CN112220926B

CN112220926B - Application of GOLT1B inhibitor in preparation of medicine for treating colorectal cancer

Info

Publication number: CN112220926B
Application number: CN202011087782.9A
Authority: CN
Inventors: 杨孜欢; 刘腾飞; 刘彬彬; 冯杏芝; 刘依婷; 蒋雪飞
Original assignee: Sixth Affiliated Hospital of Sun Yat Sen University
Current assignee: Sixth Affiliated Hospital of Sun Yat Sen University
Priority date: 2020-10-13
Filing date: 2020-10-13
Publication date: 2022-11-04
Anticipated expiration: 2040-10-13
Also published as: CN112220926A

Abstract

The invention relates to the field of medical biology, in particular to application of a GOLT1B inhibitor in preparation of a medicine for treating colorectal cancer. According to the invention, scratch and invasion experiments show that colorectal cancer cell migration and invasion capacity treated by the GOLT1B inhibitor is obviously reduced. The GOLT1B inhibitor provided by the invention can inhibit the metastasis of colorectal cancer, thereby improving the treatment effect of the colorectal cancer.

Description

Application of GOLT1B inhibitor in preparation of medicine for treating colorectal cancer

Technical Field

The invention relates to the field of medical biology, in particular to application of a GOLT1B inhibitor in preparation of a medicine for treating colorectal cancer.

Background

Colorectal Cancer (CRC) is the third most advanced malignant tumor in our country, with about 120 million new patients worldwide each year and nearly 70 million deaths; about 30-40% of patients are in early stage of colorectal cancer. And recurrence and metastasis in about 50% of patients treated with advanced CRC are important causes affecting clinical treatment efficacy and leading to death. At present, a new treatment means for colorectal cancer is urgently needed.

The vesicular transporter GOLT1B is involved in the transport of various proteins, and the role of the protein in tumors is not reported at present. Through research, the following results are found: GOLT1B is significantly highly expressed in CRC and significantly correlated with survival prognosis; high expression of GOLT1B can promote migration and invasion of tumor cells, and can also induce apoptosis of T cells and inhibit proliferation of the T cells. The GOLT1B inhibitor can obviously inhibit the migration and invasion of tumor cells, and the GOLT1B can become a new therapeutic target of colorectal cancer.

At present about 30% of patients with colorectal cancer are not effective for chemotherapy, and about 50% of patients with advanced CRC after treatment experience relapse and metastasis. However, the population for both EGFR and VEGFR targeting is limited, e.g., about 40% of patients with K-ras mutations are ineffective in cetuximab treatment. The research aiming at the screening of Golgi apparatus membrane protein GOLT1B and the early diagnosis of colorectal cancer has not been reported at home and abroad.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, provides the application of the GOLT1B inhibitor in preparing medicaments for treating colorectal cancer, provides a new treatment target and a new method for treating colorectal cancer, and provides a new scheme for combined treatment of colorectal cancer.

In order to achieve the purpose, the invention adopts the technical scheme that: provides an application of a GOLT1B inhibitor in preparing a medicine for treating colorectal cancer.

As a preferred embodiment of the use according to the present invention, the GOLT1B inhibitor is an siRNA inhibitor.

As a preferred embodiment of the application of the invention, the sequence of the siRNA inhibitor is shown as SEQ ID No.1 or SEQ ID No. 2.

As a preferred embodiment of the use according to the invention, the medicament is for subcutaneous, intravenous, intramuscular or rectal, nasal administration.

The present invention also provides a pharmaceutical composition comprising a GOLT1B inhibitor and a pharmaceutically acceptable carrier.

As a preferred embodiment of the pharmaceutical composition of the present invention, the GOLT1B inhibitor is an siRNA inhibitor.

As a preferred embodiment of the pharmaceutical composition of the invention, the sequence of the siRNA inhibitor is shown in SEQ ID No.1 or SEQ ID No. 2.

The invention has the beneficial effects that:

according to the invention, scratch and invasion experiments show that colorectal cancer cell migration and invasion capacity treated by the GOLT1B inhibitor is obviously reduced. The GOLT1B inhibitor provided by the invention can inhibit the metastasis of colorectal cancer, thereby improving the treatment effect of the colorectal cancer.

Drawings

FIG. 1: analysis of the differences between normal and tumor tissue genes in colorectal cancer patients in the Oncomine database.

FIG. 2: TCGA data analyzed the expression of GOLT1B gene levels between colorectal cancer patients and normal.

FIG. 3: CPTAC (Clinical Proteomic Tumor Analysis Consortium) data analyzed the expression of GOLT1B protein levels between colorectal cancer patients and normal.

FIG. 4 is a schematic view of: immunohistochemical analysis showed that the expression level of GOLT1B was higher in colon cancer patients than in the normal group.

FIG. 5: effect of GOLT1B expression on patient survival in colorectal cancer.

FIG. 6: QPCR in HCT116 and RKO verified siRNA knockdown efficiency of GOLT1B, × <0.0001.

FIG. 7: there was no significant difference in the effect of knocking down GOLT1B in HCT116 or RKO on cell proliferation.

FIG. 8: scratch experiments demonstrated that the migration capacity of cells was significantly reduced after knocking down of GOLT1B in HCT116, RKO, p <0.05.

FIG. 9: invasion experiments confirmed that the invasion capacity of cells was significantly reduced after knocking down of GOLT1B in HCT116, RKO, [ p ] 0.05, [ p ] 0.01.

Detailed Description

To more clearly illustrate the technical solutions of the present invention, the following embodiments are further described, but the present invention is not limited thereto, and these embodiments are only some examples of the present invention.

Example 1 significantly high expression of GOLT1B in colorectal cancer

mRNA data related to colorectal cancer were analyzed using an Oncomine online database to find that GOLT1B was significantly highly expressed in colorectal cancer (FIG. 1, FIG. 2); CPTAC (Clinical Proteomic Tumor Analysis Consortium) data showed significantly higher protein expression levels of GOLT1B in colorectal cancer patients than in the normal group (FIG. 3); immunohistochemical analysis was consistent with the results of the database (fig. 4); whereas patients with high expression of GOLT1B had lower survival rates (fig. 5).

EXAMPLE 2 culture of cells

The colorectal cancer cell lines HCT116, RKO were stored by the gastroenterology institute of Zhongshan university, and the HCT116 was cultured in a 37 ℃ humidified incubator containing 5% carbon dioxide using McCoy's 5a Medium Modified (Gibco, USA) medium containing 10% fetal bovine serum (Invitrogen, USA) and RKO using MEM (Gibco, USA) medium containing 10% fetal bovine serum (Invitrogen, USA).

EXAMPLE 3 inhibitor inhibition of GOLT1B Gene expression

HCT116 and RKO cells cultured in example 2 were seeded in a six-well plate containing an appropriate amount of complete medium at 1X 10 ⁶ Cells, enabling 30% -50% cell density at transfection, were transiently transfected into HCT116 and RKO cells using GOLT1B siRNA (siRNA sequence shown in Table 1) and control si-NC at a final concentration of 50nM. Fresh complete medium without antibiotics was replaced 12 hours after transfection.

The expression level of the target GOLT1B is detected by extracting total RNA of the transfected cells after 48h of culture and performing RT-PCR, and the result is shown in FIG. 6, which shows that the expression level of the target of the cells (treated group) transfected with the inhibitor is obviously lower than that of the control group.

TABLE 1 siRNA inhibitor sequence information

Product numbering	Product name	Target sequence	Numbering
				stB0011108A	SI001	GTTGGAGAAAGCAACAATA	SEQ ID No.1
stB0011108B	SI002	GTCCTTGGATCCCTCCTAA	SEQ ID No.2

TABLE 2 primers used for RT-PCR assays

Primer name	Primer sequences	Number of
			Forward primer	ACGGACACGCAGAAAATTGG	SEQ ID No.3
Reverse primer	AACGACAGGAAAGAAGCCCC	SEQ ID No.4

Example 4 proliferation assay

The cells were digested 48h after transfection of siRNA inhibitor into colorectal cancer cells, resuspended in complete medium and diluted to 2.5X 10 ⁴ Pieces/ml, inoculated with 200ul of resuspension in 96-well plates, then the 96-wells were placed at 37 ℃ 5% ₂ The effect of siRNA inhibitors on cell proliferation was observed in real time in an Incucyte instrument in an incubator.

The results are shown in fig. 7, where there was no significant difference in the effect of siRNA inhibitors on tumor cell proliferation.

Example 5 scratch test

The cells were digested 48h after transfection of siRNA inhibitor into colorectal cancer cells, and then seeded into 12-well plates prepared in advance with scratchers for aggregation, and wells of each scratcher were seeded with 1X 10 ⁵ The specific number of each cell is different according to different cells, so that the cells can be exactly paved on the bottom of the pore plate to form a single-layer cell after staying overnight, then the scratch is removed, the cells are washed for 3 times by PBS, and a serum-free culture medium is added; adding at 37 deg.C, 5% ₂ The culture box is used for culturing, and samples are taken for 0, 12, 24 and 48 hours and photographed. The results were then analyzed using Image J software and counted using SPSS software.

The results are shown in FIG. 8, and in agreement with the sequencing results, siRNA inhibitors significantly inhibited the migratory ability of HCT116 and RKO.

Example 6 invasion assay

The upper face of the membrane at the bottom of the Transwell cell was coated by diluting with Matrigel 1 from Corning, inc, and placed in a 37 ℃ incubator for 1h to polymerize Matrigel into a gel, before use, to hydrate the basement membrane. The tumor cells transfected with siRNA inhibitor for 48h were digested, washed twice with PBS, resuspended in serum-free medium, and adjusted to a cell density of 1X 10 ⁶ One cell/ml, 100. Mu.l of the cell resuspension was taken and added to a Transwell chamber, 500. Mu.l of a medium containing 20% FBS was added to the lower Transwell chamber, after conventional culture for 24 to 48h (depending on the invasive potential of the tumor cells), after fixation with 4% paraformaldehyde, staining with 0.1% crystal violet for 5min, the cells which did not invade the upper layer were gently wiped off with a cotton swab, washed 3 times with PBS, randomly photographed at 200X microscope for five fields, analyzed for cell number with Image J, and then analyzed for cell number with SPSS softwareAnd (5) performing statistical analysis.

The results are shown in fig. 9, where siRNA inhibitors significantly inhibited the invasive ability of HCT116 and RKO.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> secondary sixth Hospital of Zhongshan university

Application of <120> GOLT1B inhibitor in preparation of medicine for treating colorectal cancer

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 1

gttggagaaa gcaacaata 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 2

gtccttggat ccctcctaa 19

<210> 3

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 3

acggacacgc agaaaattgg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Synthesis

<400> 4

aacgacagga aagaagcccc 20

Claims

Application of a GOLT1B inhibitor in preparation of a medicine for treating colorectal cancer; the GOLT1B inhibitor is an siRNA inhibitor; the sequence of the siRNA inhibitor is shown as SEQ ID No.1 or SEQ ID No. 2.
2. The use according to claim 1, wherein the medicament is for subcutaneous, intravenous, intramuscular or nasal administration.