CN112111489A - shRNA for inhibiting SARS-COV-2 virus replication and its application - Google Patents

Abstract

The invention discloses shRNA for inhibiting SARS-COV-2 virus replication and application thereof, wherein the shRNA targets one E, M, N gene of SARS-CoV-2 virus and comprises any pair of sequences selected from the following combinations: (a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2; (b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4; (c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6; (d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and (e) an inverted repeat pair consisting of complementary SEQ ID NO 9 and SEQ ID NO 10. The invention also discloses a medicine for inhibiting SARS-CoV-2 virus replication in a subject, which comprises a vector and a nucleic acid sequence encoding single or multiple shRNAs.

Description

shRNA for inhibiting SARS-COV-2 virus replication and its application

Technical Field

The invention relates to shRNA (short hairpin RNA), in particular to shRNA for inhibiting SARS-COV-2 virus replication and application thereof.

Background

The novel coronavirus pneumonia (Corona Virus Disease 2019, COVID-19) is called new coronavirus pneumonia for short, is a global pandemic which is encountered by human beings in the last century and has the widest influence range, and forms a huge threat to global public health safety. At present, no specific treatment means or medicine is available for the new coronary pneumonia, and the disease control mainly depends on strict physical isolation to cut off the transmission path, thereby directly causing serious economic loss.

For severe, critical cases, the following treatments can be used: (1) respiratory support including oxygen therapy, high flow nasal catheter oxygen therapy or non-invasive mechanical ventilation, invasive mechanical ventilation and rescue therapy; (2) circulation support, improving microcirculation on the basis of full fluid resuscitation, using vasoactive drugs and performing hemodynamic detection when necessary; (3) renal failure and renal replacement therapy; (4) plasma treatment of convalescent; (5) blood purification treatment, etc. For a typical patient, the following procedure may be used: taking the measures of bed rest, paying attention to maintain the internal environment stability and giving effective oxygen therapy in time according to the oxygen saturation.

Currently, the drug treatments that can be tried are: interferon-alpha, lopinavir/ritonavir, ribavirin, chloroquine phosphate and abidol, ribavirin, etc. The treatment course of the trial medicine should not exceed 10 days. When intolerable toxic and side effects occur, the related medicines are stopped.

Therefore, there is a need to provide more drugs and methods for treating new coronary pneumonia.

Disclosure of Invention

One aspect of the present invention provides an siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of E, M, N genes of SARS-CoV-2 virus and comprises any pair of sequences selected from the following combinations:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

Another aspect of the present invention provides an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of E, M, N genes of SARS-CoV-2 virus and comprises any pair of sequences selected from the group consisting of:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

Another aspect of the invention provides an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus and comprises any one of the sequences shown in SEQ ID NOS: 11-15.

Another aspect of the present invention provides a DNA encoding an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of E, M, N genes of SARS-CoV-2 virus and the DNA comprises any one of a group of sequences selected from the following combinations:

(a) the sense strand comprises the sequences shown as SEQ ID NO 16 and SEQ ID NO 17, and the antisense strand comprises the sequences shown as SEQ ID NO 26 and SEQ ID NO 27;

(b) the sense strand comprises the sequences shown as SEQ ID NO. 18 and SEQ ID NO. 19, and the antisense strand comprises the sequences shown as SEQ ID NO. 28 and SEQ ID NO. 29;

(c) the sense strand comprises the sequences shown as SEQ ID NO 20 and SEQ ID NO 21, and the antisense strand comprises the sequences shown as SEQ ID NO 30 and SEQ ID NO 31;

(d) the sense strand comprises the sequences shown as SEQ ID NO. 22 and SEQ ID NO. 23, and the antisense strand comprises the sequences shown as SEQ ID NO. 32 and SEQ ID NO. 33; and

(e) the sense strand comprises the sequences shown as SEQ ID NO. 24 and SEQ ID NO. 25 and the antisense strand comprises the sequences shown as SEQ ID NO. 34 and SEQ ID NO. 35.

Another aspect of the present invention provides a DNA encoding an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of E, M, N genes of SARS-CoV-2 virus and the DNA comprises any one of a group of sequences selected from the following combinations:

(a) the sense strand is a sequence shown as SEQ ID NO. 36, and the antisense strand is a sequence shown as SEQ ID NO. 41;

(b) the sense strand is a sequence shown as SEQ ID NO. 37, and the antisense strand is a sequence shown as SEQ ID NO. 42;

(c) the sense strand is a sequence shown as SEQ ID NO. 38, and the antisense strand is a sequence shown as SEQ ID NO. 43;

(d) the sense strand is a sequence shown as SEQ ID NO. 39, and the antisense strand is a sequence shown as SEQ ID NO. 44; and

(e) the sense strand is the sequence shown as SEQ ID NO. 40, and the antisense strand is the sequence shown as SEQ ID NO. 45.

Another aspect of the invention provides a medicament for inhibiting SARS-CoV-2 viral replication in a subject, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides a method of inhibiting SARS-CoV-2 virus replication in a subject, the method comprising administering to a subject in need thereof an effective amount of a medicament of the invention, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides the use of a medicament of the invention in the preparation of a medicament for inhibiting SARS-CoV-2 viral replication in a subject, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides a pharmaceutical composition for inhibiting SARS-CoV-2 viral replication in a subject, wherein the pharmaceutical composition comprises a medicament comprising a vector and a nucleic acid sequence encoding one or more shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus, and a pharmaceutically acceptable excipient. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides a method of inhibiting SARS-CoV-2 viral replication in a subject, the method comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the invention, wherein the pharmaceutical composition comprises a medicament comprising a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus, and a pharmaceutically acceptable excipient. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides the use of a pharmaceutical composition of the invention in the preparation of a medicament for inhibiting SARS-CoV-2 viral replication in a subject, wherein the pharmaceutical composition comprises a medicament comprising a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus, and a pharmaceutically acceptable excipient. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides a pharmaceutical kit for inhibiting SARS-CoV-2 replication in a subject, the kit comprising two or more of the medicaments or pharmaceutical compositions of the invention in separate presence.

Drawings

FIG. 1: transfection efficiency of adeno-associated virus-entrapped shRNA. The fluorescence intensities of Green Fluorescent Protein (GFP), SARS-N and DAPI were counted by scanning with a whole-field cell scanning analyzer (Celigo), and the transfection efficiency was calculated. Wherein the multiplicity of infection (MOI) is 0.05.

FIG. 2: interference effect of adeno-associated virus entrapped shRNA. The full-field cell scanning analyzer (Celigo) scans and counts GFP, SARS-N and DAPI fluorescence intensity, and calculates the interference efficiency. Wherein the MOI is 0.05. # p = 0.26, no statistical difference.

FIG. 3: interference effect of lentivirus-entrapped shRNA. The viral nucleoproteins of each group (GFP, shRNA5, shRNA6, shRNA7, shRNA9, shRNA 10) were measured by immunofluorescence to calculate the interference efficiency. P < 0.001, the difference was very statistically significant.

FIG. 4: and (3) detecting the interference effect of shRNA entrapped by the lentivirus by immunofluorescence. Pictures were taken using a fluorescence microscope.

FIG. 5: and (4) determining the virus titer. Virus titers in cell cultures were determined using a spot-forming Assay (FFA). P < 0.0001, the difference was very statistically significant.

FIG. 6: and (5) detecting the virus replication number. Spot counts were performed using an enzyme linked spot analyzer CTL S6 Ultra. Among them, 5 indicates the shRNA5 group, 6 indicates the shRNA6 group, 7 indicates the shRNA7 group, 9 indicates the shRNA9 group, and 10 indicates the shRNA10 group.

Detailed Description

Definition of

In the present invention, the term "treatment" refers to both therapeutic as well as prophylactic measures which prevent or slow down the occurrence of an undesired physiological change or disorder in a subject, such as the occurrence of pulmonary fibrosis or cancer progression. Beneficial or desired clinical effects include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, diminishment or palliation of disease state, and partial or total cure of disease, whether or not detectable. "treatment" may also refer to an increase in survival compared to no treatment. Subjects in need of treatment include subjects already suffering from the disease or condition, as well as subjects likely to suffer from the disease or condition, or subjects in whom the disease or condition is to be prevented.

By "subject" or "patient" or "individual" is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis or treatment is desired. Mammals include humans, domestic animals, farm animals, zoo animals, sports animals, or pets, such as dogs, cats, pigs, rabbits, rats, mice, horses, cows, etc. The subject referred to herein is preferably a human.

The term "patient in need of treatment" or "subject in need of treatment" as used herein includes subjects, such as mammalian subjects, that benefit from administration of the polypeptides or compositions thereof of the present invention for, e.g., detection, diagnostic and/or therapeutic use.

It will also be appreciated by those of ordinary skill in the art that modified genomes as disclosed herein may be modified such that they differ in nucleotide sequence from the modified polynucleotides from which they are derived. For example, a polynucleotide or nucleotide sequence derived from a given DNA sequence may be similar, e.g., have a certain percentage identity to the starting sequence, e.g., it may be 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to the starting sequence.

In addition, nucleotide or amino acid substitutions, deletions or insertions may be made to make conservative substitutions or alterations in "non-essential" regions. For example, a polypeptide or amino acid sequence derived from a given protein may be identical to the starting sequence except for one or more individual amino acid substitutions, insertions, or deletions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more single amino acid substitutions, insertions, or deletions). In certain embodiments, the polypeptide or amino acid sequence derived from a given protein has 1 to 5, 1 to 10, 1 to 15, or 1 to 20 individual amino acid substitutions, insertions, or deletions relative to the starting sequence.

As used herein, the term "therapeutically effective amount" or "effective amount" refers to an amount of a drug or pharmaceutical composition of the present invention that is effective in preventing or alleviating the disease or condition to be treated when administered alone or in combination with an additional therapeutic agent to a cell, tissue, or subject. A therapeutically effective dose further refers to an amount of the compound sufficient to cause a reduction in symptoms, such as treatment, cure, prevention, or reduction of a related medical condition, or to increase the rate of treatment, cure, prevention, or reduction of the condition. When administering an active ingredient administered alone to an individual, a therapeutically effective amount refers to the individual ingredient. When a combination is administered, a therapeutically effective amount refers to the amount of the combination of active ingredients that produces a therapeutic effect, whether administered in combination, sequentially or simultaneously. A therapeutically effective amount will reduce symptoms, typically by at least 10%; usually at least 20%; preferably at least about 30%; more preferably at least 40% and most preferably at least 50%.

In the present invention, "about" means that the numerical value is within an acceptable error range for the specific value determined by one of ordinary skill in the art, which numerical value depends in part on how the value is measured or determined (i.e., the limits of the measurement system). For example, "about" in each practice in the art may mean within 1 or a standard deviation of more than 1. Alternatively, "about" or "substantially comprising" may mean a range of up to 20%. Furthermore, for biological systems or processes, the term may mean up to an order of magnitude or up to 5 times the value. Unless otherwise indicated, when a particular value appears in the application and claims, the meaning of "about" or "consisting essentially of" should be assumed to be within an acceptable error range for that particular value.

On day 9/1 of 2020, scientists observed under an electron microscope that the pathogen responsible for this pneumonia presented an enveloped typical coronavirus morphology with a coronal appearance. Meanwhile, the sequencing result of pathogenic genome shows that the nucleic acid sequence of the coronavirus is not completely consistent with the 6 coronavirus (such as SARS, MERS and the like) discovered before. Thus, the World Health Organization (WHO) named the new virus at 12.1/2020: 2019 Novel Coronavirus (2019 Novel Coronavir, 2019-nCoV), 2 month and 11 days, which is named SARS-CoV-2 by the International Committee for Classification of viruses (ICTV).

The patients infected with the novel coronavirus have the main clinical manifestations of fever, hypodynamia and dry cough, and the symptoms of upper respiratory tract such as nasal obstruction, watery nasal discharge and the like are rare. Approximately half of patients develop dyspnea after one week, and severe patients rapidly progress to acute respiratory distress syndrome, septic shock, refractory metabolic acidosis, and procoagulant dysfunction. The course of the disease can be middle-low fever or even no obvious fever. Some patients have mild onset symptoms and no fever, and recover after 1 week. From the current accepted cases, the prognosis of most patients is good, and the disease of a few patients is critical and even death occurs.

The coronavirus is a positive-strand RNA virus, is the largest virus genome in RNA viruses known by human at present, and has the length of 27-32 kb. Coronaviruses can infect mammals, birds, and reptiles, including humans, pigs, cattle, horses, camels, cats, dogs, bats, etc., and cause respiratory, digestive, hepatic, and nervous system-type diseases. Coronaviruses belong to the order of the nested viruses (Nidovirales) and the family of Coronaviridae (Coronaviridae), and are classified into 4 (α, β, γ, and) coronaviruses (Coronavirus). A total of 6 coronaviruses were known to infect humans 12 months ago 2019, including 2 alphacoronaviruses (HCoV-229E and HKU-NL 63) and 4 betacoronaviruses (HCoV-OC 43, HCoV-HKU1, SARS-CoV and MERS-CoV). Among them, HCoV-OC43 and HCoV-HKU1 belong to subgroup A, usually cause mild upper respiratory infection symptoms, suppress immune activity, and occasionally cause severe lower respiratory infection in immunocompromised patients or the elderly. SARS-CoV of subgroup B and MERS-CoV of subgroup C mainly invade the lower respiratory tract, causing acute respiratory distress syndrome and extrapulmonary clinical symptoms such as diarrhea, lymphopenia, liver function disorder, kidney injury, etc. SARS-CoV-2 primarily invades alveolar epithelial cells and causes clinical symptoms similar to those of SARS-CoV and MERS-CoV infection.

The novel coronavirus SARS-CoV-2 is a non-segmented positive-strand RNA virus with envelope, and the particle is circular or elliptical, has a diameter of about 60-140 nm, and belongs to the genus beta of the family Coronaviridae. The genome is about 30 kb in length. The SARS-CoV-2 genome has a typical coronavirus structure. The genome has a cap-like structure at the 5 'end and a poly-A tail at the 3' end, comprising two flanking untranslated regions (UTRs) and the entire Open Reading Frame (ORF) encoding the polyprotein. The major structural proteins of SARS-CoV-2 include spike (S) protein, envelope (E) protein, membrane (M) protein and nucleocapsid (N) protein. These proteins are essential for binding of the virus to cellular receptors and are all essential for the virus's structural completion.

The term "E" refers to the E Gene (Gene ID: 43740570), which encodes the (envelope, E) protein. The E protein, which contains a hydrophobic domain and a transmembrane alpha helical domain, is part of the viral envelope and is involved in virion assembly and release. Compared with SARS-CoV, the homology of the E protein sequence of SARS-CoV-2 is as high as 95%. The E protein of SARS-CoV can also play an ion channel role in the form of a pentamer structure, which also suggests the functional diversity of the E protein in the process of SARS-CoV-2 virus replication and pathogenesis.

The term "M" refers to the M Gene (Gene ID: 43740571) which encodes the membrane (M) protein. The M protein contains 3 transmembrane domains and 1 conserved domain, is a component of the viral envelope, and is involved in the assembly and release of viral particles. Compared with SARS-CoV, the M protein sequence of SARS-CoV-2 has homology as high as 91%. The M protein of SARS-CoV is expressed only in endoplasmic reticulum and Golgi apparatus, and its conserved domain participates in virus assembly and budding process through protein-protein interaction. In addition, there are two changes in the concept of the M protein, which play an important role in the structural stability and functional expression of other structural proteins (S, E, N proteins). In host cells, the envelope of coronaviruses is produced by endoplasmic reticulum-golgi intermediate (ERGIC), where the M protein is responsible for the building of the envelope backbone and the E protein is responsible for the production of the envelope curvature and the eventual cleavage of the mature virion envelope.

The term "N" refers to the N Gene (Gene ID: 43740575) encoding the nucleocapsid (N) protein. The N protein sequence has high conservative degree and plays an important role in the virus replication process. The main effect is to bind to the viral RNA. The N protein and the virus RNA structure form a complex, and then enter the virus capsid after being wrapped under the combined action of the M protein and the E protein. The N protein contains N1 and N2 epitopes, and the epitope N1 can stimulate the body to produce high-affinity antibodies, but generally has no neutralizing activity. The research shows that the N protein of the B subgroup of the beta coronavirus can generate serum cross reaction. Compared with SARS-CoV, the N protein homology of SARS-CoV-2 is up to 90%. Therefore, the serum of SARS-CoV-2 patient may recognize the N protein of SARS-CoV, and can be used for clinical detection of asymptomatic SARS-CoV-2 carrier.

Interference

RNA interference (RNAi) refers to the phenomenon that double-stranded RNA molecules (dsRNA) enter human cells and specifically degrade mRNA homologous thereto, thereby specifically and efficiently inhibiting the expression activity of the corresponding gene. The phenomenon of RNA interference was originally discovered in plants and lower organisms, and recently in higher eukaryotes as research progresses, and has proved to be an important evolutionarily conserved phenomenon. When homologous dsRNA is introduced into a cell with the coding region of an endogenous mRNA, the mRNA is degraded and leads to gene expression silencing, which is a special Post-transcriptional gene silencing (PTGS). Therapeutically, RNAi works by delivering small RNA duplexes, including microrna (mirna) mimics, small interfering RNA (sirna), short hairpin RNA (shrna), and Dicer substrate RNA (dsirna). It has been demonstrated that siRNA is cleaved by dsRNA specific endonucleases (Dicer enzymes). The RNA-induced silencing complex (RISC) is composed of siRNA and a multienzyme complex, which is located at a specific site of mRNA and exerts endonuclease and exonuclease activities to act on the mRNA. In addition to gene silencing at the transcriptional level (degradation of mRNA), siRNA has also been shown to reduce protein expression by silencing promoters through DNA methylation.

Since RNAi has high sequence specificity and effective interference, and can specifically silence a specific gene to thereby achieve loss of gene function or reduction in gene expression level, this technique has been widely used in the field of exploring gene function, diseases such as cancer, and the like, and treatment of viral infection.

Small interfering RNA (siRNA), sometimes referred to as short interfering RNA or silencing RNA, is a class of double-stranded RNA molecules that are 20-25 base pairs in length, similar to miRNA, and operate within the RNA interference (RNAi) pathway. It interferes with the post-transcriptional degradation of mRNA of a particular gene expressing a nucleotide sequence complementary thereto, thereby preventing translation. The siRNA is cleaved from double-stranded RNA (dsRNA) by RNase III (such as Dicer) into 21-25 bp double-stranded RNA in cells.

In one aspect of the invention, there is provided an siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of the E, M, N genes of SARS-CoV-2 virus and has any pair of sequences selected from the following combinations:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

Table 1 lists SEQ ID NO 1-10.

Sequence ID	Nucleic acid sequences
		SEQ ID NO: 1	GCGUUCCAAUUAACACCAAUA
SEQ ID NO: 2	UAUUGGUGUUAAUUGGAACGC
		SEQ ID NO: 3	GCCUCUUCUCGUUCCUCAUCA
SEQ ID NO: 4	UGAUGAGGAACGAGAAGAGGC
		SEQ ID NO: 5	GCCAAACUGUCACUAAGAAAU
SEQ ID NO: 6	AUUUCUUAGUGACAGUUUGGC
		SEQ ID NO: 7	GCUACAUCACGAACGCUUUCU
SEQ ID NO: 8	AGAAAGCGUUCGUGAUGUAGC
		SEQ ID NO: 9	GGAAGAGACAGGUACGUUAAU
SEQ ID NO: 10	AUUAACGUACCUGUCUCUUCC

TABLE 1 SEQ ID NO 1-10 sequences

In addition, polynucleotides having at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% sequence identity to any of the sequences set forth in SEQ ID Nos. 1-10 are considered to be within the scope of the present invention.

Short hairpin RNAs (shRNAs) include two short inverted repeats. The shRNA cloned into the shRNA expression vector comprises two short inverted repeat sequences, and the middle of the two short inverted repeat sequences is separated by a stem-loop (loop) sequence to form a hairpin structure. Typically, shRNA expression is under the control of an RNA polymerase (Pol) III promoter or a modified Pol II promoter. Followed by ligation with a transcription terminator. After transcription of the shRNA, two short inverted repeats connected by a stem-loop form a characteristic hairpin structure in pairs. In some embodiments, the transcription terminator is 5-6T. In some embodiments, the transcription terminator is 5 Ts (TTTTT (SEQ ID NO: 46)).

The stem loop in the shRNA insert should be near the center of the oligonucleotide. Stem loops of different sizes and nucleotide sequences have been successfully used. In some embodiments, the sequence of the stem-loop is CUCGAG (SEQ ID NO: 47) or CTCGAG (SEQ ID NO: 48).

The shRNA is typically introduced into a cell using a vector and can be passed into progeny cells, so that gene silencing can be inherited. The hairpin structure of shRNA can be cut into siRNA by a cellular mechanism, and then the purpose of degrading mRNA is achieved according to the mechanism. It has the greatest advantages of high effectiveness and specificity and rapid defense and treatment effects. Its action has shown immeasurable value in the field of gene function studies and in the field of treatment of various diseases, especially viral diseases, for example, RNAi has been found to be excellent in inhibiting replication of viruses such as HIV, Hepatitis C Virus (HCV), Hepatitis B Virus (HBV), and Poliovirus (Poliovirus) in the study of such viruses.

In one aspect of the invention, there is provided an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of E, M, N genes of SARS-CoV-2 virus and comprises any pair of sequences selected from the group consisting of:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

In another aspect of the invention, there is provided an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus and comprises one of the sequences set forth as SEQ ID NOS: 11-15. Table 2 lists SEQ ID NO 11-15.

Sequence ID	Nucleic acid sequences
		SEQ ID NO: 11	GCGUUCCAAUUAACACCAAUA CUCGAG UAUUGGUGUUAAUUGGAACGC UUUUU
SEQ ID NO: 12	GCCUCUUCUCGUUCCUCAUCA CUCGAG UGAUGAGGAACGAGAAGAGGC UUUUU
		SEQ ID NO: 13	GCCAAACUGUCACUAAGAAAU CUCGAG AUUUCUUAGUGACAGUUUGGC UUUUU
SEQ ID NO: 14	GCUACAUCACGAACGCUUUCU CUCGAG AGAAAGCGUUCGUGAUGUAGC UUUUU
		SEQ ID NO: 15	GGAAGAGACAGGUACGUUAAU CUCGAG AUUAACGUACCUGUCUCUUCC UUUUU

TABLE 2 SEQ ID NO 11-15 sequences

In some embodiments, the shRNA targets the N gene and comprises the sequence shown in SEQ ID No. 12. In some embodiments, the shRNA targets the M gene and comprises the sequence shown in SEQ ID No. 14.

In addition, polynucleotides having at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% sequence identity to any of the sequences set forth in SEQ ID NOS 11-15 are considered to be within the scope of the present invention.

DNA encoding shRNA

DeoxyriboNucleic Acid (abbreviated as DNA) is one of the four kinds of nucleic acids contained in biological cells. DNA carries the genetic information necessary for the synthesis of RNA and proteins. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose, and phosphate. Wherein, the basic groups are 4 types: adenine (a), guanine (G), thymine (T) and cytosine (C). The strand of DNA carrying the nucleotide sequence encoding the amino acid information of the protein is called the sense strand, also called the coding strand, sense strand or plus strand (+ strand). The other strand is complementary in nucleotide sequence to the sense strand and is referred to as the antisense strand. The strand that is identical to the mRNA nucleotide sequence (U instead of T) is referred to as the sense strand. A strand of single strand of DNA that can be transcribed to generate RNA according to the base pairing rule is called a template strand.

As used herein, the term "encode" refers to any process by which information in a polymer macromolecule or sequence string is used to direct the production of a second molecule or sequence string that is different from the first molecule or sequence string. As used herein, the term is used broadly and may have a variety of applications. In one aspect, the term "encoding" describes a process of semi-conservative DNA replication in which one strand of a double-stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase. In another aspect, the term "encode" refers to any process by which information in one molecule is used to direct the production of a second molecule having a different chemical nature than the first molecule. For example, a DNA molecule may encode an RNA molecule (e.g., by participating in the transcription process of a DNA-dependent RNA polymerase). Furthermore, the RNA molecule may encode a polypeptide, as in the translation process. When used to describe a translation process, the term "encode" also extends to triplet codons that encode amino acids. In some aspects, an RNA molecule can encode a DNA molecule, for example, by participating in a reverse transcription process by an RNA-dependent DNA polymerase. In another aspect, the DNA molecule may encode a polypeptide, wherein it is understood that "encoding" as used in this context encompasses both transcriptional and translational processes.

In one aspect of the invention, there is provided a DNA encoding an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus and the DNA comprises any one set of sequences selected from the group consisting of:

(a) the sense strand comprises the sequences shown as SEQ ID NO 16 and SEQ ID NO 17, and the antisense strand comprises the sequences shown as SEQ ID NO 26 and SEQ ID NO 27;

(b) the sense strand comprises the sequences shown as SEQ ID NO. 18 and SEQ ID NO. 19, and the antisense strand comprises the sequences shown as SEQ ID NO. 28 and SEQ ID NO. 29;

(c) the sense strand comprises the sequences shown as SEQ ID NO 20 and SEQ ID NO 21, and the antisense strand comprises the sequences shown as SEQ ID NO 30 and SEQ ID NO 31;

(d) the sense strand comprises the sequences shown as SEQ ID NO. 22 and SEQ ID NO. 23, and the antisense strand comprises the sequences shown as SEQ ID NO. 32 and SEQ ID NO. 33; and

(e) the sense strand comprises the sequences shown as SEQ ID NO. 24 and SEQ ID NO. 25 and the antisense strand comprises the sequences shown as SEQ ID NO. 34 and SEQ ID NO. 35.

In another aspect of the invention, there is provided a DNA encoding an shRNA that inhibits replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus and the DNA comprises any one set of sequences selected from the group consisting of:

(a) the sense strand is a sequence shown as SEQ ID NO. 36, and the antisense strand is a sequence shown as SEQ ID NO. 41;

(b) the sense strand is a sequence shown as SEQ ID NO. 37, and the antisense strand is a sequence shown as SEQ ID NO. 42;

(c) the sense strand is a sequence shown as SEQ ID NO. 38, and the antisense strand is a sequence shown as SEQ ID NO. 43;

(d) the sense strand is a sequence shown as SEQ ID NO. 39, and the antisense strand is a sequence shown as SEQ ID NO. 44; and

(e) the sense strand is the sequence shown as SEQ ID NO. 40, and the antisense strand is the sequence shown as SEQ ID NO. 45.

Table 3 lists SEQ ID NO 16-45.

Sequence ID	Nucleic acid sequences
		SEQ ID NO: 16	GCGTTCCAATTAACACCAATA
SEQ ID NO: 17	TATTGGTGTTAATTGGAACGC
		SEQ ID NO: 18	GCCTCTTCTCGTTCCTCATCA
SEQ ID NO: 19	TGATGAGGAACGAGAAGAGGC
		SEQ ID NO: 20	GCCAAACTGTCACTAAGAAAT
SEQ ID NO: 21	ATTTCTTAGTGACAGTTTGGC
		SEQ ID NO: 22	GCTACATCACGAACGCTTTCT
SEQ ID NO: 23	AGAAAGCGTTCGTGATGTAGC
		SEQ ID NO: 24	GGAAGAGACAGGTACGTTAAT
SEQ ID NO: 25	ATTAACGTACCTGTCTCTTCC
		SEQ ID NO: 26	TATTGGTGTTAATTGGAACGC
SEQ ID NO: 27	GCGTTCCAATTAACACCAATA
		SEQ ID NO: 28	TGATGAGGAACGAGAAGAGGC
SEQ ID NO: 29	GCCTCTTCTCGTTCCTCATCA
		SEQ ID NO: 30	ATTTCTTAGTGACAGTTTGGC
SEQ ID NO: 31	GCCAAACTGTCACTAAGAAAT
		SEQ ID NO: 32	AGAAAGCGTTCGTGATGTAGC
SEQ ID NO: 33	GCTACATCACGAACGCTTTCT
		SEQ ID NO: 34	ATTAACGTACCTGTCTCTTCC
SEQ ID NO: 35	GGAAGAGACAGGTACGTTAAT
		SEQ ID NO: 36	GCGTTCCAATTAACACCAATA CTCGAG TATTGGTGTTAATTGGAACGC TTTTT
SEQ ID NO: 37	GCCTCTTCTCGTTCCTCATCA CTCGAG TGATGAGGAACGAGAAGAGGC TTTTT
		SEQ ID NO: 38	GCCAAACTGTCACTAAGAAAT CTCGAG ATTTCTTAGTGACAGTTTGGC TTTTT
SEQ ID NO: 39	GCTACATCACGAACGCTTTCT CTCGAG AGAAAGCGTTCGTGATGTAGC TTTTT
		SEQ ID NO: 40	GGAAGAGACAGGTACGTTAAT CTCGAG ATTAACGTACCTGTCTCTTCC TTTTT
SEQ ID NO: 41	AAAAA GCGTTCCAATTAACACCAATA CTCGAG TATTGGTGTTAATTGGAACGC
		SEQ ID NO: 42	AAAAA GCCTCTTCTCGTTCCTCATCA CTCGAG TGATGAGGAACGAGAAGAGGC
SEQ ID NO: 43	AAAAA GCCAAACTGTCACTAAGAAAT CTCGAG ATTTCTTAGTGACAGTTTGGC
		SEQ ID NO: 44	AAAAA GCTACATCACGAACGCTTTC TCTCGAG AGAAAGCGTTCGTGATGTAGC
SEQ ID NO: 45	AAAAA GGAAGAGACAGGTACGTTAAT CTCGAG ATTAACGTACCTGTCTCTTCC

TABLE 3 SEQ ID NO 16-40 sequences

In some embodiments, the shRNA targets the N gene and the DNA comprises the following sequence: the sense strand is the sequence shown in SEQ ID NO. 37, and the antisense strand is the sequence shown in SEQ ID NO. 42. In some embodiments, the shRNA targets the M gene and the DNA comprises the following sequence: the sense strand is the sequence shown as SEQ ID NO. 39, and the antisense strand is the sequence shown as SEQ ID NO. 44.

In addition, polynucleotides having at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% sequence identity to any of the sequences set forth in SEQ ID NOS 16-45 are considered to be within the scope of the present invention.

Identity of each other

"homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing the position in each sequence, which can be aligned for comparison purposes. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. An "unrelated" or "non-homologous" sequence shares less than 40% identity, but preferably less than 25% identity, with one of the sequences of the invention.

A polynucleotide or polynucleotide region (or polypeptide region) has a certain percentage (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%) of "sequence identity" with another sequence, meaning that when aligned, the percentage of bases (or amino acids) are the same when comparing two sequences. Such alignments and percent homologies or sequence identities can be determined using software programs known in the art.

Nucleic acid sequences encoding shRNA

The terms "polynucleotide" and "nucleic acid" are used interchangeably herein to refer to a polymeric form of nucleotides of any length (ribonucleotides or deoxyribonucleotides). These terms include single-, double-or triple-stranded DNA, genomic DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrids, or polymers; the polymer comprises purine or pyrimidine bases, or other natural, chemically, biochemically modified, non-natural or derivatized nucleotide bases. The backbone of the polynucleotide may comprise sugars and phosphate groups (typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide may comprise a polymer of synthetic subunits (e.g., phosphoramidates) and thus may be oligodeoxynucleoside phosphoramidates (P-NH 2) or mixed phosphoramidate-phospholipid diester oligomers.

In one aspect of the invention, a medicament for inhibiting SARS-CoV-2 replication in a subject is provided, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus.

In some embodiments, the medicament comprises a vector and a nucleic acid sequence encoding a single shRNA. In some embodiments, the shRNA targets the N gene and comprises the sequence shown in SEQ ID No. 12. In some embodiments, the shRNA targets the M gene and comprises the sequence shown in SEQ ID No. 14.

In some embodiments, the medicament comprises a vector and a nucleic acid sequence encoding a plurality of shrnas, wherein the shrnas target E, M, N one of the genes.

In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding each shRNA are linked in direct tandem or by means of a linker. In some embodiments, the nucleic acid sequences encoding each shRNA are driven by the same promoter (promoter) or different promoters. In some embodiments, the plurality of shrnas target the same gene or different genes in E, M, N genes.

In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are in the same vector, the nucleic acid sequences encoding each shRNA are linked in direct tandem and driven by the same promoter, and the plurality of shrnas target the same one of E, M, N genes. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are in the same vector, the nucleic acid sequences encoding each shRNA are linked in direct tandem and driven by the same promoter, and the plurality of shrnas target different ones of E, M, N genes. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector, the nucleic acid sequences encoding each shRNA are linked in direct tandem and driven by different promoters, and the plurality of shrnas target E, M, N the same one of the genes. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector, the nucleic acid sequences encoding each shRNA are linked in direct tandem and driven by different promoters, and the plurality of shrnas target different ones of E, M, N genes.

In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are in the same vector, the nucleic acid sequences encoding each shRNA are linked by way of a linker and driven by the same promoter, and the plurality of shrnas target E, M, N the same gene. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector, the nucleic acid sequences encoding each shRNA are linked by way of a linker and driven by the same promoter, and the plurality of shrnas target E, M, N different ones of the genes. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector, the nucleic acid sequences encoding each shRNA are linked by way of a linker and driven by different promoters, and the plurality of shrnas target E, M, N the same gene. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector, the nucleic acid sequences encoding each shRNA are linked by way of a linker and driven by different promoters, and the plurality of shrnas target E, M, N different ones of the genes.

In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the plurality of shrnas target different ones of E, M, N genes. In some embodiments, the plurality of separate vectors are the same vector.

As used herein, the term "linker" refers to a short stretch of nucleotide sequences comprising two or more nucleotides, which may be the same or different, wherein the nucleotides are selected from Adenine (Adenine, a), Guanine (Guanine, G), Cytosine (Cytosine, C), Thymine (Thymine, T) and Uracil (Uracil, U).

Promoters

A promoter is a DNA sequence recognized, bound and initiated by RNA polymerase and contains conserved sequences required for RNA polymerase specific binding and transcription initiation, most of which are located upstream of the transcription initiation point of a structural gene, and is not transcribed per se. Eukaryotic promoters fall into three classes, transcribed by RNA polymerases I, II and III, respectively.

The RNA polymerase I promoter controls only the transcription of rRNA precursor gene, and the transcription product is cut and processed to generate various mature rRNAs. The RNA polymerase II promoter is designed to control the expression of a number of genes encoding proteins. RNA polymerase III promoters are involved in the transcription of some small RNA molecules.

In some embodiments, the promoter is a modified RNA polymerase II promoter or RNA polymerase III promoter. In some embodiments, the RNA polymerase III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, and a tRNA promoter.

Viral vectors

Viral vectors can bring genetic material into cells by exploiting the molecular mechanisms that viruses possess to transmit their genomes into other cells for infection. Viral vectors may also be referred to as vectors, vector virions, or vector particles. Examples of viral vectors include, but are not limited to: retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, baculovirus or lentivirus.

The retroviral vector may be derived from or capable of being derived from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include, but are not limited to: murine Leukemia Virus (MLV), human T-cell leukemia virus (HTLV), Murine Mammary Tumor Virus (MMTV), Rous Sarcoma Virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo MLV), FBR murine sarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myelocytoma virus-29 (MC 29), and Avian Erythrocytosis Virus (AEV).

Adenoviruses are double-stranded, linear DNA viruses that do not replicate through RNA intermediates. Adenoviruses are double-stranded DNA non-enveloped viruses capable of transducing a wide range of cell types of human and non-human origin in vivo, ex vivo and in vitro. These cells include airway epithelial cells, hepatocytes, muscle cells, cardiomyocytes, synoviocytes, primary mammary epithelial cells, and post-mitotic terminally differentiated cells (e.g., neurons). Adenoviruses have been used as vectors for gene therapy and heterologous gene expression. The large (36 kb) genome can accommodate up to 8 kb of exogenous insert DNA and is able to replicate efficiently in complementing cell lines to produce very high titers of up to 1012 transduction units per ml. Adenoviruses are therefore one of the best systems to study gene expression in primary non-replicating cells. Expression of viral or foreign genes from the adenoviral genome does not require replicating cells. Adenovirus vectors enter cells by receptor-mediated endocytosis. Once inside the cell, the adenoviral vector rarely integrates into the host chromosome. Instead, they exist as episomes (independent of the host genome), as linear genomes in the host nucleus.

Adeno-associated virus (AAV), also called adeno-associated virus, belongs to the genus dependovirus of the family parvoviridae and is the single-stranded DNA-deficient virus with the simplest structure found at present. Recombinant AAV vectors have been successfully used for in vitro, ex vivo and in vivo transduction of marker genes and genes involved in human diseases. Certain AAV vectors have been developed that can efficiently bind large payloads (up to 8-9 kb).

Herpes Simplex Virus (HSV) is an enveloped, double-stranded DNA virus that naturally infects neurons. It can accommodate large segments of exogenous DNA and has been adopted as a vector for gene delivery to neurons. The use of HSV in the course of therapy requires that strains be attenuated so that they cannot establish a lytic cycle. In particular, if the HSV vector is used for gene therapy in humans, it is preferable to insert the polynucleotide into an essential gene. This is because if the viral vector encounters a wild-type virus, the heterologous gene can be transferred to the wild-type virus by recombination. However, if the recombinant virus is constructed in a manner that prevents its replication, this can be achieved by inserting oligonucleotides into viral genes essential for replication.

The viral vector of the invention may be a vaccinia virus vector, such as MVA or NYVAC. Alternatives to vaccinia vectors include, for example, the avipox (avipox) vector known as ALVAC or canarypox, as well as strains derived therefrom that can infect and express recombinant proteins in human cells but cannot replicate. It will be appreciated that portions of the viral genome may remain intact following insertion of the recombinant gene. This means that the viral vector can retain the concept of the ability to infect cells and subsequently express additional genes that support their replication and may promote lysis and death of the infected cells.

Lentiviruses are part of a larger population of retroviruses. Can be divided into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to: human Immunodeficiency Virus (HIV), the causative agent of human autoimmune deficiency syndrome (AIDS), and Simian Immunodeficiency Virus (SIV). The non-primate lentiviral population includes the prototype "lentivirus" visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), Equine Infectious Anemia Virus (EIAV), Feline Immunodeficiency Virus (FIV), and Bovine Immunodeficiency Virus (BIV).

Pharmaceutical composition and pharmaceutical kit

"pharmaceutical composition" refers to a pharmaceutical formulation for use in humans. The pharmaceutical composition comprises the medicament of the invention and suitable formulations of carriers, stabilizers and/or excipients.

One aspect of the invention provides a pharmaceutical composition comprising a medicament comprising a vector and a nucleic acid sequence encoding at least one shRNA, wherein the vector comprises or carries the nucleic acid sequence encoding the at least one shRNA, wherein the shRNA targets one of the E, M, N genes, and a pharmaceutically acceptable excipient.

To prepare a pharmaceutical or sterile composition, the drug is admixed with a pharmaceutically acceptable carrier or excipient. Formulations of therapeutic and diagnostic agents in the form of, for example, lyophilized powders, slurries, aqueous solutions or suspensions may be prepared by mixing with physiologically acceptable carriers, excipients or stabilizers.

Pharmaceutically acceptable excipients are well known in the art. As used herein, "pharmaceutically acceptable excipient" includes materials that, when combined with an active ingredient of a composition, allow the ingredient to retain biological activity and not elicit a destructive reaction with the immune system of a subject. These may include stabilizers, preservatives, salts or sugar complexes or crystals and the like. "pharmaceutically acceptable" refers to molecules and components that do not produce an allergic or similar undesirable reaction when administered to a human. It is known in the art how to prepare aqueous compositions comprising as active ingredient. Typically, these compositions are prepared as injections or sprays, such as liquid solutions or suspensions; solid forms suitable for formulation as a solution or suspension prior to injection or spraying may also be prepared.

The medicaments or pharmaceutical compositions of the invention can be used alone or in combination with one another. Accordingly, the present invention provides a pharmaceutical kit for facilitating the above-described combination therapy comprising two or more of the agents or pharmaceutical compositions of the present invention in separate presence. In some embodiments, an individual will sometimes administer two or more of the medicaments or pharmaceutical compositions of the present invention simultaneously. In some embodiments, an individual will sometimes administer two or more of the medicaments or pharmaceutical compositions of the present invention separately.

Methods and treatments

One aspect of the invention provides a method of inhibiting SARS-CoV-2 viral replication in a subject, the method comprising administering to a subject in need thereof an effective amount of a medicament of the invention, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Further, the invention provides the use of a medicament of the invention in a method of inhibiting the replication of SARS-CoV-2 virus, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits the replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the invention provides a method of inhibiting SARS-CoV-2 viral replication in a subject, the method comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition of the invention, wherein the pharmaceutical composition comprises a medicament comprising a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 viral replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus, and a pharmaceutically acceptable excipient. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Further, the invention provides the use of a pharmaceutical composition of the invention in a method of inhibiting the replication of SARS-CoV-2 virus, wherein the pharmaceutical composition comprises a medicament comprising a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits the replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus, and a pharmaceutically acceptable excipient. In some embodiments, the medicament comprises a vector and an shRNA encoding a single agent that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and encodes a plurality of shRNAs that inhibit replication of SARS-CoV-2 virus. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in the same vector. In some embodiments, the nucleic acid sequences encoding the plurality of shrnas are located in a plurality of separate vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Suitable routes of administration include parenteral (e.g. intramuscular, intravenous or subcutaneous) and oral administration. The medicaments or pharmaceutical compositions of the methods of the invention may be administered in a variety of conventional ways, such as via tracheal intubation, oral ingestion, inhalation, topical application, or via cutaneous, subcutaneous, intraperitoneal, parenteral, intraarterial, or intravenous injection. In some embodiments, the medicament of the present invention is formulated as a spray formulation. In some embodiments, the medicament is formulated as a nasal spray formulation.

Suitable dosages are determined by the clinician, for example, using parameters or factors known or suspected to affect the treatment or expected to affect the treatment in the art. Generally, the initial dose is slightly lower than the optimal dose, and thereafter increased by a small amount until the desired or optimal effect is achieved relative to any adverse side effects. Important diagnostic measures include measuring, for example, inflammatory symptoms or levels of inflammatory cytokines produced.

The medicament or pharmaceutical composition of the present invention may be administered by continuous administration or by administration at certain intervals (e.g., 1-7 times a day, week, or week). The dosage may be provided by endotracheal intubation, intravenously, subcutaneously, intraperitoneally, transdermally, topically, orally, nasally, rectally, intramuscularly, intracerebrally or intraspinally. A preferred dosage regimen is one that includes a maximum dose or frequency of administration that avoids significant undesirable side effects.

Example 1 interference Effect of adeno-associated Virus-entrapped shRNA

Strain

A novel strain of coronavirus (SARS-CoV-2) (GenBank: MT 123290) was isolated from a throat swab of one patient and stored at the Guangzhou customs technology center P3 laboratory.

Reagent material

Vero E6 cells, 96-well cell culture plates, DMEM medium, 2% bovine serum DMEM medium, primary antibody, secondary antibody and the like. A freshly prepared 10% hypochlorous acid solution, 4% paraformaldehyde, 1.6% CMC.

Experimental methods

Taking Vero E6 of susceptible SARS-COV-2 cell, according to 1 x 10⁴One/well was plated into 96-well plates. After 24 h adherence, transfection was performed with lipofectamine3000 reagent at 0.25 μ g of shRNA entrapped in adeno-associated virus per well. Transfection efficiency was observed after 24 h.

The 96-well plate was brought to P3 and SARS-COV-2 was added at a dose (non-lethal dose) of 0.05 multiplicity of infection (MOI). Fixing and staining cells, observing cell morphology under a microscope during the process, and observing the degree of cytopathic effect under the microscope. Then, the fluorescence intensities of GFP, SARS-N and DAPI were counted by scanning with a full-field cell scanning analyzer (Celigo), and the transfection efficiency and interference efficiency were calculated.

The specific steps of cell fixation and staining are as follows:

(1) adding 1 ml/well of 4% paraformaldehyde, and fixing at room temperature for more than or equal to 1 h.

(2) 1 ml/well 4% paraformaldehyde was added to a new 24-well plate and the cell slide was transferred to a 24-well plate. And (5) ultraviolet irradiation for 30 min. The P3 laboratory was removed.

(3) And (4) discarding the fixing liquid.

(4) The plate was washed 3 times with PBS, 200. mu.l/well.

(5) Blocking and punching with 1% BSA containing 0.2% Triton, 200. mu.l/well, standing at room temperature for 20-30 min.

(6) PBS was washed three times.

(7) A first antibody: anti-SARS-N polyclonal antibody (Protoyoho, 40143-T62, 3-fold diluted with BSA and glycerol, 1: 1000) was diluted with 1% BSA at 200. mu.l/well and incubated at 37 ℃ for 1 h.

(8) Washing the plate: primary antibody was discarded, the plate was washed 3 times with PBST (0.1% Tween), 200. mu.l/well, and the liquid was discarded.

(9) Secondary antibody: alexa Fluor 594 AffiniPey Donkey Anti-Rabbit IgG (H + L) (Jackson, 1: 500) diluted with 1% BSA was incubated at 37 ℃ for 1H at 200. mu.l/well.

(10) Washing the plate: the secondary antibody was discarded and the plates were washed 3 times with PBST, 200. mu.l/well. The liquid is discarded completely.

(11) DAPI staining: DAPI (10. mu.g/ml) was diluted 5-fold with PBS, 200. mu.l/well, room temperature, protected from light, 15 min.

(12) PBS was washed three times and retained for the last time.

Results of the experiment

FIG. 1 shows the transfection efficiency of 10 shRNAs. Among them, the transfection efficiency of shRNA2, 3 and 8 was high, and the transfection efficiency of shRNA6, 7, 9 and 10 was low. FIG. 2 shows the interference effect of 10 shRNAs. The result shows that the shRNA6 has a remarkable interference effect, the shRNA5 and the shRNA7 also have a certain interference effect, and the effect of the shRNA9 and the shRNA10 is not obvious, possibly because the transfection efficiency is low (23 percent and 16 percent respectively).

Further packaging shRNA5, shRNA6, shRNA7, shRNA9 and shRNA10 into lentivirus, and constructing stable transgenic cells for verification.

Example 2 interference Effect of lentivirus-entrapped shRNA

Experimental methods

Respectively infecting Vero E6 cells with the packaged lentivirus, screening stable transfected cells for puromycin resistance, and screening according to 1.5 x 10⁴One/well was plated in a 96-well plate and after 24 h adherence SARS-COV-2 was added at a dose (non-lethal dose) with a multiplicity of infection (MOI) of 0.05. The efficiency of infection was determined by immunofluorescence (as described in example 1).

Results of the experiment

As shown in fig. 3 and 4, the interference effect of the lentiviral-entrapped shRNA5, shRNA6, shRNA7, shRNA9, shRNA10 was very significant compared to the control.

Example 3 Effect of shRNA on viral replication

Experimental methods

Vero E6 cell line for stably transferring different shRNAs according to the proportion of 1 × 10 per hole⁵Cells were plated in 24-well plates with 4 replicates per shRNA, with GFP as control. SARS-CoV-2 was inoculated at MOI =0.05, and 24 h after infection, cell culture supernatant and cells were scraped together, freeze-thawed once, and virus titer in cell cultures was determined using a spot-forming Assay (FFA). The method comprises the following specific steps:

1. VeroE6 cells were plated in 96-well flat-bottom plates at 2X 104 cells/well.

2. When the cell confluence is 100%

(1) 20 μ l of the virus solution to be tested was serially diluted 10 times with DMEM containing 2% FBS and mixed well.

(2) Abandoning the cell culture solution, adding virus supernatants with different dilution times into the cell wells, and slightly shaking the cells at 50 muL/well to enable the liquid to uniformly cover the bottom surface. 37 deg.C (5% CO)₂) And incubating for 1 h. (1.6% CMC may be preheated during this period).

(3) After 1 h, the mixture of virus solution and serum was discarded, and 1.6% CMC (100 μ L/well) was added.

(4) 37℃（5% CO₂) And incubating for 1 day.

3. Cell fixation and staining:

(1) adding 200 muL/hole 4% paraformaldehyde, and fixing at room temperature for more than or equal to 1 h.

(2) The stationary liquid and the culture liquid were discarded. The reaction mixture was refilled with 4% paraformaldehyde. Ultraviolet irradiation was carried out for 30 minutes. The P3 laboratory was removed.

(3) And (4) discarding the fixing liquid.

(4) The plate was washed 3 times with PBS at 200. mu.L/well.

(5) Blocking and punching by using 1% BSA containing 0.2% Triton, and standing at room temperature for 20-30 min at 50 muL/hole.

(6) PBS was washed three times.

(7) A first antibody: anti-SARS-N polyclonal antibody (Protoyoho, 40143-T62, 1: 4000) was diluted with 1% BSA at 50 μ L/well and incubated at 37 ℃ for 1 h.

(8) Washing the plate: discard primary antibody, wash plate 3 times with 200 μ L/well in PBST (0.1% Tween), discard liquid.

(9) Secondary antibody: goat anti rabbit IgG-HRP (Jackson, 1: 6000) diluted with 1% BSA at 50. mu.L/well was placed in a shaker and incubated at 37 ℃ for 1 h.

(10) Washing the plate: discard the secondary antibody, wash the plate 3 times with PBST, 200 μ L/well. The liquid is discarded completely.

(11) Color development: 50 muL/hole of TrueBlue (KPL, cat No. 50-78-02), standing at room temperature for 5-10 min.

(12) And (5) washing the plate for three times by ddH2O, and drying by spin.

(13) Spot counts were performed using an enzyme linked spot analyzer CTL S6 Ultra. And (3) calculating: viral titer (FFU/ml) = number of counts x 20 × corresponding dilution.

Results of the experiment

As shown in fig. 5 and 6, shRNA5, 6, 7, 9 and 10 all have different degrees of inhibition of SARS-COV-2 replication, with shRNA6 and shRNA9 being the most effective.

It should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification, improvement and variation of the inventions herein disclosed may be resorted to by those skilled in the art, and that such modifications, improvements and variations are considered to be within the scope of this invention. The materials, methods, and examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the present technology.

SEQUENCE LISTING

<110> Shenzhen Rotzmann international transformation medical research institute

<120> shRNA for inhibiting SARS-COV-2 virus replication and application thereof

<130> 20F-1589-WOP

<160> 48

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> an inverted repeat of shRNA5

<400> 1

gcguuccaau uaacaccaau a 21

<210> 2

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> Another inverted repeat sequence of shRNA5

<400> 2

uauugguguu aauuggaacg c 21

<210> 3

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> an inverted repeat of shRNA6

<400> 3

gccucuucuc guuccucauc a 21

<210> 4

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> Another inverted repeat sequence of shRNA6

<400> 4

ugaugaggaa cgagaagagg c 21

<210> 5

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> an inverted repeat of shRNA7

<400> 5

gccaaacugu cacuaagaaa u 21

<210> 6

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> Another inverted repeat sequence of shRNA7

<400> 6

auuucuuagu gacaguuugg c 21

<210> 7

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> an inverted repeat of shRNA9

<400> 7

gcuacaucac gaacgcuuuc u 21

<210> 8

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> Another inverted repeat sequence of shRNA9

<400> 8

agaaagcguu cgugauguag c 21

<210> 9

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> an inverted repeat of shRNA10

<400> 9

ggaagagaca gguacguuaa u 21

<210> 10

<211> 21

<212> RNA

<213> Artificial Sequence

<220>

<223> Another inverted repeat sequence of shRNA10

<400> 10

auuaacguac cugucucuuc c 21

<210> 11

<211> 53

<212> RNA

<213> Artificial Sequence

<220>

<223> shRNA5

<400> 11

gcguuccaau uaacaccaau acucgaguau ugguguuaau uggaacgcuu uuu 53

<210> 12

<211> 53

<212> RNA

<213> Artificial Sequence

<220>

<223> shRNA6

<400> 12

gccucuucuc guuccucauc acucgaguga ugaggaacga gaagaggcuu uuu 53

<210> 13

<211> 53

<212> RNA

<213> Artificial Sequence

<220>

<223> shRNA7

<400> 13

gccaaacugu cacuaagaaa ucucgagauu ucuuagugac aguuuggcuu uuu 53

<210> 14

<211> 53

<212> RNA

<213> Artificial Sequence

<220>

<223> shRNA9

<400> 14

gcuacaucac gaacgcuuuc ucucgagaga aagcguucgu gauguagcuu uuu 53

<210> 15

<211> 53

<212> RNA

<213> Artificial Sequence

<220>

<223> shRNA10

<400> 15

ggaagagaca gguacguuaa ucucgagauu aacguaccug ucucuuccuu uuu 53

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA5

<400> 16

gcgttccaat taacaccaat a 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA5

<400> 17

tattggtgtt aattggaacg c 21

<210> 18

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA6

<400> 18

gcctcttctc gttcctcatc a 21

<210> 19

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA6

<400> 19

tgatgaggaa cgagaagagg c 21

<210> 20

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA7

<400> 20

gccaaactgt cactaagaaa t 21

<210> 21

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA7

<400> 21

atttcttagt gacagtttgg c 21

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA9

<400> 22

gctacatcac gaacgctttc t 21

<210> 23

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA9

<400> 23

agaaagcgtt cgtgatgtag c 21

<210> 24

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA10

<400> 24

ggaagagaca ggtacgttaa t 21

<210> 25

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial sense strand of DNA encoding shRNA10

<400> 25

attaacgtac ctgtctcttc c 21

<210> 26

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA5

<400> 26

tattggtgtt aattggaacg c 21

<210> 27

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA5

<400> 27

gcgttccaat taacaccaat a 21

<210> 28

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA6

<400> 28

tgatgaggaa cgagaagagg c 21

<210> 29

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA6

<400> 29

gcctcttctc gttcctcatc a 21

<210> 30

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA7

<400> 30

atttcttagt gacagtttgg c 21

<210> 31

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA7

<400> 31

gccaaactgt cactaagaaa t 21

<210> 32

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA9

<400> 32

agaaagcgtt cgtgatgtag c 21

<210> 33

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA9

<400> 33

gctacatcac gaacgctttc t 21

<210> 34

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA10

<400> 34

attaacgtac ctgtctcttc c 21

<210> 35

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> partial antisense strand of DNA encoding shRNA10

<400> 35

ggaagagaca ggtacgttaa t 21

<210> 36

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> sense strand of DNA encoding shRNA5

<400> 36

gcgttccaat taacaccaat actcgagtat tggtgttaat tggaacgctt ttt 53

<210> 37

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> sense strand of DNA encoding shRNA6

<400> 37

gcctcttctc gttcctcatc actcgagtga tgaggaacga gaagaggctt ttt 53

<210> 38

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> sense strand of DNA encoding shRNA7

<400> 38

gccaaactgt cactaagaaa tctcgagatt tcttagtgac agtttggctt ttt 53

<210> 39

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> sense strand of DNA encoding shRNA9

<400> 39

gctacatcac gaacgctttc tctcgagaga aagcgttcgt gatgtagctt ttt 53

<210> 40

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> sense strand of DNA encoding shRNA10

<400> 40

ggaagagaca ggtacgttaa tctcgagatt aacgtacctg tctcttcctt ttt 53

<210> 41

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> antisense strand of DNA encoding shRNA5

<400> 41

aaaaagcgtt ccaattaaca ccaatactcg agtattggtg ttaattggaa cgc 53

<210> 42

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> antisense strand of DNA encoding shRNA6

<400> 42

aaaaagcctc ttctcgttcc tcatcactcg agtgatgagg aacgagaaga ggc 53

<210> 43

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> antisense strand of DNA encoding shRNA7

<400> 43

aaaaagccaa actgtcacta agaaatctcg agatttctta gtgacagttt ggc 53

<210> 44

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> antisense strand of DNA encoding shRNA9

<400> 44

aaaaagctac atcacgaacg ctttctctcg agagaaagcg ttcgtgatgt agc 53

<210> 45

<211> 53

<212> DNA

<213> Artificial Sequence

<220>

<223> antisense strand of DNA encoding shRNA10

<400> 45

aaaaaggaag agacaggtac gttaatctcg agattaacgt acctgtctct tcc 53

<210> 46

<211> 5

<212> DNA

<213> Artificial Sequence

<220>

<223> transcription terminator

<400> 46

ttttt 5

<210> 47

<211> 6

<212> RNA

<213> Artificial Sequence

<220>

<223> sequence of the stem-loop

<400> 47

cucgag 6

<210> 48

<211> 6

<212> DNA

<213> Artificial Sequence

<220>

<223> sequence of the stem-loop

<400> 48

ctcgag 6

Claims (27)

1. An siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of the E, M, N genes of SARS-CoV-2 virus and comprises any pair of sequences selected from the group consisting of:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

2. An shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, N genes of SARS-CoV-2 virus and comprises any pair of sequences selected from the group consisting of:

(a) an inverted repeat pair consisting of complementary SEQ ID NO 1 and SEQ ID NO 2;

(b) an inverted repeat pair consisting of complementary SEQ ID NO 3 and SEQ ID NO 4;

(c) an inverted repeat pair consisting of complementary SEQ ID NO 5 and SEQ ID NO 6;

(d) an inverted repeat pair consisting of complementary SEQ ID NO 7 and SEQ ID NO 8; and

(e) the pair of inverted repeats consisting of complementary SEQ ID NO 9 and SEQ ID NO 10.

3. An shRNA according to claim 2, wherein the shRNA targets one of the E, M, N genes and comprises any one of the sequences shown as SEQ ID NO 11-15.

4. An shRNA according to claim 3, wherein the shRNA targets the N gene and comprises the sequence shown in SEQ ID NO 12.

5. An shRNA according to claim 3, wherein the shRNA targets the M gene and comprises the sequence shown in SEQ ID NO 14.

6. A DNA encoding the shRNA of claim 2, wherein said DNA comprises any set of sequences selected from the group consisting of:

(a) the sense strand comprises the sequences shown as SEQ ID NO 16 and SEQ ID NO 17, and the antisense strand comprises the sequences shown as SEQ ID NO 26 and SEQ ID NO 27;

(b) the sense strand comprises the sequences shown as SEQ ID NO. 18 and SEQ ID NO. 19, and the antisense strand comprises the sequences shown as SEQ ID NO. 28 and SEQ ID NO. 29;

(c) the sense strand comprises the sequences shown as SEQ ID NO 20 and SEQ ID NO 21, and the antisense strand comprises the sequences shown as SEQ ID NO 30 and SEQ ID NO 31;

(d) the sense strand comprises the sequences shown as SEQ ID NO. 22 and SEQ ID NO. 23, and the antisense strand comprises the sequences shown as SEQ ID NO. 32 and SEQ ID NO. 33; and

(e) the sense strand comprises the sequences shown as SEQ ID NO. 24 and SEQ ID NO. 25 and the antisense strand comprises the sequences shown as SEQ ID NO. 34 and SEQ ID NO. 35.

7. The DNA of claim 6, wherein the DNA comprises a pair of sequences selected from the group consisting of:

(a) the sense strand is a sequence shown as SEQ ID NO. 36, and the antisense strand is a sequence shown as SEQ ID NO. 41;

(b) the sense strand is a sequence shown as SEQ ID NO. 37, and the antisense strand is a sequence shown as SEQ ID NO. 42;

(c) the sense strand is a sequence shown as SEQ ID NO. 38, and the antisense strand is a sequence shown as SEQ ID NO. 43;

(d) the sense strand is a sequence shown as SEQ ID NO. 39, and the antisense strand is a sequence shown as SEQ ID NO. 44; and

(e) the sense strand is the sequence shown as SEQ ID NO. 40, and the antisense strand is the sequence shown as SEQ ID NO. 45.

8. The DNA of claim 7, wherein the shRNA targets the N gene and the DNA comprises the following sequence:

the sense strand is the sequence shown in SEQ ID NO. 37, and the antisense strand is the sequence shown in SEQ ID NO. 42.

9. The DNA of claim 7, wherein the shRNA targets the M gene and the DNA comprises the following sequence:

the sense strand is the sequence shown as SEQ ID NO. 39, and the antisense strand is the sequence shown as SEQ ID NO. 44.

10. A medicament for inhibiting SARS-CoV-2 viral replication in a subject, wherein the medicament comprises a vector and a nucleic acid sequence encoding a single or a plurality of shRNA according to any of claims 2 to 5.

11. The medicament of claim 10, comprising a vector and a nucleic acid sequence encoding a single shRNA.

12. The medicament according to claim 11, wherein the shRNA targets the N gene and comprises the sequence shown in SEQ ID NO 12.

13. The medicament according to claim 11, wherein the shRNA targets the M gene and comprises the sequence shown in SEQ ID NO. 14.

14. The medicament of claim 10, wherein the medicament comprises a vector and a nucleic acid sequence encoding a plurality of shrnas.

15. The medicament of claim 10, wherein the nucleic acid sequences encoding the plurality of shrnas are in the same vector.

16. The agent of claim 15, wherein the nucleic acid sequences encoding each shRNA are linked in direct tandem or by way of a linker.

17. The agent of claim 15, wherein the nucleic acid sequences encoding each shRNA are driven by the same promoter or different promoters.

18. The medicament of claim 15, wherein the plurality of shrnas target the same gene or different genes in E, M, N genes.

19. The medicament of claim 10, wherein the nucleic acid sequences encoding the plurality of shrnas are in a plurality of separate vectors.

20. The medicament of claim 19, wherein the plurality of shrnas target different ones of E, M, N genes.

21. The medicament of claim 19, wherein the plurality of independent carriers are the same carrier.

22. The medicament of claim 10, wherein the vector is a viral vector.

23. The medicament of claim 22, wherein the nucleic acid sequence is located in the genome of the viral vector.

24. The medicament of claim 22, wherein the viral vector is selected from the group consisting of: retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, baculovirus or lentivirus.

25. The medicament of claim 10, formulated as a spray formulation.

26. The medicament of claim 25, formulated as a nasal spray.

27. A pharmaceutical composition comprising the medicament of any one of claims 10-26 and a pharmaceutically acceptable excipient.

Images