CN112239742A - Bacillus licheniformis for producing alkaline protease and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to bacillus licheniformis for producing alkaline protease and application thereof. The host cell adopted by the strain is constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and deleting 9 genome islands on the basis of Bacillus licheniformis (Bacillus licheniformis)2709 so as to realize genome simplification of the host cell. The aprE expression cassette is constructed and integrated in the transformed host strain, the enzyme activity of the double-copy recombinant strain is improved by 37.45 percent compared with that of the host, and the enzyme activity of the triple-copy recombinant strain is improved by 9.36 percent compared with that of the double-copy recombinant strain.

Description

Bacillus licheniformis for producing alkaline protease and application thereof

The technical field is as follows:

the invention belongs to the field of genetic engineering, and particularly relates to bacillus licheniformis for producing alkaline protease and application thereof.

Background art:

licheniformis 2709 industrial microorganisms, derived from natural environments such as soil, form a series of unacclimated undesirable characteristics during evolution, including: 1) foams are easily formed in the fermentation process, so that extremely high fermentation pollution risk is caused; 2) spores are easily formed during the nutritional deficiency, further accumulation of target products is influenced, and the killing cost of fermentation equipment is increased; 3) a large amount of viscous substances are formed to hinder the growth of thalli and the synthesis of products, and the requirements of stirring and dissolved oxygen are increased in large-scale industrial production; 4) a large amount of extracellular proteins and the like are secreted and synthesized, which undoubtedly seriously influences the synthesis and accumulation of target products, increases the requirements and difficulty of industrial operation, and is not favorable for the overall benefit of industrial production.

In recent years, researchers have conducted intensive studies on genetic improvement of production strains in order to obtain industrial microbial cell factories having excellent performance. Zhang et al optimized the production performance of the wild strain B.subtilis ATCC 6051a that was not acclimatized by knocking out the lipopeptide coding gene srfA that affects foam formation; illing et al increased the enzyme synthesis capacity by deleting the spore forming key control gene sigE; b. subtilis WB₈₀₀Belongs to a strain deficient in multiple proteases, which obviously promotes the accumulation of other extracellular secreted proteins.

In addition, b.licheniformis could theoretically benefit more from genome simplification, since it is able to synthesize a large number of secondary metabolites that are not essential for cell life activities. Therefore, the molecular improvement of the industrial microorganism host from the molecular level has important significance for improving the production performance of the microorganism cells.

Genome simplification engineering is mainly carried out in prokaryotic cells, particularly model strains such as E.coli and B.subtilis and the like, and certain achievements are achieved, and reports aiming at genome simplification of an industrial strain B.licheniformis 2709 are not found. The analysis of the host genome shows that a large number of nonessential genes such as isolated island genes, redundant genes, pseudogenes and the like and genes for controlling the synthesis of secondary metabolites exist, so that the cell metabolic burden and energy consumption are greatly increased, the waste of nutrient resources is caused, and the growth and fermentation performance of cells are influenced. Therefore, it is feasible and valuable to realize the construction of the basal plate cells in a specific culture medium by a small genome technology.

At present, genome simplification engineering is mainly carried out in prokaryotic cells, and no report on genome simplification of an industrial strain B. licheniformis 2709 is found. The analysis of the host genome shows that a large number of nonessential genes such as isolated island genes, redundant genes, pseudogenes and the like and genes for controlling the synthesis of secondary metabolites exist, so that the cell metabolic burden and energy consumption are greatly increased, the waste of nutrient resources is caused, and the growth and fermentation performance of cells are influenced.

The invention determines related control genes by analyzing and identifying the bad performance affecting the host fermentation production, and efficiently deletes related coding genes by adopting the established genetic operation system so as to eliminate the bad production characteristics of host cells and improve the fermentation production performance; and the possible non-essential genes such as the island gene and the like are analyzed and determined by combining the genome information of the host cell, the effective genome simplification is realized by adopting a small genome technology, and a foundation is laid for constructing the chassis cell suitable for the industrial production of the enzyme preparation.

The invention content is as follows:

in order to achieve the above object, the present invention provides a Bacillus licheniformis host bacterium suitable for industrial production, wherein the Bacillus licheniformis host bacterium is constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC, upp genes and deleting 9 genome islands to realize genome simplification of host cells on the basis of Bacillus licheniformis (Bacillus licheniformis) 2709;

the eps gene is positioned at the 1967676-1983603 site of the whole genome sequence of the Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP 033218;

the pgs gene is located at positions 1805920-1808919 of the whole genome sequence of Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP 033218;

the Genbank number of the sigF gene is CP033218.1 (located at 3898937-3899704 position on the whole genome sequence);

the Genbank accession number of the chiA gene among the chiAB genes is WP _003178684.1, the Genbank accession number of the chiB gene is WP _003178682.1 (the chiAB gene is located at position 909808-;

the Genbank number of the pulA gene is WP _009329394.1 (located at 2420607-2422739 position on the whole genome sequence);

the Genbank accession number of the amyA gene is WP _025807921.1 (located at positions 582978 and 584516 on the whole genome sequence);

the Genbank accession number of the lchA gene in the lchAC gene is WP _020450107.1, and the Genbank accession number of the lchC gene is WP _016886081.1 (the lchAC gene is located at the 834378-849050 th site on the whole genome sequence);

the Genbank accession number of the upp gene is WP _026589089 (located at 1714807-1715436 on the whole genome sequence);

the 9 genome islands are GI01 located at the 3,429,766-3,435,147 positions on the genome of Bacillus licheniformis (Bacillus licheniformis) 2709; GI02 at positions 3,671,385-3,675,741; GI03 at positions 3,708,534 and 3,716,479; GI04 at positions 4,292,644 and 4,304,905; GI05 at positions 4,305,616-4,341,077; GI06 at positions 1,117,114 and 1,157,920; GI07 at positions 3,560,703 and 3,567, 132; GI08 at positions 4,071,504-4,088,125; GI09 of 1,933,894-1,951,991, the position numbers correspond to the position codes of the whole genome sequence of Bacillus licheniformis (Bacillus licheniformis)2709, TCCC11148 in GenBank CP033218.

The invention also provides application of the bacillus licheniformis host cell, in particular application in expressing the alkaline protease AprE.

The invention provides another technical scheme, which is a bacillus licheniformis for producing alkaline protease, wherein eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes are knocked out, 9 genome islands of the bacillus licheniformis are deleted to serve as host cells, and a mutant strain GR15-2 carrying two expression cassettes is formed after aprE is integrated at a chromosome position I (2419710-fold 2422710bp) of an aprE centrosymmetric position genome); and on the basis of GR15-2, a mutant strain GR15-3 carrying three expression cassettes was constructed after integration of aprE at chromosomal site III (the central symmetrical position of the replication initiation site, genome No. (3396863-and 3397860 bp)).

The Genbank accession number of the aprE gene is CP 033218;

the invention also provides a method for producing the alkaline protease aprE by using the strain GR15-2 and the strain GR 15-3:

fermentation medium: 0.7g/L of Homoh amylase, 64g/L of corn flour, 40g/L of soybean meal, 4g/L of disodium hydrogen phosphate and 0.3g/L of potassium dihydrogen phosphate.

And (3) shaking flask fermentation: the strain is subjected to three-zone streaking on an LB plate, inverted culture is carried out at 37 ℃ overnight, a newly activated single colony is picked up to be placed in 5mL of LB culture medium, shaking culture is carried out at 37 ℃ and 220r/min for 12h, the strain is transferred to 50mL of LB liquid culture medium with the inoculum size of 2% until the OD600 reaches 0.8-1.0, then the strain is transferred to a baffle bottle of 100mL of fermentation culture medium with the inoculum size of 2%, and shaking culture is carried out at 37 ℃ and 220r/min for 40-60 h.

Fermentation in a fermentation tank: inoculating the strain into a shake flask filled with liquid LB culture medium (50mL/250mL) and carrying out shake culture at 37 ℃ for 8h, taking the strain liquid, streaking the strain liquid on a three-region of a skim milk plate, and carrying out standing culture at 37 ℃ for 36 h; selecting a single clone with a relatively large transparent ring on a flat plate, placing the single clone into a shake flask filled with a liquid LB culture medium (50/250mL), carrying out shake culture at 37 ℃ for 8h to obtain a seed solution, transferring the seed solution into the shake flask filled with a fermentation culture medium (100/500mL) according to the inoculation amount of 4%, and carrying out shake culture at 37 ℃ for 7-8 h; inoculating the culture solution into 3/5L fermentation medium at an inoculum size of 5%, and feeding to control fermentation (when sugar concentration is less than 15%, feeding 30% dextrin and 5% cottonseed protein); controlling the pH to be 7.3, the temperature to be 37 ℃, the residual sugar to be 15 percent and the dissolved oxygen to be 35 percent in the fermentation process, and fermenting for 40-72 hours.

Has the advantages that:

the invention provides a genetic modification method for B.licheniformis 2709 cells, which effectively improves the fermentation production performance and fermentation process control of the important industrial microorganisms. Taking the production of AprE as an example, eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and 9 genome island knockout bacteria GR15 have the enzyme activity on the fermentation liquor of AprE as high as 32494 +/-1013U/mL, the high enzyme yield period is as long as 16h, and the enzyme activity is improved by 36 percent compared with that of a control bacterium. After 40h shake flask fermentation, the enzyme activity of GR15-2 is improved by 37.45% compared with GR15, and the enzyme activity of GR15-3 is improved by 9.36% compared with GR15-2, namely when the genome of GR15 expression host carries three aprE expression cassettes, the enzyme activity can reach 25736 +/-997U/mL to the maximum, and is improved by 1.36 times compared with the starting strain BL delta upp.

Description of the drawings:

FIG. 1 upp Gene knockout and validation

Wherein: a, constructing a knockout vector; b, screening process of upp mutant: wherein M is a nucleic acid Marker, lanes 1-3 are vector construction verification results, 1100 bp; 4-5 is the result of single exchange verification, 1300bp, 6 is negative control, no band; 7-8 is the double exchange verification result, 1250bp, 9 is the negative control, 1900 bp;

FIG. 2 illustrates the upp gene knockout procedure;

FIG. 3 upp reverse screening vector construction and validation

Wherein: a, constructing a upp reverse screening vector; b, verification of the reverse screening vector: wherein, lanes 1-3 are the PCR verification result, and the band size is about 930 bp; c is the sensitivity analysis result of the anaplerotic recombinant bacteria to 5-FU;

FIG. 4 construction of eps mutants

Wherein: a, knockout vector verification: wherein, M is Marker; lane 1 is a negative control, no band; 2-4 are positive clones, the band size is about 910 bp; b, screening and verifying the mutant: wherein, Lane 1 is the single-crossover screening control, 2-3 is the correct single-crossover recombinant bacteria, about 1840 bp; 4-6 are correct double-crossover mutants with a band size of about 1970 bp;

FIG. 5 Effect of chiAB deletion on AprE expression;

FIG. 6 impact of deletion of chiAB, pulA and amyA on aprE expression;

FIG. 7 shows changes in cell morphology;

FIG. 8 growth and aprE synthesis of different strains;

FIG. 9 growth and enzyme production assays for BL Δ upp Δ eps Δ pgs;

FIG. 10 growth and enzyme production analysis of BL Δ upp Δ lch;

FIG. 11 GR06 for enzyme Productivity analysis;

FIG. 12 GR15 fermenter produces alkaline protease;

FIG. 13 insertion position of aprE expression cassette in the genome;

FIG. 14 Single and double crossover screening validation of integration mutants

Wherein: a, integration of aprE expression cassette at position I to construct GR15-2 mutant validation results: wherein, M and the nucleic acid Marker are 250, 500, 750,1000, 1500, 2000, 2500, 3000, 3500, 4000, 5000, 6000, 8000 and 10000bp from bottom to top in sequence; lanes 1 and 2 are correctly single-crossover recombinant bacteria, 730bp, 3 are negative controls, no band; 4 and 5 are double-exchange mutants verified by a primer pair V-F1/A-R, 700 bp; 6 and 7 are double-crossover mutants verified by primer pair A-F/V-R1, 730 bp; b, continuing to integrate the aprE expression cassette at position III to construct GR15-3 mutant validation results: wherein lanes 1 and 2 are correctly single-crossover recombinant bacteria, 700bp, 3 is a negative control, no band; 4 and 5 are double-exchange mutants verified by a primer pair V-F3/A-R, 750 bp; 6 and 7 are double-crossover mutants verified by primer pair A-F/V-R3, 750 bp;

FIG. 15 Single and double crossover screening validation primer design;

FIG. 16 aprE expression levels of different gene copy number mutants.

The specific implementation mode is as follows:

in order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. The specific embodiments described herein are merely illustrative of the present patent and do not delimit the present invention.

The invention constructs knockout vectors by shuttle plasmids pWH1520 and pTU; taking the expression and secretion condition of the alkaline protease AprE and the existence of the poor fermentation character as indexes, knocking out regulatory elements with adverse effect or nonsense, namely eps, pgs, sig, chi, pulA, amy, lch and upp genes and 9 genome islands to simplify the genome of a host cell. The relevant genome situation is shown in tables 1 and 2.

TABLE 1 genetic information for improved deletion of host traits

Note: the upp gene encodes uracil phosphotransferase, the EPS gene encodes EPS synthetic protease, the pgs gene encodes polyglutamate synthesis-related enzyme, chiAB encodes chitinase synthase, pulA encodes pullulanase, amyA encodes alpha-amylase, lchAC encodes lichenin synthase, and sigF encodes Spo0IIAC protein.

TABLE 2 genomic islands determined by the present analysis

The primers of the present invention are shown in Table 3.

TABLE 3 Primary primers of the invention

Not underlined is a restriction enzyme

The fermentation method comprises the following steps:

fermentation medium: 0.7g/L of Homoh amylase, 64g/L of corn flour, 40g/L of soybean meal, 4g/L of disodium hydrogen phosphate and 0.3g/L of potassium dihydrogen phosphate.

And (3) shaking flask fermentation: carrying out three-zone streaking on a strain on an LB (lysostaphin) flat plate, carrying out inverted culture at 37 ℃ overnight, selecting a newly activated single colony in 5mL of LB culture medium, carrying out shaking culture at 37 ℃ for 12h at 220r/min, transferring the newly activated single colony to 50mL of LB liquid culture medium until OD600 reaches 0.8-1.0, transferring the newly activated single colony to a baffle bottle of 100mL of fermentation culture medium at 2%, carrying out shaking culture at 37 ℃ at 220r/min, carrying out fixed-point sampling according to experiment requirements, centrifuging at 4 ℃ at 12000r/min for 2min, taking a supernatant, and properly diluting to determine the activity of the alkaline protease.

Fermentation in a fermentation tank: the strain to be tested is inoculated in a shake flask filled with liquid LB culture medium (50mL/250mL) and is subjected to shake culture at 37 ℃ for 8 h. Taking a bacterial liquid to mark on a three-zone skimmed milk plate, and carrying out static culture at 37 ℃ for 36 h; the single clone with the relatively large transparent circle on the plate is picked up and put into a shake flask filled with liquid LB culture medium (50/250mL), and is subjected to shake culture at 37 ℃ for 8h to obtain a seed solution, the seed solution is transferred into the shake flask filled with a fermentation culture medium (100/500mL) according to the inoculation amount of 4%, and the seed solution is subjected to shake culture at 37 ℃ for 7-8 h. The culture solution was inoculated into 3/5L fermentation medium at an inoculum size of 5%, and fermentation was controlled by feeding (30% dextrin and 5% cottonseed protein were fed when the sugar concentration was less than 15%). During the fermentation process, the pH is controlled to be 7.3, the temperature is controlled to be 37 ℃, the residual sugar is 15 percent, and the dissolved oxygen is 35 percent.

The method will be further explained by the following specific examples.

EXAMPLE 1 construction of the Strain BL Δ upp Δ eps

1. Construction of the upp reverse screening vector

The coding gene upp of uracil phosphoribosyl transferase is selected as a reverse screening marker, host cells are required to delete the gene, and the construction of the upp gene knockout vector is shown in figure 1-A. The primer pairs uppLH-F/uppLH-R and uppRH-F/uppRH-R are utilized to respectively amplify the upstream and downstream homologous arms of the upp gene, and recombined and connected with a T2(2) -ori plasmid fragment (the plasmid and the construction method thereof are disclosed in China patent CN201810898060.8, namely a malR-knocked-out Bacillus licheniformis strain, the construction method and the application) which is recovered by digestion with BamHI/SacII (hereinafter, pKSVT is used as a substitute of T2(2) -ori) to form a knocked-out vector pKSVT-delta upp, PCR verification is carried out by adopting a primer uppLH-F/uppRH-R, the size of a correct strip is about 1100bp (shown in a figure 1-B), after sequencing confirmation, the correct strip is transformed into Escherichia coli EC135 pM. Bam methylation modification, and finally the correct strip is electrically transformed into a host Bacillus licheniformis 2709 competent cell, and is statically cultured on a 25 mu g/mL Kan resistance plate for about 12h at 37 ℃.

Picking the transformants on the plate to 5mL LB medium with the same resistance concentration, culturing at 45 ℃ for 10h (1 generation); 10 μ L of the suspension was aspirated and transferred to LB medium under the same conditions, and the culture was continued at 45 ℃ for about 10 hours. Diluting the culture solution, coating Kan plate, standing at 45 deg.C, and culturing to obtain single exchange strain. However, in order to avoid non-specific integration, the primer pair upp-VF/VR was used to perform colony PCR verification single-exchange, the result is shown in FIG. 1-B, the DNA band size of the successful single-exchange recombinant bacteria is about 1300bp, and the negative control using the competent genome as the template has no band, which indicates that specific single-exchange occurs. Correctly single-crossed colonies were picked to 5mL of nonresistant LB medium for 2 passages of about 24h with shaking (1 intermediate transfer). After the subculture was completed, the culture broth was diluted and spread on a non-resistant LB plate, and left to stand at 37 ℃ for about 12 hours. Colony PCR verification is carried out on a single clone on a flat plate by adopting a primer upp-VF/upp-VR, as shown in a figure 1-B, the DNA band size of a wild strain is about 1900bp, the amplified fragment size of a mutant strain is about 1250bp due to deletion of an upp gene, double exchange is successfully carried out, the strain after deletion of the upp gene is further sequenced and verified to be named as B.licheniformis delta upp (hereinafter, abbreviated as BL delta upp) and is used as a starting strain for subsequent molecular modification, and accordingly, a gene editing process based on a temperature-sensitive vector and a reverse screening marker is induced, as shown in a figure 2.

The strong PS promoter selected in the laboratory (PS promoter gene sequence:

gtcacaatgcgccatcaaaccgttgacaagcgtccccgtcagatggccgggagccggatgaaccaccattccgcgcggc ttgttgacgacaagaacgtcctgatcttattataatataagcaaaaaactcataaaaaggaaaagcattgacctgaaaacttat cggtaaagtatgatataatacaaaaagaccgattagaggggagagaggaaac), the expression of the upp gene is started, the PS promoter and the upp open reading frame are amplified by primer pairs uppPS-F/uppPS-R and upp-F/upp-R respectively, and are recombined and connected with the pKSVT vector segment recovered by KpnI/SalI double enzyme digestion, and then are transformed into EC 135. PCR verification is performed by using the primer uppPS-F/upp-R, the result is shown in figure 3-B, if the size of the constructed correct band is about 930bp, and the vector is named pTU after further sequencing confirmation (the construction process is shown in figure 3-A), namely the upp reverse screening vector. FIG. 3-C shows the results of the sensitivity analysis of the anaplerotic recombinant bacteria to 5-FU: respectively converting the methylated modified vector pTU and the pKSVT into BL delta upp to obtain transformants BL delta upp-U and BL delta upp-T, respectively selecting monoclonals of two recombinant bacteria to liquid culture media with Kan resistance of 25 mu g/mL, carrying out shake culture at 37 ℃ for 12h, detecting OD600 of the two recombinant bacteria, adjusting the OD600 to be the same, and respectively diluting and pouring three LB culture media containing 20 mu g/mL 5-FU, 25 mu g/mL Kan and 20 mu g/mL 5-FU +25 mu g/mL Kan. As shown in FIG. 3-C, pKSVT has a small effect on the 5-FU sensitivity of BL Δ upp, and the growth of the recombinant bacteria in the three culture media has no significant difference. pTU restored BL Δ upp sensitivity to 5-FU, but when Kan was not added to the medium, BL Δ upp-U was able to grow partially on the 5-FU plates, probably due to plasmid loss in the absence of a resistant stimulus. Plasmid complementation experiments show that the upp gene can be used as a reverse screening marker to be applied to BL delta upp.

2. eps Gene Cluster knockout

Respectively amplifying the upstream and downstream sequences of the eps gene by using primers eps-LF/LR and eps-RF/RR, recombining and connecting the sequences with a vector pTU recovered by enzyme digestion, further obtaining a knockout vector pTU-delta eps, wherein the enzyme digestion verification result of the vector is shown in figure 4-A, and the plasmid with correct enzyme digestion verification is converted into BL delta upp after methylation modification. The result of colony PCR verification single-double exchange is shown in FIG. 4-B, and the size of a theoretical band is 1840bp because the plasmid of the successfully single-exchanged strain is integrated on the chromosome and PCR amplification is carried out by using a single-exchange verification primer eps-VF/VR; the strains which are subjected to double exchange and successfully lose plasmids can grow on a 5-FU plate, colony PCR is carried out by adopting primers eps-VF/eps-VR, the PCR band size of the successfully mutated strains is about 1970bp, the wild strains have no band, and the strains with positive PCR results are subjected to PCR and sequencing again to confirm that the correct knockout strains are named as BL delta upp delta eps.

The knockout methods of the chiAB, the pgs, the lchAC and the 9 genome islands are the same as the knockout of the eps gene cluster, only the homologous arm primers are replaced by the corresponding primers in the table 3 (the verification primers are also correspondingly replaced), and the knockout of the pulA, the amyA and the sigF is the CRISPR/Cas9 gene editing method, so that all strains in the table 1 are constructed.

Example 2 Effect of deletion of different genes on biosynthesis of alkaline protease AprE

1. Effect of major extracellular protein deletion on AprE biosynthesis

(1) In order to examine the influence of chitinase deletion on the secretion and expression of the host AprE, the aprE transcription level and the AprE enzyme activity of a chiaB deletion strain BL delta upp delta chi and a control strain BL delta upp fermented and cultured for 48h are respectively detected, and the result is shown in FIG. 5. The result shows that the deletion of chitinase has no obvious effect on the transcription level of aprE, but the enzyme activity (13952U/mL) is improved by 24.23 percent compared with that of a control bacterium (11231U/mL).

(2) In order to examine the influence of deletion of pullulanase (PulA) and alpha-amylase (AmyA) on the secretion and expression of the host AprE, a pulA deletion strain BL delta upp delta chi delta pul delta amy is constructed on the basis of BL delta upp delta chi, and the aprE transcription level and the aprE enzyme activity of the BL delta upp delta pul delta amy and a control strain BL delta upp fermentation culture 48h are respectively detected, and the result is shown in FIG. 6. The result shows that the protease activity (14792U/mL) of BL delta upp delta chi delta pul delta amy is improved by 34.10 percent compared with the contrast (11033U/mL) and is improved by 5.6 percent compared with BL delta upp delta chi (13952U/mL), however, the aprE transcription level is not obviously different from the contrast, which indicates that pulA and amyA are deleted, the synthesis and secretion of target protein aprE are promoted, and the aprE enzyme activity in fermentation liquor is obviously improved.

2. Effect of spore deficiency on AprE biosynthesis

In order to research influence of spore initiation and formation on BL delta upp alkaline protease synthesis, the invention adopts a CRISPR/Cas9 gene editing method (a single-plasmid CRISPR/Cas9 genome editing system is utilized to realize high-efficiency editing on a B.licheniformis 2709 genome, sigF is selected as a target gene, a knockout vector is designed, and related elements comprise: the spcas9 gene and a promoter P43 thereof, the specific targeting sgRNA and a transcription promoter PS thereof (not containing RBS), a homologous repair sequence HA which is composed of homologous arms of about 500bp and is synthesized by taking sigF-LF, sigF-LR, sigF-RF and sigF-RR as primers respectively is constructed on a shuttle vector pWH1520 one by one, related primers and functions are shown in tables 1-3), a spore starting signal is knocked out to control gene spores to form a specific sigma factor coding gene sigF, and the sigma factor is activated and expressed in a protocyte after the asymmetric division signal is transmitted. Defective mutant, named BL Δ F.

(1) The bacterial morphology and spore formation rate of the mutant after different periods of LB liquid culture are shown in figure 7, and the diagram shows that BL delta F bacterial morphology changes similarly, the bacterial morphology does not have obvious difference with that of a contrast bacterium when the mutant is cultured for 12h, but the bacterial staining is not uniform after the mutant is cultured for 24h, some areas are not easy to be colored, but mature spores are not formed, which indicates that spores form a specific sigma factor and interrupt the signal of spore maturation. Importantly, spore counting results show that the spore formation rates of the mutants are all 0, and further show that the mutants are successfully constructed.

(2) In order to verify the synthesis capability of alkaline protease of different mutant strains, synthesis conditions of AprE at different fermentation times are investigated, and enzyme activity changes at different times are detected (FIG. 8A); meanwhile, in order to analyze the cause of the differences in AprE expression levels, the viable counts at different enzyme production time points were counted, as shown in fig. 8B. The result shows that the maximum enzyme activity of the sigF deletion mutant is improved by 24.38 percent compared with that of a control, the peak value can be reached after the sigF deletion mutant is cultured for 40 hours, the enzyme production stable period can be kept for about 12 hours, the enzyme activity reaches the peak value only after the control bacterium is cultured for 46 hours, and the enzyme production stable period only lasts for about 6 hours. And analyzing the growth condition of the thalli, and finding that the viable count of the BL delta F mutant in the growth stabilization phase is higher than that of the control bacteria, and the biomass is slowly reduced in the later growth phase. In conclusion, the mutant keeps good protease synthesis capability due to interruption of sporulation signals, the enzyme activity of the mutant is reduced, and the biomass of the mutant at the later growth stage is obviously higher than that of a control bacterium. This indicates that the synthesis of AprE is not affected by the deletion of sigF, and the synthesis cycle is greatly prolonged, which is beneficial to industrial production and can provide excellent strains for industrial enzyme preparation production.

3. Blocking the Effect of extracellular stickies Synthesis on AprE Synthesis

In order to investigate the influence of deletion of Exomucopolysaccharide (EPS) or polyglutamic acid (PGA) on the secretion expression of the host AprE, a strain for knocking out an EPS gene cluster (epsA-epsO, genome position 1967676-1983603, about 16kb) in BL Δ upp is constructed, and the knocked-out strain is named as BL Δ upp Δ EPS; on the basis of BL Δ upp Δ eps, the γ -PGA synthetic gene cluster pgs (genomic position 1805920-1808919) of about 3.0kb was deleted. The pgs knock-out mutant strain was named BL Δ upp Δ eps Δ pgs.

The results of detecting the viable count and the activity change of the alkaline protease of BL delta upp delta eps delta pgs and BL delta upp fermentation culture at different time are shown in FIG. 9. As can be seen from the figure, the biomass of BL delta upp delta eps delta pgs is obviously improved by 18.49 percent compared with that of a control bacterium, the dissolved oxygen level of fermentation liquor is obviously improved probably due to the elimination of viscous substances such as polyglutamic acid and the like, the consumption of ATP by the synthesis of a macromolecular polymer is reduced, the synthesis of AprE is further enhanced, the maximum enzyme activity is improved to 14309.3 +/-386U/mL from 11320.7 +/-347U/mL, and is improved by about 26.40 percent; in addition, the increase of the dissolved oxygen of the mutant bacteria fermentation liquor leads the biomass to be effectively accumulated, so that the time (42h) of the peak value of the enzyme activity is 6h (48h) earlier than that of the control bacteria. The viscosity of viscous substances in fermentation liquor, especially polyglutamic acid, is one of the bottlenecks in the efficient industrial production of target protein, and the viscous substances seriously obstruct the transfer of oxygen in the fermentation environment and further influence the intracellular available ATP concentration. Therefore, by deleting the coding gene for controlling the synthesis of the viscous substance, the secretion synthesis of the viscous substance can be effectively blocked, and the influence on the synthesis and accumulation of the target product caused by the adverse character in the production process can be avoided.

4. Effect of foam formation defects on AprE Synthesis

To examine the influence of deletion of the lichenin encoding gene lchAC on the secretion expression of the host AprE, a knockout vector pTU-delta lch was constructed, and a lchAC deletion mutant strain BL delta upp delta lch was further obtained. The change of viable count and activity of alkaline protease of BL delta upp delta lch and BL delta upp fermentation culture at different time is detected, and the result is shown in FIG. 10, and the growth and protease synthesis capacity of the lichenin deletion mutant and the control bacterium are not significantly different.

The effect of the lch deletion on the foam formation of the strain, as well as the changes in mutant growth and enzyme production levels were examined by separate fermentation in a 5-L fermentor. The result shows that the foam amount of the mutant is greatly reduced, about 30 mu L and 250 mu L of the defoaming agent are respectively added for one time under the same condition, and the use amount of the defoaming agent is reduced by 87.5 percent. This is sufficient to show that the lch deletion mutant greatly reduced the amount of foam formed, facilitating control of the fermentation process.

5. Stacked knockout of undesirable trait-encoding genes

The host BL delta upp is taken as an initial strain, eps, pgs, sigF, chiaB, pulA, amyA and lchAC genes are knocked out one by one to obtain the strain BL delta upp delta eps delta pgs delta sig delta chi delta pulA delta amy delta lch, which is GR06 for short. In order to further compare the synthesis capacity of GR06 and the control bacterium BL delta upp protease, the enzyme activities of the GR06 and the control bacterium BL delta upp protease for synthesizing and secreting AprE are examined through shake flask fermentation, and the results are shown in figure 11, which shows that the alkaline protease activity (18473 +/-503U/mL) of GR06 is improved by about 64.57 percent compared with the control (11225U/mL), the occurrence time of the enzyme production peak value is advanced by 6-8 hours, and the enzyme production stable period is prolonged by 1 time compared with the control. Therefore, the integration of undesirable traits affecting productivity is eliminated, and excellent fermentation performance is integrated into the same host cell, thereby greatly promoting the synthesis and secretion of protease.

Example 3 knock-out of genomic islands

And taking GR06 as a starting strain, sequentially overlapping and knocking out the determined island genes by adopting the established temperature-sensitive gene editing system, knocking out and verifying by taking T-F/T-R as a single-exchange recombinant bacterium verification primer, constructing a strain GR07-GR15 as shown in Table 2, and realizing the genome simplification of 4.3%. In order to further compare the synthesis capacities of GR15 and the control bacterium BL delta upp protease, the enzyme activities of the GR15 and the control bacterium BL delta upp protease for synthesizing and secreting AprE are examined through fermentation in a 5L fermentation tank, and the results are shown in FIG. 12, which shows that the synthesis capacity of GR15 for AprE is enhanced through fermentation in the 5L fermentation tank, the enzyme activity can reach 32494 +/-1013U/mL, the high-yield enzyme period is as long as 16h, and the enzyme activity of the control bacterium BL delta upp protease is 23821 +/-635U/mL.

Example 4 construction of aprE Gene multicopy Strain

In order to examine the influence of the aprE gene concentration in the genome on the aprE biosynthesis, the constructed expression host GR15 is used as a starting strain, and the number of aprE expression cassettes on the chromosome is increased by stacking and integrating one by one.

Three different genomic locations were determined analytically based on information such as genome functional notes (GenBank number: CP033218), as shown in FIG. 13. The mutant strain GR15-2 carrying two expression cassettes was constructed after integration of aprE at chromosomal position I (2419710-2422710bp in the genome of the central symmetry of aprE); the mutant strain GR15-3 carrying three expression cassettes was then constructed after integration of aprE at chromosomal site III (position of the genome centrosymmetric to the replication initiation site (3396863-3397860 bp)).

The screening process of the two integration mutants is respectively shown in figures 14-A and 14-B, a specific single-exchange recombinant strain and a mutant which is correctly subjected to double exchange are screened by PCR, primers at two ends of an expression cassette, 5 'ends A-R and 3' ends A-F are adopted, the design positions of the primers are shown in figure 15, a single-exchange and double-exchange verification primer pair is formed, whether correct single and double exchanges occur is verified by colony PCR, two pairs of primers are required to be simultaneously adopted for amplification verification, only one pair of primers can amplify a strip when single exchange occurs, a target strip 700-900 bp needs to be simultaneously amplified when double exchange occurs, if single and double exchanges are mistaken, PCR amplification fails, and as can be seen in figure 14, the construction of the two superposed integration mutants is successful.

The AprE enzyme activity and the aprE gene transcription level of GR15, GR15-2 and GR15-3 after 40h of shake flask fermentation culture are examined, and the expression level of three strains of integration mutation bacteria aprE is detected, and the result is shown in figure 16. As can be seen from the figure, the enzyme activity of GR15-2(23594 +/-673U/mL, 40h) is improved by 37.45 percent compared with that of GR15(17231 +/-487U/mL, 40h), and the enzyme activity of GR15-3(25736 +/-997U/mL, 40h) is improved by 9.36 percent compared with that of GR15-2(23594 +/-673U/mL, 40h), namely when the genome of GR15 expression host carries three aprE expression cassettes, the enzyme activity can reach the highest 25736 +/-997U/mL (40h), and is improved by 1.36 times compared with the starting strain BL delta upp (11225 +/-387U/mL, 48 h).

The transcription level of aprE in GR15 was set to 1, the transcription levels of aprE genes in GR15-2 and GR15-3 were increased by 1.6-fold and 2.7-fold, respectively, compared to GR15, and the transcription level of aprE in GR15-3 was increased by 4.05-fold compared to the starting strain. The method proves that the aprE gene concentration has obvious influence on the expression in the fermentation process, and the expression level of the aprE gene can be improved by reasonably increasing the gene copy number.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the patent. It should be noted that, for those skilled in the art, various changes, combinations and improvements can be made in the above embodiments without departing from the patent concept, and all of them belong to the protection scope of the patent. Therefore, the protection scope of this patent shall be subject to the claims.

Claims (9)

1. The Bacillus licheniformis for producing the alkaline protease is characterized in that the adopted host bacteria are constructed by knocking out eps, pgs, sigF, chiAB, pulA, amyA, lchAC and upp genes and deleting 9 genome islands simultaneously on the basis of Bacillus licheniformis 2709 so as to realize genome simplification of host cells;

the 9 genome islands are GI01 located at the 3,429,766-3,435,147 positions on the genome of the Bacillus licheniformis 2709; GI02 at positions 3,671,385-3,675,741; GI03 at positions 3,708,534 and 3,716,479; GI04 at positions 4,292,644 and 4,304,905; GI05 at positions 4,305,616-4,341,077; GI06 at positions 1,117,114 and 1,157,920; GI07 at positions 3,560,703 and 3,567, 132; GI08 at positions 4,071,504-4,088,125; GI09 at positions 1,933,894-;

the position numbers correspond to the position codes of the whole genome sequence of the Bacillus licheniformis (Bacillus licheniformis)2709, namely TCCC11148 in GenBank CP033218.

2. The Bacillus licheniformis strain for producing alkaline protease according to claim 1 characterized by the fact that the mutant strain GR15-2 carrying two aprE expression cassettes is constituted after integration of aprE at the chromosomal location I of the host cell, i.e. at the 2419710-2422710bp of the genome.

3. The Bacillus licheniformis for producing alkaline protease according to claim 2 characterized in that the mutant strain GR15-3 carrying three expression cassettes is also constituted after integration of aprE at chromosomal site III, the central symmetry of the replication initiation site, at the genome position 3396863 and 3397860 bp.

4. A Bacillus licheniformis strain for producing alkaline protease according to claim 2 or 3 characterized in that the aprE gene is Genbank accession number CP033218.

5. Use of a Bacillus licheniformis strain for producing alkaline protease according to claim 2 or 3.

6. The use according to claim 5, wherein the alkaline protease aprE is produced by shake flask fermentation by:

after being activated, the strain is transferred to 50mL LB liquid culture medium with the inoculum size of 2 percent until the OD600 reaches 0.8-1.0, then transferred to 100mL fermentation culture medium with the inoculum size of 2 percent, and is subjected to shaking culture at 37 ℃ and 220r/min for 40-60 h.

7. The use according to claim 5, wherein the alkaline protease aprE is produced by fermentation in a fermenter by:

transferring the strain seed liquid into a shake flask filled with a fermentation culture medium in an inoculation amount of 4%, and carrying out shake culture at 37 ℃ for 7-8 h; inoculating the culture solution into a fermentation medium of a fermentation tank in an inoculation amount of 5%; controlling the pH to be 7.3, the temperature to be 37 ℃, the residual sugar to be 15 percent and the dissolved oxygen to be 35 percent in the fermentation process, and fermenting for 40-72 hours.

8. The Bacillus licheniformis producing alkaline protease according to claim 1 wherein:

the eps gene is positioned at the 1967676-1983603 site of the whole genome sequence of the Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP 033218;

the pgs gene is located at positions 1805920-1808919 of the whole genome sequence of Bacillus licheniformis 2709, namely TCCC11148 in GenBank CP 033218;

the Genbank number of the sigF gene is CP 033218.1;

the Genbank number of the chiA gene in the chiAB gene is WP _003178684.1, and the Genbank number of the chiB gene is WP _ 003178682.1;

the Genbank number of the pulA gene is WP _ 009329394.1;

the Genbank accession number of the amyA gene is WP _ 025807921.1;

the Genbank number of the lchA gene in the lchAC gene is WP-020450107.1, and the Genbank number of the lchC gene is WP-016886081.1;

the Genbank accession number of the upp gene is WP _026589089 (located at position 1714807-1715436 on the whole genome sequence).

9. The Bacillus licheniformis for producing alkaline protease according to claim 1, characterized in that the knockout of the chiaB, pgs, lchAC, eps, upp gene and 9 genomic islands is achieved by constructing knockout vector containing the homology arms upstream and downstream of the knockout gene;

the sigF, pulA and amyA genes are knocked out by a CRISPR/Cas9 gene editing method.

Images