CN112159814B

CN112159814B - CpG oligodeoxynucleotide, preparation and use thereof

Info

Publication number: CN112159814B
Application number: CN202011187615.1A
Authority: CN
Inventors: 景志忠; 房永祥; 赵波; 贾怀杰; 陈国华; 何小兵; 沈岩尔; 李政厅; 杨帆; 刘娟; 秦娟
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2020-10-29
Filing date: 2020-10-29
Publication date: 2023-05-16
Anticipated expiration: 2040-10-29
Also published as: CN112159814A

Abstract

The invention discloses a preparation method and application of a CpG-containing oligodeoxynucleotide composite adjuvant. The invention provides CpG oligodeoxynucleotide with the sequence of SEQ ID No.1, and all the nucleotides are thio-modified. The CpG oligodeoxynucleotide has the capability of enhancing B cell proliferation and Th I type immune response; the sulfo-modification prolongs the residence time of the hydrolytic enzyme in the body and reduces the hydrolytic action of various hydrolytic enzymes on the hydrolytic enzyme; the preparation method is simple, the quality is easy to control, and the large-scale production is easy to realize; has good safety and low toxic and side effects. The invention provides a preparation method of a CpG-containing oligodeoxynucleotide composite adjuvant, which is formed by mixing and emulsifying CpG oligodeoxynucleotide and an oil emulsion ISA206 according to a certain proportion, and has the advantages of simple process and stable performance. The CpG-containing oligodeoxynucleotide composite adjuvant provided by the invention can promote the early generation of antibodies and has a strong immune enhancement effect.

Description

CpG oligodeoxynucleotide, preparation and use thereof

Technical Field

The invention relates to a CpG oligodeoxynucleotide, a composite adjuvant containing the CpG oligodeoxynucleotide, a preparation method and application thereof.

Background

In the development of vaccines, it was recognized that the successful preparation of vaccines, the compatibility of the adjuvant with the vaccine components must be studied to form stable, safe, immunogenic vaccine complexes. Adjuvants are nonspecific immunopotentiators that, together with an antigen or after prior injection into the body, can enhance the body's immune response to an antigen or alter the type of immune response. Therefore, the adjuvant plays a vital role as a nonspecific immunopotentiator for inducing an effective immune response in the body after vaccination. Common adjuvants are: mineral adjuvants such as aluminum salt adjuvants, oil emulsion adjuvants such as ISA206, cytokine adjuvants, microbial component adjuvants such as CpG-ODN, LPS (research progress of CpG-ODN as animal vaccine adjuvants, black longjiang livestock veterinarian, 2018; recent research progress of novel vaccine adjuvants for TOLL-like receptors, chinese vaccine and immunity, 2018), immune complexes such as liposomes and Immune Stimulating Complexes (ISCOMs), traditional Chinese medicine adjuvants such as traditional Chinese medicine polysaccharides, etc. Among them, aluminum salts and oil emulsion adjuvants such as ISA206 are the most widely used vaccine adjuvants, but serious side effects such as local inflammation, granuloma or aseptic abscess are generated after inoculation of vaccines containing such adjuvants, and systemic reactions such as discomfort, fever and adjuvant arthritis appear in inoculated animals (classification of immune adjuvants and mechanism of action, journal of bioengineering in China, 2019; development and prospect of research of immune adjuvants, report of infectious diseases in China, 2014). The generation of these side effects seriously affects the health and food safety of animal organisms, and is not suitable for the development requirements of modern vaccine industry, so that the development of a safe and efficient novel vaccine adjuvant is urgently needed to improve and enhance the immune effect of the vaccine and reduce the occurrence degree of the side effects.

The compound adjuvant is an adjuvant with two or more different action mechanisms, is scientifically and organically combined together, enhances/promotes antigen specificity or comprehensive immune response through synergistic/superposition effects, plays the adjuvant effect to the maximum degree and reduces the occurrence degree of side reaction, so that the research and development of a novel compound adjuvant with multiple activation action mechanisms and functions becomes the most urgent key technology and scientific problem in the field of current efficient vaccine research. The complex adjuvants that have been developed or are under development at present are: a compound adjuvant with aluminum salt as carrier, such as aluminum salt+mpla, aluminum salt+cia 05 (TLR 4 ligand), aluminum salt+cpgodn; composite adjuvants such as PELC with emulsion as carrier are composed of bioabsorbable polymers PEG-b-plal, span85 and squalene; a liposome-based complex adjuvant such as an Immune Stimulating Complex (ISCOM) which is a lipid vesicle composed of saponin, cholesterol, and phospholipid and having a diameter of about 30-40 nm; non-carrier adjuvant compound adjuvants such as TLR7/8 ligand (3M-052) +TLR9 ligand (CpG), cpG ODN+polyI: C, etc. These complex adjuvants also have certain limitations, such as ISCOMs that form complexes only when combined with antigens or immunogens that contain more hydrophobic groups; the oil emulsion adjuvant has strong viscosity and is not easy to be injected. In addition, the immune adjuvant effect of different compound adjuvants is different, the adjuvant effect of the same compound adjuvant in different types of animals is different, the optimal dosage and the ratio of the same compound adjuvant and different antigens are also different (the research progress of the compound adjuvant, the animal husbandry science and technology of Guangdong, 2013), (the compound research progress of the immune adjuvant, journal of Chinese immunology, 2019). Therefore, the design, screening and induction of novel composite adjuvants of comprehensive or specific immune response types aiming at the immunological characteristics of animal organisms and combining the characteristics of antigens themselves become the most urgent scientific problem in the current vaccine development and vaccine research fields.

CpG refers to dinucleotides composed of cytosine (C) and guanine (G) linked via phosphodiester bonds (p), and CpG dinucleotides and two bases at the 5 'end and the 3' end thereof form a CpG motif (CpG motifs). CpG motifs are also known as immunostimulatory sequences (immunostimulatory sequence, ISS), whereas CpG ODNs refer to oligodeoxynucleotides containing unmethylated CpG motifs. CpG dinucleotides occur less frequently in the vertebrate genome, mostly methylated, whereas CpG dinucleotides occur more frequently and mostly unmethylated in the bacterial genome. The immune system of vertebrates recognizes this feature in the bacterial genome as a dangerous stimulus signal through pattern recognition receptors (pattern recognition receptors, PRRs), which in turn stimulates the body to produce an immune protective response. CpG ODN can promote maturation and activation of dendritic cells, macrophages and B cells, up-regulate expression of CD80, CD86, CD40 and MHC-II molecules, promote secretion of IL-6, IL-12, IFN-gamma and other Thl type cytokines, induce the body to generate Thl type immune response (phosphodiester CpG oligonucleotides as adjuvants: polyguanosine runs enhance cellular uptake and improve immunostimulative activity ofphosphodiester CpG oligonucleotides in vitro and in immunology,2002,106 (1): 102-112).

The basic motif of CpG ODN structure is 5'-X1X2CGYY-3', X1 represents purine, X2 represents purine or thymine, Y represents pyrimidine. It has been found that the immunostimulatory activity of a single 6 deoxynucleotide CpG motif is very weak and that the length of CpG must be increased, typically 15-30 bases, to achieve optimal immunostimulatory effect. Numerous studies have demonstrated that CpG ODNs have species specificity, and that the same CpG ODN sequence has different effects in different species, as well as different CpG ODN sequences that are effective in different species. (CpG motifs in bacterial DNA and their immune effects. Annual Review of Immunology,2002, 20:709-760). The immunostimulatory activity of a CpG ODN is related to the structural characteristics of the sequence, and mainly comprises the number and the position of CpG motifs in the sequence, whether the framework is subjected to thio modification, whether the sequence has a palindromic structure, whether the 5 '-end is free, whether the 3' -end contains poly G and the like. One or more CpG motifs can be arranged in one CpG ODN sequence, purine and pyrimidine at two sides of the CpG motif can be arranged, and bases among the CpG motifs are different, so that different CpG ODNs show different properties and different immunity enhancing and regulating effects. The related research results show that different species respectively have specific CpG ODN sequences, and the CpG ODNs of different sequences have different immunostimulatory effects and exhibit different immunostimulatory effects. Furthermore, cpG ODNs are classified into four types A, B, C, P according to their structural and biological properties. Specific structural features, functions, etc. of each type are shown in Table 1.

Table 1: classification and structural features of CpG ODN

After the CpG ODN is ingested into immune cells through endocytosis, the CpG ODN is recognized by and combined with TLR9 on endosomes/lysosomes in the cells, so that the TLR9 is dimerized, then a dimeric complex recruits a marrow-like differentiation factor 88 (Myeloid differentiation factor, myD 88) and an IL-1 receptor-related kinase (IL-1 receptor-associtedkinase 4, IRAK4) at the downstream of the dimeric complex, the IRAK4 is phosphorylated and interacts with a tumor necrosis factor receptor-related factor 6 (TNF-receptor-associated factor 6, TRAF 6), thereby activating the IκB kinase, releasing NF- κB into the nucleus, activating a series of nuclear transcription factors, finally promoting the related immune cells to secrete a series of cytokines and chemokines, triggering an intracellular sterilization mechanism or inducing an inflammatory reaction, and eliminating or destroying pathogenic microorganisms (signal transductionpathways mediated by the interaction ofCpG DNAwith Toll-like receptor 9.Seminars in immunology,16 (1): 17-22) invading the organism.

CpG ODN as a novel, safe and efficient immunoadjuvant has a wide application prospect. The ability of CpG ODN to produce antibodies is 15 times that of the individual vaccine immunization groups when the CpG ODN is used as an adjuvant of hepatitis B vaccine to immunize gorilla or monkeys, which shows that the CpG ODN can be used as a good hepatitis B vaccine adjuvant. On day 2017.11.9, the company Dynavax Technologies announced that the drug HEPLISAVB was approved by the United states FDA, the drug (CpG ODN 1018 used in combination with a commercially available hepatitis B vaccine) was used as the first vaccine containing CpG adjuvant in the world (DynavaxAnnounces FDA approval ofHEPLISAV-B (TM) forprevention ofHepatits B inAdults.Coley company used CpG ODN 7909 as an adjuvant for hepatitis B vaccine), clinical test results showed that the vaccine had much higher antibody titer than the hepatitis B vaccine single-use group at all time points after the initial immunization, the company Coley used CpG ODN 7909 as an adjuvant for commercial multivalent influenza inactivated vaccine (Fluarix), and the random double blind phase I clinical test results showed that CpG ODN was a safe and reliable adjuvant, which could reduce the amount of (Fluarix) when the CpG ODN was used in combination with a porcine pseudorabies vaccine for vaccinating piglets, the CpG ODN was used in combination with streptococcal sepsis vaccine to significantly enhance the immune response of pigs, and the combined use of CpG ODN with streptococcal sepsis vaccine was a novel vaccine which was a safe and highly potent activated immune response.

Disclosure of Invention

It is a first object of the present invention to provide a CpG oligodeoxynucleotide that is different from the existing CpG ODN.

The second object of the present invention is to provide a compound adjuvant containing the CpG ODN of the present invention and a method for preparing the same, which can overcome the deficiencies of the prior art.

It is a third object of the present invention to provide the use of a specific composite adjuvant comprising the CpG ODN of the present invention.

The sequence of the CpG oligodeoxynucleotide is SEQ ID No.1, and all nucleotides are subjected to thio modification. The invention is a specific CpG oligodeoxynucleotide, named CpG ODN46. The CpG ODN46 of the present invention belongs to type A, contains 3 CpG units, and has a chain length of 29nt. The thio-modified poly G can enable the CpG ODN to form a stable G-tetramer structure, prolongs the retention time of the A-type CpG ODN in the pDC endosome vesicle, and is not degraded by in vivo DNase, thereby improving the stability of the CpG ODN.

The CpG oligodeoxynucleotide can be applied to preparation of a composite adjuvant or vaccine.

The invention provides an adjuvant, which comprises the CpG oligodeoxynucleotide.

The invention provides a vaccine which contains the CpG oligodeoxynucleotide and a disease antigen.

Preferably, the vaccine of the invention is compounded by CpG oligodeoxynucleotide total thio modified sequence of SEQ ID No.1, foot-and-mouth disease virus inactivated antigen and ISA206 oil emulsion.

The CpG ODN46 of the present invention is a dinucleotide composed of cytosine and guanine linked via a phosphodiester linkage. CpG has been proved by a large number of clinical experiments to be a novel, safe and efficient adjuvant. CpG46 is a novel immunostimulatory molecule that applicants have designed, optimized, screened for their own initiative and that has strong immunostimulatory capacity. Related experiments show that the humoral and cellular immune responses can be obviously enhanced. Aiming at the defects of the adjuvant in the prior art, the invention takes the oil emulsion ISA206 as a carrier system, which is the most commonly used oil adjuvant in animal vaccines, and stimulates the organism to generate humoral and cellular immune response through the slow release effect of antigen. The ligand CpG of TLR9 is used as an immune stimulating molecule, which can induce the organism to generate a cell immune response mainly comprising Th1 type immune response. The invention organically combines a carrier system and a stimulus molecule, and develops a novel, safe and efficient composite adjuvant. The research result provides powerful technical support for the development of novel vaccines, and also provides guarantee for the healthy development of the livestock industry, and has huge market prospects at home and abroad.

The invention has the following advantages:

1. the CpG ODN46 has strong immune stimulation effect;

2. the full thio-modified CpG ODN46 prolongs the residence time of the full thio-modified CpG ODN in a human body and reduces the hydrolysis of various hydrolytic enzymes; the preparation method is simple, the quality is easy to control, and the large-scale production is easy to realize;

3. the CpG ODN46 has good safety and low toxic and side effects;

4. the CpG ODN 46-containing composite adjuvant has strong immunity enhancing effect.

Drawings

FIG. 1 is a graph showing one of results of screening CpG ODN46 sequences by using spleen cells obtained by lysing erythrocytes in mice and detecting proliferation of T cells by CFSE labeling.

FIG. 2 is a graph showing one of the results of screening CpG ODN46 sequences by using spleen cells obtained by lysing erythrocytes in mice and detecting proliferation of B cells by CFSE labeling.

FIG. 3 is a graph showing the results of CpG ODN46 stimulating secretion of cytokines from spleen cells of lysed erythrocytes of mice. Wherein FIG. 3A shows IFN-gamma, FIG. 3B shows IL-6, and FIG. 3C shows TNF-alpha.

FIG. 4 is a graph showing the results of serum antibody titer measurements at different time points after single immunization of mice with a vaccine containing CpG ODN46 compound adjuvant-compatible foot-and-mouth disease virus inactivated antigen.

Detailed Description

The present invention is explained in detail below with reference to examples. The experimental methods used in the following examples are all conventional methods unless otherwise specified; materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

1. Design and screening of CpG ODN molecules

Screening of (one) CpG ODN molecules

Through screening and verification of the structure activity and the function of 4 CpG ODN sequences (see Table 2), a CpG ODN sequence CpG ODN46-mod with a strong immune enhancement effect is screened, the nucleotide sequence of the CpG ODN is SEQ ID No.1, and all nucleotides are subjected to thio modification, which is called CpG ODN46 for short.

The CpG ODN nucleotide backbone in Table 2 is that all nucleotides are not thio-modified (named suffix-non) and all nucleotides are thio-modified (named suffix-mod). The non-CpG controls contained no CpG units and had a chain length of 15nt; cpG ODN46, containing 3 CpG units, chain length 29nt.

Table 2: cpG and non-CpG sequences used in this study

Group of	Sequence (5 '-3')
		non-CpG control-non	GCTAGAGCTTAGGCT
non-CpG control-mod	GCTAGAGCTTAGGCT
		CpGODN46-non	TCGTCCATGACGTTCCTGACGTTGGGGGG
CpGODN46-mod	TCGTCCATGACGTTCCTGACGTTGGGGGG (sequence 1)

The nucleotide sequences of the invention are aligned with published CpG sequences as shown in Table 3

Table 3; cpG ODN46 and published or published CpG sequence and its characteristic

/>

(II) specific immune Effect detection

1. Isolation of mouse spleen cells

(1) Neck-breaking method or CO ₂ C57 BL/6 mice were sacrificed by anaesthesia, spleens of the mice were aseptically isolated, placed on a 100 μm screen, and RPMI1640 medium (Gibco, cat. No. C11875500 BT) was added by grinding, and muscle or other tissue fractions were filtered off.

(2) Centrifuge at 2000rpm/min at room temperature for 5 min. The residual liquid was discarded, and 2mL of erythrocyte lysate (Tiangen Biochemical technology (Beijing) Co., ltd., product No. RT 122-02) was added to resuspend the cells at room temperature for 5 minutes.

(3) Immediately add 2-3 volumes of RPMI1640 medium and mix upside down. Centrifuge at 2000rpm/min at room temperature for 5 min. The residual liquid was discarded and 1mL of DPBS was added.

(4) Appropriate amount of cells were added to a final concentration of 5uM CFSE (5 (6) -Carboxyfluorescein diacetate N-succinimidyl ester, CFSE) (carboxyfluorescein diacetate succinimidyl ester) (Sigma-Aldrich, cat. No. 21888).

(5) Light was protected from the light and shaken at 37℃for 10 minutes. Immediately add 1 volume of RPMI1640/10% FBS (fetal bovine serum, FBS) (fetal bovine serum) (Gibco, cat No. 16000044) and place on ice for 5 minutes. Centrifuge at 2000rpm/min at room temperature for 5 min. An appropriate amount of RPMI1640/10% fetal bovine serum was added and washed 3 times. 1mL RPM 1640/10% fetal bovine serum was added and counted.

(6) Will be 1X 10 ⁶ The cells were inoculated into 48-well cell culture plates, and a final concentration of 1. Mu.g/mL of non-CpG control-non, non-CpG control-mod, cpG ODN 46-non, cpG ODN46-mod, 100ng/mL of positive control LPS (lipopolysaccharide) (Sigma-Aldrich, cat. L4391), blank control (control), 5% CO2, and incubated at 37℃for 3 days were added, respectively.

Analysis of the ability of CpG ODN to stimulate spleen T cell proliferation

(1) The cells after 1 treatment were collected and centrifuged at 2000rpm/min for 5 minutes at room temperature. Cell culture supernatants were collected, assayed for secreted cytokines and stored at-80℃for later use. Cell pellet was washed 1 time with DPBS, cell counted, 100. Mu.L 1X 10 per tube ⁶ Individual cells. An appropriate amount of Fc receptor blocker (CD 16/32) (BD Pharmingen, cat. No. 553142) was added to each tube and incubated for 5 minutes at room temperature in the absence of light.

(2) An appropriate amount of antibody CD3 (BD Pharmingen, cat. No. 553063) and corresponding isotype control antibody (BD Pharmingen, cat. No. 553925) were added, negative cell controls were set, and incubated at 4℃for 30min in the absence of light. Wash 1 time with DPBS (EDTA 2mmol+1% serum) and add 400. Mu.L DPBS.

(3) Flow cytometer (BD Acclri C6 Plus) analysis

The mean of the experimental group data was plotted divided by the fold of the mean of the blank group (fold difference = experimental group mean/blank group mean), and all experiments were repeated at least 3 times.

The results, as shown in figure 1, demonstrate that CpG ODN46-mod has a greater ability to stimulate T proliferation compared to other groups including positive control LPS, demonstrating the potential of synthetic, thio-modified CpG ODN46 as an immunopotentiator or immunoadjuvant.

Analysis of the ability of CpG ODN to stimulate spleen B cell proliferation

(1) The cells after 1 treatment were collected and centrifuged at 2000rpm/min for 5 minutes at room temperature. Collecting cell culture supernatant, measuring secreted cytokines,preserving at-80 ℃ for standby. Cell pellet was washed 1 time with DPBS, cell counted, 100. Mu.L 1X 10 per tube ⁶ Individual cells. An appropriate amount of Fc receptor blocker (CD 16/32) (BD Pharmingen, cat. No. 553142) was added to each tube and incubated for 5 minutes at room temperature in the absence of light.

(2) An appropriate amount of antibody CD19 (BD Pharmingen, cat. No. 550992) and corresponding isotype control antibody (BD Pharmingen, cat. No. 553932) were added, negative cell controls were set, and incubated at 4℃for 30 minutes in the absence of light. Wash 1 time with DPBS (EDTA 2mmol+1% FBS) and add 400. Mu.L DPBS.

(3) Flow cytometer (BD Acclri C6 Plus) analysis

The results, as shown in figure 2, show that CpG ODN46-mod has a strong ability to stimulate B proliferation compared to other groups including positive control LPS, demonstrating the potential of synthetic, thio-modified CpG ODN46 as an immunopotentiator or immunoadjuvant.

Analysis of the ability of CpG ODN to stimulate spleen cells to secrete cytokines

Cytokine detection was performed using the Biolegend kit LEGENDplex ^TM Mouse Th Cytokine Panel (13-plex) (Biolegend, cat 740005)

(1) Sample preparation: the cell culture supernatant obtained in (1) above in 2 or 3 was diluted twice as a sample with assay buffer (50. Mu.l sample+50. Mu.l assay buffer).

(2) Preparing a system:

1) Add 25ul Assay Buffer to each sample tube.

2) Add 25ul of each sample to the corresponding sample tube.

3) Add 25ul of each standard to the corresponding standard tube.

4) 25ul of mixing beads were added to each tube (vortex well, 1 time after every 2-3 minutes).

5) When the Beads were added, the Beads were prevented from settling, and the final volume per tube was 75ul.

(3) The EP tube was shaken at 310rpm/min and incubated at room temperature for 2 hours in the absence of light.

(4) 25ul SA-PE was added directly to each tube.

(5) The EP tube was shaken at 310rpm/min and incubated at room temperature for 30 minutes in the absence of light.

(6) Centrifuge at 1000g for 5 min.

(7) The supernatant was carefully pipetted off with a gun head at 125. Mu.l. Note that the Beads were not aspirated and the liquid was removed as much as possible.

(8) 200ul 1x WB was added per tube. The Beads were vortexed, centrifuged at 1000g for 5 min and the supernatant discarded.

(9) 200-300ul of WB was added per tube. Scroll Beads.

(10) Flow cytometer (BD Acclri C6 Plus) on-machine detection analysis

With Student's t test, there was a significant difference at P < 0.05.

As shown in FIG. 3, it can be seen that stimulation of CpG ODN46-mod significantly increases the expression of IL-6, IL-10, IFN- γ, and TNF- α; IL-2, IL-4, IL-5, IL-9, IL-13, IL-17A, IL-17F, IL-21, and IL-22 are not expressed. It was shown that synthetic, sulfur-modified CpG ODN46 significantly increased the expression of B cell proliferation-related cytokines (IL-6 and IL-10). In addition, cpG ODN46-mod significantly increased IFN- γ expression, indicating its ability to induce Th 1-type immune responses and to combat intracellular microbial infection.

The result shows that CpG ODN46-mod has strong capability of inducing Th1 type immune response and B cell differentiation proliferation.

2. Application of composite adjuvant prepared from CpG ODN46 of the invention to preparation of vaccine of foot-and-mouth disease virus inactivated antigen in mice

1. Animals

SPF-grade BALB/c (animal laboratory, animal institute, lanzhou, china academy of agricultural sciences), 10 animals per group, are shown in Table 4.

Table 4: experimental grouping set-up

Group of	Adjuvant, antigen component	Number of animals (Only)
			1(CpGODN46-mod)	CpGODN46-mod, FMDVAg, ISA206 adjuvant	10
2(ISA206)	FMDVAg, ISA206 adjuvant	10
			3(PBS)	PBS	10

2. Preparing a vaccine:

CpG containing ODN complex adjuvants required for group 1: cpG ODN46-mod (50-100 ug/mL) and the concentration of the oil emulsion ISA206 (volume percent refers to the total volume of the pre-prepared vaccine) are mixed according to a certain proportion, placed on ice, emulsified for 3 minutes at 5000rpm/min, and emulsified for 1 minute at intervals, repeatedly emulsified for 2 times, emulsified for 3 times and placed at 4 ℃ for standby.

Vaccine required for group 1: dissolving CpG-containing ODN compound adjuvant and FMDV Ag (Inactivated Antigen of Foot and Mouth Disease Virus, FMDV Ag) (foot-and-mouth disease virus inactivated antigen) (provided by well-known biological technology Co., ltd.) in PBS at a certain ratio; or dissolving CpG ODN46-mod, oil emulsion ISA206 and foot-and-mouth disease virus inactivated antigen in PBS to obtain vaccine; and the concentration of CpG ODN46-mod is 50-100ug/mL, the concentration of FMDV Ag is 10-50 ug/mL, and the concentration of oil emulsion ISA206 is 50% (volume percent).

Vaccine required for group 2: dissolving the oil emulsion ISA206 and the foot-and-mouth disease virus inactivated antigen in PBS according to a certain proportion to obtain a vaccine; and the concentration of FMDV Ag is 10-50 mug/mL and the concentration of the oil emulsion ISA206 is 50% (volume percent).

Vaccine required for group 3: PBS.

3. Emulsification of vaccine: the prepared vaccine is put on ice for emulsification for 3 minutes at 5000rpm/min, the interval is 1 minute, the emulsification is repeated for 2 times, the total emulsification is carried out for 3 times, and the mixed solution is put at 4 ℃ for standby.

4. Animal immunization: the emulsified vaccine was injected intramuscularly into the thigh muscle of both hind legs, 100 μl of each leg, and 200 μl of vaccine was immunized per mouse.

5. Serum collection: at various time points of immunization, 200 μl of blood was collected from the tail vein on

day

0,7,14,28,60,90, respectively. The mixture was centrifuged at 4000rpm/min at 4℃overnight for 15 minutes, and the supernatant was collected and stored at-80℃for further use.

6. Antibody determination: liquid-phase blocking ELISA (Liquid-phase blocking sandwich ELISA, LB-ELISA) (product number A10171 of well-known biological sciences Co., ltd.) is specifically as follows:

1) Preparation of the reagent: the materials provided by the kit are used for preparing washing liquid, coating buffer solution and substrate solution of the experiment.

2) Coating ELISA plates: rabbit anti-serum IgG was diluted 1:1000 to working concentration with coating buffer, 50 μl of solution was added to each well of ELISA plate, and after shaking for 2-3 min the plate was sealed at room temperature overnight.

3) Antigen-antibody reaction (control serum and serum to be tested): the serum to be tested was serially diluted in a volume of 50. Mu.l/well on U-type hemagglutination plates, and the negative and positive control serum was diluted in the appropriate ratio, diluted to the use concentration of viral antigen (1:8) with PBST, and then 50. Mu.l/well was added to the viral antigen control well, plus 100. Mu.l. Mix well with shaking, seal plate, overnight at 4 ℃.

4) ELISA plates were washed 5 times with wash buffer PBST, dried on absorbent paper, and antigen-antibody reaction plates were removed from 4℃and allowed to stand at room temperature for 5 minutes, and each well of virus and serum mixture was transferred to ELISA plates in sequence, 50. Mu.l was added to each well, and plates were sealed and incubated at 37℃for 1 hour.

5) The ELISA plates were also washed 5 times with wash buffer PBST, and guinea pig antisera were diluted 1:1000 with guinea pig antisera dilution to working concentration, 50 μl per well was added, and the plates were closed and incubated for l hours at 37 ℃.

6) After washing the plates, the rabbit anti-guinea pig enzyme conjugate was diluted 1:500 to working concentration with PBST, 50 μl was added per well and incubated for 1 hour at 37 ℃.

7) After washing the plates, 50. Mu.l of substrate solution was added to each well and incubated at 37℃for 15 minutes.

8) The reaction was stopped by adding 50. Mu.l of stop solution to each well, and the light absorption was immediately read at 492 nm.

9) And judging that the wells with the OD value of the detected serum being greater than the critical value are negative wells, the wells with the OD value being less than or equal to the critical value are positive wells, and the dilution corresponding to the OD value of the positive wells being equal to the critical value is the antibody titer of the serum. If the threshold is between two titers, the antibody titer takes a median.

With Student's t test, there was a significant difference at P < 0.05.

As shown in fig. 4, the antibody titer of the CpG ODN46-mod composite adjuvant group was far higher than that of the control oil emulsion ISA206, and the duration of the CpG ODN46-mod composite adjuvant group antibody remained at a higher titer after 90 days, indicating that the CpG ODN46 composite adjuvant can nonspecifically enhance the antibody titer of the antigen and extend the duration of the antibody.

Sequence listing

<110> the animal doctor institute of Lanzhou, china academy of agricultural sciences

<120> a CpG oligodeoxynucleotide, preparation and use thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial sequence (CpG ODN 46)

<400> 1

tcgtccatga cgttcctgac gttgggggg 29

Claims

1. A CpG ODN having the nucleotide sequence of SEQ ID No.1, wherein all nucleotides in the CpG ODN are thio modified.

2. The use of the CpG ODN of claim 1 for the preparation of a vaccine.

3. A foot-and-mouth disease vaccine comprising a foot-and-mouth disease virus immunogen, the CpG ODN of claim 1, and an ISA206 adjuvant; the concentration of the CpG ODN is 10 mug/100 mul; the concentration of the foot-and-mouth disease virus immunogen is 5 mug/100 mul; the concentration of the 206 adjuvant was 50%.