CN112159814A

CN112159814A - CpG oligodeoxynucleotide, preparation and application thereof

Info

Publication number: CN112159814A
Application number: CN202011187615.1A
Authority: CN
Inventors: 景志忠; 房永祥; 赵波; 贾怀杰; 陈国华; 何小兵; 沈岩尔; 李政厅; 杨帆; 刘娟; 秦娟
Original assignee: Lanzhou Veterinary Research Institute of CAAS
Current assignee: Lanzhou Veterinary Research Institute of CAAS
Priority date: 2020-10-29
Filing date: 2020-10-29
Publication date: 2021-01-01
Anticipated expiration: 2040-10-29
Also published as: CN112159814B

Abstract

The invention discloses a preparation method and application of a CpG-containing oligodeoxynucleotide composite adjuvant. The invention provides CpG oligodeoxynucleotide with a sequence of SEQ ID No.1, and all nucleotides are modified by sulfo. The CpG oligodeoxynucleotide has the capability of enhancing the proliferation of B cells and Th I type immune response; the sulfo-modification prolongs the retention time of the compound in vivo and reduces the hydrolysis of various hydrolytic enzymes; the preparation method is simple, the quality is easy to control, and the large-scale production is easy to realize; high safety and low toxic by-effect. The invention provides a preparation method of a CpG oligodeoxynucleotide composite adjuvant, which is prepared by mixing and emulsifying CpG oligodeoxynucleotide and oil emulsion ISA206 according to a certain proportion, and has simple process and stable performance. The CpG-containing oligodeoxynucleotide composite adjuvant provided by the invention can promote the early generation of antibodies and has a strong immune enhancement effect.

Description

CpG oligodeoxynucleotide, preparation and application thereof

Technical Field

The invention relates to a CpG oligodeoxynucleotide, a composite adjuvant containing the CpG oligodeoxynucleotide, a preparation method and application thereof.

Background

In the process of vaccine development, people recognize that the successful preparation of the vaccine must research the compatibility of the adjuvant and the vaccine components to ensure that the adjuvant and the vaccine components form a stable, safe and immunogenic vaccine compound. Adjuvants are non-specific immunopotentiators that, together with an antigen or after prior injection into the body, enhance the body's immune response to the antigen or alter the type of immune response. Therefore, the adjuvant plays a crucial role as a non-specific immunopotentiator to induce an effective immune response in the body after vaccination. Commonly used adjuvants are: mineral adjuvants such as aluminum salt adjuvants, oil emulsion adjuvants such as ISA206, cytokine adjuvants, microbial component adjuvants such as CpG-ODN, LPS (CpG-ODN has been developed as an animal vaccine adjuvant, Heilongjiang animal veterinarian, 2018; recent development of novel TOLL-like receptor vaccine adjuvants, Chinese vaccines and immunization, 2018), immune complexes such as liposomes and immune-stimulating complexes (ISCOMs), traditional Chinese medicine adjuvants such as traditional Chinese medicine polysaccharides, etc. Wherein, the aluminum salt and oil emulsion adjuvant such as ISA206 is the most widely applied vaccine adjuvant, but serious side reactions are generated after the vaccine containing the adjuvant is inoculated, such as local inflammation, granuloma or aseptic abscess, discomfort, fever, adjuvant arthritis and other systemic reactions of inoculated animals (immunologic adjuvant classification and action mechanism, China journal of biological engineering, 2019; immunologic adjuvant research progress and prospect, China infectious disease academic newspaper, 2014). The generation of these side reactions seriously affects the health and food safety of animal bodies, and is not suitable for the development requirement of modern vaccine industry, so that the development of a safe and efficient novel vaccine adjuvant is urgently needed to improve and enhance the immune effect of the vaccine and reduce the occurrence degree of the side reactions.

The compound adjuvant is characterized in that adjuvants with two or more different action mechanisms are scientifically and organically combined together, and the antigen specificity or comprehensive immune response is enhanced/promoted through a synergistic/superposition effect, the adjuvant effect is exerted to the maximum extent, and the occurrence degree of side reactions is reduced, so that the research and development of a novel compound adjuvant with multiple activation action mechanisms and functions becomes the most urgent key technical and scientific problem in the field of efficient vaccine creation research. Composite adjuvants that have been developed or are being developed are: composite adjuvant using aluminum salt as carrier, such as aluminum salt + MPLA, aluminum salt + CIA05(TLR4 ligand), aluminum salt + CpG ODN; the composite adjuvant with emulsion as carrier, such as PELC, is composed of bioabsorbable polymer PEG-b-PLACL, Span85 and squalene; a composite adjuvant with liposome as carrier, such as immunostimulating complex (ISCOM), is a lipid vesicle with diameter of about 30-40 nm composed of saponin, cholesterol, and phospholipid; non-carrier adjuvant composite adjuvant, such as TLR7/8 ligand (3M-052) + TLR9 ligand (CpG), CpG ODN + poly I: C, etc. These composite adjuvants also have certain limitations, such as ISCOMs can only form complexes when matched with antigens or immunogens with more hydrophobic groups; the oil emulsion adjuvant has strong viscosity and is not easy to inject. In addition, different composite adjuvants have different immune adjuvant effects, and the same composite adjuvant has different adjuvant effects in different types of animals and different optimal doses and proportions with different antigens (research progress of composite adjuvants, guangdong animal husbandry and veterinary science, 2013), (research progress of composite adjuvants, journal of immunology, 2019). Therefore, aiming at the immunological characteristics of animal organisms, and combining the characteristics of antigens, the design, screening and induction of novel composite adjuvants which can induce the organisms to generate comprehensive or specific immunoreaction types become the most urgent scientific problem in the field of vaccine development and vaccine research.

CpG refers to a dinucleotide composed of cytosine (C) and guanine (G) linked via a phosphodiester bond (p), and CpG dinucleotides and two bases at the 5 'end and the 3' end of the dinucleotide constitute a CpG motif (CpG motif). CpG motifs are also known as immunostimulatory sequences (ISS), whereas CpG ODN refers to oligodeoxynucleotides containing unmethylated CpG motifs. CpG dinucleotides occur less frequently in vertebrate genomes and are mostly methylated, whereas CpG dinucleotides occur more frequently in bacterial genomes and are mostly unmethylated. The immune system of vertebrates recognizes this feature in the bacterial genome as a danger-stimulating signal via Pattern Recognition Receptors (PRRs), thereby stimulating the body to produce an immune protective response. CpG ODN can promote maturation and activation of dendritic cells, macrophages and B cells, up-regulate the expression of CD80, CD86, CD40 and MHC-II molecules, promote secretion of Thl-type cytokines such as IL-6, IL-12, IFN-gamma, etc., and induce the body to generate Thl-type immune response (phospholipid CpG oligonucleotides as intermediates: polysaccharides in human cellular uptake and immune activity of phosphorus oligonucleotides, 2002,106(1): 102-112).

The basic motif of the CpG ODN structure is 5 '-X1X 2 CGYY-3', X1 represents purine, X2 represents purine or thymine, and Y represents pyrimidine. It was found that the CpG motif containing 6 deoxynucleotides alone has extremely weak immunostimulatory activity, and the CpG length must be increased to exhibit the optimal immunostimulatory effect, and is generally 15 to 30 bases. Numerous studies have demonstrated that CpG ODN are species-specific, that the same CpG ODN sequence may have different effects in different species, and that the effective CpG ODN sequence may also vary from species to species. (CpG motifs in bacterial DNA and the same immune effects, annual Review of Immunology,2002, 20: 709-760). The immunostimulatory activity of CpG ODN is related to the sequence structure characteristics, mainly including the number and position of CpG motif in the sequence, whether the skeleton is modified by thio, whether the sequence has palindrome, whether the 5 'end is free, whether the 3' end contains poly G, etc. One CpG ODN sequence can have one or more CpG motifs, purine and pyrimidine on two sides of the CpG motif, and the difference of bases among the CpG motifs makes different CpG ODNs have different properties and present different immune enhancement and immune regulation effects. The related research results show that different species have specific CpG ODN sequences, and the CpG ODN with different sequences has different immune stimulation effects and shows different immune stimulation effects. In addition, CpG ODN are classified into A, B, C, P types according to their structural and biological properties. The specific structural features, functions, etc. of each type are shown in table 1.

Table 1: classification and structural features of CpG ODN

After being taken into immune cells by endocytosis, CpG ODN is recognized by TLR9 on endosome/lysosome in the cells and combined with the same, so that TLR9 is dimerized, and then a dimerized compound recruits medullary differentiation factor 88 (Myd differentiation factor 88, MyD88) and IL-1receptor-associated kinase (IL-1receptor-associated kinase 4, IRAK4) downstream of the same, so that IRAK4 is phosphorylated and interacts with tumor necrosis factor receptor-associated factor 6(TNF-receptor-associated factor 6, TRAF6), thereby activating I kappa B kinase, releasing NF-kappa B into the nucleus, activating a series of nuclear transcription factors, finally promoting relevant immune cells to secrete a series of cytokines and chemotactic factors, triggering an intracellular bactericidal mechanism or inducing inflammatory response, CpG clearance or elimination of pathogenic microorganisms (signal transduction pathway) invading organisms, 16(1):17-22).

The CpG ODN is used as a novel, safe and efficient immunologic adjuvant and shows wide application prospect. The CpG ODN is used as adjuvant of hepatitis B vaccine to immunize gorilla or monkey, and the antibody generating capacity is 15 times of that of single vaccine immunization group, which shows that the CpG ODN can be used as good adjuvant of hepatitis B vaccine. 2017.11.9, Dynavax Technologies announced that the American FDA approval of the HEPLISAV-B drug (CpG ODN 1018 in combination with commercial hepatitis B vaccine) was approved as the first vaccine with CpG adjuvant in the world (DynavaxAnnous FDA appro of HEPLISAV-B (TM) for prevention of hepatitis B in Adults. Coley, Inc. used CpG ODN 7909 as adjuvant for hepatitis B vaccine, clinical trial showed that the vaccine had much higher antibody titers than the hepatitis vaccine alone at all time points after initial immunization.Coley, used CpG ODN 7909 as adjuvant for commercial multivalent inactivated influenza vaccine (Fluarix), and random double-blind phase I clinical trial showed that CpG ODN was a safe, CpG adjuvant and decreased (Fluarix), when CpG ODN was combined with porcine pseudovaccine, it significantly enhanced the humoral and cellular immune response of piglets, when combined with porcine pseudostreptococcal vaccines, can obviously enhance the immune response of the pig body. In conclusion, the CpG ODN is a safe, efficient and novel activator mainly promoting Th1 type immune response, and presents good immune adjuvant effect.

Disclosure of Invention

It is a first object of the present invention to provide a CpG oligodeoxynucleotide which is different from existing CpG ODNs.

The second objective of the present invention is to provide a composite adjuvant containing CpG ODN of the present invention and a preparation method thereof, which can overcome the disadvantages of the prior art.

The third purpose of the invention is to provide the application of the specific composite adjuvant containing the CpG ODN of the invention.

The sequence of the CpG oligodeoxynucleotide of the invention is SEQ ID No.1, and all nucleotides are all modified by sulfo. The invention relates to a specific CpG oligodeoxynucleotide which is named CpG ODN 46. The CpG ODN46 belongs to A type, contains 3 CpG units and has the chain length of 29 nt. The thio-modified polyG can enable the CpG ODN to form a stable G-tetramer structure, prolong the retention time of the A-type CpG ODN in a vesicle in a pDC, and thus the A-type CpG ODN is not degraded by in vivo DNA enzyme, thereby improving the stability of the CpG ODN.

The CpG oligodeoxynucleotide can be applied to preparation of a composite adjuvant or a vaccine.

The invention provides an adjuvant, which contains the CpG oligodeoxynucleotide.

The invention provides a vaccine, which contains the CpG oligodeoxynucleotide and a pathogenic antigen.

Preferably, the CpG oligodeoxynucleotide for the vaccine is prepared by compounding a sequence of SEQ ID No.1, a foot-and-mouth disease virus inactivated antigen and an ISA206 oil emulsion.

The CpG ODN46 of the present invention is a dinucleotide composed of cytosine and guanine linked via a phosphodiester bond. CpG is proved to be a novel, safe and efficient adjuvant by a large number of clinical experiments. CpG46 is a novel immunostimulatory molecule autonomously designed, optimized, screened by the applicant with strong immunostimulatory capacity. The related experiments show that the immune response of the body fluid and the cells can be obviously enhanced. Aiming at the defects of the adjuvant in the prior art, the oil emulsion ISA206 is used as a carrier system, is the most common oil adjuvant in animal vaccines, and stimulates an organism to generate humoral and cellular immune response through the slow release effect of antigen. CpG which is a ligand of TLR9 is taken as an immune stimulating molecule, and can induce the organism to generate a cellular immune response mainly based on Th1 type immune response. The invention organically combines a carrier system and a stimulating molecule, and two adjuvants with complementary functions, and develops a novel, safe and efficient composite adjuvant. The research result provides powerful technical support for the development of novel vaccines, also provides guarantee for the healthy development of the livestock industry, and has huge market prospects at home and abroad.

The invention has the following advantages:

1. the CpG ODN46 of the present invention has strong immunostimulating effect;

2. the total-thio modified CpG ODN46 prolongs the retention time in vivo and reduces the hydrolysis effect of various hydrolases; the preparation method is simple, the quality is easy to control, and the large-scale production is easy to realize;

3. the CpG ODN46 has good safety and low toxic and side effects;

4. the CpG-containing ODN46 composite adjuvant has strong immune enhancement effect.

Drawings

FIG. 1 is a graph showing one of the results of screening CpG ODN46 sequences using mouse spleen cells lysed for erythrocytes and a method of detecting T cell proliferation using CFSE labeling.

FIG. 2 is a graph showing one of the results of screening CpG ODN46 sequences using a method of lysing splenocytes from mice and detecting B cell proliferation using CFSE labeling.

FIG. 3 is a graph showing the results of CpG ODN46 stimulation of cytokine secretion from spleen cells of mouse lysed erythrocytes. Wherein FIG. 3A is IFN-. gamma.FIG. 3B is IL-6, FIG. 3C is the result of expression of TNF-. alpha..

FIG. 4 is a graph showing the result of the measurement of the serum antibody titer at different time points after a single immunization of a mouse, in a vaccine containing the CpG ODN46 composite adjuvant and an inactivated antigen of foot and mouth disease virus.

Detailed Description

The present invention will be explained in detail with reference to examples. The experimental methods used in the following examples are all conventional methods unless otherwise specified; materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Design and screening of CpG ODN molecule

Screening of CpG ODN molecules

Through screening and verifying the structure and function of 4 CpG ODN sequences (see Table 2), a CpG ODN46-mod with strong immune enhancement function is screened, the nucleotide sequence is SEQ ID No.1, and all nucleotides are all modified by sulfo, which is referred to as CpG ODN46 for short.

The CpG ODN nucleotide backbone in Table 2 is a backbone of all nucleotides that have not been thio-modified (name suffix-non) and all nucleotides that have been thio-modified (name suffix-mod). non-CpG controls contain no CpG units, 15nt chain length; CpG ODN46, containing 3 CpG units, 29nt long.

Table 2: CpG and non-CpG sequences used in this study

Group of	Sequence (5 '-3')
		non-CpG control-non	GCTAGAGCTTAGGCT
non-CpG control-mod	GCTAGAGCTTAGGCT
		CpGODN46-non	TCGTCCATGACGTTCCTGACGTTGGGGGG
CpGODN46-mod	TCGTCCATGACGTTCCTGACGTTGGGGGG (sequence 1)

The nucleotide sequences of the present invention are compared to published CpG sequences as shown in Table 3

Table 3; CpG ODN46 and published or published CpG sequences and their characteristics

(II) specific immune Effect detection

1. Isolation of mouse spleen cells

(1) By breaking the neck or CO₂C57 BL/6 mice were sacrificed by anesthesia, spleens of the mice were aseptically isolated, placed on a 100 μm sieve, and RPMI1640 medium (Gibco, cat # C11875500BT) was added with grinding, and muscle or other tissue fractions were filtered off.

(2) At 2000rpm/min, centrifuge at room temperature for 5 minutes. The residual liquid was discarded, and 2mL of erythrocyte lysate (Tiangen Biochemical technology (Beijing) Co., Ltd., cat. No. RT122-02) was added to resuspend the cells at room temperature for 5 minutes.

(3) Immediately add 2-3 times volume of RPMI1640 medium and mix by inversion. At 2000rpm/min, centrifuge at room temperature for 5 minutes. The residual liquid was discarded and 1mL of DPBS was added.

(4) Appropriate cells were added to a final concentration of 5uM CFSE (5(6) -Carboxyfluorescein diacetate N-succinimidyl ester, CFSE) (Sigma-Aldrich, Cat. No. 21888).

(5) Protected from light and shaken at 37 ℃ for 10 minutes. Immediately, 1 volume of RPMI 1640/10% FBS (fetal bovine serum) (Gibco, cat # 16000044) was added and placed on ice for 5 minutes. At 2000rpm/min, centrifuge at room temperature for 5 minutes. Appropriate amount of RPMI 1640/10% fetal bovine serum was added and washed 3 times. 1mL of RPMI 1640/10% fetal bovine serum was added and counted.

(6) Will be 1 × 10⁶Each/mL was inoculated in a 48-well cell culture plate, and a final concentration of 1. mu.g/mL of non-CpG control-non, non-CpG control-mod, CpG ODN 46-non, CpG ODN46-mod, 100ng/mL of positive control LPS (lipopolysaccharide, LPS) (lipopolysaccharide) (Sigma-Aldrich, Cat. No. L4391), blank control (control), 5% CO2, and cultured at 37 ℃ for 3 days, respectively.

Assay of ability of CpG ODN to stimulate spleen T cell proliferation

(1) 1 treated cells were collected, centrifuged at 2000rpm/min for 5 minutes at room temperature. Cell culture supernatants were collected, assayed for secreted cytokines, and stored at-80 ℃ for future use. The cell pellet was washed 1 time with DPBS, the cells counted, 100. mu.L per tube 1X 10⁶And (4) cells. An appropriate amount of Fc receptor blocker (CD16/32) (BD Pharmingen, cat # 553142) was added to each tube and incubated for 5 minutes at room temperature in the absence of light.

(2) Appropriate amounts of antibody CD3(BD Pharmingen, cat # 553063) and the corresponding isotype control antibody (BD Pharmingen, cat # 553925) were added, negative cell controls were set, and incubated at 4 ℃ for 30min in the dark. Washed 1 time with DPBS (EDTA 2mmol + 1% serum) and 400. mu.L of DPBS was added.

(3) Analysis by flow cytometry (BD Accrri C6 Plus)

The mean of the experimental group data was plotted divided by the multiple of the mean of the blank (fold difference-mean experimental group/mean blank), and all experiments were repeated at least 3 times.

The results are shown in fig. 1, where CpG ODN46-mod has a stronger ability to stimulate T proliferation compared to other groups including the positive control LPS, indicating that synthetic, thio-modified CpG ODN46 has potential as an immunopotentiator or immune adjuvant.

Assay of ability of CpG ODN to stimulate spleen B cell proliferation

(2) Appropriate amounts of antibody CD19(BD Pharmingen, cat # 550992) and the corresponding isotype control antibody (BD Pharmingen, cat # 553932) were added, negative cell controls were set, and incubated at 4 ℃ for 30 minutes in the dark. Washed 1 time with DPBS (EDTA 2mmol + 1% FBS) and 400. mu.L DPBS was added.

(3) Analysis by flow cytometry (BD Accrri C6 Plus)

The results are shown in fig. 2, where CpG ODN46-mod has a strong ability to stimulate B proliferation compared to other groups including the positive control LPS, indicating that synthetic, thio-modified CpG ODN46 has potential as an immunopotentiator or immune adjuvant.

Assay of ability of CpG ODN to stimulate cytokine secretion from spleen cells

Cytokine detection was performed using a Biolegend kit LEGENDplex^TMMouse Th Cytokine Panel (13-plex) (Biolegend, cat # 740005)

(1) Sample preparation: the cell culture supernatant obtained in (1) in 2 or 3 above was used as a sample and diluted one-fold with assay buffer (50. mu.l sample + 50. mu.l assay buffer).

(2) Preparing a system:

1) add 25ul Assay Buffer to each sample tube.

2) Add 25ul of each sample to the corresponding sample tube.

3) Add 25ul of each standard to the corresponding standard tube.

4) Add 25ul of mixing beads to each tube (vortex well, vortex 1 time after every 2-3 minutes).

5) When Beads were added, settling of Beads was avoided, with a final volume of 75ul per tube.

(3) Protected from light, shake the EP tube at 310rpm/min, and incubate at room temperature for 2 hours.

(4) Add 25ul of SA-PE directly to each tube.

(5) Protected from light, shake the EP tube at 310rpm/min, and incubate for 30min at room temperature.

(6) Centrifuge at 1000g for 5 minutes.

(7) The supernatant 125. mu.l was carefully aspirated off with a pipette tip. Note that the Beads were not aspirated, and the liquid was removed as much as possible.

(8) Add 200ul 1 × WB per tube. Vortex Beads, centrifuge at 1000g for 5 min and discard supernatant.

(9) 200-300ul 1 xWB was added per tube. Vortex Beads.

(10) Detection analysis on a flow cytometer (BD Accrri C6 Plus)

With Student's t test, there was a significant difference when P < 0.05.

The results are shown in FIG. 3, and it can be seen that stimulation with CpG ODN46-mod significantly increased the expression of IL-6, IL-10, IFN-. gamma.and TNF-. alpha.; IL-2, IL-4, IL-5, IL-9, IL-13, IL-17A, IL-17F, IL-21 and IL-22 are not expressed. It was shown that synthetic, sulfur-modified CpG ODN46 significantly increased the expression of B cell proliferation-associated cytokines (IL-6 and IL-10). In addition, CpG ODN46-mod significantly increased IFN- γ expression, suggesting the ability to induce Th 1-type immune responses and to combat intracellular microbial infections.

This result indicates that CpG ODN46-mod has a strong ability to induce Th1 type immune response and induce B cell differentiation and proliferation.

Second, the application of the vaccine prepared by the CpG ODN46 of the invention and prepared by the compound adjuvant and combined with the foot-and-mouth disease virus inactivated antigen in mice

1. Animal(s) production

SPF-grade BALB/c (animal laboratory, Lanzhou veterinary research institute, national academy of agricultural sciences), 10 animals per group, grouped as shown in Table 4.

Table 4: experimental group setup

Group of	Adjuvant, antigenic component	Number of animals (only)
			1(CpGODN46-mod)	CpGODN46-mod, FMDVAg, ISA206 adjuvant	10
2(ISA206)	FMDVAg, ISA206 adjuvant	10
			3(PBS)	PBS	10

2. Preparing a vaccine:

CpG-containing ODN composite adjuvant required for group 1: mixing CpG ODN46-mod (50-100ug/mL) and oil emulsion ISA206 with concentration of 50% (volume percentage content refers to total volume of the pre-prepared vaccine) at a certain ratio, placing on ice, emulsifying at 5000rpm/min for 3 min, separating 1 min, repeating emulsifying for 2 times, emulsifying for 3 times, and placing at 4 deg.C for use.

Vaccine required for group 1: dissolving the CpG-containing ODN composite adjuvant and FMDV Ag (activated Antigen of Foot and Mouth Disease Virus, FMDV Ag) (Inactivated Antigen of Foot and Mouth Disease Virus) (provided by Zhongnong Witt Biotech Co., Ltd.) in PBS according to a certain proportion; or dissolving CpG ODN46-mod, oil emulsion ISA206 and foot-and-mouth disease virus inactivated antigen in PBS according to a proportion to obtain the vaccine; the concentration of CpG ODN46-mod is 50-100ug/mL, the concentration of FMDV Ag is 10-50 mug/mL, and the concentration of oil emulsion ISA206 is 50% (volume percentage content).

Vaccine required for group 2: dissolving oil emulsion ISA206 and foot-and-mouth disease virus inactivated antigen in PBS according to a certain proportion to obtain a vaccine; the concentration of FMDV Ag is 10-50 mug/mL, and the concentration of oil emulsion ISA206 is 50% (volume percentage content).

Vaccine required for group 3: PBS.

3. Emulsification of the vaccine: the prepared vaccine is put on ice, emulsified for 3 minutes at 5000rpm/min at intervals of 1 minute, repeatedly emulsified for 2 times, totally emulsified for 3 times and put at 4 ℃ for standby.

4. Animal immunization: the emulsified vaccine was injected intramuscularly into the thigh muscle of the two hind legs, 100. mu.l per leg, and 200. mu.l vaccine was co-immunized per mouse.

5. Collecting serum: at different time points of immunization,

day

0,7,14,28,60,90, 200 μ l of blood was collected from the tail vein, respectively. Centrifuging at 4 deg.C overnight at 4000rpm/min at 4 deg.C for 15 min, collecting supernatant, and storing at-80 deg.C.

6. Antibody determination: liquid phase blocking ELISA (Liquid-phase blocking sandwich ELISA, LB-ELISA) (Zhongnong Willd Biotech, Inc., cat # A10171) was as follows:

1) preparation of reagents: and (3) preparing a washing solution, a coating buffer solution and a substrate solution for an experiment by using the materials provided by the kit.

2) Coating ELISA plate: the rabbit antiserum IgG was diluted 1:1000 with coating buffer to working concentration, 50. mu.l of solution was added to each well of the ELISA plate, the plate was sealed with a membrane after shaking for 2-3 minutes and overnight at room temperature.

3) Antigen-antibody reaction (control serum and test serum): the sera to be tested were serially diluted in duplicate on a U-shaped hemagglutination plate at 50. mu.l/well, and the negative and positive control sera were diluted in appropriate proportions with PBST to the used concentration of viral antigen (1:8), then 50. mu.l were added per well and 100. mu.l were added to the viral antigen control wells. Mix well with shaking and seal the plate overnight at 4 ℃.

4) Washing the ELISA plate 5 times with washing buffer PBST, spin-drying on absorbent paper, taking out the antigen-antibody reaction plate from 4 deg.C, standing at room temperature for 5 min, transferring the virus and serum mixture of each well onto the ELISA plate, adding 50 μ l per well, sealing, and incubating at 37 deg.C for 1 hr.

5) The ELISA plates were also washed 5 times with washing buffer PBST, and guinea pig antiserum dilutions were used to dilute the guinea pig antiserum to working concentrations at 1:1000, 50. mu.l per well, sealed and incubated at 37 ℃ for l hours.

6) After washing the plates as above, the rabbit anti-guinea pig enzyme conjugate was diluted 1:500 with PBST to working concentration, 50. mu.l was added to each well, and incubated at 37 ℃ for 1 hour.

7) After washing the plate, 50. mu.l of substrate solution was added to each well and incubated at 37 ℃ for 15 minutes.

8) The reaction was stopped by adding 50. mu.l of stop solution to each well, and the absorbance was immediately read at 492 nm.

9) And judging the result that the wells with the OD values of the detected serum being more than the critical value are negative wells and the wells with the OD values being less than or equal to the critical value are positive wells, and the corresponding dilution when the OD value of the positive wells is equal to the critical value is the antibody titer of the serum. Antibody titers were intermediate if the cut-off was between two titers.

With Student's t test, there was a significant difference when P < 0.05.

The antibody titer determination results are shown in fig. 4, and it can be seen that the antibody titer of the CpG ODN46-mod complex adjuvant group is much higher than that of the control group oil emulsion ISA206, and the duration of the CpG ODN46-mod complex adjuvant group antibody is still maintained at a higher titer after 90 days, which indicates that the CpG ODN46 complex adjuvant can non-specifically enhance the antibody titer of the antigen and prolong the antibody duration.

Sequence listing

<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences

<120> CpG oligodeoxynucleotide, preparation and use thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Artificial sequence (CpG ODN 46)

<400> 1

tcgtccatga cgttcctgac gttgggggg 29

Claims

1. The sequence of the CpG oligodeoxynucleotide is SEQ ID No.1, and all nucleotides are all modified by sulfo.

2. Use of the CpG oligodeoxynucleotide as set forth in claim 1 for preparing a composite adjuvant.

3. The use of the CpG oligodeoxynucleotide as claimed in claim 1 in a vaccine.

4. The CpG-containing oligodeoxynucleotide composite adjuvant according to claim 1, for use in a vaccine.

5. An adjuvant comprising the CpG oligodeoxynucleotide of claim 1.

6. A vaccine comprising the CpG oligodeoxynucleotide of claim 1 and a pathogenic antigen.

7. The vaccine of claim 5, which is prepared by compounding all nucleotides with all thio-modified sequence of SEQ ID No.1 nucleotide, foot and mouth disease virus inactivated antigen and ISA206 oil emulsion.