CN112175928A

CN112175928A - Application of protein encoded by salmonella bacteriophage gene as gram-negative bacteria lyase

Info

Publication number: CN112175928A
Application number: CN202011088227.8A
Authority: CN
Inventors: 李锦铨; 徐偲月; 晏婷
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-10-13
Filing date: 2020-10-13
Publication date: 2021-01-05
Anticipated expiration: 2040-10-13
Also published as: CN112175928B

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a protein derived from salmonella bacteriophage gene coding as a lyase, wherein the amino acid sequence of the protein is shown as SEQ ID NO.2, and the nucleotide sequence of the gene coding the protein is shown as SEQ ID NO. 1. The invention discovers for the first time that the protein shown in SEQ ID NO.2 has the function of lyase and can cleave gram-negative bacteria such as escherichia coli and the like from inside, the lyase has high cleavage effect and has cleavage effect on various escherichia coli and salmonella.

Description

Application of protein encoded by salmonella bacteriophage gene as gram-negative bacteria lyase

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of a protein derived from salmonella bacteriophage gene code as a lyase.

Background

The lyase produced by phage coding is produced in the later stage of phage infection of bacteria, and the lyase can reach the effect of cracking bacteria by acting on peptidoglycan layer of bacterial cell wall. At present, more researches on positive bacteria lyase internationally exist, and as cell wall outer membranes do not exist, the lyase added from an external source can directly act on bacteria, and the effects of bacteria cracking and sterilization can be achieved by cracking the cell walls of the bacteria. However, for gram-negative bacteria lytic enzymes, which have an outer cell wall membrane and are highly resistant to exogenously added lytic enzymes, most membrane-penetrating agents are used in combination with lytic enzymes in the current research, and the research finds that a small part of lytic enzymes have the capability of independently lysing negative bacteria, which is presumably related to the charge property of the lytic enzymes themselves. Most of phage lytic enzymes have the characteristic of double domains, namely, a catalytic domain at the N end and a binding domain at the C end, wherein the binding domain is responsible for binding with a specific site on the cell wall of host bacteria, and the catalytic domain can specifically cut off chemical bonds on peptidoglycan, so that the effect of cracking bacteria is achieved. In addition, some lyase with other structural characteristics, such as some gram-negative bacteria lyase, catalytic domain is at C end, binding domain is at N end; some lyases also have a structure in which multiple binding domains or different catalytic domains are connected in series.

With the development of sequencing technology, large-scale virus metagenomics and culture technology, complete phage genome sequences in databases are increasing, and as the 9 months in 2019, the genome quantity exceeds 8000, and the continuous research of new phage genomes is beneficial to further understanding of diversity of phage genomes and interaction mechanisms between phage and bacteria. A plurality of functional proteins in the phage need to be mined, scientific basis can be provided for the subsequent safe application of the phage in the fields of food, medicine, agriculture and the like through ORF prediction, function prediction and virulence factor or drug resistance factor prediction, and in addition, the development of the phage proteins, the evolution and the cracking mechanism of the phage and the like can be researched on the basis of the functional genomics analysis of the phage. However, currently, there is still high inaccuracy in predicting the function of lyase through software, for example, experiments prove that the lyase with a cracking function only accounts for about 5% of the capacity of cracking live bacteria.

The bacteriophage lyase has wide application prospect in the fields of medical treatment, agriculture, food safety and the like due to high-efficiency bactericidal property, species specificity and safety, and the gram-positive bacterium lyase is applied to the field of food safety at present to successfully eliminate food-borne pathogenic bacteria. However, gram-negative bacteria lyase has fewer related application examples due to the restriction of the outer membrane. The lyase can be used for researching a bacterial ghost vaccine or an active substance delivery carrier by self-internally cleaving bacterial ghost cells formed by gram-negative bacteria, however, not all lyases have good self-internally cleaving effect, and therefore, part of lyases do not have the capacity of preparing the gram-negative bacterial ghost cells.

Ghosts are the outer cell membranes from gram-negative bacteria that do not contain all cytoplasmic components, but have an intact cellular morphology, including all cell surface structures. Thus the bacterial ghosts can be used as delivery vehicles for vaccines, drugs or active substances, etc. Compared with the traditional vaccine, the bacterial ghost serving as the vaccine has the advantages of targeting, inherent adjuvant property, no denaturation in the cracking process, retention of all antigenic determinants and the like. At present, bacterial ghost cells are successfully constructed in various strains such as escherichia coli, staphylococcus aureus, pseudomonas aeruginosa, klebsiella pneumoniae and the like.

Disclosure of Invention

The application of the protein derived from salmonella bacteriophage gene code as lyase, the protein sequence is shown in SEQ ID NO.2, and the coding nucleotide sequence is shown in SEQ ID NO. 1.

In order to achieve the purpose, the invention adopts the following technical measures:

the application of the protein derived from salmonella bacteriophage gene code as lyase comprises the steps of directly preparing the lyase by utilizing the protein, wherein the lyase can be used for directly cracking cells by adding an inducer without adding any other materials and can be used for cell disruption in protein expression; the application of the invention also comprises the preparation of bacterial ghosts (pathogenic escherichia coli and salmonella) by utilizing the gene for encoding the protein, and the prepared bacterial ghost cells are used as antigen substances for vaccine preparation and can also be used as delivery vectors of medicines, heterologous antigens, nucleic acids and the like, which are safer due to the lack of inclusion.

Compared with the prior art, the invention has the following advantages:

1. the invention discovers for the first time that the protein shown in SEQ ID NO.2 has the function of lyase and can crack gram-negative bacteria such as escherichia coli, salmonella and the like from inside;

2. the lyase provided by the invention has high lytic effect and has lytic effect on various gram-negative bacteria.

Drawings

FIG. 1 shows the PCR amplification product of ORF-40 inserted gene.

FIG. 2 is a PCR validation of the bacterial liquid of the recombinant plasmid transformant;

wherein A is PCR verification of Escherichia coli BL21(DE3) -pBAD24-ORF 40 bacterial liquid; b is PCR verification of escherichia coli BL21(AI) -pBAD24-ORF 40 bacterial liquid; c is PCR verification of Escherichia coli BL21(DE3) pLysS-pBAD 24-ORF 40 bacterial liquid; m: marker DL 2000; lanes 1-3: 3 transformants were picked for validation from the same strain. FIG. 3 is a graph of the lysis of self-induced engineered Escherichia coli;

wherein A isE.colithe cleavage curve of trans5 alpha-pBAD 24-ORF 40, B isE.coliThe cleavage curve of BL21(DE3) -pBAD24-ORF 40, C isE.coliThe cleavage curve of BL21(AI) -pBAD24-ORF 40, D isE.coliCleavage curves of BL21(DE3) plySs-pBAD 24-ORF 40.

FIG. 4 shows construction of chloramphenicol-resistant recombinant vectors and PCR verification of transformant bacterial fluid.

FIG. 5 is a lysis curve for Salmonella and E.coli containing the recombinant lysogen plasmid pBAD24-ORF 40.

Detailed Description

The following examples are intended to further illustrate, but not limit, the present invention. It will be understood by those skilled in the art that any parallel changes and modifications of the present invention, which are not specifically described, are within the scope of the present invention and are conventional in the art, may be made without departing from the spirit and principles of the present invention; the reagents or materials, if not specifically mentioned, are commercially available.

Example 1:

construction of engineered strains and determination of self-lysis curves

1. Lyase gene cloning and pBAD24-ORF 40 vector construction

Upstream and downstream primers ORF 40-F and ORF40-R of the inserted gene were designed using the base sequence of ORF40 (shown in SEQ ID NO.1, corresponding amino acid sequence shown in SEQ ID NO. 2) as a template, and upstream and downstream primers pBAD24-F and pBAD24-R of plasmid linearization were designed using the sequence of plasmid pBAD24 as a template, and the primers ORF 40-F and ORF40-R of the inserted gene had homologous sequences to the primers pBAD24-F and pBAD24-R of plasmid pBAD24, and were synthesized by Shanghai Producer corporation.

orf 40-f:ttgggctagcaggaggaattcaccatgaagtcgcgtcgaa ga aga

orf 40-r:caaaacagccaagcttgcacgttattattgcaccggtttt gaca

pbad24-f:taacgtgcaagcttggctgttttg

pbad24-r:ggtgaattcctcctgctagcccaa

The procedure for PCR amplification of the gene of interest ORF40 was as follows: taking 1 mu L gene as a template, adding 100ng of upstream and downstream primers ORF 40-F and ORF40-R respectively for PCR amplification, wherein the PCR conditions are as follows: (1) pre-denaturation at 94 ℃ for 10 min; (2) denaturation at 94 ℃ for 30sec, annealing at 55 ℃ for 30sec, extension at 72 ℃ for 30sec, 30 cycles; (3) extension at 72 ℃ for 5 min.

The linearized PCR amplification procedure for vector pBAD24 was as follows: using 1. mu.L of gene as template, 100ng of each of upstream and downstream primers pBAD24-F and pBAD24-R was added for PCR amplification under the following conditions: (1) pre-denaturation at 98 ℃ for 30 sec; (2) denaturation at 98 ℃ for 10sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 2min for 30sec, 25 cycles; (3) extension at 72 ℃ for 5 min.

Constructing a recombinant plasmid pBAD24-ORF 40 by utilizing the principle of homologous recombination: transferring 1 muL of PCR product of inserted gene and 1 muL of PCR product of plasmid linearization into 50 muL of competence E.coli trans5 alpha, carrying out PCR verification on the transformant by taking ORF 40-F and ORF40-R as primers, and obtaining the full-length ORF40 gene through amplification, as shown in figure 1, wherein M is standard molecular weight DL2000, and 1-5 are amplification bands which are consistent with target size 576 bp.

2. Construction of large intestine engineering strain self-induced cracking system

The recombinant plasmids constructed in step 1 were transformed into E.coli trans5 α, E.coli BL21(DE3), E.coli BL21(DE3) pLysS and E.coli BL21(AI), respectively, correct transformants were picked and verified, the results of verification are shown in FIG. 2, a single clone of E.coli trans5 α -pBAD24-ORF 40, E.coli BL21(DE3) -pBAD24-ORF 40, E.coli BL21(AI) -pBAD24-ORF 40 and E.coli BL21(DE3) pLysS-pBAD 24-ORF 40 was inoculated into 5mL of the corresponding resistant LB medium, cultured at 37 ℃, 180rpm for 8h, 100 μ L was inoculated into 10mL of the corresponding resistant strain liquid, cultured at 37 ℃, 180rpm for 0.6, and introduced into E.coli strains of E.coli trans5 α -ORF 40 (DE 4640-pLysS-pBAD 24-ORF 40) and E.coli BL21(DE 4640) through induction, respectively, pBAD24-ORF 40 and pBAD 38-3638-ORF 40 (DE 5-3696L/3640, cultured at 37 ℃, 100 μ L The reagent was prepared by adding 1mol/L IPTG inducer and 20% arabinose to E.coli BL21(AI) -pBAD24-ORF 40, performing induction expression at 37 ℃ and 180rpm, respectively, and measuring OD600 value of the bacterial solution with the uninduced strain as a control, and plotting a lysis curve (FIG. 3).

As shown in FIG. 3, when the lyase gene (ORF 40) was expressed in trans5 α, BL21(DE3), BL21(DE3) plysS, BL21(AI) of engineered E.coli, the OD value decreased compared to the control, demonstrating that the ability of the lyase to self-endo-lyse facilitates the lysis of the engineered E.coli, which facilitates the release of the bacterial content, i.e., the release of recombinant proteins.

Therefore, a recombinant plasmid containing ORF40 gene can be constructed, the recombinant plasmid and a recombinant plasmid expressing heterologous protein are transferred into escherichia coli (the induction conditions of the two are different), the heterologous protein is induced and expressed, then IPTG and arabinose are added to induce and express the self-endolyase, and according to the cracking capability of SAR-endolysin, a physical crushing method can be replaced in a heterologous protein expression system, and an expression strain is cracked mildly; in addition, the method can be combined with a physical method, so that the disadvantages caused by the traditional physical crushing method (for example, the traditional physical crushing method has higher strength and can cause excessive cell crushing, which is not beneficial to the extraction of soluble protein) are avoided.

According to the results, the cracking effect of the lyase is different for different engineering strains,escherichia coli trans5 alpha, BL21(AI), BL21(DE3) and pLysSBL21(AI) in bacterial liquid OD of 8h, 3.5h and 3.5h respectively₆₀₀The cracking efficiency is maximum at the moment when the cracking efficiency is reduced to the minimum.

Example 2:

construction of Escherichia coli ghost cells

1. Identification of chloramphenicol resistant pBAD24-ORF 40 recombinant plasmid

Coli X7213 competent cells were prepared, and the constructed recombinant plasmid pBAD24-ORF 40 was transformed into X7213 competent cells.

And carrying out PCR verification on the transformant by using ORF 40-F and ORF40-R as primers, and carrying out gel nucleic acid electrophoresis on PCR products to show that the size of a band is consistent with that of a target band, as shown in A in FIG. 4.

2. Conjugation transfer to Salmonella typhimurium and pathogenic E.coli

The bacterial ghost strain is constructed by conjugative transfer by taking salmonella typhimurium ATCC 13311 and escherichia coli ATCC700728 as recipient bacteria and escherichia coli X7213 carrying chloramphenicol resistant recombinant plasmid pBAD24-ORF 40 as donor bacteria. And (3) picking a transformant on a transformation plate, inoculating and culturing, using a bacterial liquid as a template, using ORF 40-F and ORF40-R as primers to carry out PCR verification, wherein the verification result is shown as B and C in figures 4, and the result shows that the pBAD24-ORF 40 recombinant plasmid has been successfully transferred into the salmonella typhimurium ATCC 13311 and the escherichia coli ATCC700728, so as to obtain recombinant strains of the salmonella typhimurium ATCC 13311-pBAD 24-ORF 40 and the escherichia coli ATCC700728-pBAD 24-ORF 40.

3. Drawing of bacterial ghost cell lysis curve

Selecting and inoculating the correct salmonella typhimurium ATCC 13311-pBAD 24-ORF 40 and escherichia coli ATCC700728-pBAD 24-ORF 40 in a 5mL LB + Cm culture medium in a single clone mode, culturing at 37 ℃ and 180rpm for 8h, transferring to a 10mL LB + Cm culture medium according to the proportion of 1:100, culturing at 37 ℃ and 180rpm until OD600 is about 0.6, respectively adding an arabinose inducer with the final concentration of 0.2%, performing induction expression at 37 ℃ and 180rpm, taking an uninduced strain as a control, measuring the OD600 value of a bacterial liquid of the strain, sampling every 30min to draw a cracking curve, centrifuging after cracking to obtain ghost cells, centrifuging at 6000rpm for 15min to collect the cracked bacterial bodies, adding PBS to wash for 3 times, freeze-drying, and storing at-80 ℃.

The cleavage results are shown in FIG. 5, and the specific data are as follows:

the bacterial ghost cells prepared by the invention have similar effects to other bacterial ghost cells, the bacterial ghost prepared by the embodiment can be used as an efficient DNA vaccine vector, and gene therapy application mainly focuses on DNA (deoxyribonucleic acid) transmission to target cells to cause strong and effective immune response in human medicine, which is of great importance in research of new strategies of vaccine and tumor therapy. The DNA with negative charge can be combined on the bacterial inner membrane with positive charge through the transmembrane pore on the bacterial ghost surface, and the bacterial ghost surface is provided with a perfect ligand which is combined with a receptor on the cell surface, so that the DNA vaccine can be guided into a receptor cell in a targeting manner.

When it is used in a DNA Vaccine vector, reference is made to Wen J, Yang Y, Zhao G, et al.Salmonella typhi Ty21a bacterial vector authors HIV-1gp140 DNA Vaccine-induced periphytol and microbial antigens response via TLR4 pathway [ J ] Vaccine,2012,30(39): 5733-:

mouse macrophage RAW264.7 was transfected with Ty21a salmonella ghosts loaded with hiv gp140 DNA vaccine and found that the ghosts were efficiently taken up. Compared with mice immunized with naked DNA vaccine, mice immunized with Salmonella ghost containing HIV gp140 DNA vaccine can induce strong systemic and local anti-gp 140 antibody response.

Loading of DNA into ghosts

DNA was transferred into Salmonella ghost cells by suspending Salmonella ghosts in a buffer containing HIV gp140 DNA (100mM NaCl,10mM sodium acetate,10mM HEPES, pH 7) (results showed transfection efficiencies of more than 50% when bacterial ghosts were loaded with a fluorescent protein expression plasmid).

Inoculating bacterial ghosts to macrophages

Inoculating the salmonella ghost containing the DNA into macrophages, wherein the macrophages grow best when the ratio of the salmonella ghost to the macrophages is 1: 10-1: 100, and collecting supernate for measuring the cell factors 12h, 24h, 36h and 48h after inoculation.

Mouse immunization experiment mice were subcutaneously inoculated with 100. mu.g of Salmonella ghost DNA vaccine, 20. mu.g of naked DNA or PBS, the same vaccine was inoculated every two weeks, mouse sera were collected at baseline time and 10 days after the final immunization, stored at-20 ℃ and the antibody amount was measured by ELISA method, respectively.

Sequence listing

<110> university of agriculture in Huazhong

<120> use of protein encoded by bacteriophage gene derived from salmonella as gram-negative bacteria lyase

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 576

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgaagtcgc gtcgaaagaa gaggtgttac gtgagtctga aatcagcagc gactaaagga 60

ggttgtagcg tgctcgctat catcgggctt gtattgtcga tgacaagtac gcatgtacgt 120

actaataaag aaggtcttga aataatcggt aatgcagaag gttgtatgcg caacccgtat 180

gtatgcccta ctggttattt aacagttggc attggtagcc gcatctacag cgatgagccc 240

gctgtacggc gcgaaggcct gacagaccag gagattgctg accgctgggt caagaatatt 300

caagaggccg aaaaatgtgt taatgactgg ttccacggta aagatatgaa cacgaaccag 360

ttcagcgcca tgacctctat ggtatttaac catggttgca ctagactccg taagaacaag 420

gatggttcac ctaccaaaat atatactgct gctcgtaaac aaaactggac tgaaatgtgt 480

aaccgcataa cggactggga tatgggtggt aagtataggg gcttgacaat acgtaagcaa 540

aaggaaaaag cgctatgtct aaaaccggtg caataa 576

<210> 2

<211> 191

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Lys Ser Arg Arg Lys Lys Arg Cys Tyr Val Ser Leu Lys Ser Ala

1 5 10 15

Ala Thr Lys Gly Gly Cys Ser Val Leu Ala Ile Ile Gly Leu Val Leu

20 25 30

Ser Met Thr Ser Thr His Val Arg Thr Asn Lys Glu Gly Leu Glu Ile

35 40 45

Ile Gly Asn Ala Glu Gly Cys Met Arg Asn Pro Tyr Val Cys Pro Thr

50 55 60

Gly Tyr Leu Thr Val Gly Ile Gly Ser Arg Ile Tyr Ser Asp Glu Pro

65 70 75 80

Ala Val Arg Arg Glu Gly Leu Thr Asp Gln Glu Ile Ala Asp Arg Trp

85 90 95

Val Lys Asn Ile Gln Glu Ala Glu Lys Cys Val Asn Asp Trp Phe His

100 105 110

Gly Lys Asp Met Asn Thr Asn Gln Phe Ser Ala Met Thr Ser Met Val

115 120 125

Phe Asn His Gly Cys Thr Arg Leu Arg Lys Asn Lys Asp Gly Ser Pro

130 135 140

Thr Lys Ile Tyr Thr Ala Ala Arg Lys Gln Asn Trp Thr Glu Met Cys

145 150 155 160

Asn Arg Ile Thr Asp Trp Asp Met Gly Gly Lys Tyr Arg Gly Leu Thr

165 170 175

Ile Arg Lys Gln Lys Glu Lys Ala Leu Cys Leu Lys Pro Val Gln

180 185 190

<210> 3

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ttgggctagc aggaggaatt caccatgaag tcgcgtcgaa gaaga 45

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

caaaacagcc aagcttgcac gttattattg caccggtttt gaca 44

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taacgtgcaa gcttggctgt tttg 24

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtgaattcc tcctgctagc ccaa 24

Claims

1. The application of the protein derived from salmonella bacteriophage gene code as lyase, the amino acid sequence of the protein is shown in SEQ ID NO. 2.

2. The use of claim 1, wherein the nucleotide sequence of the gene encoding the protein is shown as SEQ ID No. 1.

3. The use according to claim 1, wherein the protein is used for preparing gram-negative bacterial ghost cells.

4. The use according to claim 3, wherein the gram-negative bacteria is Escherichia coli or Salmonella.

5. Use according to claim 1, of the protein for lysing gram-negative bacteria.