WO2021259244A1

WO2021259244A1 - Shrna for inhibiting replication of sars-cov-2 virus and application of shrna

Info

Publication number: WO2021259244A1
Application number: PCT/CN2021/101493
Authority: WO
Inventors: 苏金; 赵金存; 杨鹏辉; 孙静; 苗凯
Original assignee: 深圳霁因生物医药转化研究院
Priority date: 2020-06-23
Filing date: 2021-06-22
Publication date: 2021-12-30
Also published as: CN112111489A

Abstract

Provided are siRNA and shRNA for inhibiting replication of the SARS-COV-2 virus, and an encoding DNA of the shRNA, and a drug and a drug composition comprising said shRNA.

Description

ShRNA inhibiting SARS-COV-2 virus replication and its application

Technical field

The invention relates to a shRNA (short hairpin RNA), in particular to a shRNA for inhibiting SARS-COV-2 virus replication and its application.

Background technique

New Coronavirus Pneumonia (Corona Virus Disease 2019, COVID-19), referred to as "New Coronary Pneumonia", is a global pandemic with the widest impact that humans have encountered in the past 100 years, posing a huge threat to global public health security. At present, there is no specific treatment or medicine for new coronary pneumonia. Disease control mainly relies on strict physical isolation to cut off the transmission route, which directly causes serious economic losses.

For severe and critical cases, the following methods can be used for treatment: (1) Respiratory support, including oxygen therapy, high-flow nasal catheter oxygen therapy or non-invasive mechanical ventilation, invasive mechanical ventilation and rescue treatment; (2) Circulatory support, adequate On the basis of fluid resuscitation, improve microcirculation, use vasoactive drugs, and perform hemodynamic testing if necessary; (3) Renal failure and renal replacement therapy; (4) Recovered patients' plasma therapy; (5) Blood purification therapy, etc. . For general patients, the following methods can be used for treatment: bed rest, attention to maintaining a stable internal environment, and timely effective oxygen therapy measures based on oxygen saturation.

At present, the drug treatments that can be tried include: interferon alpha, lopinavir/ritonavir, ribavirin, chloroquine phosphate and arbidol, ribavirin, etc. The treatment course of trial drugs should not exceed 10 days. Relevant drugs should be stopped when untolerable side effects occur.

Therefore, it is necessary to provide more drugs and methods for the treatment of new coronary pneumonia.

Summary of the invention

One aspect of the present invention provides an siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and includes any one selected from the following combinations A pair of sequences:

(a) An inverted repeat sequence pair composed of complementary SEQ ID NO:1 and SEQ ID NO:2;

(b) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 3 and SEQ ID NO: 4;

(c) An inverted repeat sequence pair composed of complementary SEQ ID NO: 5 and SEQ ID NO: 6;

(d) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 7 and SEQ ID NO: 8; and

(e) An inverted repeat sequence pair composed of complementary SEQ ID NO: 9 and SEQ ID NO: 10.

Another aspect of the present invention provides a shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and comprises a combination selected from Any pair of sequences:

Another aspect of the present invention provides a shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and includes SEQ ID NO: 11 Any one of the sequences shown in -15.

Another aspect of the present invention provides a DNA encoding shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus, and the DNA comprises Any set of sequences selected from the following combinations:

(a) The sense strand contains the sequence shown in SEQ ID NO: 16 and SEQ ID NO: 17, and the antisense strand contains the sequence shown in SEQ ID NO: 26 and SEQ ID NO: 27;

(b) The sense strand includes the sequence shown in SEQ ID NO: 18 and SEQ ID NO: 19, and the antisense strand includes the sequence shown in SEQ ID NO: 28 and SEQ ID NO: 29;

(c) The sense strand includes the sequence shown in SEQ ID NO: 20 and SEQ ID NO: 21, and the antisense strand includes the sequence shown in SEQ ID NO: 30 and SEQ ID NO: 31;

(d) The sense strand contains the sequence shown in SEQ ID NO: 22 and SEQ ID NO: 23, and the antisense strand contains the sequence shown in SEQ ID NO: 32 and SEQ ID NO: 33; and

(e) The sense strand includes the sequences shown in SEQ ID NO: 24 and SEQ ID NO: 25, and the antisense strand includes the sequences shown in SEQ ID NO: 34 and SEQ ID NO: 35.

(a) The sense strand is the sequence shown in SEQ ID NO: 36, and the antisense strand is the sequence shown in SEQ ID NO: 41;

(b) The sense strand is the sequence shown in SEQ ID NO: 37, and the antisense strand is the sequence shown in SEQ ID NO: 42;

(c) The sense strand is the sequence shown in SEQ ID NO: 38, and the antisense strand is the sequence shown in SEQ ID NO: 43;

(d) The sense strand is the sequence shown in SEQ ID NO: 39, and the antisense strand is the sequence shown in SEQ ID NO: 44; and

(e) The sense strand is the sequence shown in SEQ ID NO: 40, and the antisense strand is the sequence shown in SEQ ID NO: 45.

Another aspect of the present invention provides a drug for inhibiting SARS-CoV-2 virus replication in a subject, wherein the drug comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 virus replication, wherein The shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides a method for inhibiting SARS-CoV-2 virus replication in a subject, the method comprising administering to the subject in need an effective amount of the drug of the present invention, wherein the drug comprises a vector and a coded single or Nucleic acid sequences of multiple shRNAs that inhibit SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides the application of the medicament of the present invention in the preparation of a medicament for inhibiting the replication of SARS-CoV-2 virus in a subject, wherein the medicament comprises a vector and a code for single or multiple inhibition of SARS-CoV-2 virus The nucleic acid sequence of the replicated shRNA, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides a pharmaceutical composition for inhibiting SARS-CoV-2 virus replication in a subject, wherein the pharmaceutical composition comprises a vector and encoding single or multiple shRNAs that inhibit SARS-CoV-2 virus replication A nucleic acid sequence drug and a pharmaceutically acceptable excipient, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides a method for inhibiting SARS-CoV-2 virus replication in a subject, the method comprising administering to the subject in need an effective amount of the pharmaceutical composition of the present invention, wherein the pharmaceutical composition contains Vectors, drugs and pharmaceutically acceptable excipients that encode single or multiple shRNA nucleic acid sequences that inhibit SARS-CoV-2 virus replication, wherein the shRNA targets E, M, and N of SARS-CoV-2 virus One of the genes. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides the application of the pharmaceutical composition of the present invention in the preparation of a drug for inhibiting SARS-CoV-2 virus replication in a subject, wherein the pharmaceutical composition comprises a carrier containing a single or multiple SARS-inhibiting -Drugs and pharmaceutically acceptable excipients of the nucleic acid sequence of the shRNA replicated by the CoV-2 virus, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a chronic virus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides a drug set for inhibiting SARS-CoV-2 replication in a subject, the drug set comprising two or more drugs or pharmaceutical compositions of the present invention that exist independently.

Description of the drawings

Figure 1: Transfection efficiency of adeno-associated virus packaged shRNA. The full-field cell scanning analyzer (Celigo) scans and counts the fluorescence intensity of Green fluorescent protein (GFP), SARS-N and DAPI, and calculates the transfection efficiency. Among them, the multiplicity of infection (MOI) is 0.05.

Figure 2: The interference effect of adeno-associated virus packaged shRNA. The full-field cell scanning analyzer (Celigo) scans and counts the fluorescence intensity of GFP, SARS-N and DAPI, and calculates the interference efficiency. The MOI is 0.05. #, p=0.26, no statistical difference.

Figure 3: The interference effect of lentivirus packaged shRNA. The viral nucleoprotein of each group (GFP, shRNA5, shRNA6, shRNA7, shRNA9, shRNA10) was measured by immunofluorescence method, and the interference efficiency was calculated. ***, p<0.001, the difference is statistically significant.

Figure 4: Immunofluorescence detection of the interference effect of lentivirus packaged shRNA. Use a fluorescence microscope to take pictures.

Figure 5: Virus titer determination. The Focus-forming Assay (FFA) was used to determine the virus titer in cell culture. ****, p<0.0001, the difference is statistically significant.

Figure 6: Detection of virus copy number. Enzyme-linked spot analyzer CTL S6 Ultra was used for spot counting. Among them, 5 represents the shRNA5 group, 6 represents the shRNA6 group, 7 represents the shRNA7 group, 9 represents the shRNA9 group, and 10 represents the shRNA10 group.

Figure 7: Body weight changes of mice infected with SARS-Cov-2. shRNA6N represents the shRNA6 group, where N represents that shRNA6 is a sequence designed for the N protein of the virus; shRNA9M represents the shRNA9 group, where M represents that shRNA9 is a sequence designed for the M protein of the virus.

Figure 8: Virus titer in lung tissue of mice after SARS-Cov-2 infection. shRNA-6N represents the shRNA6 group, where N represents that shRNA6 is a sequence designed for the N protein of the virus; shRNA-9M represents the shRNA9 group, where M represents that shRNA9 is a sequence designed for the M protein of the virus. ****, p<0.0001, the difference is statistically significant.

detailed description

definition

In the present invention, the term "treatment" refers to therapeutic and preventive measures that prevent or slow down the occurrence of undesirable physiological changes or conditions in a subject, such as the occurrence of pulmonary fibrosis or cancer progression. Favorable or desired clinical effects include, but are not limited to, alleviation of symptoms, reduction of disease degree, stabilization of disease state (that is, no deterioration), delay or slowdown of disease progression, reduction or alleviation of disease state, and partial or partial disease All are cured, regardless of whether the above effects are detectable. "Treatment" can also refer to prolonged survival compared to no treatment. The objects in need of treatment include those who have already suffered from the disease or condition, as well as those who are likely to suffer from the disease or condition, or those who want to prevent the disease or condition.

"Subject" or "patient" or "individual" refers to any subject for which diagnosis, prognosis, or treatment is desired, especially a mammalian subject. Mammals include humans, domestic animals, farm animals, zoo animals, sports animals, or pets, such as dogs, cats, pigs, rabbits, rats, mice, horses, cows, cows, and the like. The object referred to herein is preferably a human.

As used herein, the term "patient in need of treatment" or "subject in need of treatment" includes subjects who benefit from the administration of the polypeptides or compositions thereof for testing, diagnostic and/or therapeutic purposes of the present invention, such as mammalian subjects. .

Those of ordinary skill in the art should also understand that the modified genomes as disclosed herein can be modified so that they differ in nucleotide sequence from the modified polynucleotides from which they are derived. For example, a polynucleotide or nucleotide sequence derived from a specified DNA sequence can be similar, for example, it has a certain percentage identity with the starting sequence, for example, it can be 60%, 70%, 75%, or 60% with the starting sequence. 80%, 85%, 90%, 95%, 98%, or 99% are the same.

In addition, nucleotide or amino acid substitutions, deletions or insertions can be made to make conservative substitutions or changes in "non-essential" regions. For example, a polypeptide or amino acid sequence derived from a specified protein, except for one or more individual amino acid substitutions, insertions or deletions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 Except for one or more single amino acid substitutions, insertions or deletions), the rest may be the same as the starting sequence. In certain embodiments, the polypeptide or amino acid sequence derived from the specified protein has 1 to 5, 1 to 10, 1 to 15, or 1 to 20 individual amino acid substitutions, insertions, or deletions relative to the starting sequence.

As used herein, the term "therapeutically effective amount" or "effective amount" refers to when the drug or pharmaceutical composition of the present invention is administered alone or in combination with another therapeutic agent to a cell, tissue, or subject, it Effectively prevent or slow down the amount of the disease or condition to be treated. A therapeutically effective dose further refers to the amount of the compound sufficient to cause alleviation of symptoms, such as treating, curing, preventing or alleviating related medical conditions, or improving the treatment rate, cure rate, prevention rate, or alleviation rate of the symptoms . When administered to an individual administered active ingredient alone, the therapeutically effective amount refers to the individual ingredient. When a combination is administered, the therapeutically effective amount refers to the combined amount of active ingredients that produce a therapeutic effect, regardless of whether it is administered in combination, continuous or simultaneous. A therapeutically effective amount will reduce symptoms usually by at least 10%; usually at least 20%; preferably at least about 30%; more preferably at least 40% and most preferably at least 50%.

In the present invention, "about" means that the index value is within the acceptable error range of the specific value determined by a person of ordinary skill in the art, and the value partly depends on how it is measured or determined (that is, the limit of the measurement system). For example, "about" can mean within one or more than one standard deviation in every practice in the art. Alternatively, "about" or "substantially comprising" can mean up to 20% of the range. In addition, for biological systems or processes, the term can mean at most an order of magnitude or at most 5 times the value. Unless otherwise stated, when a specific value appears in this application and claims, the meaning of "about" or "substantially comprising" should be assumed to be within the acceptable error range of the specific value.

SARS-CoV-2

On January 9, 2020, under an electron microscope, scientists observed that the pathogen causing the pneumonia presented a typical corona virus shape with an envelope and a corona-like appearance. At the same time, the sequencing results of the pathogenic genome showed that its nucleic acid sequence was not completely consistent with the six previously discovered coronaviruses (such as SARS, MERS, etc.). Therefore, on January 12, 2020, the World Health Organization (WHO) named the new virus: 2019 Novel Coronavirus (2019-nCoV), and on February 11, the International Commission for Classification of Viruses (ICTV) named it It is SARS-CoV-2.

Patients infected with the new coronavirus have fever, fatigue, and dry cough as their main clinical manifestations. Upper respiratory tract symptoms such as nasal congestion and runny nose are rare. About half of the patients have difficulty breathing more than a week later. In severe cases, they rapidly progress to acute respiratory distress syndrome, septic shock, difficult to correct metabolic acidosis, and coagulation dysfunction. Severe and critically ill patients may have moderate to low fever during the course of their illness, or even no obvious fever. Some patients have mild onset symptoms, but no fever, and usually recover after 1 week. Judging from the status of the currently admitted cases, most patients have a good prognosis, and a few patients are critically ill and even die.

Coronavirus is a positive-stranded RNA virus, which is currently the virus with the largest genome among RNA viruses known to humans, with a length of 27 to 32 kb. Coronavirus can infect mammals, birds, and reptiles, including humans, pigs, cows, horses, camels, cats, dogs, bats, etc., and cause respiratory, digestive, liver, and nervous system diseases. Coronaviruses belong to the order Nidovirales and Coronaviridae, which can be divided into 4 (α, β, γ, and δ) coronavirus genera (Coronavirus). Before December 2019, there are 6 types of coronaviruses known to infect humans, including 2 types of alpha coronaviruses (HCoV-229E and HKU-NL63) and 4 types of beta coronaviruses (HCoV-OC43, HCoV-HKU1, SARS) -CoV and MERS-CoV). Among them, HCoV-OC43 and HCoV-HKU1 belong to the A subgroup, which usually cause mild upper respiratory tract infection symptoms, suppress immune activity, and occasionally cause severe lower respiratory tract infections in patients with weakened immunity or the elderly. SARS-CoV of B subgroup and MERS-CoV of C subgroup mainly invade the lower respiratory tract, causing acute respiratory distress syndrome and extrapulmonary clinical symptoms such as diarrhea, lymphopenia, liver dysfunction, and kidney injury. SARS-CoV-2 mainly invades alveolar epithelial cells and causes clinical symptoms similar to SARS-CoV and MERS-CoV infections.

The new coronavirus SARS-CoV-2 is an enveloped, unsegmented positive-stranded RNA virus with round or oval particles with a diameter of about 60-140nm and belongs to the β genus of the Coronavirus family. The genome length is about 30kb. The SARS-CoV-2 genome has a typical coronavirus structure. The genome has a cap-like structure at the 5'end and a poly A tail at the 3'end, which contains two flanking untranslated regions (UTR) and the entire open reading frame (ORF) encoding the polyprotein. . The main structural proteins of SARS-CoV-2 include spike (S) protein, envelope (E) protein, membrane (M) protein and nucleocapsid (N) protein. These proteins are essential for the binding of the virus to cell receptors, and are necessary to complete the structure of the virus.

The term "E" refers to the E gene (Gene ID: 43740570), which encodes (envelope, E) protein. The E protein contains a hydrophobic domain and a transmembrane alpha helix domain, which is a component of the virus envelope and participates in the assembly and release of virus particles. Compared with SARS-CoV, the E protein sequence of SARS-CoV-2 has 95% homology. The E protein of SARS-CoV can also function as an ion channel in the form of a pentameric structure, which also suggests the functional diversity of E protein in the process of SARS-CoV-2 virus replication and pathogenicity.

The term "M" refers to the M gene (Gene ID: 43740571), which encodes a membrane (M) protein. The M protein contains 3 transmembrane domains and 1 conserved domain. It is a component of the virus envelope and participates in the assembly and release of virus particles. Compared with SARS-CoV, the M protein sequence of SARS-CoV-2 has up to 91% homology. The M protein of SARS-CoV is only expressed in the endoplasmic reticulum and Golgi apparatus, and its conserved domains participate in the process of virus assembly and budding through protein-protein interactions. In addition, there are two conceptual changes in M protein, which play an important role in the structural stability and functional expression of other structural proteins (S, E, and N proteins). In the host cell, the envelope of the coronavirus is produced by the endoplasmic reticulum-Golgi intermediate (ERGIC), in which the M protein is responsible for the construction of the envelope skeleton, and the E protein is responsible for the generation of envelope curvature and the mature virus particle package. The final cut of the film.

The term "N" refers to the N gene (Gene ID: 43740575), which encodes the nucleocapsid (N) protein. The N protein sequence is highly conserved and plays an important role in the process of virus replication. The main function is to bind to the RNA of the virus. The N protein forms a complex with the viral RNA structure, and then under the joint action of the M protein and the E protein, it enters the virus capsid after being encapsulated. N protein contains N1 and N2 epitopes. Epitope N1 can stimulate the body to produce high-affinity antibodies, but generally has no neutralizing activity. Studies have found that the N protein of β-coronavirus B subgroup can undergo serum cross-reaction. Compared with SARS-CoV, the N protein homology of SARS-CoV-2 is as high as 90%. Therefore, the serum of SARS-CoV-2 patients may recognize the N protein of SARS-CoV, which can be used for clinical detection of asymptomatic SARS-CoV-2 carriers.

RNA interference

RNA interference (RNA interference, RNAi) refers to the phenomenon that double-stranded RNA molecules (dsRNA) enter human cells to specifically degrade the homologous mRNA, thereby specifically and efficiently inhibiting the expression activity of the corresponding gene. RNA interference was first discovered in plants and lower organisms. With the deepening of research, it has also been discovered in higher eukaryotes recently, and it has proved to be an important evolutionary conservation phenomenon. When a dsRNA homologous to the coding region of an endogenous mRNA is introduced into a cell, the mRNA is degraded to cause gene expression silencing, which is a special type of post-transcriptional gene slience (PTGS). In treatment, RNAi works by delivering small RNA duplexes, including microRNA (miRNA) mimics, small interfering RNA (siRNA), short hairpin RNA (shRNA) and Dicer substrate RNA (dsiRNA). It has been proved that siRNA is cleaved by dsRNA-specific endonuclease (Dicer enzyme). RNA-induced silencing complex (RISC) is composed of siRNA combined with a multi-enzyme complex. It is located in a specific part of mRNA and exerts endonuclease and exonuclease activities to act on mRNA. In addition to gene silencing (degrading mRNA) at the transcriptional level, siRNA has also been shown to reduce protein expression by silencing the promoter by DNA methylation.

Because the use of RNAi has a high degree of sequence specificity and effective interference, it can specifically silence specific genes, thereby obtaining gene function loss or gene expression reduction, so this technology has been widely used to explore gene function, cancer and other diseases. The therapeutic area of antiviral infection.

siRNA

Small interfering RNA (siRNA), sometimes called short interfering RNA or silencing RNA, is a type of double-stranded RNA molecule that is 20-25 base pairs in length, similar to miRNA, and operates within the RNA interference (RNAi) pathway. It interferes with post-transcriptionally degraded mRNA of specific genes expressing complementary nucleotide sequences, thereby preventing translation. siRNA is cut into double-stranded RNA (double stranded RNA, dsRNA) by RNase III (such as Dicer) into double-stranded RNA with a size of 21-25bp in the cell.

In one aspect of the present invention, there is provided an siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of the E, M, and N genes of SARS-CoV-2 virus and has a combination selected from Any pair of sequences in:

(c) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 5 and SEQ ID NO: 6;

Table 1 lists SEQ ID NO:1-10.

序列IDSerial ID	核酸序列Nucleic acid sequence
SEQ ID NO:1SEQ ID NO:1	GCGUUCCAAUUAACACCAAUAGCGUUCCAAUUAACACCAAUA
SEQ ID NO:2SEQ ID NO: 2	UAUUGGUGUUAAUUGGAACGCUAUUGGUGUUAAUUGGAACGC
SEQ ID NO:3SEQ ID NO: 3	GCCUCUUCUCGUUCCUCAUCAGCCUCUUCUCGUUCCUCAUCA

SEQ ID NO:4SEQ ID NO: 4	UGAUGAGGAACGAGAAGAGGCUGAUGAGGAACGAGAAGAGGC
SEQ ID NO:5SEQ ID NO: 5	GCCAAACUGUCACUAAGAAAUGCCAAACUGUCACUAAGAAAU
SEQ ID NO:6SEQ ID NO: 6	AUUUCUUAGUGACAGUUUGGCAUUUCUUAGUGACAGUUUGGC
SEQ ID NO:7SEQ ID NO: 7	GCUACAUCACGAACGCUUUCUGCUACAUCACGAACGCUUUCU
SEQ ID NO:8SEQ ID NO: 8	AGAAAGCGUUCGUGAUGUAGCAGAAAGCGUUCGUGAUGUAGC
SEQ ID NO:9SEQ ID NO: 9	GGAAGAGACAGGUACGUUAAUGGAAGAGACAGGUACGUUAAU
SEQ ID NO:10SEQ ID NO: 10	AUUAACGUACCUGUCUCUUCCAUUAACGUACCUGUCUCUUCC

Table 1 Sequence of SEQ ID NO: 1-10

In addition, any one of the sequences shown in SEQ ID NO: 1-10 has at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively Polynucleotides having a sequence identity of at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% are considered to be within the scope of the present invention.

shRNA

Short hairpin RNA (short hairpin RNA, shRNA) includes two short inverted repeat sequences. The shRNA cloned into the shRNA expression vector includes two short inverted repeats, separated by a loop sequence in the middle, forming a hairpin structure. Generally, shRNA expression is controlled by RNA polymerase (Pol) III promoter or modified pol II promoter. Then connect the transcription terminator. After the shRNA is transcribed, two short inverted repeats connected by a stem loop pair together to form a characteristic hairpin structure. In some embodiments, the transcription terminator is 5-6 Ts. In some embodiments, the transcription terminator is 5 T (TTTTT (SEQ ID NO: 46)).

The stem loop in the shRNA insert should be close to the center of the oligonucleotide. Stem loops of different sizes and nucleotide sequences have been successfully used. In some embodiments, the sequence of the stem loop is CUCGAG (SEQ ID NO: 47) or CTCGAG (SEQ ID NO: 48).

shRNA is usually introduced into cells using vectors and can be passed to progeny cells so that gene silencing can be inherited. The hairpin structure of shRNA can be cleaved into siRNA by the cellular mechanism, and then the mRNA can be degraded according to the aforementioned mechanism. Its biggest advantage is that it has a high degree of effectiveness and specificity, as well as rapid defense and treatment effects. Its role has shown immeasurable value in the field of gene function research and the treatment of various diseases, especially the treatment of viral diseases, such as anti-AIDS (HIV), hepatitis C virus (HCV), and type B Studies on viruses such as hepatitis virus (HBV) and poliovirus (Poliovirus) have found that RNAi has an excellent effect on inhibiting the replication of these viruses.

In one aspect of the present invention, there is provided a shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and includes a combination selected from Any pair of sequences in:

In another aspect of the present invention, there is provided a shRNA that inhibits the replication of SARS-CoV-2 virus, wherein the shRNA targets one of the E, M, and N genes of SARS-CoV-2 virus and contains as SEQ ID NO: One of the sequences shown in 11-15. Table 2 lists SEQ ID NO: 11-15.

Table 2 Sequence of SEQ ID NO: 11-15

In some embodiments, the shRNA targets the N gene and includes the sequence shown in SEQ ID NO: 12. In some embodiments, the shRNA targets the M gene and includes the sequence shown in SEQ ID NO: 14.

In addition, any one of the sequences shown in SEQ ID NO: 11-15 has at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternative Polynucleotides having a sequence identity of at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% are considered to be within the scope of the present invention.

DNA encoding shRNA

Deoxyribonucleic acid (English Deoxyribo Nucleic Acid, abbreviated as DNA) is one of the nucleic acids contained in four biological macromolecules in biological cells. DNA carries the genetic information necessary to synthesize RNA and protein. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose and phosphoric acid. There are 4 kinds of bases: adenine (A), guanine (G), thymine (T) and cytosine (C). The strand of DNA that carries the nucleotide sequence encoding the amino acid information of the protein is called the sense strand, also known as the coding strand, the sense strand or the positive strand (+ strand). The nucleotide sequence of the other strand is complementary to the sense strand and is called the antisense strand. The strand that has the same nucleotide sequence as the mRNA (U instead of T) is called the sense strand. A single strand of DNA double-strand that can direct transcription to generate RNA according to the rule of base pairing is called the template strand.

As used herein, the term "encoding" refers to any process by which information in a polymer macromolecule or sequence string is used to direct the production of a second molecule or sequence string that is different from the first molecule or sequence string. As used herein, the term is widely used and can have various applications. In one aspect, the term "encoding" describes the process of semi-conservative DNA replication in which one strand of a double-stranded DNA molecule is used as a template to encode a newly synthesized complementary sister strand by a DNA-dependent DNA polymerase. In another aspect, the term "encoding" refers to any process by which information in one molecule is used to direct the production of a second molecule that has a different chemical property from the first molecule. For example, a DNA molecule can encode an RNA molecule (e.g., by participating in the transcription process of a DNA-dependent RNA polymerase). Moreover, RNA molecules can encode polypeptides, as in the translation process. When used to describe the translation process, the term "encode" also extends to triplet codons that encode amino acids. In some aspects, RNA molecules can encode DNA molecules, for example, by participating in the reverse transcription process of RNA-dependent DNA polymerase. In another aspect, a DNA molecule can encode a polypeptide, where it should be understood that "encoding" as used in this case encompasses both transcription and translation processes.

In one aspect of the present invention, there is provided a DNA encoding shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and the DNA contains any set of sequences selected from the following combinations:

In another aspect of the present invention, there is provided a DNA encoding a shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and all The DNA contains any set of sequences selected from the following combinations:

Table 3 lists SEQ ID NO: 16-45.

Table 3 Sequence of SEQ ID NO: 16-40

In some embodiments, the shRNA targets the N gene and the DNA includes the following sequence: the sense strand is the sequence shown in SEQ ID NO: 37, and the antisense strand is the sequence shown in SEQ ID NO: 42. In some embodiments, the shRNA targets the M gene and the DNA includes the following sequence: the sense strand is the sequence shown in SEQ ID NO: 39, and the antisense strand is the sequence shown in SEQ ID NO: 44.

In addition, any one of the sequences shown in SEQ ID NO: 16-45 has at least about 70%, or alternatively at least about 75%, or alternatively at least about 80%, or alternatively at least about 85%, or alternative Polynucleotides having a sequence identity of at least about 90%, or alternatively at least about 95%, or alternatively at least about 97% are considered to be within the scope of the present invention.

Identity

"Homology" or "identity" or "similarity" refers to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing the position in each sequence, which can be aligned for comparison purposes. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matches or homologous positions shared by the sequences. The "irrelevant" or "non-homologous" sequence shares less than 40% identity with one of the sequences of the invention, but preferably less than 25% identity.

A polynucleotide or a polynucleotide region (or a polypeptide or a polypeptide region) has a certain percentage of another sequence (for example, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% Or 99%) "sequence identity" means that when the two sequences are compared, the percentage of bases (or amino acids) is the same when comparing two sequences. This alignment and percent homology or sequence identity can be determined using software programs known in the art.

Nucleic acid sequence encoding shRNA

The terms "polynucleotide" and "nucleic acid" as used interchangeably herein refer to a polymerized form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. These terms include single-stranded, double-stranded or triple-stranded DNA, genomic DNA, cDNA, genomic RNA, mRNA, DNA-RNA hybrids, or polymers; the polymer contains purine or pyrimidine bases, or other natural, chemical, Biochemically modified, non-natural or derived nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (usually found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide may contain polymers of synthetic subunits (e.g. phosphoramidates), and therefore may be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidates- Phospholipid diester oligomers.

In one aspect of the present invention, there is provided a drug for inhibiting SARS-CoV-2 replication in a subject, wherein the drug comprises a vector and a nucleic acid sequence encoding single or multiple shRNAs that inhibit SARS-CoV-2 virus replication, wherein The shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus.

In some embodiments, the drug comprises a vector and a nucleic acid sequence encoding a single shRNA. In some embodiments, the shRNA targets the N gene and includes the sequence shown in SEQ ID NO: 12. In some embodiments, the shRNA targets the M gene and includes the sequence shown in SEQ ID NO: 14.

In some embodiments, the drug comprises a vector and a nucleic acid sequence encoding multiple shRNAs, wherein the shRNA targets one of the E, M, and N genes.

In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequence encoding each shRNA is directly connected in tandem or through a linker. In some embodiments, the nucleic acid sequence encoding each shRNA is driven by the same promoter or different promoters. In some embodiments, the multiple shRNAs target the same gene or different genes among the E, M, and N genes.

In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are directly connected in tandem and driven by the same promoter, and the multiple shRNAs target E The same gene in, M and N genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are directly connected in tandem and driven by the same promoter, and the multiple shRNAs target E , M, N genes in different genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are directly connected in tandem and driven by different promoters, and the multiple shRNAs target E The same gene in, M and N genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are directly connected in tandem and driven by different promoters, and the multiple shRNAs target E , M, N genes in different genes.

In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are connected by a linker and driven by the same promoter, and the multiple shRNAs target The same gene in E, M, and N genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are connected by a linker and driven by the same promoter, and the multiple shRNAs target Different genes in E, M, and N genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are connected by a linker and driven by different promoters, and the multiple shRNAs target The same gene in E, M, and N genes. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector, the nucleic acid sequences encoding each shRNA are connected by a linker and driven by different promoters, and the multiple shRNAs target Different genes in E, M, and N genes.

In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the multiple shRNAs target different genes among the E, M, and N genes. In some embodiments, the multiple independent vectors are the same vector.

As used herein, the term "linker" refers to a short nucleotide sequence comprising two or more identical or different nucleotides, wherein the nucleotides are selected from Adenine (Adenine, A ), Guanine (Guanine, G), Cytosine (Cytosine, C), Thymine (T) and Uracil (Uracil, U).

Promoter

Promoter is a DNA sequence that RNA polymerase recognizes, binds and starts transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription initiation point of structural genes. The promoter itself is not Transcription. There are three types of eukaryotic promoters, which are transcribed by RNA polymerases I, II, and III.

The RNA polymerase I promoter only controls the transcription of rRNA precursor genes, and the transcription product is cut and processed to generate various mature rRNAs. The RNA polymerase II promoter is designed to control the expression of many genes encoding proteins. The RNA polymerase III promoter is involved in the transcription of some small RNA molecules.

In some embodiments, the promoter is a modified RNA polymerase II promoter or RNA polymerase III promoter. In some embodiments, the RNA polymerase III promoter is selected from the group consisting of U6 promoter, H1 promoter, and tRNA promoter.

Viral vector

Viral vectors can bring genetic material into cells. The principle is to use the molecular mechanism of viruses to transmit their genomes into other cells for infection. Viral vectors can also be referred to as vectors, vector virus particles, or vector particles. Examples of viral vectors include, but are not limited to: retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, baculovirus, or lentivirus.

The retroviral vector can be derived or capable of being derived from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include but are not limited to: murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), mouse breast tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney Murine Leukemia Virus (Mo MLV), FBR Murine Osteosarcoma Virus (FBR MSV), Moloney Murine Sarcoma Virus (Mo-MSV), Abelson Murine Leukemia Virus (A-MLV), Avian Myeloma Virus-29 (MC29) And Avian Polycythemia Virus (AEV).

Adenoviruses are double-stranded linear DNA viruses that do not replicate through RNA intermediates. Adenovirus is a double-stranded DNA non-enveloped virus that can transduce a wide range of cell types of human and non-human origin in vivo, in vitro and in vitro. These cells include airway epithelial cells, hepatocytes, muscle cells, cardiomyocytes, synovial cells, primary breast epithelial cells, and terminally differentiated cells (e.g., neurons) after mitosis. Adenovirus has been used as a vector for gene therapy and heterologous gene expression. The large (36 kb) genome can accommodate up to 8 kb of foreign inserted DNA and can replicate efficiently in complementary cell lines to produce very high titers of up to 1012 transduction units per milliliter. Adenovirus is therefore one of the best systems for studying gene expression in primary non-replicating cells. The expression of viral genes or foreign genes from the adenoviral genome does not require replicating cells. Adenovirus vectors enter cells through receptor-mediated endocytosis. Once inside the cell, the adenovirus vector rarely integrates into the host chromosome. Instead, they exist as episomes (independent of the host genome) as a linear genome in the host cell nucleus.

Adeno-associated virus (adeno-associated virus, AAV), also known as adeno-associated virus, belongs to the genus of dependent viruses in the Parvoviridae family, and is the simplest type of single-stranded DNA-deficient virus found so far. Recombinant AAV vectors have been successfully used for the transduction of marker genes and genes involved in human diseases in vitro, in vitro and in vivo. Certain AAV vectors have been developed that can effectively bind large payloads (up to 8-9 kb).

Herpes simplex virus (HSV) is an enveloped double-stranded DNA virus that naturally infects neurons. It can accommodate large segments of foreign DNA and has been adopted as a carrier for gene delivery to neurons. The use of HSV during treatment requires attenuating the strains so that they cannot establish a lytic cycle. In particular, if the HSV vector is used for gene therapy in humans, it is preferable to insert the polynucleotide into the essential gene. This is because if the viral vector encounters a wild-type virus, the heterologous gene can be transferred to the wild-type virus by recombination. However, if the recombinant virus is constructed in a way that prevents its replication, this can be achieved by inserting oligonucleotides into viral genes necessary for replication.

The viral vector of the present invention may be a vaccinia virus vector, such as MVA or NYVAC. Alternatives to vaccinia vectors include, for example, fowlpox or canarypox (avipox) vectors called ALVAC, and strains derived therefrom, which can infect and express recombinant proteins in human cells but cannot replicate . It should be understood that part of the viral genome can remain intact after the insertion of the recombinant gene. This means that viral vectors can retain the concept of the ability to infect cells and subsequently express additional genes that support their replication and may promote the lysis and death of infected cells.

Lentiviruses are part of a larger group of retroviruses. Can be divided into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to: human immunodeficiency virus (HIV), the pathogen of human autoimmune deficiency syndrome (AIDS), and simian immunodeficiency virus (SIV). The non-primate lentivirus group includes the prototype "lentivirus" visna/maedi virus (VMV), as well as the related goat arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and feline immunodeficiency virus ( FIV) and Bovine Immunodeficiency Virus (BIV).

Pharmaceutical composition and medicine kit

"Pharmaceutical composition" refers to a pharmaceutical preparation for humans. The pharmaceutical composition comprises a suitable formulation of the medicament of the present invention and a carrier, stabilizer and/or excipient.

One aspect of the present invention provides a pharmaceutical composition comprising a medicament containing a vector and a nucleic acid sequence encoding at least one shRNA, and a pharmaceutically acceptable excipient, wherein the vector contains or carries the nucleic acid sequence encoding at least one shRNA, Wherein the shRNA targets one of the E, M, and N genes.

In order to prepare a pharmaceutical composition or a sterile composition, the drug is mixed with a pharmaceutically acceptable carrier or excipient. The preparation of therapeutic and diagnostic drugs in the form of, for example, lyophilized powder, slurry, aqueous solution or suspension can be prepared by mixing with physiologically acceptable carriers, excipients or stabilizers.

Pharmaceutically acceptable excipients are well known in the art. As used herein, "pharmaceutically acceptable excipients" include materials that when combined with the active ingredients of the composition allow the ingredients to maintain biological activity and do not cause a destructive reaction with the subject's immune system. These may include stabilizers, preservatives, salts or sugar complexes or crystals and the like. "Pharmaceutically acceptable" refers to molecules and ingredients that do not produce allergic reactions or similar undesired reactions when administered to the human body. It is known in the art how to prepare an aqueous composition containing as an active ingredient. Generally, these compositions are prepared as injections or sprays, such as liquid solutions or suspensions; they can also be prepared in solid forms suitable for formulating solutions or suspensions before injection or spraying.

The medicament or pharmaceutical composition of the present invention can be used alone or in combination with each other. Correspondingly, the present invention provides a medicine kit to facilitate the above-mentioned combination therapy, which contains two or more independent drugs or pharmaceutical compositions of the present invention. In some embodiments, individuals sometimes administer two or more drugs or pharmaceutical compositions of the present invention at the same time. In some embodiments, individuals sometimes administer two or more drugs or pharmaceutical compositions of the present invention separately.

Methods and treatment

One aspect of the present invention provides a method for inhibiting SARS-CoV-2 virus replication in a subject, the method comprising administering an effective amount of the drug of the present invention to the subject in need, wherein the drug comprises a vector and a single or Nucleic acid sequences of multiple shRNAs that inhibit SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Further, the present invention provides the application of the drug of the present invention in a method for inhibiting SARS-CoV-2 virus replication, wherein the drug comprises a vector and a nucleic acid encoding a single or multiple shRNA that inhibits SARS-CoV-2 virus replication Sequence, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Another aspect of the present invention provides a method for inhibiting SARS-CoV-2 virus replication in a subject, the method comprising administering to the subject in need an effective amount of the pharmaceutical composition of the present invention, wherein the pharmaceutical composition comprises A drug containing a vector, a nucleic acid sequence encoding a single or multiple shRNA that inhibits SARS-CoV-2 virus replication, and a pharmaceutically acceptable excipient, wherein the shRNA targets E, M, and M of the SARS-CoV-2 virus One of the N genes. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Further, the present invention provides the use of the pharmaceutical composition of the present invention in a method for inhibiting SARS-CoV-2 virus replication, wherein the pharmaceutical composition comprises a vector containing a vector and encoding single or multiple SARS-CoV-2 viruses Drugs and pharmaceutically acceptable excipients that replicate the nucleic acid sequence of shRNA, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus. In some embodiments, the medicament comprises a vector and a shRNA encoding a single shRNA that inhibits SARS-CoV-2 virus replication. In some embodiments, the medicament comprises a vector and a plurality of shRNA encoding a plurality of shRNAs that inhibit SARS-CoV-2 virus replication. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in the same vector. In some embodiments, the nucleic acid sequences encoding multiple shRNAs are located in multiple independent vectors. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adeno-associated virus. In some embodiments, the virus is a lentivirus. In some embodiments, the nucleic acid sequence is located in the genome of the viral vector.

Suitable routes of administration include parenteral administration (for example, intramuscular, intravenous or subcutaneous administration) and oral administration. The drugs or pharmaceutical compositions of the method of the present invention can be administered in a variety of conventional ways, such as transtracheal intubation, oral ingestion, inhalation, topical application, or transdermal, subcutaneous, intraperitoneal, parenteral, and intraarterial administration. Or intravenous injection. In some embodiments, the medicament of the present invention is formulated as a spray formulation. In some embodiments, the drug is formulated as a nasal spray formulation.

The appropriate dose is determined by the clinician, for example, using parameters or factors known or suspected to affect the treatment or expected to affect the treatment in the art. Usually, the starting dose is slightly lower than the optimal dose, and thereafter a small increase until the desired or optimal effect is achieved relative to any adverse side effects. Important diagnostic measures include measuring, for example, inflammatory symptoms or the level of inflammatory cytokines produced.

The medicament or pharmaceutical composition of the present invention can be administered by continuous administration or by administration at certain intervals (for example, one day, one week, or 1-7 times a week). The dose can be provided by tracheal intubation, intravenous, subcutaneous, intraperitoneal, transdermal, topical, oral, transnasal, transrectal, intramuscular, intracerebral, or intraspine. A preferred dosage regimen is a regimen that includes the maximum dosage or dosing frequency that avoids significant undesirable side effects.

Example 1 Interference effect of adeno-associated virus packaged shRNA

Virus strain

The new coronavirus (SARS-CoV-2) strain (GenBank: MT123290) was isolated from a patient's throat swab and stored in the P3 laboratory of Guangzhou Customs Technology Center.

Reagent materials

Vero E6 cells, 96-well cell culture plate, DMEM medium, 2% bovine serum DMEM medium, primary antibody, secondary antibody, etc. Freshly prepared 10% hypochlorous acid solution, 4% paraformaldehyde, 1.6% CMC.

experimental method

Take susceptible SARS-COV-2 in Vero E6 cells according to 1x10 ⁴ cells / well were plated in 96-well plates. After 24 hours of adherence, each well was transfected with lipofectamine 3000 reagent according to the amount of 0.25 μg of shRNA contained in adeno-associated virus. Observe the transfection efficiency after 24h.

Bring the 96-well plate into P3, and add SARS-COV-2 at a dose (non-lethal dose) with a multiplicity of infection (MOI) of 0.05. Cells are fixed and stained. During the period, observe the cell morphology under the microscope and observe the degree of cytopathic changes under the microscope. Then, the full-field cell scanning analyzer (Celigo) scans and counts the fluorescence intensity of GFP, SARS-N and DAPI, and calculates the transfection efficiency and interference efficiency.

The specific steps of cell fixation and staining are as follows:

(1) Add 1ml/well 4% paraformaldehyde and fix at room temperature for ≥1h.

(2) Add 1ml/well 4% paraformaldehyde to a new 24-well plate, and transfer the cell slide to the 24-well plate. UV irradiation for 30min. Move out of the P3 laboratory.

(3) Discard the fixative.

(4) Wash the plate 3 times with PBS, 200μl/well.

(5) Use 1% BSA containing 0.2% Triton to seal and perforate, 200 μl/well, and place at room temperature for 20-30 minutes.

(6) Wash with PBS three times.

(7) Primary antibody: 1% BSA diluted anti-SARS-N polyclonal antibody (Yiqiao Shenzhou, 40143-T62, 3 times diluted with BSA and glycerol, 1:1000 used) 200μl/well, incubated at 37°C for 1h.

(8) Wash the plate: discard the primary antibody, wash the plate 3 times with PBST (0.1% Tween), 200 μl/well, and discard the liquid.

(9) Secondary antibody: 1% BSA diluted with Alexa

594 AffiniPure Donkey Anti-Rabbit IgG(H+L)(Jackson, 1:500) 200μl/well, incubate at 37°C for 1h.

(10) Wash the plate: discard the secondary antibody, wash the plate 3 times with PBST, 200μl/well. Discard the liquid.

(11) DAPI staining: DAPI (10μg/ml) was diluted 5 times with PBS, 200μl/well, room temperature, protected from light, 15min.

(12) Wash with PBS three times, and keep it for the last time.

Experimental result

Figure 1 shows the transfection efficiency of 10 shRNAs. Among them, the transfection efficiency of shRNA2, 3, 8 is higher, and the transfection efficiency of shRNA6, 7, 9, 10 is lower. Figure 2 shows the interference effects of 10 shRNAs. The results show that shRNA6 has a significant interference effect, while shRNA5 and shRNA7 also have a certain interference effect. Although the effects of shRNA9 and shRNA10 are not obvious, it may be because of their low transfection efficiency (23% and 16%, respectively).

Furthermore, shRNA5 (SEQ ID NO: 11, targeting N protein), shRNA6 (SEQ ID NO: 12, targeting N protein), shRNA7 (SEQ ID NO: 13, targeting N protein), shRNA9 (SEQ ID NO: 14. Targeting M protein), shRNA10 (SEQ ID NO: 15, targeting E protein) were packaged into lentivirus, and stable transfected cells were constructed for verification.

Example 2 Interference effect of lentivirus packaged shRNA

experimental method

The packaged lentivirus Vero E6 cells were infected, the puromycin resistance stably transfected cells were screened, of 1.5 * 10 ⁴ cells / well were plated in 96-well plates for 24h adherent, according to infection (MOI) of of SARS-COV-2 was added at a dose of 0.05 (non-lethal dose). Immunofluorescence (same as in Example 1) was used to determine the infection efficiency.

Experimental result

As shown in Figures 3 and 4, compared with the control, the interference effects of shRNA5, shRNA6, shRNA7, shRNA9, and shRNA10 contained in the lentivirus package are extremely significant.

Example 3 The influence of shRNA on virus replication

experimental method

The Vero E6 cell line stably transfected with different shRNAs was ^{seeded into a 24-well plate with 1×10 5} cells per well, with 4 replicates per shRNA, and GFP was used as the control. Inoculate SARS-CoV-2 at MOI=0.05, scrape the cell culture supernatant and cells together at 24h after infection, freeze and thaw once, use Focus-forming Assay (FFA) to determine the virus droplets in the cell culture Spend. Specific steps are as follows:

1. VeroE6 cells are seeded on a 96-well flat bottom plate, 2×104 cells/well.

2. Wait until the cell confluence reaches 100%

(1) Take 20 μl of virus solution to be tested, dilute it continuously with DMEM containing 2% FBS by 10 times, and mix thoroughly.

(2) Discard the cell culture medium, add virus supernatants of different dilution multiples to the cell wells, 50 μL/well, shake slightly to make the liquid evenly cover the bottom surface. Incubate at 37°C (5% CO ₂ ) for 1 hour. (1.6% CMC can be preheated during this period).

(3) After 1 hour, discard the mixture of virus liquid and serum, and add 100 μL/well of 1.6% CMC.

(4) Incubate at 37°C (5% CO ₂ ) for 1 day.

3. Cell fixation and staining:

(1) Add 200μL/well of 4% paraformaldehyde and fix at room temperature for ≥1h.

(2) Discard the fixative and culture medium. Refill with 4% paraformaldehyde. 30 minutes of UV irradiation. Move out of the P3 laboratory.

(3) Discard the fixative.

(4) Wash the plate 3 times with PBS, 200 μL/well.

(5) Use 1% BSA containing 0.2% Triton to seal and perforate, 50 μL/well, and place at room temperature for 20-30 minutes.

(6) Wash with PBS three times.

(7) Primary antibody: 1% BSA diluted anti-SARS-N polyclonal antibody (Yiqiao Shenzhou, 40143-T62, 1:4000) 50μL/well, incubated at 37°C for 1h.

(9) Secondary antibody: Goat anti-rabbit IgG-HRP (Jackson, 1:6000) diluted with 1% BSA, 50μL/well, placed on a shaker, and incubated at 37°C for 1h.

(10) Wash the plate: discard the secondary antibody, wash the plate 3 times with PBST, 200 μL/well. Discard the liquid.

(11) Color development: TrueBlue (KPL, cat.no.50-78-02) 50μL/well, at room temperature, placed for 5-10min.

(12) Wash the plate three times with ddH2O and spin dry.

(13) Enzyme-linked spot analyzer CTL S6 Ultra is used for spot counting. Calculation: virus titer (FFU/ml) = count number × 20 × corresponding dilution.

Experimental result

As shown in Figures 5 and 6, shRNA5, 6, 7, 9, 10 all have varying degrees of inhibiting SARS-COV-2 replication, and shRNA6 and shRNA9 have the most significant effects.

Example 4 shRNA6 and shRNA9 inhibit SARS-CoV-2 in mice

Choose shRNA6 and shRNA9 that have the best effect in in vitro cell experiments for in vivo experiments.

experimental method

Vector and virus packaging: siRNA6 and siRNA9 are connected to the same AAV9 vector as ACE2 to construct AAV9-CMV-ACE2-U6-shRNA6 and AAV9-CMV-ACE2-U6-shRNA6 plasmids. The control group uses irrelevant siRNA sequences (NC -siRNA) Construction of AAV9-CMV-ACE2-U6-shNC-RNA plasmid. The above three plasmids were packaged into AAV.

Mice infected with AAV and SARS-Cov-2: 6-week-old female BALB/c mice were anesthetized with 1% sodium pentobarbital, then fixed on a foam board, and the laryngoscope was inserted into the mouse In the throat, the glottis is exposed. Insert the lancet with the plastic hose into the glottis carefully, pull out the needle and leave the plastic hose in place, and use the spray needle to give 2*10 ¹¹ AAV-shRNA viruses/control viruses. Nasal drip method: Take 6-week-old female BALB/c mice and anesthetize with isoflurane. ^{2*10 11} AAV-shRNA viruses/control viruses were instilled through the nasal cavity. Seventeen days after infection with AAV, the animals were transported to the P3 laboratory and infected with 1.0×10 ⁵ PFU of SARS-Cov-2 by nasal drip.

Observe the body weight of the mice: before infection and from day 1 to day 10 after infection, the changes in the body weight of the mice were detected.

To detect the level of virus replication in animals: prepare a homogenate from animal tissues on the 1st and 3rd day after infection with SARS-Cov-2, add 0.9ml DMEM to each well of a 48-well plate, 10 times serial dilution, and remove the culture In the plate, add 200μl of diluted virus sample. The culture plate is placed in the protective box, and then placed in the cell culture box for 1 hour. Gently shake every 15 minutes (put the culture plate in a sealable protective box and transport it to the incubator for culture). Remove the inoculum from the culture plate. Mix 7ml of 2x 2% DMEM medium and 7ml of 56°C 1.2% agarose, add 1ml to each well of the culture plate; after the culture plate is cooled in the biological safety cabinet, add 0.5ml of 2% bovine serum DMEM medium to each well. Put it into a protective box and place it in a cell culture box for 2 days. Two days later, the culture plate was taken out of the cell incubator, and 1 ml of 25% formalin solution was added to each well in the biological safety cabinet, and the plate was fixed at room temperature for 20 minutes. Remove the fixative and agarose plugs, and add 1ml of 0.1% crystal violet solution to each well. Stain at room temperature for 3 minutes. Remove the dye solution, add _{1ml ddH 2} O to each well and wash once. Count virus plaques.

Experimental result

As shown in Figure 7, the weight of mice administered shRNA6 only slightly decreased on the first day after being infected with SARS-Cov-2, and then returned to normal and exceeded the initial body weight; mice administered shRNA9 suffered from SARS-Cov-2 infection. The body weight dropped significantly in the first 3 days, and then gradually increased, but did not recover the initial weight; the mice administered with the control (Ctrl) vector dropped extremely significantly in the first 6 days after the SARS-Cov-2 infection, and then gradually increased, but recovered Less than initial weight. On the 10th day after SARS-Cov-2 infection, the weight of mice in the shRNA6 group of the control group lost the most, followed by the shRNA9 group. The weight of the mice in the shRNA6 group did not change significantly.

As shown in Figure 8, on the 1st and 3rd days after SARS-Cov-2 infection, the virus titers in the lung tissues of mice in the shRNA-6N group and shRNA-9M group were significantly lower than those in the control group (p<0.0001) . It shows that shRNA6 and shRNA9 have a significant inhibitory effect on SARS-CoV-2 in mice, and the effect of shRNA6 is more significant.

It should be understood that although the present invention has been specifically disclosed through preferred embodiments and optional features, those skilled in the art can make modifications, improvements and changes to the present invention disclosed herein, and these modifications, improvements and changes are considered Within the scope of the present invention. The materials, methods, and examples provided herein are representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the technology.

Claims

An siRNA that inhibits SARS-CoV-2 virus replication, wherein the siRNA targets one of the E, M, and N genes of SARS-CoV-2 virus and contains any pair of sequences selected from the following combinations:

(a) An inverted repeat sequence pair composed of complementary SEQ ID NO:1 and SEQ ID NO:2;

(b) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 3 and SEQ ID NO: 4;

(c) An inverted repeat sequence pair composed of complementary SEQ ID NO: 5 and SEQ ID NO: 6;

(d) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 7 and SEQ ID NO: 8; and

(e) An inverted repeat sequence pair composed of complementary SEQ ID NO: 9 and SEQ ID NO: 10.
A shRNA that inhibits SARS-CoV-2 virus replication, wherein the shRNA targets one of the E, M, and N genes of the SARS-CoV-2 virus and contains any pair of sequences selected from the following combinations:

(a) An inverted repeat sequence pair composed of complementary SEQ ID NO:1 and SEQ ID NO:2;

(b) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 3 and SEQ ID NO: 4;

(c) An inverted repeat sequence pair composed of complementary SEQ ID NO: 5 and SEQ ID NO: 6;

(d) An inverted repeat sequence pair consisting of complementary SEQ ID NO: 7 and SEQ ID NO: 8; and

(e) An inverted repeat sequence pair composed of complementary SEQ ID NO: 9 and SEQ ID NO: 10.
The shRNA according to claim 2, wherein the shRNA targets one of the E, M, and N genes and comprises any one of the sequences shown in SEQ ID NO: 11-15.
The shRNA according to claim 3, wherein the shRNA targets the N gene and comprises the sequence shown in SEQ ID NO: 12.
The shRNA according to claim 3, wherein the shRNA targets the M gene and comprises the sequence shown in SEQ ID NO: 14.
A DNA encoding the shRNA of claim 2, wherein the DNA comprises any set of sequences selected from the following combinations:

(a) The sense strand contains the sequence shown in SEQ ID NO: 16 and SEQ ID NO: 17, and the antisense strand contains the sequence shown in SEQ ID NO: 26 and SEQ ID NO: 27;

(b) The sense strand includes the sequence shown in SEQ ID NO: 18 and SEQ ID NO: 19, and the antisense strand includes the sequence shown in SEQ ID NO: 28 and SEQ ID NO: 29;

(c) The sense strand includes the sequence shown in SEQ ID NO: 20 and SEQ ID NO: 21, and the antisense strand includes the sequence shown in SEQ ID NO: 30 and SEQ ID NO: 31;

(d) The sense strand contains the sequences shown in SEQ ID NO: 22 and SEQ ID NO: 23, and the antisense strand contains the sequences shown in SEQ ID NO: 32 and SEQ ID NO: 33; and

(e) The sense strand includes the sequences shown in SEQ ID NO: 24 and SEQ ID NO: 25, and the antisense strand includes the sequences shown in SEQ ID NO: 34 and SEQ ID NO: 35.
The DNA according to claim 6, wherein the DNA comprises a pair of sequences selected from the group consisting of:

(a) The sense strand is the sequence shown in SEQ ID NO: 36, and the antisense strand is the sequence shown in SEQ ID NO: 41;

(b) The sense strand is the sequence shown in SEQ ID NO: 37, and the antisense strand is the sequence shown in SEQ ID NO: 42;

(c) The sense strand is the sequence shown in SEQ ID NO: 38, and the antisense strand is the sequence shown in SEQ ID NO: 43;

(d) The sense strand is the sequence shown in SEQ ID NO: 39, and the antisense strand is the sequence shown in SEQ ID NO: 44; and

(e) The sense strand is the sequence shown in SEQ ID NO: 40, and the antisense strand is the sequence shown in SEQ ID NO: 45.
The DNA of claim 7, wherein the shRNA targets the N gene and the DNA comprises the following sequence:

The sense strand is the sequence shown in SEQ ID NO: 37, and the antisense strand is the sequence shown in SEQ ID NO: 42.
The DNA of claim 7, wherein the shRNA targets the M gene and the DNA comprises the following sequence:

The sense strand is the sequence shown in SEQ ID NO: 39, and the antisense strand is the sequence shown in SEQ ID NO: 44.
A drug for inhibiting SARS-CoV-2 virus replication in a subject, wherein the drug comprises a vector and a nucleic acid sequence encoding a single or multiple shRNA according to any one of claims 2 to 5.
The medicine according to claim 10, which comprises a vector and a nucleic acid sequence encoding a single shRNA.
The drug according to claim 11, wherein the shRNA targets the N gene and comprises the sequence shown in SEQ ID NO: 12.
The drug according to claim 11, wherein the shRNA targets the M gene and comprises the sequence shown in SEQ ID NO: 14.
The drug according to claim 10, wherein the drug comprises a vector and a nucleic acid sequence encoding a plurality of shRNAs.
The drug according to claim 10, wherein the nucleic acid sequences encoding multiple shRNAs are located in the same vector.
The drug according to claim 15, wherein the nucleic acid sequence encoding each shRNA is directly connected in tandem or through a linker.
The drug according to claim 15, wherein the nucleic acid sequence encoding each shRNA is driven by the same promoter or different promoters.
The medicament according to claim 17, wherein the promoter is a modified RNA polymerase II promoter or RNA polymerase III promoter.
The medicament according to claim 18, wherein the RNA polymerase III promoter is selected from the group consisting of U6 promoter, H1 promoter, and tRNA promoter.
The medicament according to claim 15, wherein the multiple shRNAs target the same gene or different genes among the E, M, and N genes.
The drug according to claim 10, wherein the nucleic acid sequence encoding a plurality of shRNAs are located in a plurality of independent vectors.
The medicament according to claim 21, wherein the plurality of shRNAs target different genes among the E, M, and N genes.
The drug according to claim 21, wherein the plurality of independent carriers are the same carrier.
The drug according to claim 10, wherein the vector is a viral vector.
The drug according to claim 24, wherein the nucleic acid sequence is located in the genome of the viral vector.
The medicament according to claim 24, wherein the viral vector is selected from: retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, vaccinia virus, baculovirus or lentivirus.
The drug according to claim 26, wherein the viral vector is an adeno-associated virus.
The drug according to claim 27, wherein the viral vector is a lentivirus.
The medicine according to claim 10, wherein the subject is a mammal.
The medicament according to claim 10, wherein the mammal is a human.
The medicine according to claim 10, which is formulated as a spray formulation.
The medicine according to claim 26, which is formulated as a nasal spray formulation.
A pharmaceutical composition comprising the drug according to any one of claims 10-26 and a pharmaceutically acceptable excipient.