CN110004150B - CpG oligonucleotide sequence with immune enhancement activity and application thereof - Google Patents

Abstract

The invention discloses a CpG oligonucleotide sequence with immune enhancing activity and application thereof. The invention provides oligodeoxynucleotide, the nucleotide sequence of which is sequence 1, and all nucleotides in the oligodeoxynucleotide are modified by sulfo, the oligodeoxynucleotide shown in the sequence 1 provided by the invention has strong immune enhancement function; the retention time of the compound in the body is prolonged, and the hydrolysis of various hydrolytic enzymes is reduced; the preparation method is simple, the quality is easy to control, and the large-scale production is easy to realize; high safety and low toxic by-effect.

Description

CpG oligonucleotide sequence with immune enhancement activity and application thereof

Technical Field

The invention belongs to the technical field of vaccine immunologic adjuvants, and particularly relates to a CpG oligonucleotide sequence with immune enhancing activity and application thereof.

Background

In the process of vaccine development, people recognize that the successful preparation of the vaccine must consider the use of the adjuvant, and must study the compatibility of the adjuvant and the vaccine components to ensure that the adjuvant and the vaccine components form a stable, safe and immunogenic vaccine compound. Therefore, the research of the vaccine adjuvant is always an important link in the vaccine research process, and the vaccine adjuvant plays an important role as a non-specific immunopotentiator for inducing effective immune response after vaccination. Many substances have been tried as vaccine adjuvants, but only aluminum salt adjuvants, MA59 (oil-in-water emulsions), MPL (glycolipids), virus-like particles (VLPs), immunopotentiating Reconstituted Influenza Virosomes (IRIV), and cholera enterotoxin (CT) are approved for use in human vaccines. The 206 oil adjuvant (Montanide ISA 206) is the most widely used adjuvant in animal vaccines. Although the adjuvant is approved for vaccine preparation, side reactions such as injection site swelling, granuloma, fever, pain, allergy and the like are often occurred in practical application. In addition, some adjuvants are costly. Therefore, the development of an ideal vaccine adjuvant which is broad in spectrum, safe, efficient and convenient to produce and use is urgent.

Numerous studies have demonstrated that synthetic CpG ODN and CpG DNA from some bacteria have good immune enhancing effects. CpG refers to a dinucleotide composed of cytosine (C) and guanine (G) linked via a phosphodiester bond (p), and CpG dinucleotides and two bases at the 5 'end and the 3' end of the dinucleotide constitute a CpG motif (CpG motif). CpG motifs are also referred to as immunostimulatory sequences (ISS), whereas CpG ODNs refer to oligodeoxynucleotides containing unmethylated CpG motifs. CpG dinucleotides occur less frequently in vertebrate genomes and are mostly methylated, whereas CpG dinucleotides occur more frequently in bacterial genomes and are mostly unmethylated. The immune system of vertebrates recognizes this feature in the bacterial genome as a danger-stimulating signal via Pattern Recognition Receptors (PRRs), thereby stimulating the body to produce an immune protective response. CpG ODN can promote maturation and activation of dendritic cells, macrophages and B cells, up-regulate the expression of CD80, CD86, CD40 and MHC-II molecules, promote secretion of Thl-type cytokines such as IL-6, IL-12, IFN-gamma, etc., and induce Thl-type immune response (polydiester CpG oligonucleotides as an adjuvant: polysaccharides across cellular uptake and immune activity of phospholipid CpG oligonucleotides in vitro and in vivo. Immunity, 2002,106 (1): 102-112).

The basic motif of the CpG ODN structure is 5' -X ₁ X ₂ CGYY-3’，X ₁ Represents purine, X ₂ Represents purine or thymine, and Y represents pyrimidine. It was found that the CpG motif containing 6 deoxynucleotides alone has extremely weak immunostimulatory activity, and the CpG length must be increased to exhibit the optimal immunostimulatory effect, and is generally 15 to 30 bases. Meanwhile, a great deal of research also finds that the immunostimulatory activity of the CpG ODN is related to the characteristics of the sequence structure, and mainly comprises the number and the position of CpG motifs in the sequence, whether the skeleton is subjected to thio modification, whether the sequence has a palindrome, whether the 5 'end is free, whether the 3' end contains poly G and the like. One or more CpG motifs, purine and pyrimidine on both sides of the CpG motif, and the difference of bases between CpG motifs can exist in one CpG ODN sequence, so that different CpG ODNs have different properties and different immune enhancement and immune regulation effects. In addition, cpG ODN are species-specific, and the same CpG ODN sequence has different effects in different species, and the effective CpG ODN sequence in different species is also different. (CpG motifs in bacterial DNA and the ir immune effects. Annual Review of Immunology,2002, 20, 709-760).

After CpG ODN is taken into immune cells by endocytosis, it is recognized by TLR9 on endosome/lysosome in cells and combined with it, resulting in TLR9 dimerization, then the dimerized complex recruits Myeloid differentiation factor 88 (Myeloid differentiation factor 88, myD88) and IL-1receptor-associated kinase (IL-1 receptor-associated kinase 4, IRAK4) downstream thereof, so that IRAK4 is phosphorylated and interacts with tumor necrosis factor receptor-associated factor 6 (TNF-receptor-associated factor 6, TRAF6), thereby activating I kappa B kinase, releasing NF-kappa B into the nucleus, activating a series of nuclear transcription factors, finally causing relevant immune cells to secrete a series of cytokines and chemokines, triggering the intracellular bactericidal mechanism or inducing inflammatory response, clearing or eliminating CpG diseases (signal transduction microorganism mediated targeting DNA) invading the body (17. Tissue of receptor-related diseases, 17. 16).

The CpG ODN is used as a novel, safe and efficient immunologic adjuvant and shows good application prospect. The CpG ODN is used as adjuvant of hepatitis B vaccine to immunize gorilla or monkey, and the antibody generating capacity is 15 times of that of single vaccine immunization group, which shows that the CpG ODN can be used as good adjuvant of hepatitis B vaccine. 2017.11.9, dynavax Technologies declared American FDA approval for the drug HELISAV-B, a approved drug (CpG ODN 1018 in combination with commercial hepatitis B vaccine) as the first vaccine with CpG adjuvants in the world (Dynavax antibiotics FDA approval of HELISAV-B (TM) for expression of hepatitis B in Adults. Http:// inventors. Dynavax. Com/expressions-expressions). The Coley company uses CpG ODN 7909 as an adjuvant of the hepatitis B vaccine, and clinical test results show that the antibody titer of the vaccine is far higher than that of a hepatitis B vaccine single group at all time points after primary immunization. The Coley company uses CpG ODN 7909 as an adjuvant of a commercial multivalent influenza inactivated vaccine (Fluarix), and random double-blind phase I clinical test results show that the CpG ODN is a safe and reliable adjuvant and can reduce the dosage of the Fluarix. When the CpG ODN and the porcine pseudorabies vaccine are jointly inoculated to the piglets, the humoral and cellular immune response of the piglets can be obviously enhanced. When the CpG ODN is combined with the Streptococcus suis septicemia inactivated vaccine, the immune response of a pig body can be obviously enhanced. In a word, a large number of studies at home and abroad prove that the CpG ODN is a novel and efficient immune activator and presents good immune adjuvant effect. However, the development of the immunostimulatory effect of CpG ODN is closely related to its sequence structure, and the immunostimulatory effect of CpG ODN of different sequences is different, and CpG ODN exhibits different stimulatory effects and different immunostimulatory effects on different species and cell subsets. Therefore, it is necessary to further study the rules of action of CpG ODN with different sequences on different species, cells and antigen components and design and improve an efficient and specific CpG ODN sequence, which lays a foundation for the application of CpG ODN as a vaccine adjuvant in vaccine preparation and also provides technical support for the prevention and control of major epidemic diseases.

Disclosure of Invention

It is an object of the present invention to provide an oligodeoxynucleotide.

The oligodeoxynucleotide provided by the invention has a nucleotide sequence of sequence 1, all nucleotides in the oligodeoxynucleotide are modified by sulfo, the oligodeoxynucleotide contains 2 CpG units, and the chain length of the oligodeoxynucleotide is 21nt.

The application of the oligodeoxynucleotide as an immunopotentiator or immunoadjuvant is also within the protection scope of the invention.

The application of the oligodeoxynucleotide as described above to improve the immunogenicity of an antigen or a vaccine is also within the scope of the present invention.

The application of the oligodeoxynucleotide in preparing the vaccine is also the protection scope of the invention.

It is another object of the present invention to provide a vaccine.

The invention provides a vaccine which comprises an immunogen and the oligodeoxynucleotide.

In the above, the vaccine is an animal vaccine.

In the above, the vaccine is an animal vaccine, and the animal vaccine is a foot-and-mouth disease vaccine.

The invention has the following advantages:

1. the artificially synthesized CpG ODN (sequence 1) has strong immune enhancement effect;

2. the artificial CpG ODN (sequence 1) prolongs the retention time in vivo and reduces the hydrolysis effect of various hydrolytic enzymes;

3. the artificially synthesized CpG ODN (sequence 1) has simple preparation method, easy quality control and easy large-scale production;

4. the artificially synthesized CpG ODN (sequence 1) has good safety and low toxic and side effects;

based on the reasons, the inventor selects a CpG ODN sequence with strong immunity enhancing capability by comparing, optimizing, designing and screening the CpG ODN sequence, and verifies the immunity enhancing potential by in vitro and in vivo experiments.

Drawings

FIG. 1 is a graph showing one of the results of screening CpG ODN sequences using mouse spleen cells lysed for erythrocytes and a method of detecting T cell proliferation using CFSE labeling.

FIG. 2 is a graph showing one of the results of screening CpG ODN sequences using a method of lysing splenocytes from mice and detecting B cell proliferation using CFSE labeling.

FIG. 3 is a graph showing the results of CpG ODN stimulating cytokine secretion from spleen cells of mice lysed erythrocytes.

FIG. 4 is a graph showing the results of the measurement of the antibody titer of the mouse serum at different time points after single immunization after the CpG ODN is mixed with the foot and mouth disease antigen and the 206 adjuvant.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The present invention will be described in detail with reference to the following specific examples, but the present invention is not limited to these examples, and any modifications or substitutions in the basic spirit of the examples are included in the scope of the present invention as claimed in the claims.

Example 1 screening of oligodeoxynucleotide molecules containing CpG sequence units

Through the screening and verification of the structure effect and the function of 4 CpG ODN sequences (table 1), a CpG ODN sequence CpG-45-mod with strong immunity enhancement function is screened, the nucleotide sequence is sequence 1, and all nucleotides are all modified by sulfo.

The CpG ODN nucleotide backbone in Table 1 is a backbone of all nucleotides that have not been thio-modified (name suffix-non) and all nucleotides that have been thio-modified (name suffix-mod). CpG-21 contains no CpG unit and has a chain length of 15nt; cpG-45, containing 2 CpG units, 21nt long.

TABLE 1

Group of	Sequence (5 '-3')
		CpG-21-non	GCTAGAGCTTAGGCT
CpG-21-mod	GCTAGAGCTTAGGCT
		CpG-45-non	TCCATGACGTTCCTGACGTTG
CpG-45-mod	TCCATGACGTTCCTGACGTTG (SEQ ID NO: 1)

The specific immune effect is detected as follows:

1. isolation of mouse spleen cells

(1) By breaking the neck or CO ₂ C57BL/6 mice were sacrificed by anesthesia, spleens of the mice were aseptically isolated, placed on a 100 μm sieve, and RPMI1640 medium (Gibco, cat # C11875500 BT) was added with grinding, and muscle or other tissue fractions were filtered off.

(2) At 2000rpm/min, centrifuge at room temperature for 5 minutes. The residual liquid was discarded, and 2mL of erythrocyte lysate (Tiangen Biochemical technology (Beijing) Co., ltd., cat. No. RT 122-02) was added to resuspend the cells at room temperature for 5 minutes.

(3) Immediately add 2-3 times volume of RPMI1640 medium, reverse and mix well. At 2000rpm/min, centrifuge at room temperature for 5 minutes. The residual liquid was discarded and 1mL of DPBS was added.

(4) Appropriate amounts of cells were added to a final concentration of 5uM CFSE (5 (6) -Carboxyfluorescein diacetate N-succinimidyl ester (Sigma-Aldrich, cat # 21888).

(5) Protected from light and shaken at 37 ℃ for 10 minutes. 1 volume of RPMI1640/10% FBS (fetal bovine serum) (Gibco, cat No. 16000044) was immediately added and placed on ice for 5 minutes. At 2000rpm/min, centrifuge at room temperature for 5 minutes. Appropriate amount of RPMI1640/10% fetal bovine serum was added and washed 3 times. Add 1mL RPMI1640/10% fetal calf serum and count.

(6) Will be 1 × 10 ⁶ Each/mL of the cells was inoculated in a 48-well cell culture plate, and a final concentration of 1. Mu.g/mL of CpG-21-non, cpG-21-mod, cpG-45-non, cpG-45-mod, 100ng/mL of LPS (lipopolysaccharide, LPS) (lipopolysaccharide) (Sigma-Aldrich, cat # L4391), and a blank control (control) were added thereto, respectively, and the cells were incubated at 37 ℃ for 3 days in 5% of CO2.

Assay of ability of CpG ODN to stimulate spleen T cell proliferation

(1) 1 treated cells were collected, centrifuged at 2000rpm/min for 5 minutes at room temperature. Cell culture supernatants were collected, assayed for secreted cytokines, and stored at-80 ℃ for future use. The cell pellet was washed 1 time with DPBS, the cells counted, 100. Mu.L per tube 1X 10 ⁶ And (4) cells. An appropriate amount of Fc receptor blocker (CD 16/32) (BD Pharmingen, cat # 553142) was added to each tube and incubated for 5 minutes at room temperature in the absence of light.

(2) Appropriate amount of antibody CD3 (BD Pharmingen, cat # 553063) and corresponding isotype control antibody (BD Pharmingen, cat # 553925) were added, negative cell control was set, and incubated at 4 ℃ for 30min in the dark. Washed 1 time with DPBS (EDTA 2mmol +1% serum) and 400. Mu.L DPBS was added.

(3) Analysis by flow cytometry (BD Accrri C6 Plus)

The mean of the experimental group data was plotted divided by the multiple of the mean of the blank control group (fold difference = experimental group mean/blank control group mean), and all experiments were repeated at least 3 times.

The results are shown in FIG. 1, where CpG-45-mod has a stronger ability to stimulate T proliferation compared to other groups including positive control LPS, indicating that synthetic, thio-modified CpG-45 has potential as an immunopotentiator or immunoadjuvant.

Assay of ability of CpG ODN to stimulate splenic B cell proliferation

(1) Collection 1 treated cellsAt 2000rpm/min, centrifuge at room temperature for 5 minutes. Cell culture supernatants were collected, assayed for secreted cytokines, and stored at-80 ℃ for future use. The cell pellet was washed 1 time with DPBS, the cells counted, 100. Mu.L per tube 1X 10 ⁶ And (4) cells. An appropriate amount of Fc receptor blocker (CD 16/32) (BD Pharmingen, cat # 553142) was added to each tube and incubated for 5 minutes at room temperature protected from light.

(2) Appropriate amounts of antibody CD19 (BD Pharmingen, cat # 550992) and the corresponding isotype control antibody (BD Pharmingen, cat # 553932) were added, negative cell controls were set, and incubated at 4 ℃ for 30 minutes in the dark. Wash 1 time with DPBS (EDTA 2mmol +1% FBS) and add 400. Mu.L DPBS.

(3) Analysis by flow cytometry (BD Accrri C6 Plus)

The mean of the experimental group data was plotted divided by the multiple of the mean of the blank control group (fold difference = experimental group mean/blank control group mean), and all experiments were repeated at least 3 times.

The results are shown in FIG. 2, where CpG-45-mod has a strong ability to stimulate B proliferation compared to other groups including the positive control LPS, indicating that synthetic, thio-modified CpG-45 has potential as an immunopotentiator or immunoadjuvant.

4.CpG ODN ability to stimulate cytokine secretion from spleen cells

Cytokine detection was performed using a Biolegend kit LEGENDplex ^TM Mouse Th Cytokine Panel (13-plex) (Biolegend, cat # 740005)

(1) Sample preparation: the cell culture supernatant obtained in (1) in 2 or 3 above was used as a sample and diluted one-fold with assay buffer (50. Mu.l sample + 50. Mu.l assay buffer).

(2) Preparing a system:

1) Add 25ul Assay Buffer to each sample tube.

2) Add 25ul of each sample to the corresponding sample tube.

3) Add 25ul of each standard to the corresponding standard tube.

4) Add 25ul of mixing beads to each tube (vortex well, vortex 1 time after every 2-3 minutes).

5) When Beads were added, settling of Beads was avoided, with a final volume of 75ul per tube.

(3) Protected from light, shake the EP tube at 310rpm/min, and incubate at room temperature for 2 hours.

(4) Add 25ul of SA-PE directly to each tube.

(5) Protected from light, shake the EP tube at 310rpm/min, and incubate for 30min at room temperature.

(6) Centrifuge at 1000g for 5 minutes.

(7) The supernatant 125. Mu.l was carefully aspirated off with a pipette tip. Note that the Beads were not aspirated, and the liquid was removed as much as possible.

(8) 200ul 1 × WB was added to each tube. Vortex Beads, centrifuge at 1000g for 5 min and discard supernatant.

(9) 200-300ul 1 × WB is added to each tube. Vortex Beads.

(10) Detection and analysis on a flow cytometer (BD Accrri C6 Plus)

With Student's t test, there was a significant difference when P < 0.05.

The results are shown in FIG. 3, and it can be seen that stimulation with CpG-45-mod significantly increased the expression of IL-6, IL-10, IFN-. Gamma.and TNF-. Alpha.; IL-2, IL-4, IL-5, IL-9, IL-13, IL-17A, IL-17F, IL-21 and IL-22 are not expressed. Synthetic, sulfur-modified CpG-45 was shown to significantly increase expression of cytokines associated with B cell proliferation (IL-6 and IL-10). In addition, cpG-45-mod significantly increased IFN- γ expression, indicating the ability to induce Th 1-type immune responses and to combat intracellular microbial infections.

The results are consistent with the results of the experiments for stimulating B cell proliferation, and again, cpG-45-mod has a strong ability to induce B cell differentiation and proliferation.

Example 2 application of CpG-45-mod in combination with inactivated foot-and-mouth disease antigen as adjuvant to immunize mice

1. Animal(s) production

SPF-grade BALB/c (animal laboratory of Lanzhou veterinary research institute, national academy of agricultural sciences), 10 animals per group, grouped as follows:

TABLE 2

Group of	Adjuvant, antigenic component	Number of animals (only)
			1(CpG-45-mod)	CpG-45-mod, FMDV Ag,206 adjuvant	10
2(206)	FMDV Ag,206 adjuvant	10
			3(PBS)	PBS	10

2. Preparing a vaccine:

vaccine required for group 1: cpG-45-mod, FMDV Ag (Foot and Mouth Disease Virus, FMDV) (provided by Zhongnong Witt. Biotech Co., ltd.), and 206 adjuvant were dissolved in PBS to obtain vaccine, and the concentration of CpG-45 was 10 μ g/100 μ l, the concentration of FMDV Ag was 5 μ g/100 μ l, and the concentration of 206 adjuvant was 50% (volume percentage content).

Vaccine required for group 2: FMDV Ag and 206 adjuvant are dissolved in PBS to obtain the vaccine, the concentration of the FMDV Ag is 5 mug/100 mug, and the concentration of the 206 adjuvant is 50% (volume ratio).

Vaccine required for group 3: 0.01M, PBS pH 7.2.

3. Emulsification of the vaccine: the prepared vaccine is pushed back and forth by two 50mL syringes, mixed for 15 minutes and placed at 4 ℃ for standby.

4. Animal immunization: the emulsified vaccine was injected intramuscularly into the thigh muscle of the two hind legs, 100. Mu.l per leg, and 200. Mu.l vaccine was co-immunized per mouse.

5. Collecting serum: at various time points of immunization, day 0,7,14,28,60,90, 200 μ l of blood was collected from the tail vein, respectively. Centrifuging at 4 deg.C overnight at 4000rpm/min at 4 deg.C for 15 min, collecting supernatant, and storing at-80 deg.C.

6. Antibody determination: liquid phase blocking ELISA (Liquid-phase blocking sandwich ELISA, LB-ELISA) (Zhongnong Willd Biotech, inc., cat # A10171) was as follows:

1) Preparation of reagents: and (3) preparing a washing solution, a coating buffer solution and a substrate solution for an experiment by using the materials provided by the kit.

2) Coating ELISA plate: the rabbit antiserum IgG was diluted with coating buffer at 1.

3) Antigen-antibody reaction (control serum and test serum): the serum to be tested was serially diluted in duplicate on a U-type hemagglutination plate at 50. Mu.l/well, and the negative and positive control sera were diluted in appropriate proportions with PBST to the used concentration of viral antigen (1:8), then 50. Mu.l was added per well and 100. Mu.l was added to the viral antigen control wells. Mix well with shaking and seal the plate overnight at 4 ℃.

4) Washing the ELISA plate 5 times with washing buffer PBST, spin-drying on absorbent paper, taking out the antigen-antibody reaction plate from 4 deg.C, standing at room temperature for 5 min, transferring the virus and serum mixture of each well onto the ELISA plate, adding 50 μ l per well, sealing, and incubating at 37 deg.C for 1 hr.

5) The ELISA plates were also washed 5 times with the wash buffer PBST, and guinea pig antiserum was diluted with guinea pig antiserum dilutions to working concentrations at 1.

6) After washing the plates as above, the rabbit anti-guinea pig enzyme conjugate was diluted with PBST at 1.

7) After washing the plate, 50. Mu.l of substrate solution was added to each well and incubated at 37 ℃ for 15 minutes.

8) The reaction was stopped by adding 50. Mu.l of stop solution to each well, and the absorbance was immediately read at 492 nm.

9) And judging the result that the wells with the OD values of the detected serum being more than the critical value are negative wells and the wells with the OD values being less than or equal to the critical value are positive wells, and the corresponding dilution when the OD value of the positive wells is equal to the critical value is the antibody titer of the serum. Antibody titers were intermediate if the cut-off value was between the two titers.

With Student's t test, there was a significant difference when P < 0.05.

The results of the antibody titer determination are shown in FIG. 4, and it can be seen that the antibody titer of the CpG-45-mod group is much higher than that of the 206 group, and the duration of the antibody of the CpG-45-mod group is still maintained at a higher titer after 90 days, indicating that the antibody titer of the CpG-45 can nonspecifically enhance the antigen.

Therefore, the CpG-45 synthesized by the invention has strong immune enhancement activity, can be used as an immune enhancer or an immune adjuvant and added into animal vaccine products, and can enhance the immune response level of antigen so as to achieve the purpose of preventing and controlling epidemic diseases.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> CpG oligonucleotide sequence with immune enhancement activity and application thereof

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<400> 1

tccatgacgt tcctgacgtt g 21

Claims (4)

1. An oligodeoxynucleotide, the nucleotide sequence of which is sequence 1, wherein all nucleotides in the oligodeoxynucleotide are modified by sulfo.

2. Use of the oligodeoxynucleotide as claimed in claim 1 for increasing the immunogenicity of an antigen or vaccine.

3. Use of the oligodeoxynucleotide as claimed in claim 1 for the preparation of a vaccine.

4. A foot and mouth disease vaccine comprising a foot and mouth disease virus immunogen, the oligodeoxynucleotide of claim 1, and an ISA 206 adjuvant;

the oligodeoxynucleotide as claimed in claim 1, having a concentration of 10 μ g/100 μ l;

the concentration of the foot-and-mouth disease virus immunogen is 5 mug/100 mug;

the concentration of the 206 adjuvant is 50%.

Images