patent/CN112239742B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106755046A (en) * | 2016-11-30 | 2017-05-31 | 成都美溢德生物技术有限公司 | A kind of method for transforming bacillus gene group |
CN107779465A (en) * | 2017-10-30 | 2018-03-09 | 成都美溢德生物技术有限公司 | A kind of method for reducing fermentation of bacillus liquid viscosity |
CN109337855A (en) * | 2018-11-20 | 2019-02-15 | 成都美溢德生物技术有限公司 | A kind of efficient method for reducing fermentation of bacillus liquid viscosity |
Also Published As
Publication number | Publication date |
---|---|
CN112239742A (en) | 2021-01-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sidhu et al. | Strain improvement for the production of a thermostable α-amylase | |
CN107400677B (en) | Bacillus licheniformis genome editing vector based on CRISPR-Cas9 system and preparation method thereof | |
CN105671070B (en) | A kind of CRISPRCas9 system and its construction method for Bacillus subtilis genes group editor | |
CN106754466A (en) | It is a kind of for efficient exogenous protein expression and the bacillus subtilis of High Density Cultivation | |
US20160289690A1 (en) | Mortierella alpina recombinant gene expression system and construction method and use thereof | |
CN110055204B (en) | Method for improving fermentation enzyme production of bacillus licheniformis by knocking out spo II Q and pcf genes and application | |
CN105420154A (en) | Double knockout recombinant rhodococcus as well as construction method and application thereof | |
CN112239742B (en) | Bacillus licheniformis for producing alkaline protease and application thereof | |
CN112513249B (en) | Mutant strain of trichoderma filamentous fungus and method for producing protein | |
CN106497961A (en) | A kind of genetic engineering modified method for improving bacillus biomass | |
CN112239743B (en) | Bacillus licheniformis host cell and genetic modification method and application thereof | |
CN116144571B (en) | Bacillus pumilus independent of antibiotics and capable of stabilizing high-yield alpha-amylase, and construction method and application thereof | |
He et al. | Direct production of ethanol from raw sweet potato starch using genetically engineered Zymomonas mobilis | |
CN113980938B (en) | Method for obtaining high-yield high-stability heterologous beta-glucosidase | |
AU2020204574B2 (en) | B.licheniformis engineering bacteria for inhibiting bacterial autolysis, construction method and application thereof | |
JP6465470B2 (en) | Method for producing saccharifying enzyme, and method for saccharification of plant biomass | |
CN102229942A (en) | Multifunctional shuttle vector new pBE2, construction method thereof and method for constructing alkali protease mutation library by using same | |
CN106754605B (en) | A kind of method that alpha amylase is lived in raising bacillus subtilis fermentation liquor | |
CN116445378A (en) | Bacillus licheniformis recombinant strain for high yield of alkaline protease and application | |
Buchholz et al. | Growth of Zymomonas on lactose: gene cloning in combination with mutagenesis | |
CN103361390B (en) | Method for eliminating side product polysaccharide in fermentation production of pyrroloquinoline quinone, and application of method | |
US11352633B2 (en) | Aureobasidium pullulans strains with high-yield heavy oil and construction method and application thereof | |
CN103205481A (en) | Method for improving aureomycin yield as well as recombinant expression vector and genetic engineering bacterium of aureomycin | |
US8735160B2 (en) | Methods for targetted mutagenesis in gram-positive bacteria | |
CN106011107B (en) | Construction method and the application of a kind of alkali resistance alpha-amylase and its genetic engineering bacterium |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |