CN112210569B - Recombinant Buthus martensii Katoxin polypeptide Makatoxin-3 and preparation method and application of mutant thereof - Google Patents

Abstract

The invention discloses a preparation method of a recombinant Buthus martensii Karsch polypeptide Makatoxin-3 and a mutant thereof, and application of the polypeptides. The invention constructs MBP-Makatoxin-3 and a mutant fusion protein expression system thereof for the first time, the soluble expression in a pMBP system is greatly improved, and the recombinant Buthus martensii Karsch venom polypeptide Makatoxin-3 and the mutant thereof with high biological activity are obtained, the recombinant Buthus martensii Karsch venom polypeptide Makatoxin-3 produced by the technology has wide biological activity and good analgesic effect on various pain models of mice, the use of the Makatoxin-3 mutant can effectively overcome the pain-causing effect of natural Makatoxin-3 and retain the analgesic activity thereof, and the invention has important guiding significance for developing novel analgesic drugs based on scorpion venom polypeptides.

Description

Recombinant Buthus martensii Karsch polypeptide Makatoxin-3 and preparation method and application of mutant thereof

Technical Field

The invention belongs to the technical field of medical biology, and particularly relates to a recombinant Buthus martensii Karsch polypeptide Makatoxin-3 and a preparation method and application of a mutant thereof.

Background

The scorpion is used as a traditional famous and precious traditional Chinese medicine in China, has long medication history and high medicinal value, and is mainly distributed in Shandong, Hebei, Henan, Shanxi, Hubei and other places in China. According to the record of "Chinese pharmacopoeia" 2015 edition, the east Asia scorpion used as a whole with dryness as a medicine is called scorpion, which is pungent, mild, toxic, and entering liver channel, has the efficacies of calming endogenous wind and relieving spasm, dredging collaterals and relieving pain, counteracting toxic substances and dissipating stagnation, and can be used for treating spasm and convulsion, infantile convulsion, stroke, tetanus, pyocutaneous disease, scrofula, rheumatism obstinate arthralgia, migraine and other symptoms, and is a commonly used medicine for calming liver wind. Modern pharmacological research shows that the scorpion has good analgesic effect on various rheumatic arthralgia, trigeminal neuralgia, headache, toothache, intractable migraine and cancer pain.

Through a mouse pain model, the difference of analgesic activities of different parts of the scorpion is compared, the analgesic activity of the scorpion tail is found to be more than 5 times of that of the scorpion body, and further research shows that scorpion venom in the scorpion venom gland is a main component for the scorpion to exert the efficacy, and the scorpion venom has a very strong analgesic effect in the mouse pain model. Modern pharmacological studies show that scorpion venom has strong analgesic activity, and Liu Chong Ming and Wei Guo Qian (Liu Chong Ming, Wei Guo Qian, 1989) adopt a mouse body twisting method, a mouse thermal radiation tail flicking method and a rat trigeminal nerve induced cortex potential method to test the analgesic effect of the scorpion venom, and compare the analgesic effect with aspirin, antadine and morphine, and the results show that the scorpion venom has strong inhibition effects on visceral pain, skin burning pain and trigeminal nerve induced cortex potential. Wu Yingliang et al (Yang, J Proteomics,206,103435,2019) ground the toxic tail gland part of the processed scorpion into powder, and then extract the active ingredients with water, and find that the extract of toxic tail gland still contains a large amount of active toxin polypeptide. This shows that some polypeptide toxins in the venom glands of the processed scorpion can still keep activity, which suggests that the main component of the scorpion exerting the analgesic effect may be the polypeptide toxins from the venom glands.

The scorpion venom of east Asia scorpion is mainly composed of two parts of protein and non-protein, the non-protein part mainly includes lipid, free amino acid and other organic acid, etc., the main active component of scorpion venom is protein, mainly composed of scorpion toxin and enzyme. Scorpion toxin is a toxic protein composed of 20-80 amino acids, the molecular weight is mainly between 6000-9000Da, the specificity is high, the molecular structure contains 3-4 pairs of disulfide bonds, and three pairs of disulfide bonds form a circular core structure, so that the scorpion toxin has important significance for maintaining stability and exerting neurotoxicity. Modern researches show that the main active substance in scorpion venom acts on Na in large quantity ⁺ 、K ⁺ 、C ^l- 、Ca ²⁺ Toxin polypeptides of plasma channels. In recent years, researchers have isolated multiple polypeptide toxins from Buthus martensii Karsch venom that act on ion channels. Researches show that the toxin polypeptides have remarkable analgesic, anti-inflammatory and anti-tumor activities and have great drug development values.

Makatoxin-3 is a sodium channel toxin polypeptide isolated from scorpion venom. Makatoxin-3 produces strong nociceptive activity by delaying the inactivation of sodium ion channel Nav1.7, as shown in FIG. 1, where panels A and B are the number of paw withdrawal of mice every 5min after different doses of native Makatoxin-3 were injected, indicating that native Makatoxin-3 can increase the total number of paw withdrawal of mice in a dose-dependent manner. Nevertheless, Makatoxin-3 showed significant analgesic activity in various mouse models of inflammatory pain (fig. 2A-C). And in contrast to morphine, the analgesic activity of Makatoxin-3 was independent of the endogenous opiate system and was not reversible by opiate receptor inhibitors (fig. 2D-F). Through further studies, it was found that K8, K9 and particularly R58 of Makatoxin-3 are key amino acid residues involved in the interaction of Makatoxin-3-Nav1.7 (FIG. 3). These results indicate that Makatoxin-3 has potential value in the development of novel analgesic drugs. Obtaining the Makatoxin-3 and the mutant thereof with high activity can possibly obtain a novel polypeptide analgesic prodrug with high-efficiency analgesia but no pain-causing activity. However, Makatoxin-3 has very high biological activity and potential medicinal value, but has very low content in scorpion crude venom (about 0.5 percent of total protein of scorpion venom), and is difficult to separate and purify, thus far failing to meet the requirement of drug development. Therefore, the development of novel efficient polypeptide recombinant preparation technology is urgently needed to obtain Makatoxin-3 and mutants thereof for research and development of novel analgesic drugs.

Because scorpion toxin polypeptide has small molecular weight and is rich in disulfide bond, the current recombinant preparation method which is developed around toxin polypeptide and takes escherichia coli as a host mainly comprises an inclusion body renaturation technology and a fusion expression technology; however, due to the diversity and differences in toxin polypeptides and structures, these recombinant expression methods tend to have low yields and low activities (Cao, Biotechnol Prog 26,1240-1244, 2010) (Cao, Biotechnol Lett 37,2461 2466, 2015). The recombinant Buthus martensii Karsch polypeptide Makatoxin-3 and its mutant, which are disclosed in this patent, prepared according to the SUMO fusion expression method described in our previous patent (patent publication No. 101591668A), still failed to obtain soluble proteins with high activity (Table 1), and in addition, the natural Makatoxin-3 has pain-causing activity. Therefore, a novel recombination technology needs to be developed aiming at the structural sequence characteristics of Makatoxin-3 and mutants thereof so as to obtain an analgesic lead compound with high activity and low toxicity.

Disclosure of Invention

The invention aims to: aiming at the defects of the existing scorpion toxin polypeptide preparation technology, the invention provides a preparation method of a recombinant east Asia clamp scorpion toxin polypeptide Makatoxin-3 and a mutant thereof. The second purpose of the invention is to provide the application of the recombinant Buthus martensii Karsch toxin polypeptide Makatoxin-3 and the mutant thereof in analgesia. The Buthus martensii Karsch toxin polypeptide Makatoxin-3 and the mutant thereof have good development prospects of novel analgesic drugs.

In order to achieve the first object, the invention provides the following technical scheme:

a method for preparing recombinant Buthus martensii Katoxin-3 and its mutant comprises the following steps:

the method comprises the following steps: the method comprises the following steps of connecting a Makatoxin-3 gene or a mutant thereof with a periplasmic cavity expression vector fused with MBP protein which is subjected to double digestion after double digestion by utilizing a double digestion technology to construct a recombinant Makatoxin-3 or recombinant Makatoxin-3 mutant expression vector, wherein the N end of MBP contains a His6 label, the Makatoxin-3 gene is positioned at the C end of MBP, and the N end of the Makatoxin-3 is connected with the C end of His-MBP;

step two: transferring the recombinant Makatoxin-3 or recombinant Makatoxin-3 mutant expression vector obtained in the step one into an expression host, screening out a high-copy transformant, transferring the obtained high-copy transformant into a culture medium for culturing, and inducing and expressing soluble His6-MBP fused Makatoxin-3 and a mutant thereof by using an inducer, wherein the Makatoxin-3 or the Makatoxin-3 mutant in the fusion protein is the recombinant toxin polypeptide Makatoxin-3 or the mutant thereof;

step three: cracking cells by a physical method or a chemical reagent to release soluble recombinant MBP-Makatoxin-3 and mutant fusion protein thereof, extracting the recombinant fusion protein, purifying the fusion protein by His to obtain pure MBP-Makatoxin-3 and mutant fusion protein thereof, carrying out enzyme digestion reaction to release Makatoxin-3 or mutant thereof, and purifying again to obtain pure Makatoxin-3 and mutant protein thereof.

Specifically, the periplasmic cavity expression vector for fusing the MBP protein is a periplasmic cavity expression vector pLicC-MBP.

The expression host is preferably an expression vector suitable for the regulation of the T7 promoter, and preferred expression hosts include any one of E.coli, yeast and mammalian cells. More preferably, the expression host is E.coli.

Preferably, the inducer is any one of lactose, galactose and isopropyl galactoside (IPTG), the induction temperature is 15-37 ℃, and the induction time is 2-24 h.

Wherein, the nucleotide sequence of the encoded toxin polypeptide Makatoxin-3 is SEQ ID NO.1, and the nucleotide sequence has an amino acid sequence of SEQ ID NO. 2.

Specifically, the mutant of the toxin polypeptide Makatoxin-3 comprises any one of Makatoxin-1, Makatoxin-3-R58A and Makatoxin-1-D8K-D9K-R58A, wherein the nucleotide sequence SEQ ID NO.3 of the mutant Makatoxin-3 coding toxin polypeptide Makatoxin-1 has an amino acid sequence shown in SEQ ID NO. 4; the nucleotide sequence SEQ ID NO.5 of the mutant Makatoxin-3-R58A of the encoding toxin polypeptide Makatoxin-3 has an amino acid sequence shown in SEQ ID NO. 6; the nucleotide sequence SEQ ID NO.7 of the mutant Makatoxin-3, which encodes the toxin polypeptide Makatoxin-1-D8K-S9K-R58A, has an amino acid sequence shown in SEQ ID NO. 8. The two polypeptides of Makatoxin-3-R58A and Makatoxin-1-D8K-S9K-R58A are synthesized after mutation, and names of the two polypeptides are named according to mutation sites, for example, the amino acid R at the 58 th position of Makatoxin-3 is mutated into A by the Makatoxin-3-R58A, the amino acid D at the eight bit of the Makatoxin-1 is mutated into K by the Makatoxin-1-D8K-S9K-R58A is mutated into K by the S at the ninth position, and the R at the 58 th position is mutated into A by the Makatoxin-1.

Specifically, the last amino acid encoded by the gene of Makatoxin-3 and its mutant is followed by a termination codon TGA.

In a preferred embodiment, in step (3), the MBP-Makatoxin-3 and its mutant fusion protein is purified by nickel ion affinity chromatography, and is cut by TEV-protease specific protease, the MBP fragment in the fusion protein can be recognized and efficiently cleaved by TEV-protease specific protease to release MBP, and the MBP protein containing His6 tag and the recombinant scorpion venom protein Makatoxin-3 and its mutant without His6 are further separated by nickel ion affinity chromatography.

The recombinant scorpion venom protein Makatoxin-3 and the mutant thereof prepared by the method are also within the protection scope of the invention.

The invention further provides application of the recombinant scorpion venom protein Makatoxin-3 and the mutant thereof in preparing a medicament for easing pain.

Has the advantages that: compared with the prior art, the invention has the following advantages:

(1) the recombinant expression method of the invention can obtain the recombinant polypeptide with natural N end; the periplasmic cavity expression system and the MBP fusion expression technology can obtain the high-expression-quantity and correctly folded Makatoxin-3 and the mutant thereof;

(2) the recombinant Makatoxin-3 and the mutant thereof obtained by the invention have the same biological value and biological action as the naturally separated Makatoxin-3;

(3) the invention recombines the Makatoxin-3 and the mutant thereof and applies the Makatoxin-3 mutant to analgesia, and the use of the Makatoxin-3 mutant can effectively overcome the pain-causing effect of natural Makatoxin-3 and keep the analgesic activity of the natural Makatoxin-3;

(4) the analgesic activity generated by using the recombinant Makatoxin-3 and the mutant thereof is independent of an endogenous opium system and cannot be reversed by an opium receptor antagonist naloxone, and the side effects of drug tolerance, addiction and the like of the opioid receptor agonist analgesics such as morphine and the like can be predicted to be absent.

Drawings

FIG. 1 is a graph of the pain-causing effect of natural Makatoxin-3, wherein Panel A is the number of paw withdrawal per 5min of the mouse and Panel B shows that natural Makatoxin-3 can increase the total number of paw withdrawal in the mouse in a dose-dependent manner;

FIG. 2 is a graph showing the analgesic effect of natural Makatoxin-3; wherein, the graph A and the graph B show that the natural Makatoxin-3 has dose-dependent analgesic effect on inflammatory pain caused by formalin, the graph C shows that the natural Makatoxin-3 has obvious prevention and treatment effects in a CFA (circulating fluid dynamics) induced allodynic hypersensitivity model, the graph D, the graph E is a graph of formalin test results, and the graph F shows that naloxone does not reverse the analgesic effect of Makatoxin-3 in the CFA induced allodynic model;

FIG. 3 is a schematic representation of the interaction pattern of Makatoxin-3 with sodium channel Nav1.7, where A is the homology modeling structure of natural Makatoxin-3, B is the structure of human Nav1.7 channel, C and D are the surface of the Makatoxin-3-Nav1.7 binding complex, Nav1.7 negative electrostatic potential plane, respectively, and C indicates that extensive polar interaction is formed between Makatoxin-3 and VSD4 of Nav1.7 channel; E-F shows the specific interaction between the Makatoxin-3 residue and the Nav1.7 channel, and the polar interaction is shown as a red dotted line;

FIG. 4 is a comparison of analgesic activity of natural Makatoxin-3 and recombinant Makatoxin-3;

FIG. 5 is a diagram of the construction of Makatoxin-3 and its mutant vector;

FIG. 6 is HPLC analysis of rMakatoxin-3 and its mutants;

FIG. 7 is a diagram showing the purification process of MBP-Makatoxin-3 analyzed by SDS-PAGE, wherein the left diagram shows the components of the purification process of MBP-Makatoxin-3 analyzed by SDS-PAGE; l8 in the left panel is MBP-Makatoxin3 eluted from the nickel column; l1 is uninduced whole bacteria, L2 is induced whole bacteria, L3 is crushed thallus precipitate, L4 is crushed centrifugal supernatant, L5 is penetration after nickel column loading, L6 is penetration of AKATA balance, and L7 is 3% Buffer B impurity washing; the right panel shows the components of the MBP-Makatoxin-3 enzyme digestion mixture analyzed by SDS-PAGE, wherein L4 is rMakatoxin-3; l1 is MBP-Makatoxin-3 before enzyme digestion, L2 and L3 are TEV protease enzyme digestion mixture of the MBP-Makatoxin-3, and L5 is MBP label and TEV protease eluted by 100% Buffer B;

FIG. 8 is a SDS-PAGE analysis of the purification process of MBP-Makatoxin-1; the left panel shows the components of the purification process of MBP-Makatoxin-1 analyzed by SDS-PAGE, wherein L8 is MBP-Makatoxin-1 eluted from a nickel column; l1 is uninduced whole bacteria, L2 is induced whole bacteria, L3 is crushed thallus precipitate, L4 is crushed centrifugal supernatant, L5 is penetration after nickel column loading, L6 is penetration of AKATA balance, and L7 is 3% Buffer B impurity washing; the right panel shows the MBP-Makatoxin-1 enzyme digestion mixture analyzed by SDS-PAGE, wherein L3 is rMakatoxin-1; l1 is MBP-Makatoxin-1 before enzyme digestion, L2 is a TEV protease enzyme digestion mixture of MBP-Makatoxin-1, and L4 is an MBP label and TEV protease eluted by 100% Buffer B;

FIG. 9 is an SDS-PAGE analysis of the purification process of MBP-Makatoxin-3-R58A; the left panel shows the components of the purification process of MBP-Makatoxin-3-R58A analyzed by SDS-PAGE, wherein L8 is MBP-Makatoxin-3-R58A eluted from a nickel column; l1 is uninduced whole bacteria, L2 is induced whole bacteria, L3 is crushed thallus precipitate, L4 is crushed centrifugal supernatant, L5 is penetration after nickel column loading, L6 is penetration of AKATA balance, and L7 is 3% Buffer B impurity washing; the right panel shows the MBP-Makatoxin-3-R58A enzyme digestion mixture analyzed by SDS-PAGE, wherein L3-6 is rMakatoxin-3-R58A; l1 is MBP-Makatoxin-3-R58A before enzyme digestion, L2 is a TEV protease enzyme digestion mixture of MBP-Makatoxin-3-R58A, and L7 is an MBP label and TEV protease eluted by 100 percent Buffer B;

FIG. 10 is an SDS-PAGE analysis of the purification process of MBP-Makatoxin-1-D8K-S9K-R58A; the left panel shows the components of the purification process of MBP-Makatoxin-1-D8K-S9K-R58A analyzed by SDS-PAGE, wherein L8 is MBP-Makatoxin-1-D8K-S9K-R58A eluted from a nickel column; l1 is uninduced whole bacteria, L2 is induced whole bacteria, L3 is crushed thallus precipitate, L4 is crushed centrifugal supernatant, L5 is penetration after nickel column loading, and L6 is 3% Buffer B impurity washing; the right panel shows the components of the mixture of the SDS-PAGE analysis MBP-Makatoxin-1-D8K-S9K-R58A, wherein L4 is rMakatoxin-1-D8K-S9K-R58A; l1 is MBP-Makatoxin-1-D8K-S9K-R58A before enzyme digestion, L2 and L3 are TEV protease enzyme digestion mixtures of MBP-Makatoxin-1-D8K-S9K-R58A, and L5 is MBP label and TEV protease eluted by 100 percent Buffer B;

FIG. 11 is a circular dichroism spectrum of rMakatoxin-3 and rMakatoxin-3-R58A;

FIG. 12 is a graph of the analgesic effects of rMakatoxin-3 and rMakatoxin-3-R58A, wherein rMakatoxin-3(A, B), rMakatoxin-1(C, D), rMakatoxin-3-R58A (E, F), and rMakatoxin-1-D8K-S9K-R58A (G, H) have an analgesic effect in the mouse formalin model;

FIG. 13 shows the pain-causing effects of rMakatoxin-3 and rMakatoxin-3-R58A;

FIG. 14 is a graph of the analgesic effect of rMakatoxin-3, rMakatoxin-1, and rMakatoxin-3-R58A in a mouse CFA model;

FIG. 15 is a graph of the analgesic effect of rMakatoxin-3 in comparison to other analgesics in the mouse formalin model.

Detailed Description

The present invention will be described in further detail with reference to specific examples.

The reagents used in the following examples are all commercially available reagents. BCA protein concentration determination kit (batch number: P0012S) was purchased from Biyuntian biotech research institute; chromatographic grade trifluoroacetic acid (TFA), Acetonitrile (ACN) was purchased from Merck Drugs & Biotechnology, Germany; hemocyanin (KLH), 1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC: 1-Ethyl-3- (3-dimethylamino propyl) from Sigma, HRP-labeled goat anti-rabbit anti-IgG from Abcam, Tris, acrylamide, methylene bisacrylamide from Shanghai Czeri bioengineering, Inc., Sephadex G-50 dextran packing, XK26-1000 chromatography column from GE Healthcare Life Sciences, USA.

Olympus inverted microscope from Olympus, usa; right hand, automated micromanipulation MP-225, electrode drawing instrument P97, available from SUTTER corporation, usa; the single-probe ultra-low noise patch clamp amplifier Axon 200B and the digital-to-analog converter Digidata 1550 are available from MoLecular Devices, USA; ALA-VM8 full-automatic perfusion system was purchased from ALA, USA; MF-830 electrode polisher was purchased from Narishige, Japan; waters 2695 HPLC (Waters 2996 diode array detector, Waters Empower Pro chromatography workstation), HPLC C18 reversed-phase HPLC column specification Sino Chrom 5 μm from Waters corporation, USA.

Example 1 preparation of recombinant Buthus martensii Katoxin-3.

(1) The nucleotide sequence of the code scorpion venom protein Makatoxin-3 is SEQ ID NO.1, and the code scorpion venom protein has an amino acid sequence of SEQ ID NO. 2; for the nucleotide sequence (SEQ ID NO.1) encoding the Makatoxin-3 protein, the recognition site for the restriction enzyme is added before the first amino acid and the stop codon TAG and the recognition site for the restriction enzyme are added after the last amino acid.

(2) The nucleotide sequence SEQ ID NO.3 of the code scorpion venom protein Makatoxin-1 has an amino acid sequence SEQ ID NO. 4; for the nucleotide sequence encoding the Makatoxin-1 protein (SEQ ID NO.1), the recognition site for the restriction enzyme is added before the first amino acid, and the stop codon TAG and the recognition site for the restriction enzyme are added after the last amino acid.

(3) Construction of Makatoxin-3 and Makatoxin-1 expression vectors by using double enzyme digestion technology respectively

The following two upstream and downstream primers were designed based on the gene sequence of Makatoxin-3 on NCBI: CGGGGTACCGAAAATCTGTATTTTCAGGGCACCGCATG and 3-R GGAGCTCTTATTAATCTGCCGGTGTAC, and the following two upstream and downstream primers are designed according to the gene sequence of Makatoxin-1 on NCBI:

rMakatoxin-1-F: CGGGGTACCGAAAATCTGTATTTTCAGGGCACCGCATGTAG and rMakatoxin-1-R: GGAGCTCTTATTAATCTGCCGGTGTACAAC, the following specific reaction systems were set up in a 50. mu.l PCR reaction tube: q5 High-Fidelity DNA Polymerase Master mix: 25 mul; ddH ₂ O: 23 mu l of the solution; forward primers (10 pM): 1 mul; reverse primers (10 pM): 1 mul; cDNA template: 500 ng/. mu.l, for a total of 50. mu.l.

The specific reaction procedure is as follows: preheating at 98 deg.C for 3min, preheating at 98 deg.C for 30s, preheating at 60 deg.C for 20s, and circulating for 30 times. After the reaction is finished, 1.0% Agarose electrophoresis identification is carried out, and the target band is recovered by tapping.

PCR enzyme digestion treatment of gene fragments and vectors: the pLicC-MBP vector is selected as an expression vector, and KpnI and sacI are selected as enzyme cutting sites. After the PCR product is subjected to electrophoretic separation, cutting the gel and recovering a target fragment, and then respectively establishing an enzyme digestion reaction system as follows: gene fragment: 16 μ l (1 μ g); NEB Smartcut buffer: 2 mu l of the solution; kpn I: 1 μ l (15U); and Sac I: mu.l (15U).

And (3) connecting the gene fragment and the pLicC-MBP vector: establishing a corresponding connection system by using the gene fragment subjected to double enzyme digestion and a pLicC-MBP vector: 10 × Ligation Buffer: 3 mu l of the solution; gene enzyme cutting fragment: 15 μ l (0.2 pmol); pLicC-MBP linearized vector: 2. mu.l (0.03 pmo); t4 DNA Ligase: mu.l (350U). A schematic of the plasmid is shown in FIG. 5.

(4) Constructing a pLicC-MBP-Makatoxin-3-R58A mutant expression vector and a pLicC-MBP-Makatoxin-1-D8K-S9K-R58A mutant expression vector on the basis of pLicC-MBP-Makatoxin-3 plasmid and pLicC-MBP-Makatoxin-1 plasmid respectively by utilizing a DpnI point mutation technology.

Designing upstream and downstream primers according to gene sequences:

rMakatoxin-3-R58A-F: GGATAAAGTTCCGATTGCAATTCCGGGTCCGTGTATTGGTCG and

rMakatoxin-3-R58A-R:CAATACACGGACCCGGAATTGCAATCGGAACTTTATCCGGCAGATC；

rMakatoxin-1-D8K-S9K-F GTGATGCTTATATTGCCAAAAAGGAAAACTGTACCTATTTTTGTGG and rMakatoxin-1-D8K-

S9K-R: AATAGGTACAGTTTTCCTTTTTGGCAATATAAGCATCACGTCC, rMakatoxin-1-R58A-F: CGATAAGGTACCGATTGCAATACCAGGACCATGCCGTGGCCG and

rMakatoxin-1-R58A-R:GCATGGTCCTGGTATTGCAATCGGTACCTTATCGGGCAAGTC，

reagents were added to the PCR tubes as follows: q5 Hot Start HiFi PCR Master Mix: 25 mul; ddH ₂ O: 23 mu l of the solution; forward primers (10 pM): 1 mul; reverse primers (10 pM): 1 mul; pLicC/MBP-Makatoxin-3/1: 500 ng/. mu.l, for a total of 50. mu.l.

The specific reaction procedure is as follows: preheating at 94 ℃ for 3min in the first step, 20s at 98 ℃, 30s at 60 ℃ and 6:30s at 72 ℃ in the second step, and circulating for 30 times in the second step. First step 72 ℃ for 8 min. After the reaction is finished, recovering the PCR product, performing DpnI enzyme digestion, and preparing a reaction mixed solution according to the following steps: recovered PCR product: 17 μ l (1 μ g); 10 XNEB (CutSmart) buffer: 2 mu l of the solution; dpn I (20U/. mu.L): mu.l (15U). Reaction conditions are as follows: 4h at 37 ℃ and 15min at 80 ℃.

(5) The Makatoxin-3 and the mutant recombinant expression vector thereof are transferred into host cells to realize high-efficiency soluble expression.

Two tubes of the prepared BL21 competent cells, one tube is used as a blank control, and the tube is put on ice for precooling for 20 min. Then, recombinant MBP-Makatoxin-3 or its mutant plasmid was added to one tube, and the other tube was incubated on ice for 20min without treatment as a blank. Then heat shock is carried out, the incubated two tubes BL21 are subjected to competence, the water bath with the set temperature of 42 ℃ is put in, the time is precisely timed for 90s, the tube is immediately put on ice to be cooled for 5min after 90s, and the tube is added with the tube which is preheated at the temperature of 37 DEG CThe good LB medium, placed in 37 degrees C shaking table, 220rpm shake incubation for 1 h. Then, 200. mu.l each of the incubated competencies was plated on ampicillin-resistant LB solid medium and placed in a 37 ℃ incubator overnight. Colonies of moderate size, smooth-edged colonies were selected from LB solid plates which had been transformed with the plasmid, and the colonies were picked up with a sterilized 10. mu.l tip (one tip for each clone), transferred to a sterilized tube of LB medium (3 ml) containing 100. mu.g/ml Amp, and shaken overnight at 220rpm (typically 10-12h) at 37 ℃ in a shaker. The next morning 3ml of the shaken broth was transferred to 500ml of sterilized Amp containing 100. mu.g/ml (one vial for each vial), placed in a shaker at 37 ℃ and shaken at 220rpm until OD 600 ═ 0.8-1 (about 5 hours), then 1mM IPTG (isopropyl-. beta. -D-thiogalactoside) was added at a final concentration of 1mM, set at 37 ℃ and 180rpm, and induced for 3.5 hours. Transferring the induced bacterial liquid into a 250ml centrifuge cup at 4500rpm, collecting the thallus, adding 150ml Buffer A (55mM NaH) ₂ PO4, 200mM NaCl, 10% glycerol, 40mM imidazole, pH 8.0. ) And (4) resuspending. The resuspended suspension was crushed under high pressure (setting conditions: power 1.5Kbar, 4 ℃ C.). And finally, centrifuging the crushed bacterium liquid at 12000rpm for 50min, collecting supernatant, and placing the supernatant on ice for later use. Opening AKATA chromatographic system to balance nickel column with Buffer A for 3 column volumes, taking down after balancing, sampling collected supernatant with peristaltic pump, taking column back to AKTA, observing ultraviolet absorption peak at 215nm/280nm, washing absorption peak with Buffer A, and adding 100% Buffer B (100mM NaH) to obtain final product ₂ PO4, 500mM NaCl, 10% glycerol, 500mM imidazole, pH 8.0), observing the peaks, and collecting the eluate to obtain recombinant MBP-Makatoxin-3 or its mutant.

(4) Separation and purification of recombinant MBP-Makatoxin-3 and mutant thereof

Since the eluate of the recombinant MBP-Makatoxin-3 and its mutant contains a large amount of salt, which is not conducive to subsequent enzyme digestion, the collected recombinant MBP-Makatoxin-3 and its mutant are first replaced with a solution with a lower salt concentration, and then the protein is desalted into Buffer C (25mM NaH2PO4, 50mM NaCl, 10% glycerol, 25mM imidazole, pH 8.0) using a GE HiTrap desaling (5ml) Desalting column. Then, the enzyme was digested for 12 hours in a 25 ℃ incubator with the addition of TEV protease, GSH (reduced glutathione) and GSSG (oxidized glutathione) at final concentrations of 3mM and 0.3 mM. And after the enzyme digestion is finished in the morning on the third day, opening an AKTA chromatographic system, balancing the nickel column by 3 column volumes by using Buffer A, loading the enzyme digestion mixture by using an instrument loading ring, collecting the penetration liquid, balancing 3 column volumes by using 100% of Buffer A after the loading is finished, eluting by using 100% of Buffer B, and collecting the eluent. And concentrating the collected penetrating fluid, and cleaning the 5KD ultrafiltration membrane with 500ml double distilled water before use, wherein the optimal sample flow rate during concentration is 30-50ml/min, the corresponding rotation speed of a peristaltic pump is 70-90rpm, and the RET pipe clamp is not required to be completely clamped, and pressure is slightly applied. Finally, the concentrated recombinant Makatoxin-3 and its mutant were loaded by HPLC (results are shown in fig. 6), and the chromatographic conditions were as follows: mobile phase a was an aqueous solution containing 0.1% trifluoroacetic acid and mobile phase B was a solution containing 0.1% acetonitrile. In FIG. 7, lane 8 on the left is purified MBP-Makatoxin-3, and lane 4 is purified rMakatoxin-3 polypeptide; in FIG. 8, lane 8 on the left is purified MBP-Makatoxin-1, and lane 3 is purified rMakatoxin-1 polypeptide; in FIG. 9, lane 8 shows purified MBP-Makatoxin-3-R58A in the left panel, and lane 3-6 shows purified rMakatoxin-3-R58A polypeptide in the right panel; in FIG. 10, lane 7 of the left panel shows purified MBP-Makatoxin-1-D8K-S9K-R58A, and lane 4 of the right panel shows purified rMakatoxin1-D8K-S9K-R58A polypeptide. The spatial structures of the recombinant Makatoxin-3 and the mutant protein thereof prepared by the research are close (as shown in figure 11). In this study, the final soluble rMakatoxin-3 protein was 0.5mg, calculated on 1L of bacterial culture, and the obtained polypeptide had better activity (Table 1).

TABLE 1 comparison of the polypeptides obtained for different expression systems

(5) Research on analgesic and pain-causing activities of the recombinant Makatoxin-3 and the mutant thereof.

Mouse formalin inflammatory pain relief study: full male C57BL/6J male mice (20g + -2 g) were selected, 6-9 mice per group. Mice were injected intraperitoneally with 100 μ L/mouse, the polypeptide injection concentrations were 150nmol/kg, 300nmol/kg and 450nmol/kg, the blank group was injected with Saline and 1% BSA, the control group was injected with 5mg/kg morphine, and after 30min, the left hind sole was injected subcutaneously with 10 μ L of 1% (v/v) formalin solution. Counting: after the left hind sole of the mouse is injected with formalin subcutaneously, the duration of pain behaviors (such as licking and shaking feet) of the mouse within every 5min is observed and recorded, and the sum of the pain behaviors occurring in Phase I (0-10min) and Phase II (10-40min) is counted respectively, wherein the experimental time is 40 min. As shown in fig. 12, after intraperitoneal injection of different high concentrations of recombinant Makatoxin-3(rMakatoxin-3), the duration of pain behavior occurred in mice within 5min was significantly reduced, and the reduction was more significant the higher the injection amount, especially in Phase II (10-40min), the duration of pain behavior of recombinant Makatoxin-3 was significantly reduced, and the reduction was more significant the higher the injection amount. The recombinant Makatoxin-1 has similar effect with Makatoxin-3-R58A. In addition, rMakatoxin-1-D8K-S9K-R58A had a lower analgesic effect than rMakatoxin-3 (FIG. 12).

Mouse pain development study: selecting a C57BL/6J male mouse (20g +/-2 g), and adopting a sole injection mode; injection volume: 10 μ L each; each group had a total of 10, and the dosages were set for each group: rMakatoxin-3 and rMakatoxin-3-R58A were injected at a concentration of 50nmol/kg, while blank groups were injected with Saline and 1% BSA, and Morphine (Morphine) was injected at a concentration of 5 mg/kg. We used a camera with 720P resolution to record the pain behavior of the mice after the whole procedure by playback, recording for 120 min. Counting the total times of licking the feet within 120 min; the licking duration was calculated. rMakatoxin-3 has a significant pain-causing effect (FIGS. 13A and B), while the pain-causing effect of rMakatoxin-3 after R58A mutation is significantly reduced.

Mouse mechanical pain threshold detection experiment: c57BL/6J male mice (20g + -2 g) were divided into 10 mice per group and injected plantar; mu.L/mouse, rMakatoxin-3 and rMakatoxin-3-R58A were injected at a concentration of 50nmol/kg, Saline and 1% BSA were injected in the blank group, and Morphine was injected at a concentration of 5 mg/kg. After the injection of the polypeptide, the pain of scorpion toxin generally lasts for about 60min until the pain behaviors (licking, leg shaking and leg hanging) are obviously reduced or disappeared, then the mice are placed in Plantar Test (Hargreaves method) Glass standards to be adapted for 5-10min, then a von-frey electromechanical acupuncture instrument is used for testing the mechanical threshold of the administration sole, and the force threshold when the mice generate natural foot shrinkage (including stepping) after being stimulated by the mechanical acupuncture is the foot shrinkage threshold (calculated by weight unit g) of the mice is repeatedly tested for 5 times by each mouse, and the average value is used as a final reference value. The results showed that the mechanical threshold of the mice was significantly reduced after the injection of rMakatoxin-3, and therefore rMakatoxin-3 had a significant pain-causing effect (FIG. 14C), while the pain-causing effect of rMakatoxin-3 after the R58A mutation was significantly reduced.

Mouse CFA chronic pain analgesia study: full male C57BL/6J male mice (20g + -2 g) were selected, 6-8 mice per group. The administration mode comprises the following steps: mice were intraperitoneally injected with 100 μ L/mouse, the polypeptide injection concentrations were 300nmol/kg and 450nmol/kg, respectively, blank groups were injected with Saline and 1% BSA, control groups were injected with 5mg/kg morphine, 30min after administration, mice were given a left posterior plantar subcutaneous injection (10 μ L0.5 mg/ml) CFA (complete Freund's adjuvant), the mechanical pain threshold of mice was measured 2h and 24h after plantar injection of CFA, then administration was performed again, and the mechanical pain threshold of mice was measured again 2h later. Adopting a recording mode: after the mice were injected subcutaneously (10. mu.l of 0.5mg/ml) with CFA (complete Freund's adjuvant) on the soles of the feet, the mice were placed in Plantar Test (Hargreaves method) Glass standards and the mechanical pain threshold of the left hind-feet of the mice was recorded with an electronic von Frey pain tester. rMakatoxin-3, rMakatoxin-1 and rMakatoxin-3-R58A all showed significant analgesic effects in the CFA model. Morphine showed a reduced analgesic effect upon long-term administration, however, the analgesic effects of rMakatoxin-3, rMakatoxin-1 and rMakatoxin-3-R58A were still superior to morphine (FIG. 14). In addition, the analgesic effects of rMakatoxin-3 were compared with those of analgesics other than morphine, and rMakatoxin-3 was found to have a better analgesic effect in the mouse formalin model (as shown in FIG. 15).

The present invention provides a preparation idea and a method of a recombinant scorpion venom protein Makatoxin-3 and mutants thereof, and a plurality of methods and ways for implementing the technical scheme, and the above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, a plurality of improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention. All the components not specified in this embodiment can be implemented by the prior art.

Sequence listing

<110> Jiangsu province institute of traditional Chinese medicine

<120> recombinant Buthus martensii Katoxin polypeptide Makatoxin-3 and preparation method and application of mutant thereof

<130> 20201014

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 201

<212> DNA

<213> 66 amino acid Sequence (Artificial Sequence) encoding scorpion venom protein Makatoxin-3

<400> 1

ggtcgtgatg cctatattgc aaaaaaggaa aattgtacct acttctgcgc cctgaatccg 60

tattgtaatg atctgtgcac caaaaatggc gcaaaaagcg gttattgtca gtgggcaggc 120

cgctatggca atgcctgttg gtgcattgat ctgccggata aagttccgat tcgtattccg 180

ggtccgtgta ttggtcgcta a 201

<210> 2

<211> 66

<212> PRT

<213> 66 amino acid residues Sequence of scorpion venom protein Makatoxin-3 (Artificial Sequence)

<400> 2

Gly Arg Asp Ala Tyr Ile Ala Lys Lys Glu Asn Cys Thr Tyr Phe Cys

1 5 10 15

Ala Leu Asn Pro Tyr Cys Asn Asp Leu Cys Thr Lys Asn Gly Ala Lys

20 25 30

Ser Gly Tyr Cys Gln Trp Ala Gly Arg Tyr Gly Asn Ala Cys Trp Cys

35 40 45

Ile Asp Leu Pro Asp Lys Val Pro Ile Arg Ile Pro Gly Pro Cys Ile

50 55 60

Gly Arg

65

<210> 3

<211> 201

<212> DNA

<213> 66 amino acid Sequence (Artificial Sequence) encoding scorpion venom protein Makatoxin-1

<400> 3

ggacgtgatg cttatattgc cgacagcgaa aactgtacct atttttgtgg ttcaaatcca 60

tattgcaacg atttatgtac cgagaacggt gctaagagtg gctactgcca atgggcaggt 120

agatatggaa atgcctgctg gtgcatagac ttgcccgata aggtaccgat tagaatacca 180

ggaccatgcc gtggccgata a 201

<210> 4

<211> 66

<212> PRT

<213> 66 amino acid residues Sequence of scorpion venom protein Makatoxin-1 (Artificial Sequence)

<400> 4

Gly Arg Asp Ala Tyr Ile Ala Asp Ser Glu Asn Cys Thr Tyr Phe Cys

1 5 10 15

Gly Ser Asn Pro Tyr Cys Asn Asp Leu Cys Thr Glu Asn Gly Ala Lys

20 25 30

Ser Gly Tyr Cys Gln Trp Ala Gly Arg Tyr Gly Asn Ala Cys Trp Cys

35 40 45

Ile Asp Leu Pro Asp Lys Val Pro Ile Arg Ile Pro Gly Pro Cys Arg

50 55 60

Gly Arg

65

<210> 5

<211> 201

<212> DNA

<213> 66 amino acid Sequence (Artificial Sequence) encoding scorpion venom protein Makatoxin-3-R58A

<400> 5

ggtcgtgatg catatattgc aaaaaaagaa aattgtacct atttttgtgc actgaatccg 60

tattgtaatg atctgtgtac caaaaatggt gcaaaaagcg gttattgtca gtgggcaggt 120

cgttatggta atgcatgttg gtgtattgat ctgccggata aagttccgat tgcaattccg 180

ggtccgtgta ttggtcgtta a 201

<210> 6

<211> 66

<212> PRT

<213> amino acid residue Sequence of scorpion venom protein Makatoxin-3-R58A (Artificial Sequence)

<400> 6

Gly Arg Asp Ala Tyr Ile Ala Lys Lys Glu Asn Cys Thr Tyr Phe Cys

1 5 10 15

Ala Leu Asn Pro Tyr Cys Asn Asp Leu Cys Thr Lys Asn Gly Ala Lys

20 25 30

Ser Gly Tyr Cys Gln Trp Ala Gly Arg Tyr Gly Asn Ala Cys Trp Cys

35 40 45

Ile Asp Leu Pro Asp Lys Val Pro Ile Ala Ile Pro Gly Pro Cys Ile

50 55 60

Gly Arg

65

<210> 7

<211> 201

<212> DNA

<213> 66 amino acid Sequence (Artificial Sequence) encoding scorpion venom protein Makatoxin-1-D8K-D9K-R58A

<400> 7

ggacgtgatg cttatattgc caaaaaggaa aactgtacct atttttgtgg ttcaaatcca 60

tattgcaacg atttatgtac cgagaacggt gctaagagtg gctactgcca atgggcaggt 120

agatatggaa atgcctgctg gtgcatagac ttgcccgata aggtaccgat tgcaatacca 180

ggaccatgcc gtggccgata a 201

<210> 8

<211> 66

<212> PRT

<213> scorpion venom protein Makatoxin-1-D8K-D9K-R58A Sequence of 66 amino acid residues (Artificial Sequence)

<400> 8

Gly Arg Asp Ala Tyr Ile Ala Lys Lys Glu Asn Cys Thr Tyr Phe Cys

1 5 10 15

Gly Ser Asn Pro Tyr Cys Asn Asp Leu Cys Thr Glu Asn Gly Ala Lys

20 25 30

Ser Gly Tyr Cys Gln Trp Ala Gly Arg Tyr Gly Asn Ala Cys Trp Cys

35 40 45

Ile Asp Leu Pro Asp Lys Val Pro Ile Ala Ile Pro Gly Pro Cys Arg

50 55 60

Gly Arg

65

<210> 9

<211> 38

<212> DNA

<213> rMakatoxin-3 upstream primer (Artificial Sequence)

<400> 9

cggggtaccg aaaatctgta ttttcagggc accgcatg 38

<210> 10

<211> 27

<212> DNA

<213> rMakatoxin-3 downstream primer (Artificial Sequence)

<400> 10

ggagctctta ttaatctgcc ggtgtac 27

<210> 11

<211> 41

<212> DNA

<213> rMakatoxin-1 upstream primer (Artificial Sequence)

<400> 11

cggggtaccg aaaatctgta ttttcagggc accgcatgta g 41

<210> 12

<211> 30

<212> DNA

<213> rMakatoxin-1 downstream primer (Artificial Sequence)

<400> 12

ggagctctta ttaatctgcc ggtgtacaac 30

<210> 13

<211> 42

<212> DNA

<213> rMakatoxin-3-R58A upstream primer (Artificial Sequence)

<400> 13

ggataaagtt ccgattgcaa ttccgggtcc gtgtattggt cg 42

<210> 14

<211> 46

<212> DNA

<213> rMakatoxin-3-R58A downstream primer (Artificial Sequence)

<400> 14

caatacacgg acccggaatt gcaatcggaa ctttatccgg cagatc 46

<210> 15

<211> 46

<212> DNA

<213> rMakatoxin-1-D8K-D9K upstream primer (Artificial Sequence)

<400> 15

gtgatgctta tattgccaaa aaggaaaact gtacctattt ttgtgg 46

<210> 16

<211> 43

<212> DNA

<213> rMakatoxin-1-D8K-D9K downstream primer (Artificial Sequence)

<400> 16

aataggtaca gttttccttt ttggcaatat aagcatcacg tcc 43

<210> 17

<211> 42

<212> DNA

<213> rMakatoxin-1-R58A upstream primer (Artificial Sequence)

<400> 17

cgataaggta ccgattgcaa taccaggacc atgccgtggc cg 42

<210> 18

<211> 42

<212> DNA

<213> rMakatoxin-1-R58A downstream primer (Artificial Sequence)

<400> 18

gcatggtcct ggtattgcaa tcggtacctt atcgggcaag tc 42

Claims (5)

1. A preparation method of a recombinant Buthus martensii Katoxin-3 mutant is characterized by comprising the following steps:

the method comprises the following steps: the method comprises the following steps of connecting the Makatoxin-3 mutant gene with a periplasmic cavity expression vector fused with MBP protein which is subjected to double digestion after double digestion by utilizing a double digestion technology to construct a recombinant Makatoxin-3 mutant expression vector, wherein the N end of MBP contains a His6 label, the Makatoxin-3 mutant gene is positioned at the C end of the MBP, and the N end of the Makatoxin-3 mutant gene is connected with the C end of His-MBP;

step two: transferring the recombinant Makatoxin-3 mutant expression vector obtained in the step one into an expression host, screening out a high-copy transformant, transferring the obtained high-copy transformant into a culture medium for culture, and inducing and expressing a soluble His6-MBP fused Makatoxin-3 mutant by using an inducer, wherein the Makatoxin-3 mutant in the fusion protein is a recombinant toxin polypeptide Makatoxin-3 mutant;

step three: cracking cells by using a physical method or a chemical reagent, releasing soluble recombinant MBP-Makatoxin-3 mutant fusion protein, extracting the recombinant fusion protein, purifying the fusion protein by His to obtain pure MBP-Makatoxin-3 mutant fusion protein, carrying out enzyme digestion reaction, releasing a Makatoxin-3 mutant, and purifying again to obtain pure Makatoxin-3 mutant protein;

the periplasmic cavity expression vector fused with the MBP protein is a periplasmic cavity expression vector pLicC-MBP, the expression host is escherichia coli, and the mutant of the toxin polypeptide Makatoxin-3 is any one of Makatoxin-3-R58A and Makatoxin-1-D8K-S9K-R58A, wherein the nucleotide sequence for coding the Makatoxin-3-R58A is SEQ ID NO.5, and has an amino acid sequence shown in SEQ ID NO. 6; the nucleotide sequence of the code Makatoxin-1-D8K-S9K-R58A is SEQ ID NO.7, and the nucleotide sequence has an amino acid sequence shown in SEQ ID NO. 8;

in the third step, the MBP-Makatoxin-3 mutant fusion protein is purified by using nickel ion affinity chromatography, enzyme digestion is carried out by using TEV protease to release MBP, and the MBP protein containing a His6 label and the recombinant scorpion venom protein Makatoxin-3 mutant without His6 are further separated by using nickel ion affinity chromatography.

2. The method of claim 1, wherein the inducer is any one of lactose, galactose and isopropyl galactoside (IPTG), the induction temperature is 15-37 ℃, and the induction time is 2-24 h.

3. The method according to claim 1, wherein the last amino acid encoded by the Makatoxin-3 mutant gene is followed by a termination codon TGA.

4. The mutant of the recombinant scorpion venom protein Makatoxin-3 prepared by the preparation method of any one of claims 1-3.

5. Use of the recombinant scorpion venom protein Makatoxin-3 mutant in the preparation of drugs for easing pain according to claim 4.

Images