CN112142834A - Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice - Google Patents

Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice Download PDF

Info

Publication number
CN112142834A
CN112142834A CN202011060584.3A CN202011060584A CN112142834A CN 112142834 A CN112142834 A CN 112142834A CN 202011060584 A CN202011060584 A CN 202011060584A CN 112142834 A CN112142834 A CN 112142834A
Authority
CN
China
Prior art keywords
ala
leu
arg
ser
glu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011060584.3A
Other languages
Chinese (zh)
Inventor
吕冰
王家豪
方是珍
王艺霖
陈洪晴
陈开�
杨超
陈云
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yangzhou University
Original Assignee
Yangzhou University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yangzhou University filed Critical Yangzhou University
Priority to CN202011060584.3A priority Critical patent/CN112142834A/en
Publication of CN112142834A publication Critical patent/CN112142834A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance

Abstract

The invention discloses application of rice osmotic stress response protein OsU496A in improving the rice osmotic stress resistance, which is characterized in that firstly, an interference expression vector containing a specific fragment of a coding gene of positive and negative RNAi rice osmotic stress response protein OsU496A is introduced into rice cells, tissues or organs to reduce the expression quantity of the coding gene of the rice osmotic stress response protein OsU496A in the rice cells, tissues or organs, then the rice cells, tissues or organs are cultured into plants to reduce the expression quantity of the coding gene of the rice osmotic stress response protein OsU496A, and rice with good physiological indexes and improved osmotic stress resistance under osmotic stress is obtained. The invention provides a new choice for genetic improvement and molecular breeding of rice.

Description

Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice
Technical Field
The invention relates to application of rice osmotic stress response protein OsU496A in improving the osmotic stress resistance of rice, belonging to the field of plant genetic engineering.
Background
Rice is a crop with a wide planting range, is planted in 113 countries in the world, is one of staple food for more than half of the population in the world, and is also the most important food crop in Asia. China is also the first high-yield rice country and consumer country in the world, and the history of planting rice is long. In recent years, the yield of rice is remarkably improved due to the popularization of excellent varieties and the reform of a farming system, but abiotic stresses such as osmotic stress still restrict the development of high yield, diversification and quality improvement of rice. The water demand of rice in the whole growth period is huge, the agricultural water consumption in the world at present accounts for more than 70% of the total amount of fresh water, and osmotic stress caused by water resource shortage can not only hinder the growth and development of rice, but also cause the reduction of quality and yield. Under the osmotic stress environment, the rice cannot obtain water required by normal growth, so that the form, internal physiological environment and metabolism of the rice are changed, the growth and development of plants are delayed, and the plants can die seriously. The intensity and frequency of osmotic stress occurrence are further increasing with the rapid development of economy, population growth, and the influence of global warming on the maldistribution of precipitation. The rice with better stress resistance is bred by improving the rice variety, so that the shortage of water resources is relieved, and the method is a basic direction at present.
Plants are anchored at fixed positions by root systems and cannot avoid adverse environments through movement, in order to reduce damage caused by osmotic stress, various response ways are evolved in rice, and the tolerance of the rice to the osmotic stress is improved through some transcription factors, enzymes and some functional proteins. When suffering from osmotic stress, rice can start the response of related genes, and the damage of the osmotic stress to the rice can be relieved through the expression of the response genes. With the continuous development and improvement of functional genomics, researches on analyzing and cloning response genes and response signal regulation and control processes thereof under the osmotic stress of rice based on multidisciplinary crossing and combining microcosmic and macroscopical aspects have been comprehensively developed. The method is an important way for improving the stress resistance of rice by discovering and identifying genes capable of effectively improving the stress resistance of rice and then introducing the functional genes into the rice to obtain a new stress resistance material.
Disclosure of Invention
The invention aims to solve the problems and provides application of rice osmotic stress response protein OsU496A in improving the osmotic stress resistance of rice.
The invention aims to realize the application of rice osmotic stress response protein OsU496A in improving the osmotic stress resistance of rice, and is characterized in that: firstly, introducing an interference expression vector containing a specific fragment of a positive and negative RNAi rice osmotic stress response protein OsU496A coding gene into rice cells, tissues or organs to reduce the expression quantity of the rice osmotic stress response protein OsU496A coding gene in the rice cells, tissues or organs, then culturing the rice cells, tissues or organs into plants to reduce the expression quantity of the rice osmotic stress response protein OsU496A coding gene, and obtaining the rice with good physiological indexes and improved osmotic stress resistance under osmotic stress.
In the rice osmotic stress response protein OsU496A, the amino acid is SEQ ID No. 1, and the SEQ ID No. 1 is:
Met Gly Asn Ser Ser Ser Ser Gly Ser His Arg Pro Pro Arg Pro Ala
Ser Ser Glu Ser Ala Leu Pro Pro Ala Ala Ala Ala Ala Glu Glu Leu
Ser Ser Tyr Glu Ala Ala Cys Arg Ser Asp Pro Glu Leu Arg Thr Phe
Asp Thr Thr Leu Gln Arg Arg Thr Ser Arg Ala Ile Ser Thr Leu Ala
Val Gly Val Glu Val Arg Ser Leu Ser Leu Glu Ser Leu Arg Glu Val
Thr Gly Cys Leu Leu Asp Met Asn Gln Glu Val Val Arg Val Ile Leu
Asp Cys Lys Lys Asp Ile Trp Lys Ser Pro Glu Leu Phe Asp Leu Val
Glu Asp Tyr Phe Glu Ser Ser Leu His Thr Leu Asp Phe Cys Thr Ala
Leu Asp Lys Cys Leu Lys Arg Ala Arg Asp Ser Gln Leu Leu Leu His
Val Ala Leu Gln Arg Phe Asp Asp Glu Glu Asp Asn Asp Ala Ala Ala
Ala Gly Gln Glu Asp Ala Ala Pro Ser Ala Arg Tyr Ala Arg Thr Leu
His Glu Leu Arg Gln Phe Lys Ala Ala Gly Asp Pro PheThr Glu Glu
Phe Phe Ser Ala Phe Gln Ala Val Tyr Arg Gln Gln Leu Thr Met Leu
Glu Lys Leu Gln Gln Arg Lys His Arg Leu Asp Lys Lys Val Arg Ala
Ile Lys Ala Trp Arg Arg Val Ser Ser Ile Ile Phe Ala Thr Thr Phe
Ala Ala Val Leu Ile Cys Ser Val Val Ala Ala Ala Ile Ala Ala Pro
Pro Val Ala Ala Ala Leu Ala Ala Ala Ala Ser Ile Pro Val Gly Ser
Met Gly Lys Trp Ile Asp Ser Leu Leu Lys Gly Tyr Gln Asp Ala Leu
Arg Gly Gln Lys Glu Val Val Ser Ala Met Gln Val Gly Thr Phe Ile
Ala Ile Lys Asp Leu Asp Ser Ile Arg Val Leu Ile Asn Arg Val Glu
Leu Glu Ile Ser Ser Met Ile Asp Cys Val Glu Phe Ala Glu Arg Asp
Glu Glu Ala Val Lys Phe Gly Val Glu Glu Ile Lys Lys Lys Leu Glu
Val Phe Met Lys Ser Val Glu Asp Leu Gly Glu Gln Ala Asp Arg Cys
Ser Arg Asp Ile Arg Arg Ala Arg Thr Val Val Leu Gln Arg Ile Ile
Arg His Pro Ser
。
in the rice osmotic stress response protein OsU496A, the coding gene nucleotide sequence is SEQ ID No. 2, and the SEQ ID No. 2 is:
atggggaacagcagcagcagcggcagccaccggcctccccggccggcgagctcggagtcg
gcgctgccgcccgcggcggcggcggcggaggagctgagctcgtacgaggcggcgtgccga
tcagacccggagctgcgcacgttcgacaccacgctgcagcggcgcacgagccgcgccatc
tcgacgctggcggtgggcgtggaggtgcgttcgctgtccctcgagtccctccgcgaggtc
accggctgcctcctcgacatgaaccaggaggtggtgcgcgtcatcctcgactgcaagaag
gacatctggaagagccccgagctgttcgacctcgtcgaggactacttcgagagcagcctc
cacaccctcgacttctgcaccgcactcgacaagtgcctcaagcgcgcccgcgactcccag
ctcctcctgcacgtcgcgctccagcggttcgacgacgaggaggacaacgacgccgccgcc
gccggccaggaggacgccgctccctccgcccggtacgcgcgcacgctccacgagctgcgc
cagttcaaggcggccggggaccccttcaccgaggagttcttcagcgccttccaggccgtg
taccggcagcagctgaccatgctggagaagctgcagcagcgcaaacaccggctcgacaag
aaggtcagggcgatcaaggcgtggcgccgtgtgtcgagcatcatcttcgccaccaccttc
gcggccgtgctcatctgctcggtggttgccgcggccatcgctgccccaccagtcgcggcg
gcattggccgcagctgcttccattccggtgggatctatggggaagtggatcgattctcta
ctgaaagggtatcaggacgctctccgtggacagaaggaggtggtgagcgcaatgcaggtg
gggacgttcattgccatcaaggatttggacagtatcagggtgctcatcaaccgggtggag
ttggagatcagctcgatgatcgactgcgtagagttcgctgagcgagatgaggaggcggtc
aagtttggggttgaggagatcaagaagaagctggaggtcttcatgaagagtgtagaggat
ctaggagagcaggcagatcggtgtagccgggatattcgtcgggcaaggaccgtcgtgcta
cagagaatcatccggcatcctagctga
。
the physiological indexes comprise relative water content, water loss rate of in-vitro leaves, proline content, soluble sugar content, malondialdehyde content, hydrogen peroxide content and antioxidant enzyme activity, and the antioxidant enzyme comprises: SOD, CAT, POD, APX.
The improvement of the osmotic stress capability is shown in that under osmotic stress, the plants show a lighter wilting degree and a better growth state after the expression level of the encoding gene of the rice osmotic stress response protein OsU496A is reduced.
The method is advanced and scientific, and in the invention, the osmotic stress response protein OsU496A (full name UPF0496 protein 1, coding gene number: LOC _ Os03g10240) is derived from Oryzasativa Japonica group. Has one of the following amino acid residue sequences:
(1)SEQIDNo:1；
(2) the protein which has the amino acid residue sequence of SEQ ID No. 1 through editing and has the function of regulating and controlling the growth and development of plants.
SEQ ID No. 1 in the sequence table consists of 388 amino acid residues.
The rice osmotic stress response protein has the coding gene comprising one of the following nucleotide sequences:
(1) 2 nucleotide sequence of SEQ ID No;
(2) a nucleotide sequence of SEQ ID No. 3;
(3) a nucleotide sequence which is edited on the basis of the nucleotide sequence of SEQ ID No. 2 and the nucleotide sequence of SEQ ID No. 3 and has a regulating effect on the growth and development of plants;
(4) nucleotide sequence with more than 90% homology with SEQ ID No. 2 nucleotide sequence and coding protein with same function.
According to the invention, OsU496A recombinant expression vector is constructed, and the gene is transformed genetically to obtain the interference expression plant and over-expression plant of the gene. The obtained transgenic plants were treated with 50mM mannitol and found to show an increase in the relative water content, the content of osmotically protected solutes, the activity of antioxidases interfering with the expression strain, a decrease in the water loss rate and the hydrogen peroxide content of the leaves in vitro, and the opposite result in the overexpression strain, compared to the wild type plants. The results show that the gene participates in osmotic stress response, is an important gene for responding osmotic stress to rice, can improve physiological indexes of rice plants under osmotic stress by down-regulating the expression of the gene, obviously improves the tolerance of the rice to the osmotic stress, and plays an important role in research on a rice stress-resistant mechanism and cultivation of stress-resistant crops.
The invention has the beneficial effects that:
(1) the osmotic stress response protein OsU496A of rice related by the invention is induced and expressed by osmotic stress, which shows that the protein has the function of osmotic stress response, can be applied to osmotic genetic breeding of crops, provides more high-quality resources for breeding of crop varieties, and has great significance for crop improvement.
(2) The rice osmotic stress response gene OsU496A is applied to plant genetic engineering to obtain rice transgenic plants of OsU496A which are overexpressed and interfered, the stress resistance of the interfered expression plant system under osmotic stress environment is obviously superior to that of wild type and overexpressed plants, the gene is proved to participate in the physiological response process of rice to osmotic stress, new gene resources are provided for crop variety improvement, and the application value is very high.
Drawings
FIG. 1 is a map of pTCK303 vector of the present invention;
FIG. 2 is a phenotype plot of 17 days after 50mM mannitol treatment of RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants of the invention;
FIG. 3 is a graph showing the rate of water loss from leaves ex vivo in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress in accordance with the present invention.
FIG. 4 is a graph of the relative water content in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the relative water content in the leaf; b is the relative water content in the root;
FIG. 5 shows the proline content in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the proline content in the leaves; b is the proline content in the root;
FIG. 6 shows soluble sugar content in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the soluble sugar content in the leaves; b is the soluble sugar content in the root;
FIG. 7 shows malondialdehyde levels in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the malondialdehyde content in the leaves; b is the malondialdehyde content in the root;
FIG. 8 shows the hydrogen peroxide content in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the hydrogen peroxide content in the leaves; b is the hydrogen peroxide content in the root;
FIG. 9 shows SOD activity in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is SOD activity in leaves; b is the SOD activity in the roots;
FIG. 10 shows CAT activity in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is CAT activity in leaves; b is CAT activity in the roots;
FIG. 11 shows POD activity in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is POD activity in leaves; b is POD activity in roots;
FIG. 12 shows APX activity in RNAi-OsU496A, wild type and OX-OsU496A transgenic rice plants under osmotic stress according to the invention. A is the APX activity in leaves; b is the APX activity in the roots.
Detailed Description
The embodiments of the present invention will be described in detail with reference to the accompanying drawings so that the advantages and features of the present invention can be more clearly understood and appreciated by those skilled in the art, and the scope of the present invention is not limited in any way.
Example 1: construction of OsU496A gene interference expression vector and overexpression vector.
1.1 constructing OsU496A gene interference expression vector;
OsU496A the interfering expression vector is constructed by connecting a segment of the sequence SEQ ID No. 4 in the opposite direction of each end of the vector intron. The specific method comprises the following steps: designing a specific amplification primer with a target sequence of SEQ ID No. 4, wherein SacI and SpeI enzyme cutting sites are added at the tail end of the primer, and the primer sequences are F:5'-GGTACCACTAGTAGCAGCCTCCACACCCTCG-3' and R:5'-GGATCCGAGCTCTCGATCCACTTCCCCATA-3' respectively. Total RNA of rice leaves was extracted using a plant RNA extraction kit from Kangji century Co. The total RNA of the rice leaf is obtained according to the Reveraid of the holo-type gold companyTMThe product specification of the first StrandcDNASynthesisKit is subjected to reverse transcription to obtain the first strand cDNA of the rice leaf. The interfering fragment was amplified using the above primers using cDNA as a template. The plasmid was ligated with pMD19-T vector to pMD19-T-iU496A, and then pMD19-T-iU496A and empty vector pTCK303 plasmid were digested simultaneously with SacI and speI (see FIG. 1 for vector map). The enzyme digestion product is recovered by an agarose gel DNA recovery kit of Tiangen company after electrophoresis, the interference fragment enzyme digestion product and the pTCK303 plasmid enzyme digestion product are respectively recovered according to the product instruction, the recovered interference target fragment and the pTCK303 plasmid vector fragment are connected by T4-DNA ligase overnight and then are transformed into Trans 5 alpha competent cells, and the specific steps are as follows:
(a) adding 10 mu L of recombinant plasmid into 100 mu L LTrans 5 alpha competent cells, and slightly mixing uniformly;
(b) placing in ice bath for 30 min;
(c) heat shock is carried out for 45s in water bath at 42 ℃;
(d) quickly transferring into an ice bath and standing for 2min without shaking a centrifuge tube in the process;
(e) adding 500 μ L sterile liquid LB culture medium, culturing at 37 deg.C/200 rpm for 1 h;
(f) adding 200 mu L of cultured bacterial liquid to an LB solid culture medium containing kanamycin, and uniformly spreading;
(g) inverting the plate, and culturing overnight at 37 ℃;
identifying and screening single colonies containing recombinant plasmids, extracting an intermediate vector containing an i-U496A target segment by using an AxyPrep plasmid DNA small-scale kit of Axygen company after amplification culture, naming the intermediate vector as pTCK303-iU496A1, simultaneously double-digesting the recombinant vector pMD19-T-iU496A plasmid and the intermediate vector pTCK303-iU496A1 plasmid by using BamH I and Kpn I, respectively recovering an interference fragment of the pMD19-T-iU496A plasmid digestion product and the pTCK303-iU496A1 plasmid digestion product, connecting by T4-DNA ligase, transforming Trans 5 alpha competent cells, identifying and screening the recombinant plasmids, and obtaining an interference expression vector pTCK303-iU496A containing positive and negative RNAi target segments.
1.2 constructing OsU496A gene over-expression vector;
a primer for amplifying the coding region sequence of OsU496A gene, namely SEQIDNo:3 is designed, BamH I and SpeI enzyme cutting sites are added at the tail end of the primer, and the primer sequences are F:5'-GGATCCATGGGGAACAGCAGCA-3' and R:5'-ACTAGTTCAGCTAGGATGCCGGATGA-3' respectively. The cDNA was used as a template, the full length of the coding region was obtained by amplification using the above primers, and the cDNA was obtained from the same
Figure BDA0002712294710000051
TA cloning is carried out on a T1 cloning kit product, then BamH I and Spe I are used for double enzyme digestion, simultaneously, empty vector pTCK303 plasmid is subjected to double enzyme digestion, enzyme digestion products are respectively recovered after electrophoresis, the recovered OsU496A target fragment and pTCK303 plasmid vector fragment are subjected to overnight connection by T4-DNA ligase and then transformed into Trans 5 alpha competent cells, and recombinant plasmid is identified and screened out, so as to obtain a recombinant over-expression vector pTCK303-0sU496A containing OsU496A target fragment.
Example 2: interfering with the expression of pTCK303-iU496A and overexpressing pTCK303-0sU496A recombinant vectors to transform rice plants;
after verifying and confirming that the constructed recombinant vectors interfering expression pTCK303-iU496A and overexpression pTCK303-0sU496A are correct, transferring the recombinant vectors into agrobacterium EHA105, and specifically comprising the following steps:
(a) adding 2 mu L of recombinant plasmid into 100 mu L of agrobacterium tumefaciens competence, and slightly mixing;
(b) standing on ice for 5 min;
(c) immersing in liquid nitrogen for 5 min;
(d) water bath at 37 deg.C for 5 min;
(e) standing on ice for 5 min;
(f) adding 700 μ L liquid LB culture medium, shaking at 28 deg.C/200 rpm for 2-3 h;
(g) coating 200 mu L of bacterial liquid on an LB plate containing kanamycin and rifampicin;
(h) placing upside down in 28 deg.C incubator for 2-3 days.
And respectively transforming the recombinant plasmids into rice plants by an agrobacterium EHA105 mediated genetic transformation method to finally obtain stably expressed RNAi-OsU496A and OX-OsU496A transgenic rice materials.
Example 3: OsU496A interfere with phenotypic analysis of expression and overexpression lines under osmotic stress;
consistent germination RNAi-OsU496A, wild type and OX-OsU496A seeds were cultured in IRRI nutrient solution for 10 days and then treated with 50mM mannitol solution. After treatment, the phenotype of each strain is obviously different, the wilting degree of the RNAi-OsU496A strain is obviously less than that of the wild type and over-expression, wherein the wilting degree of the over-expression strain is the most serious, and the osmotic stress resistance of the interference expression strain is better than that of the wild type, and the wild type is better than that of the over-expression strain (figure 2).
Example 4: the influence of osmotic stress on the water-retaining capacity and the osmotic protective solute of each strain of rice seedlings;
4.1 the influence of osmotic stress on the relative water content of each strain of rice seedlings and the water loss rate of the leaves in vitro;
the water loss rate and relative water content of each of OsU496A transgenic rice seedlings were measured 2 days after treatment of 10-day-old seedlings with 50mM mannitol solution as in example 3.1. The water loss rate and the relative water content of the isolated leaves among seedlings of each line of the control group have no obvious difference, and after treatment, the water loss rate and the relative water content of the isolated leaves among seedlings of each line are reduced to different degrees (figure 3 and figure 4). Compared with the wild type, the relative water content of the interference strain seedlings is higher than that of the wild type, the water loss rate of the leaves in vitro is lower than that of the wild type, the over-expression strain is opposite, and the relative water content among the strains achieves obvious difference, which shows that the water retention capacity of the rice seedlings can be enhanced by the down-regulation of OsU 496A.
4.2 influence of osmotic stress on the content of osmotically protected solutes of the rice seedlings of each strain;
the culture and treatment method is the same as the embodiment 4.1, under the normal growth condition, the proline content in the leaves and roots of the interference strain seedlings is higher than that of the wild type and the over-expression strain, after treatment, the proline content in the leaves and roots of the rice seedlings of each strain line is increased in different ranges, the increase range of the proline content in the leaves and roots of the interference strain seedlings is larger than that of the wild type, and the over-expression strain is lower than that of the wild type (figure 5). At the same time, the content of soluble sugar in seedlings of each line is determined, and the change trend of the content of proline is the same as the change trend of the content of proline (figure 6), and the OsU496A is further verified to improve the osmotic stress resistance by increasing the content of osmoprotective solute in the seedlings.
Example 5: influence of osmotic stress on the oxidation resistance and the membrane oxidation degree of each strain of rice seedlings;
5.1 the influence of osmotic stress on the malondialdehyde content and the active oxygen content of each strain of rice seedlings;
the culture and treatment method is the same as the embodiment 4.1, after treatment, the malonaldehyde content in the leaves and roots of the seedling of the overexpression strain is the largest, the malonaldehyde content is obviously higher than that of the wild type and the interference strain, the interference strain is the smallest and obviously smaller than that of the wild type, and no obvious difference exists under the control condition (figure 7). The change trend of the hydrogen peroxide content in the roots and leaves of each line seedling after the control group and the mannitol treatment is the same as that of the malondialdehyde content (figure 8).
5.2 influence of osmotic stress on the antioxidant enzyme activity of each strain of rice seedlings;
the culture and treatment method is the same as that of embodiment 4.1, after treatment, SOD enzyme activities in roots and leaves of seedlings of each strain show consistent rising trend, SOD enzyme activities in roots of seedlings of interfering strains are higher than those of wild types, the wild types are higher than those of over-expression, and the interfering expression strains and the wild types all achieve obvious difference (figure 9). In addition, the change rule of the activities of POD enzyme, CAT enzyme and APX enzyme in roots and leaves of the seedlings of each line after the treatment of mannitol is similar to that of SOD enzyme, and the activities are expressed as that of an interference expression line which is the highest, a wild type which is the second lowest and an overexpression line which is the lowest (figure 10, figure 11 and figure 12).
The results prove that OsU496A can negatively regulate the response process of rice to osmotic stress on phenotype and physiological level, namely inhibition of OsU496A expression can enhance the osmotic stress resistance of rice, and has important significance for explaining the mechanism of the osmotic stress resistance of the rice and improving the variety of crops.
SEQIDNo:4
agcagcctccacaccctcgacttctgcaccgcactcgacaagtgcctcaagcgcgcccgc
gactcccagctcctcctgcacgtcgcgctccagcggttcgacgacgaggaggacaacgac
gccgccgccgccggccaggaggacgccgctccctccgcccggtacgcgcgcacgctccac
gagctgcgccagttcaaggcggccggggaccccttcaccgaggagttcttcagcgccttc
caggccgtgtaccggcagcagctgaccatgctggagaagctgcagcagcgcaaacaccgg
ctcgacaagaaggtcagggcgatcaaggcgtggcgccgtgtgtcgagcatcatcttcgcc
accaccttcgcggccgtgctcatctgctcggtggttgccgcggccatcgctgccccacca
gtcgcggcggcattggccgcagctgcttccattccggtgggatctatggggaagtggatc
ga
。
Sequence listing
<110> Yangzhou university
<120> rice osmotic stress response protein, method for improving rice osmotic stress resistance and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 388
<212> PRT
<213> Oryza sativa (Oryza sativa)
<400> 1
Met Gly Asn Ser Ser Ser Ser Gly Ser His Arg Pro Pro Arg Pro Ala
1 5 10 15
Ser Ser Glu Ser Ala Leu Pro Pro Ala Ala Ala Ala Ala Glu Glu Leu
20 25 30
Ser Ser Tyr Glu Ala Ala Cys Arg Ser Asp Pro Glu Leu Arg Thr Phe
35 40 45
Asp Thr Thr Leu Gln Arg Arg Thr Ser Arg Ala Ile Ser Thr Leu Ala
50 55 60
Val Gly Val Glu Val Arg Ser Leu Ser Leu Glu Ser Leu Arg Glu Val
65 70 75 80
Thr Gly Cys Leu Leu Asp Met Asn Gln Glu Val Val Arg Val Ile Leu
85 90 95
Asp Cys Lys Lys Asp Ile Trp Lys Ser Pro Glu Leu Phe Asp Leu Val
100 105 110
Glu Asp Tyr Phe Glu Ser Ser Leu His Thr Leu Asp Phe Cys Thr Ala
115 120 125
Leu Asp Lys Cys Leu Lys Arg Ala Arg Asp Ser Gln Leu Leu Leu His
130 135 140
Val Ala Leu Gln Arg Phe Asp Asp Glu Glu Asp Asn Asp Ala Ala Ala
145 150 155 160
Ala Gly Gln Glu Asp Ala Ala Pro Ser Ala Arg Tyr Ala Arg Thr Leu
165 170 175
His Glu Leu Arg Gln Phe Lys Ala Ala Gly Asp Pro Phe Thr Glu Glu
180 185 190
Phe Phe Ser Ala Phe Gln Ala Val Tyr Arg Gln Gln Leu Thr Met Leu
195 200 205
Glu Lys Leu Gln Gln Arg Lys His Arg Leu Asp Lys Lys Val Arg Ala
210 215 220
Ile Lys Ala Trp Arg Arg Val Ser Ser Ile Ile Phe Ala Thr Thr Phe
225 230 235 240
Ala Ala Val Leu Ile Cys Ser Val Val Ala Ala Ala Ile Ala Ala Pro
245 250 255
Pro Val Ala Ala Ala Leu Ala Ala Ala Ala Ser Ile Pro Val Gly Ser
260 265 270
Met Gly Lys Trp Ile Asp Ser Leu Leu Lys Gly Tyr Gln Asp Ala Leu
275 280 285
Arg Gly Gln Lys Glu Val Val Ser Ala Met Gln Val Gly Thr Phe Ile
290 295 300
Ala Ile Lys Asp Leu Asp Ser Ile Arg Val Leu Ile Asn Arg Val Glu
305 310 315 320
Leu Glu Ile Ser Ser Met Ile Asp Cys Val Glu Phe Ala Glu Arg Asp
325 330 335
Glu Glu Ala Val Lys Phe Gly Val Glu Glu Ile Lys Lys Lys Leu Glu
340 345 350
Val Phe Met Lys Ser Val Glu Asp Leu Gly Glu Gln Ala Asp Arg Cys
355 360 365
Ser Arg Asp Ile Arg Arg Ala Arg Thr Val Val Leu Gln Arg Ile Ile
370 375 380
Arg His Pro Ser
385
<210> 2
<211> 2251
<212> DNA
<213> Oryza sativa (Oryza sativa)
<400> 2
ccacgccaaa gtgccaaaca ctcccccact ctctccctct ctctctctct ctctcgccaa 60
aagctttggt tgcttgctcg cttcacccaa acaaactcat cgatccgggc aaaaacacgc 120
gcaaatcgct gtgctacacc tcctcgcgtt cgctcgctac agcgcaccac atccacacac 180
acgctcccag ccccagcgat cgatggagtg agacgcatca ggttgcttcc ggcgacggcc 240
attgccgcct ccctctccct ccctccgccc gcgcgccgcc acaccccccc atcgcttctt 300
cctttcgtca tgcgtacaag ccatccccac atcaccacca ccacctcgcc tgacaacagc 360
agcaggagcg acgctccaca aaaccacccc ccaaatccct ccgtcccgta gcgcctacta 420
cccccgcctc ctgcattctt ctccttgctt ctccgtaacc tcgcgctttc ttggccgctt 480
cgcccgcgac gcaacggggg ggagaggcct tcctccgttt ccttggatag gataaagctc 540
gcggatctcc gctcaatcca gttcttcatt ctcctctccc ggttctgttc ttggttcttg 600
gaaagccggt ggggtgcggg tggctcgtgg cgatcagtgc tcgctcgttt gatccatcct 660
agttgctgag acgtttcgtt tcttgatctt ggtgttactt tccccaaaaa tccaatacaa 720
agatccggtg gaggtctgat ctgtgagcga cgcctgcccg gtttccttcc ggcaatgggg 780
aacagcagca gcagcggcag ccaccggcct ccccggccgg cgagctcgga gtcggcgctg 840
ccgcccgcgg cggcggcggc ggaggagctg agctcgtacg aggcggcgtg ccgatcagac 900
ccggagctgc gcacgttcga caccacgctg cagcggcgca cgagccgcgc catctcgacg 960
ctggcggtgg gcgtggaggt gcgttcgctg tccctcgagt ccctccgcga ggtcaccggc 1020
tgcctcctcg acatgaacca ggaggtggtg cgcgtcatcc tcgactgcaa gaaggacatc 1080
tggaagagcc ccgagctgtt cgacctcgtc gaggactact tcgagagcag cctccacacc 1140
ctcgacttct gcaccgcact cgacaagtgc ctcaagcgcg cccgcgactc ccagctcctc 1200
ctgcacgtcg cgctccagcg gttcgacgac gaggaggaca acgacgccgc cgccgccggc 1260
caggaggacg ccgctccctc cgcccggtac gcgcgcacgc tccacgagct gcgccagttc 1320
aaggcggccg gggacccctt caccgaggag ttcttcagcg ccttccaggc cgtgtaccgg 1380
cagcagctga ccatgctgga gaagctgcag cagcgcaaac accggctcga caagaaggtc 1440
agggcgatca aggcgtggcg ccgtgtgtcg agcatcatct tcgccaccac cttcgcggcc 1500
gtgctcatct gctcggtggt tgccgcggcc atcgctgccc caccagtcgc ggcggcattg 1560
gccgcagctg cttccattcc ggtgggatct atggggaagt ggatcgattc tctactgaaa 1620
gggtatcagg acgctctccg tggacagaag gaggtggtga gcgcaatgca ggtggggacg 1680
ttcattgcca tcaaggattt ggacagtatc agggtgctca tcaaccgggt ggagttggag 1740
atcagctcga tgatcgactg cgtagagttc gctgagcgag atgaggaggc ggtcaagttt 1800
ggggttgagg agatcaagaa gaagctggag gtcttcatga agagtgtaga ggatctagga 1860
gagcaggcag atcggtgtag ccgggatatt cgtcgggcaa ggaccgtcgt gctacagaga 1920
atcatccggc atcctagctg aaaaaaaaaa ggaaaaagag agaggaagga tgcaaggaat 1980
ttggtgatgg cgatgcactt gaaagggtct atgacctaga caagcaagca aacgatgtga 2040
tcagtggcct aaagcaacaa ataatgctgt cagacttctg tgagccatca ctattactga 2100
ctttatttat cacctgtcct gatctccata gtttatcaat gtgtttggcg ttctgttttt 2160
cgtttgattt tattcattac ctcactttaa tctcctatgg ggtacatctt tgaaagtttc 2220
aatcaataat aatccaattt gctgtgctca a 2251
<210> 3
<211> 1167
<212> DNA
<213> Oryza sativa (Oryza sativa)
<400> 3
atggggaaca gcagcagcag cggcagccac cggcctcccc ggccggcgag ctcggagtcg 60
gcgctgccgc ccgcggcggc ggcggcggag gagctgagct cgtacgaggc ggcgtgccga 120
tcagacccgg agctgcgcac gttcgacacc acgctgcagc ggcgcacgag ccgcgccatc 180
tcgacgctgg cggtgggcgt ggaggtgcgt tcgctgtccc tcgagtccct ccgcgaggtc 240
accggctgcc tcctcgacat gaaccaggag gtggtgcgcg tcatcctcga ctgcaagaag 300
gacatctgga agagccccga gctgttcgac ctcgtcgagg actacttcga gagcagcctc 360
cacaccctcg acttctgcac cgcactcgac aagtgcctca agcgcgcccg cgactcccag 420
ctcctcctgc acgtcgcgct ccagcggttc gacgacgagg aggacaacga cgccgccgcc 480
gccggccagg aggacgccgc tccctccgcc cggtacgcgc gcacgctcca cgagctgcgc 540
cagttcaagg cggccgggga ccccttcacc gaggagttct tcagcgcctt ccaggccgtg 600
taccggcagc agctgaccat gctggagaag ctgcagcagc gcaaacaccg gctcgacaag 660
aaggtcaggg cgatcaaggc gtggcgccgt gtgtcgagca tcatcttcgc caccaccttc 720
gcggccgtgc tcatctgctc ggtggttgcc gcggccatcg ctgccccacc agtcgcggcg 780
gcattggccg cagctgcttc cattccggtg ggatctatgg ggaagtggat cgattctcta 840
ctgaaagggt atcaggacgc tctccgtgga cagaaggagg tggtgagcgc aatgcaggtg 900
gggacgttca ttgccatcaa ggatttggac agtatcaggg tgctcatcaa ccgggtggag 960
ttggagatca gctcgatgat cgactgcgta gagttcgctg agcgagatga ggaggcggtc 1020
aagtttgggg ttgaggagat caagaagaag ctggaggtct tcatgaagag tgtagaggat 1080
ctaggagagc aggcagatcg gtgtagccgg gatattcgtc gggcaaggac cgtcgtgcta 1140
cagagaatca tccggcatcc tagctga 1167
<210> 4
<211> 482
<212> DNA
<213> Oryza sativa (Oryza sativa)
<400> 4
agcagcctcc acaccctcga cttctgcacc gcactcgaca agtgcctcaa gcgcgcccgc 60
gactcccagc tcctcctgca cgtcgcgctc cagcggttcg acgacgagga ggacaacgac 120
gccgccgccg ccggccagga ggacgccgct ccctccgccc ggtacgcgcg cacgctccac 180
gagctgcgcc agttcaaggc ggccggggac cccttcaccg aggagttctt cagcgccttc 240
caggccgtgt accggcagca gctgaccatg ctggagaagc tgcagcagcg caaacaccgg 300
ctcgacaaga aggtcagggc gatcaaggcg tggcgccgtg tgtcgagcat catcttcgcc 360
accaccttcg cggccgtgct catctgctcg gtggttgccg cggccatcgc tgccccacca 420
gtcgcggcgg cattggccgc agctgcttcc attccggtgg gatctatggg gaagtggatc 480
ga 482

Claims (5)

1. The application of the rice osmotic stress response protein OsU496A in improving the osmotic stress resistance of rice is characterized in that: firstly, introducing an interference expression vector containing a specific fragment of a positive and negative RNAi rice osmotic stress response protein OsU496A coding gene into rice cells, tissues or organs to reduce the expression quantity of the rice osmotic stress response protein OsU496A coding gene in the rice cells, tissues or organs, then culturing the rice cells, tissues or organs into plants to reduce the expression quantity of the rice osmotic stress response protein OsU496A coding gene, and obtaining the rice with good physiological indexes and improved osmotic stress resistance under osmotic stress.
2. Use according to claim 1, characterized in that: the rice osmotic stress response protein OsU496A is derived fromOryzasativaJaponicaGroup; has one of the following amino acid residue sequences:
(1)SEQIDNo:1；
(2) a protein which is edited by the amino acid residue sequence of SEQ ID No. 1 and has a regulating effect on the growth and development of plants;
SEQ ID No. 1 consists of 388 amino acid residues;
SEQ ID No. 1 is:
Met Gly Asn Ser Ser Ser Ser Gly Ser His Arg Pro Pro Arg Pro Ala
Ser Ser Glu Ser Ala Leu Pro Pro Ala Ala Ala Ala Ala Glu Glu Leu
Ser Ser Tyr Glu Ala Ala Cys Arg Ser Asp Pro Glu Leu Arg Thr Phe
Asp Thr Thr Leu Gln Arg Arg Thr Ser Arg Ala Ile Ser Thr Leu Ala
Val Gly Val Glu Val Arg Ser Leu Ser Leu Glu Ser Leu Arg Glu Val
Thr Gly Cys Leu Leu Asp Met Asn Gln Glu Val Val Arg Val Ile Leu
Asp Cys Lys Lys Asp Ile Trp Lys Ser Pro Glu Leu Phe Asp Leu Val
Glu Asp Tyr Phe Glu Ser Ser Leu His Thr Leu Asp Phe Cys Thr Ala
Leu Asp Lys Cys Leu Lys Arg Ala Arg Asp Ser Gln Leu Leu Leu His
Val Ala Leu Gln Arg Phe Asp Asp Glu Glu Asp Asn Asp Ala Ala Ala
Ala Gly Gln Glu Asp Ala Ala Pro Ser Ala Arg Tyr Ala Arg Thr Leu
His Glu Leu Arg Gln Phe Lys Ala Ala Gly Asp Pro PheThr Glu Glu
Phe Phe Ser Ala Phe Gln Ala Val Tyr Arg Gln Gln Leu Thr Met Leu
Glu Lys Leu Gln Gln Arg Lys His Arg Leu Asp Lys Lys Val Arg Ala
Ile Lys Ala Trp Arg Arg Val Ser Ser Ile Ile Phe Ala Thr Thr Phe
Ala Ala Val Leu Ile Cys Ser Val Val Ala Ala Ala Ile Ala Ala Pro
Pro Val Ala Ala Ala Leu Ala Ala Ala Ala Ser Ile Pro Val Gly Ser
Met Gly Lys Trp Ile Asp Ser Leu Leu Lys Gly Tyr Gln Asp Ala Leu
Arg Gly Gln Lys Glu Val Val Ser Ala Met Gln Val Gly Thr Phe Ile
Ala Ile Lys Asp Leu Asp Ser Ile Arg Val Leu Ile Asn Arg Val Glu
Leu Glu Ile Ser Ser Met Ile Asp Cys Val Glu Phe Ala Glu Arg Asp
Glu Glu Ala Val Lys Phe Gly Val Glu Glu Ile Lys Lys Lys Leu Glu
Val Phe Met Lys Ser Val Glu Asp Leu Gly Glu Gln Ala Asp Arg Cys
Ser Arg Asp Ile Arg Arg Ala Arg Thr Val Val Leu Gln Arg Ile Ile
Arg His Pro Ser
。
3. use according to claim 1, characterized in that: in the rice osmotic stress response protein OsU496A, the coding gene nucleotide sequence comprises one of the following nucleotide sequences:
(1) 2 nucleotide sequence of SEQ ID No;
(2) a nucleotide sequence of SEQ ID No. 3;
(3) a nucleotide sequence which is edited on the basis of the nucleotide sequence of SEQ ID No. 2 and the nucleotide sequence of SEQ ID No. 3 and has a regulating effect on the growth and development of plants;
(4) a nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of SEQ ID No. 2 and encodes protein with the same function;
SEQ ID No. 2 is:
atggggaacagcagcagcagcggcagccaccggcctccccggccggcgagctcggagtcg
gcgctgccgcccgcggcggcggcggcggaggagctgagctcgtacgaggcggcgtgccga
tcagacccggagctgcgcacgttcgacaccacgctgcagcggcgcacgagccgcgccatc
tcgacgctggcggtgggcgtggaggtgcgttcgctgtccctcgagtccctccgcgaggtc
accggctgcctcctcgacatgaaccaggaggtggtgcgcgtcatcctcgactgcaagaag
gacatctggaagagccccgagctgttcgacctcgtcgaggactacttcgagagcagcctc
cacaccctcgacttctgcaccgcactcgacaagtgcctcaagcgcgcccgcgactcccag
ctcctcctgcacgtcgcgctccagcggttcgacgacgaggaggacaacgacgccgccgcc
gccggccaggaggacgccgctccctccgcccggtacgcgcgcacgctccacgagctgcgc
cagttcaaggcggccggggaccccttcaccgaggagttcttcagcgccttccaggccgtg
taccggcagcagctgaccatgctggagaagctgcagcagcgcaaacaccggctcgacaag
aaggtcagggcgatcaaggcgtggcgccgtgtgtcgagcatcatcttcgccaccaccttc
gcggccgtgctcatctgctcggtggttgccgcggccatcgctgccccaccagtcgcggcg
gcattggccgcagctgcttccattccggtgggatctatggggaagtggatcgattctcta
ctgaaagggtatcaggacgctctccgtggacagaaggaggtggtgagcgcaatgcaggtg
gggacgttcattgccatcaaggatttggacagtatcagggtgctcatcaaccgggtggag
ttggagatcagctcgatgatcgactgcgtagagttcgctgagcgagatgaggaggcggtc
aagtttggggttgaggagatcaagaagaagctggaggtcttcatgaagagtgtagaggat
ctaggagagcaggcagatcggtgtagccgggatattcgtcgggcaaggaccgtcgtgcta
cagagaatcatccggcatcctagctga
；
SEQ ID No. 3 is:
atggggaacagcagcagcagcggcagccaccggcctccccggccggcgagctcggagtcg
gcgctgccgcccgcggcggcggcggcggaggagctgagctcgtacgaggcggcgtgccga
tcagacccggagctgcgcacgttcgacaccacgctgcagcggcgcacgagccgcgccatc
tcgacgctggcggtgggcgtggaggtgcgttcgctgtccctcgagtccctccgcgaggtc
accggctgcctcctcgacatgaaccaggaggtggtgcgcgtcatcctcgactgcaagaag
gacatctggaagagccccgagctgttcgacctcgtcgaggactacttcgagagcagcctc
cacaccctcgacttctgcaccgcactcgacaagtgcctcaagcgcgcccgcgactcccag
ctcctcctgcacgtcgcgctccagcggttcgacgacgaggaggacaacgacgccgccgcc
gccggccaggaggacgccgctccctccgcccggtacgcgcgcacgctccacgagctgcgc
cagttcaaggcggccggggaccccttcaccgaggagttcttcagcgccttccaggccgtg
taccggcagcagctgaccatgctggagaagctgcagcagcgcaaacaccggctcgacaag
aaggtcagggcgatcaaggcgtggcgccgtgtgtcgagcatcatcttcgccaccaccttc
gcggccgtgctcatctgctcggtggttgccgcggccatcgctgccccaccagtcgcggcg
gcattggccgcagctgcttccattccggtgggatctatggggaagtggatcgattctcta
ctgaaagggtatcaggacgctctccgtggacagaaggaggtggtgagcgcaatgcaggtg
gggacgttcattgccatcaaggatttggacagtatcagggtgctcatcaaccgggtggag
ttggagatcagctcgatgatcgactgcgtagagttcgctgagcgagatgaggaggcggtc
aagtttggggttgaggagatcaagaagaagctggaggtcttcatgaagagtgtagaggat
ctaggagagcaggcagatcggtgtagccgggatattcgtcgggcaaggaccgtcgtgcta
cagagaatcatccggcatcctagctga
。
4. the use of claim 1, wherein the physiological parameters include relative water content, rate of water loss from leaves ex vivo, proline content, soluble sugars content, malondialdehyde content, hydrogen peroxide content, and antioxidant enzyme activity, and the antioxidant enzymes include: SOD, CAT, POD, APX.
5. The use according to claim 1, wherein the improvement of the osmotic stress capability is shown in that the plants show a lighter wilting degree and a better growth state after the expression level of the gene encoding the rice osmotic stress response protein OsU496A is reduced under osmotic stress.
CN202011060584.3A 2020-09-30 2020-09-30 Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice Pending CN112142834A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011060584.3A CN112142834A (en) 2020-09-30 2020-09-30 Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011060584.3A CN112142834A (en) 2020-09-30 2020-09-30 Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice

Publications (1)

Publication Number Publication Date
CN112142834A true CN112142834A (en) 2020-12-29

Family

ID=73951291

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011060584.3A Pending CN112142834A (en) 2020-09-30 2020-09-30 Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice

Country Status (1)

Country Link
CN (1) CN112142834A (en)

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GENBANK: "XM_015777113", 《NCBI》 *
王家豪等: "OsU496A参与水稻幼苗模拟干旱胁迫应答的生理机制", 《2018年中国作物学会学术年会论文摘要集》 *

Similar Documents

Publication Publication Date Title
US9809827B2 (en) Transgenic maize
CN106868021B (en) Gene OsNAC1 for controlling rice seed size and application thereof
CN112831478B (en) Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof
CN107746846B (en) IbABF4 gene for coding sweet potato bZIP transcription factor and application thereof
CN113717983A (en) Longan gene DlGRAS34, protein and application thereof in regulating and controlling plant flowering
CN107056911B (en) Strawberry transcription factor for promoting early flowering of plants and application thereof
CN110004154B (en) Application of tea tree CsJAZ1 gene
CN108998472B (en) Method for improving cadmium tolerance of plants by using ramie BnXTH1 gene
CN111979253B (en) TrFQR1 gene, cloning thereof, expression vector construction method and application
CN111763251B (en) Trifolium repens transcription factor TrNAC and coding sequence and application thereof
LU504522B1 (en) Gene related to low potassium stress of tobacco, promoter and application thereof
CN115927371B (en) Sea sword bean CrHsf7 gene and transcription factor and application thereof
CN110684088B (en) Protein ZmbZIPa3 and application of coding gene thereof in regulating and controlling plant growth and development and stress tolerance
CN114921473B (en) Gene for negative regulation and control of synthesis of endogenous salicylic acid of cassava and application of gene
CN114540373B (en) Gene for reducing cadmium content in rice grains and application thereof
CN110819602A (en) Application of rice tRNA isopentenyl transferase gene OsIPT9 in resisting brown planthopper
CN116042673A (en) Application of AsNADP-ME1 gene in improving drought tolerance of plants
CN111454964B (en) Rape cold-resistant gene BnTR1, and coding protein and application thereof
CN112142834A (en) Application of rice osmotic stress response protein OsU496A in improving osmotic stress resistance of rice
CN116622666A (en) Method for regulating drought resistance of plants and application of TaMPK3 in regulating drought resistance of plants
CN114214333A (en) Gene for regulating and controlling development of plant leaf epidermal hair and thickness of secondary wall and application thereof
CN108103075B (en) Switchgrass gene PvC3H29 for delaying plant senescence and application thereof
CN112501142A (en) Cryptomeria fortunei cold-resistant regulatory gene CfAPX and application thereof
CN114277035B (en) Cassava MeRS40 gene, protein and application thereof
CN115710588B (en) Application of over-expression bna-miR166f in improvement of complex quantitative characters such as rape harvest index and the like

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20201229