CN112143789A

CN112143789A - Kit and method for identifying position of GALT gene containing two mutation sites simultaneously

Info

Publication number: CN112143789A
Application number: CN202010950644.2A
Authority: CN
Inventors: 彭艳华; 龚强; 余艳; 代冰; 李慧源; 张可可
Original assignee: Changsha Jinyu Medical Laboratory Co Ltd
Current assignee: Changsha Jinyu Medical Laboratory Co Ltd
Priority date: 2020-09-10
Filing date: 2020-09-10
Publication date: 2020-12-29

Abstract

The invention discloses a kit and a method for identifying the position of GALT gene containing two mutation sites simultaneously. The kit comprises the following primer pairs: f1: GCGCAGTGGAACCGATCCTCTG, respectively; r1: CCAAGGGTACTGGGCACCGA, respectively; f2: GCGCAGTGGAACCGATCCTGAC, respectively; r2: CCAAGGGTACTGGGCACGCG, respectively; the two mutation sites are C.27G > C and C.482T > C mutation sites. The method can identify whether the C.27G > C and C.482T > C mutation sites are on the same chromosome or different chromosomes, and has the advantages of small workload, short time consumption and easy operation.

Description

Kit and method for identifying position of GALT gene containing two mutation sites simultaneously

Technical Field

The invention belongs to the technical field of biomedical detection, and particularly relates to a kit and a method for identifying a position of a PAH gene containing two mutation sites (C.27G > C and C.482T > C) at the same time.

Background

Galactosemia (GAL) is an autosomal recessive inherited metabolic disorder caused by enzyme defects in the galactose metabolic pathway, in which galactosemia due to GALT deficiency is relatively common, also known as classic galactosemia, resulting from pathogenic variation of the GALT gene. Galactose in a human body is mainly metabolized through a Leloir pathway, and when enzymes in the Leloir pathway are deficient, galactose in the human body cannot be completely compensated through the alternative metabolic pathway, so that galactose and alternative metabolites thereof are accumulated, and galactosemia is caused. Classic galactosemia occurs at step 2 of galactose metabolism, i.e. GALT deficiency leads to accumulation of its precursor galactose-1-phosphate. The infant patients usually get ill in perinatal period, and have various complications such as diarrhea, vomiting, hypoglycemia, liver function injury and the like, and even have septicemia, shock and death. Galactose metabolism intermediate has cytotoxicity, and may cause long-term complications such as mental retardation, growth retardation, and ataxia. The GALT gene can be diagnosed by gene detection.

Mutations in different GAL genes affect GAL activity and structure to a different extent. Aiming at the two mutation sites involved in the scheme, the two mutation sites occur on the same chromosome or different chromosomes, and the influence on the severity of the disease of a patient is different. If two mutations occur on the same chromosome, no disease is caused; if the two mutations occur on different chromosomes, respectively, diseases are caused. To assess the severity of the disease, the known mutations of the different GAL genes are identified as being distributed on the same or different chromosomes, which is crucial for the diagnosis of the disease. The existing method is to extract DNA, construct a vector and carry out in-vitro expression experiments, needs a complete set of laboratories of molecular biology, microorganism and cell culture, has great difficulty, large workload and long time consumption, and is difficult to implement in common laboratories.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a kit and a method for identifying the position of two mutation sites of a GALT gene.

In order to achieve the purpose, the technical scheme provided by the invention is as follows:

the kit for identifying the GALT gene simultaneously containing two mutation site positions contains the following primer pairs:

F1：GCGCAGTGGAACCGATCCTCTG(SEQ ID NO.1)

R1：CCAAGGGTACTGGGCACCGA(SEQ ID NO.2)

F2：GCGCAGTGGAACCGATCCTGAC(SEQ ID NO.3)

R2：CCAAGGGTACTGGGCACGCG(SEQ ID NO.4)；

the two mutation sites are: C.27G > C, C.482T > C mutation site.

Preferably, the primer pairs are used in combination in the following arrangement:

①：F1+R1

②：F1+R2

③：F2+R1

④：F2+R2。

preferably, according to the mutation distribution of C.27G > C and C.482T > C, the primer pairs are combined and used according to the following arrangement:

the method comprises the following steps: when the sample to be tested contains C.27G > C and C.482T > C mutations at the same time but is distributed on different chromosomes: f1+ R2 or F2+ R1; wherein, F1 and R1 are primers for detecting wild type;

secondly, when the sample to be detected contains C.27G C and C.482T C mutations and is distributed on the same chromosome: f2+ R2.

The method for identifying the mutation sites simultaneously containing C.27G > C and C.482T > C based on the kit adopts a primer pair in the kit to carry out amplification detection under the following sequence and conditions:

①：94℃，5min；

②：94℃，30s；56℃，30s；72℃，2min；35Cycles；

③：72℃，5min；25℃，∝；

if the amplified fragment shows specific bands through agarose gel electrophoresis, C.27G > C and C.482T > C are shown.

According to the known site C.27G > C and C.482T > C mutation of GALT gene, two groups of primers are designed, wherein the first group comprises: the 3' terminal base is complementary to the normal template base, and the second group: the 3' terminal base is complementary to the mutated template base. Based on the fact that thermostable Taq DNA polymerase lacks 3 ' → 5 ' exo-proofreading activity, the specific base at the 3 ' end of the primer is complementary to the opposite base of the wild type and mutant alleles, respectively, and if this base pair is mismatched, the chain extension reaction is hindered by the formation of a 3 ', 5 ' -phosphodiester bond, and the amplification result is: wild template blocking and mutant primer amplification; or mutation template blocking, wild primer amplification.

The invention designs different primer pairs, and the extracted template is amplified and then is subjected to agarose gel electrophoresis so as to achieve the aim of identification. The invention can identify whether the mutation sites of C.27G > C and C.482T > C are on the same chromosome or different chromosomes. The existing method comprises the steps of DNA extraction, cloning vector construction and in-vitro expression experiment, needs a complete set of molecular biology, microorganism and cell culture laboratories, is extremely difficult, has large workload, takes 2-3 months, and is difficult to implement in common laboratories.

Drawings

FIG. 1 is an electrophoretogram of Z, T, S samples;

FIG. 2 is an electrophoretogram of a comparative primer pair.

Detailed Description

DNA extraction

3 samples are selected, one wild type is named as Z, one sample which simultaneously contains C.27G > C and C.482T > C mutations and is distributed on different chromosomes is named as T, and the other sample which simultaneously contains C.27G > C and C.482T > C mutations and is distributed on the same chromosome is named as S. The DNA was extracted according to the instructions of the reagent QIAamp DNA Blood Mini Kit (250) (Qiagen, 163030523) and stored at-20 ℃ until use.

PCR amplification

Fragment amplification was performed according to the reaction system shown in Table 1 (commercial reagents were purchased from Nanjing Novozam Biotech Co., Ltd.).

TABLE 1 reaction System

Reagent	Volume (μ L)
		2 × Vazyme LAmp Master Mix (for commercial use)	25
ddH2O	13
		Primers Mixer(F+R)	8
Template DNA (for commercial use)	4
		Total volume	50

The reaction system was configured as shown in Table 1, in which the Primers (F + R) were amplification Primers.

Two sets of amplification primer sequences were designed by the present invention, as shown in Table 2 below. Wherein the 3 'end of the F1 and F2 sequences is directed to the wild type and mutant templates of the site C.27G > C, and the 3' end of the R1 and R2 sequences is directed to the wild type and mutant templates of the site C.482T > C. Table 2 primer sequences were freely combined at 5P concentration 1: 1F-terminus and R-terminus to give 4 sets of Primers Mixer (F + R) mixtures as in Table 3.

TABLE 2 primer sequences

TABLE 3 Primers Mixer (F + R) primer combinations

Group 1	F1+R1
		Group 2	F1+R2
Group 3	F2+R1
		Group 4	F2+R2

After all reagents are prepared, dividing each group of primers into 3 parts, respectively adding Z, T samples and S samples to obtain 12 parts of mixed solution, naming the mixed solution as Z1-Z4, T1-T4 and S1-S4 according to the grouping of the primers, and carrying out PCR amplification according to the following amplification procedures:

[94℃，5min]；[94℃，30s；56℃，30s；72℃，2min；35Cycles]；[72℃，5min；25℃，∝]。

3. electrophoresis

Preparing gel

1g of agarose gel (dry powder) was added to 100ul of 1 XTAE solution and mixed. Putting the mixed solution into a microwave oven, and setting the microwave oven to be on strong fire for-3 min. After cooling, 5ul of DD nucleic acid dye is added, and the gel is evenly mixed and poured for solidification.

② sample application

Dilute to 1X loading buffer with water. Taking out the amplification product to be detected, and according to the product: and (loading buffer) adding samples on the configured rubber block in a ratio of 1: 1. Meanwhile, DL 2000DNA Marker is added into a swimming groove.

③ electrophoresis

Setting parameters of the electrophoresis apparatus: 70V-100 min.

4. Results

As a result, as shown in FIG. 1, the Z sample showed a specific band in the first primer combination, and no band in the remaining combinations. T samples showed specific bands in groups 2 and 3, and no band in groups 1 and 4. The S sample has a specific band in the 4 th group of primer combination, and has no appearance in the 1 st, 2 nd and 3 rd groups.

5. Control

The primer sequences of the control group are shown in Table 4, the primer combinations are shown in Table 5, and the other operations are the same as those of embodiments 1 to 3.

TABLE 4 control primer sequences

TABLE 5 Primers Mixer (F + R) control primer combinations

Group 1	F1+R1
		Group 2	F1+R2
Group 3	F2+R1
		Group
4	F2+R2

As a result, as shown in FIG. 2, in the Z sample, in addition to the occurrence of a specific band in the first set of primer combinations, bands were also present in the remaining combinations in which no band should be present; in addition to the occurrence of specific bands in groups 2 and 3, the T samples also exhibited bands in groups 1 and 4 in which no band should be observed; in addition to the presence of a specific band in the primer combination of group 4, the S sample also showed bands in groups 1, 2 and 3 where no band should appear.

Sequence listing

<110> Changsha gold Domain medical laboratory Co., Ltd

<120> kit and method for identifying position of GALT gene containing two mutation sites simultaneously

<141> 2020-09-10

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> null

<400> 1

gcgcagtgga accgatcctc tg 22

<210> 2

<211> 20

<212> DNA

<213> null

<400> 2

ccaagggtac tgggcaccga 20

<210> 3

<211> 22

<212> DNA

<213> null

<400> 3

gcgcagtgga accgatcctg ac 22

<210> 4

<211> 20

<212> DNA

<213> null

<400> 4

ccaagggtac tgggcacgcg 20

<210> 5

<211> 22

<212> DNA

<213> null

<400> 5

gcgcagtgga accgatcctc ag 22

<210> 6

<211> 20

<212> DNA

<213> null

<400> 6

ccaagggtac tgggcaccca 20

<210> 7

<211> 22

<212> DNA

<213> null

<400> 7

gcgcagtgga accgatcctc ac 22

<210> 8

<211> 20

<212> DNA

<213> null

<400> 8

ccaagggtac tgggcacccg 20

Claims

1. A kit for identifying the position of GALT gene containing two mutation sites simultaneously is characterized in that the kit contains the following primer pairs:

F1:GCGCAGTGGAACCGATCCTCTG

R1:CCAAGGGTACTGGGCACCGA

F2:GCGCAGTGGAACCGATCCTGAC

R2:CCAAGGGTACTGGGCACGCG；

the two mutation sites are: C.27G > C, C.482T > C mutation site.

2. The kit of claim 1, wherein the primer pairs are used in combination in the following arrangement:

①：F1+R1

②：F1+R2

③：F2+R1

④：F2+R2。

3. the kit of claim 2, wherein the primer pairs are used in combination according to the mutation profiles of C.27G > C and C.482T > C as follows:

when a sample to be detected contains C.27G > C and C.482T > C mutations at the same time but is distributed on different chromosomes: f1+ R2 or F2+ R1;

4. A method for identifying the position of GALT gene containing two mutation sites simultaneously, which is characterized in that the method adopts the primer pair in the kit of any one of claims 1 to 3 to carry out amplification detection under the following sequence and conditions:

①：94℃，5min；

②：94℃，30s；56℃，30s；72℃，2min；35Cycles；

③：72℃，5min；25℃，∝；

if the amplified fragment shows a specific band by agarose gel electrophoresis, C.27G > C and C.482T > C mutation sites are shown.