CN112080509A - Strawberry vitamin C synthesis related gene FaGalLDH and application thereof - Google Patents
Strawberry vitamin C synthesis related gene FaGalLDH and application thereof Download PDFInfo
- Publication number
- CN112080509A CN112080509A CN202010988819.9A CN202010988819A CN112080509A CN 112080509 A CN112080509 A CN 112080509A CN 202010988819 A CN202010988819 A CN 202010988819A CN 112080509 A CN112080509 A CN 112080509A
- Authority
- CN
- China
- Prior art keywords
- fagalldh
- vitamin
- gene
- strawberry
- content
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
- C12Y103/02—Oxidoreductases acting on the CH-CH group of donors (1.3) with a cytochrome as acceptor (1.3.2)
- C12Y103/02003—L-Galactonolactone dehydrogenase (1.3.2.3)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a synthesis related gene FaGalLDH of strawberry vitamin C and application thereof, wherein the synthesis related gene FaGalLDH of strawberry vitamin C has the following structure shown in SEQ ID NO: 1. Application of a strawberry vitamin C synthesis related gene FaGalLDH in improving vitamin C content. Application of a gene FaGalLDH related to synthesis of strawberry vitamin C in improving salt tolerance of plants. After the gene is overexpressed in arabidopsis thaliana, a transgenic plant with obviously improved vitamin C (AsA) content is obtained, and the salt tolerance of the transgenic plant is improved. Experiments prove that the FaGalLDH gene can synthesize vitamin C in vitro, the optimal induction conditions are optimized and found, the vitamin C content of transgenic Arabidopsis leaves can be obviously improved through overexpression, and the normal growth of plants is not obviously influenced. The protein and the coding gene thereof have important theoretical and practical significance for researching the synthesis mechanism of the plant vitamin C and improving the improvement and stress resistance of the vitamin C content of the plant, and have wide application prospect.
Description
Technical Field
The invention relates to the technical field of plant molecular genetics and genetic engineering, in particular to a synthesis related gene FaGalLDH of strawberry vitamin C and application thereof.
Background
Strawberry (Fragaria x ananassa Duch.) is a perennial herb of the genus Fragaria of the family Rosaceae, and has bright fruit color, rich fragrance, palatable sour and sweet taste, high nutrition and health promotion value, and good reputation of "fruit queen". Strawberry fruits have been demonstrated to have strong antioxidant activity, associated with vitamin C and polyphenolic compounds contained in the fruits. Vitamin C (also called ascorbic acid) is a water-soluble vitamin, not only has positive prevention effect on diseases such as scurvy, arteriosclerosis, hypertension and the like of human, but also plays important roles in resisting oxidation, stress and the like in the growth and development process of plants. In addition, the vitamin C is one of the standards for measuring the internal quality of strawberry fruits, and the content of the vitamin C directly influences the nutritional value of the strawberry fruits, so that the research on the key gene for synthesizing the vitamin C is of great significance for improving the quality and production of the strawberries. L-galactose-1, 4-lactone dehydrogenase (GalLDH) is a key enzyme in vitamin C synthesis, but few studies on GalLDH genes in strawberry fruits are reported at present, so that the mechanism of the GalLDH genes in vitamin C accumulation is clarified, and the mechanism is important for strawberry production.
Disclosure of Invention
The technical problem to be solved by the invention is as follows: how to improve the content of vitamin C in strawberry fruits by using genetic engineering and provides a strawberry vitamin C synthesis related gene FaGalLDH and application thereof.
The invention solves the technical problems through the following technical scheme, and the synthesis related gene FaGalLDH of strawberry vitamin C has the following amino acid sequence shown in SEQ ID NO: 1.
The primer names and sequences of FaGalLDH cloning the gene are as follows:
FaGalLDH-F，CGATGCAGAGAGCTCTCACTCT；
FaGalLDH-R，CGTCAAATGGTATCAGACGATG。
the CDS region of the gene FaGalLDH comprises a complete open reading frame ORF, contains 1743bp and encodes 580 amino acids.
An expression vector containing the gene FaGalLDH.
The expression vector is as follows: pMAL-FaGalLDH.
The application of the strawberry vitamin C synthesis related gene FaGalLDH in improving the vitamin C content.
The application of the strawberry vitamin C synthesis related gene FaGalLDH in improving the salt tolerance of plants.
The gene FaGalLDH is transferred into Arabidopsis thaliana for overexpression, and 50-200 mM NaCl is used for treating the transgenic Arabidopsis thaliana.
Compared with the prior art, the invention has the following advantages: the invention provides a strawberry vitamin C synthesis related gene FaGalLDH and application thereof, a prokaryotic expression vector pMAL-FaGalLDH is constructed, strawberry pMAL-FaGalLDH in-vitro expression protein is obtained by purification, the condition of catalyzing vitamin C synthesis is optimized, and the protein is found to have highest activity under the conditions of 25 ℃ and pH4.0. After the gene is overexpressed in arabidopsis thaliana, a transgenic plant with obviously improved vitamin C (AsA) content is obtained, and the salt tolerance of the transgenic plant is improved. Experiments prove that the FaGalLDH gene can synthesize vitamin C in vitro, the optimal induction conditions are optimized and found, the vitamin C content of transgenic Arabidopsis leaves can be obviously improved through overexpression, and the normal growth of plants is not obviously influenced. The protein and the coding gene thereof have important theoretical and practical significance for researching the synthesis mechanism of the plant vitamin C and improving the improvement and stress resistance of the vitamin C content of the plant, and have wide application prospect.
Drawings
FIG. 1 is an electrophoretogram of the results of PCR amplification of the FaGalLDH gene;
in the figure, M is DL2000 DNA Marker; 1. 2 and 3 are the PCR amplification result of the FaGalLDH gene;
FIG. 2 is a graph showing the development period of strawberry and the content of vitamin C in the organs;
in the figure, a, vitamin C content in different tissue parts; B. vitamin C content in fruits of 5 developmental stages;
FIG. 3 is a graph showing the development period of strawberry and the expression level of FaGalLDH in organs;
in the figure, A, FaGalLDH gene expression quantity of different tissue organs of strawberry; B. FaGalLDH gene expression level of strawberry fruits at 5 developmental stages;
FIG. 4 is a pMAL-c5X-FaGalLDH protein induction map;
FIG. 5 is a diagram of pMAL-c5X-FaGalLDH protein induction purification;
in the figure, 1, protein inclusion body 2, crushed supernatant 3, purified protein;
FIG. 6 is a schematic representation of the effect of temperature and pH on FaGalLDH enzyme activity;
in the figure, a, effect of temperature on FaGalLDH enzyme activity; B. effect of pH on FaGalLDH enzyme activity.
FIG. 7 is the validation results of over-expressing the FaGalLDH gene in transgenic Arabidopsis;
in the figure, A, semi-quantitative analysis; B. the expression level of FaGalLDH gene; C. the enzymatic activity of FaGalLDH; D. vitamin C (AsA) content;
FIG. 8 is a photograph showing the root length of Arabidopsis thaliana cultured for 13 d;
FIG. 9 is the root length of wild and transgenic Arabidopsis thaliana at NaCl concentration.
Detailed Description
The following examples are given for the detailed implementation and specific operation of the present invention, but the scope of the present invention is not limited to the following examples.
Firstly, cloning a target gene as follows:
design of specific primers
Taking cDNA of 'Hongyan' strawberry fruit as a template, FaGalLDH-F as an upstream primer and FaGalLDH-R as a downstream primer, carrying out PCR reaction, cloning to obtain a FaGalLDH gene, wherein a CDS region of the FaGalLDH comprises a complete Open Reading Frame (ORF) containing 1743bp and encoding 580 amino acids.
And secondly, comparing the vitamin C content of the "Hongyan" and the "octoji" which are not expressed by the FaGalLDH with the vitamin C content of the "Hongyan" and the "octoji" which are expressed by the FaGalLDH.
The vitamin C content can be determined by 2, 6-dichlorophenol indophenol titration. Weighing a proper amount of about 5g of a sample to be detected, adding a small amount of 2% oxalic acid solution, grinding in an ice bath, fully grinding, filtering to 50mL by using a funnel, and fixing the volume by using 2% oxalic acid solution. Then sucking 10mL of solution to be detected into a conical flask, titrating the solution to pink with calibrated 2, 6-dichlorophenol indophenol solution until the solution is not faded within 15s, and recording the dosage V of the titrating solution0(ii) a Blank control determination, 10mL of 2% oxalic acid solution was pipetted into a conical flask and titrated with a calibrated 2, 6-dichlorophenol indophenol solution, and the amount of the titrated solution V was recorded1。
The formula:
m: the amount of VC contained in each 100g of sample is mg/100 g.
V0: the volume of 2, 6-dichlorophenol indophenol solution used for the sample was titrated, mL.
V1: volume of 2, 6-dichlorophenol indophenol solution used for blank control, mL.
A: 1mL2, 6-dichlorophenol indophenol solution corresponds to the amount of VC, mg/mL.
B: the amount of the sample to be measured in mL is used in titration.
a: sample size, g, of the sample to be tested.
b: the volume of the sample to be measured is determined as mL.
The vitamin C content in different tissues and organs of the two varieties of the "Hongyan" and the "octopus" was tested. The results showed that the vitamin C content of the strawberry of "Hongyan" was significantly higher in the development stages of 5 fruits and different tissues and organs than in the variety "Octopus" (see FIG. 2). In addition, B in fig. 2 shows: the vitamin C content of the two varieties of the 'Hongyan' and the 'Zhangji' is in a total obvious rising trend in the fruit development process, namely the vitamin C level of the mature fruit is the highest, and the content of the small green fruit is the least; as can be seen from A in FIG. 2, the vitamin C content in the root, stem, leaf and flower organs was as high as that of the leaf but lower than that of the mature fruit, and the vitamin C content in the flower was as low as 0.17mg/100g and 1.15mg/100g, respectively. It can be easily seen from A and B in FIG. 3 that the content of vitamin C is greatly different in different development stages and different organ tissues of the two strawberry varieties, and has obvious tissue specificity.
Real-time quantitative PCR detected the spatiotemporal expression pattern of the FaGalLDH gene in 'russian' and 'octopus' strawberries. It can be seen from a of fig. 3 that the expression level of FaGalLDH in "red color" was higher than that in "octopus" in the roots, stems, flowers and mature fruits of both "red color" and "octopus"; the FaGalLDH expression level of the flowers was very low in both strawberry varieties, similar to the vitamin C content. And the expression level in roots, stems, leaves and flowers is lower than that of mature fruits; in fig. 3B, the expression level of FaGalLDH was the highest in the mature period with the growth and development tendency in all 5 developmental stages of the strawberry fruit, and the expression level of FaGalLDH was lower than that of "reddish" in each period. These expression patterns are clearly and positively correlated with the vitamin C content in the strawberries in fig. 2, indicating that FaGalLDH expression is closely related to the accumulation of vitamin C content.
Protein function verification of strawberry FaGalLDH gene
pMAL-c5X-FaGalLDH protein expression vector was constructed, and pMAL-c5X-FaGalLDH was induced at 28 ℃ with a final concentration of IPTG of 0.5 mM. The theoretical size of the pMAL-c5X-FaGalLDH fusion protein was predicted to be 104kDa based on DNAMAN8 analysis. From FIG. 4, it can be seen that no protein product appears from 0h, the induced protein product increases from 1h after the induction, and the increase of the expression band is obvious at 6 h. In contrast, the strains in which the empty vector pMAL-c5X and the expression vector were not induced by IPTG had no protein product expressed; the induced protein band in the figure is similar to the predicted protein in size, and can be determined as the target protein. Taken together, induction at 28 ℃ for 6h with a final IPTG concentration of 0.5mM induced the pMAL-c5X-FaGalLDH protein.
Inducing protein expression at 28 ℃ under the condition that the IPTG final concentration is 0.5mM, collecting thalli for 6h, carrying out ultrasonic crushing on the induced bacterial liquid under the condition that the temperature is 4 ℃, carrying out ultrasonic crushing for 3s, stopping the ultrasonic crushing for 3s, and repeating for 90 times; after crushing, centrifuging for 20-30min at 4 ℃ and 10000rpm to obtain a protein crude extract. Purifying the target protein by using starch resin. And the purified target band in FIG. 5 is identical to that in FIG. 4, and there is a protein band around 100kD, indicating that the purification yielded a prokaryotic expressed protein of FaGalLDH.
The enzymatic activity of FaGalLDH protein catalyzing the synthesis of vitamin C was determined. The results are shown in FIG. 6. The enzyme activity of FaGalLDH proteins was measured at different temperatures and pH. Where in fig. 6 a can be found: under the condition of different temperatures from 5 ℃ to 25 ℃, the FaGalLDH protease activity increases along with the increase of the temperature, and when the temperature exceeds 25 ℃, the enzyme activity decreases along with the increase of the temperature, which indicates that the optimal temperature of the FaGalLDH enzyme activity is 25 ℃. In addition, B in FIG. 6 shows that the enzyme activity of FaGalLDH shows a trend of increasing and then decreasing with increasing pH value in different pH environments, and the activity is best at pH around 4.0, indicating that the optimum pH of the enzyme activity is about 4.0.
Fourth, overexpression function verification in Arabidopsis thaliana
Through an agrobacterium-mediated method, the inflorescence of arabidopsis (Col-0) is infected by using pCXSN-FLAG-FaGalLDH-GV3101 bacterial liquid, transgenic arabidopsis is obtained through screening, and two strains Line1 and Line2 are selected for subsequent experiments. The vitamin C content, the expression amount of FaGalLDH gene and the FaGalLDH enzyme activity in wild arabidopsis (WT) and transgenic arabidopsis were measured, respectively, and the obtained results are shown in fig. 7. B in fig. 7 is a real-time quantitative PCR result showing that the expression level of FaGalLDH gene was significantly higher in the overexpression arabidopsis thaliana plants Line1 and Line2 than in the control plant (WT). Furthermore, the results of such semi-quantitative analysis (a in fig. 7) also showed that no band of FaGalLDH was detected in the wild arabidopsis plants, whereas the band of FaGalLDH was detected in the transgenic arabidopsis plants, and that the band of Line1 plants was significantly brighter than that of Line2, and in addition, FaGalLDH enzyme activities of the overexpressing arabidopsis Line1 and Line2 plants were increased by about 8-fold and 4-fold, respectively, as compared with WT (C in fig. 7). The vitamin C content of the transgenic plants Line1 and Line2 was increased by 80% and 20% compared to WT (D in FIG. 7). This is consistent with the expression results and enzyme activity results for the FaGalLDH gene. In conclusion, the strawberry FaGalLDH gene is over-expressed in Arabidopsis, the activity of the transgenic plant FaGalLDH is improved, and the content of vitamin C is also increased.
The wild arabidopsis thaliana and the overexpression transgenic arabidopsis thaliana are sown on an MS solid medium containing 0mM, 50mM, 100mM, 150mM and 200mM NaCl, vernalization is carried out for 3d at low temperature (4 ℃), after illumination culture for 13d, the growth condition of the arabidopsis thaliana is observed, photographing and recording are carried out, the result is shown in figure 8, the growth conditions of the wild arabidopsis thaliana and the FaGalLDH gene overexpression transgenic arabidopsis thaliana on the MS solid medium containing 0mM NaCl are similar, the growth of the stable overexpression transgenic arabidopsis thaliana is better than that of the wild arabidopsis thaliana under the treatment of 50mM NaCl, the root length is respectively increased by about 57.78% and 33.32% compared with that of the wild arabidopsis thaliana, and the root length of the stable overexpression transgenic arabidopsis thaliana. All Arabidopsis thaliana growth was inhibited under 200mM NaCl treatment, but the growth of transgenic Arabidopsis thaliana was slightly better than that of wild Arabidopsis thaliana. As shown in fig. 9, these cases indicate that FaGalLDH gene overexpression improves tolerance of arabidopsis plants to sodium chloride.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> agriculture university of Anhui
<120> strawberry vitamin C synthesis related gene FaGalLDH and application
<130> 100
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1743
<212> DNA
<213> Fragaria × ananassa Duch
<400> 1
atgcagagag ctctcactct gaagcgcacg ctccaatccc tccccagaat cactaaaaac 60
ccattgatcc cagggcgtgc attctgcaat gcttcaacac cgtcgccggc atcagcatct 120
gagctgcgca agtacatggg gtacaccgcc ctcgtgttat tctgcggtgc cgccacctac 180
tactctttcc catttcccga ggacgccaag cacaagaagg cccaaatctt ccgctacgcc 240
cctctccctg aggagctcca caccgtctct aactggagcg ggacccacga ggttcagacc 300
cgggtcttcc accagcccga gacccttgag gagctcgaga aagtagtcaa ggaggccaat 360
gctaggaagt accggattcg ccccgtcggc tctgggttgt cccccaatgg gattggattg 420
tccagggctg ggatggtcaa tttggctctc atggatgagg tcttggaggt ggataaggag 480
aagaagcgag tgagagtgca agctgggatc agggtccagc aattggttga tgggattaaa 540
gatcagggcc ttactttgca gaactttgca tccattaggg agcagcagat tgggggaatt 600
ctgcaggttg gtgctcatgg tactggtgca aggttacctc ctattgatga gcaggtgatc 660
agcatgaaat tggtcactcc tgccaaggga acaatagaag tctccaaggt aaaagatccg 720
gaactgtttt atttagctcg ctgtggcctt ggcggtcttg gagttgttgc tgaagttacc 780
ctccagtgtg ttgagagaca ggagcttgta gagcacacta ctgtttcaaa catggaagaa 840
atcaagaaaa atcacaagaa gttgctctcc gagaacaaac atgtgaagta cctctatatt 900
ccatataccg acactgttgt gattgtgaca tgcaaccctg tctcaaaatg gaaaggtccc 960
ccaaagttca aacccaaatt tacaacggat gaagccattc agcacgttcg tgatctatac 1020
agggactgcc tcaggaagta cagagtagtt ccagacaaca gcgtagatat agacgaactc 1080
tcttttacag agttgcgtga taaactcatt gccctaaatc ctctcaacaa ggatcatatc 1140
gttaaagtga atcaagctga ggcagagttc tggaggaagt cagagggata cagagtagga 1200
tggagtgatg aaattttggg ttttgactgt ggtggccaac aatgggtttc ggagacttgt 1260
tttccagctg gaactattgc caaacccagc atgaaagacc ttgaatacat agaagatcta 1320
aaacagctaa tagagaagga agagattcct gcgcctgctc caatagagca gcgttggaca 1380
gccagcagta agagccccat gagtccagct tcaagcttaa aggaggatga tatattttca 1440
tgggttggca ttatcatgta ccttccaacg acagatgccc gccaaagaaa ggatattaca 1500
gaagagtttt tccactacag gcatctaact cagacacagt tgtgggatac atattcttct 1560
tatgaacact gggccaagat tgaggtccca aaggacaaag aacaacttac cgctctgcag 1620
gcaaggctca ggaagcgttt tccagttgat gcctacaaca aagcacgatc ggagttagac 1680
ccaaaccgga tcctttcaaa cgtcaagctg gaaaagcttt ttccatcgtc tgataccatt 1740
tga 1743
Claims (9)
1. A gene FaGalLDH related to the synthesis of strawberry vitamin C, wherein the FaGalLDH gene has the amino acid sequence shown in SEQ ID NO: 1.
2. The gene FaGalLDH according to claim 1, wherein the primer names and sequences for cloning the gene FaGalLDH are as follows:
FaGalLDH-F，CGATGCAGAGAGCTCTCACTCT；
FaGalLDH-R，CGTCAAATGGTATCAGACGATG。
3. the gene FaGalLDH according to claim 1, wherein the CDS region of the gene FaGalLDH comprises a complete open reading frame ORF, 1743bp, encoding 580 amino acids.
4. An expression vector comprising the gene FaGalLDH of claim 1.
5. The expression vector of claim 4, wherein the expression vector is: pMAL-FaGalLDH.
6. The use of the strawberry vitamin C synthesis-associated gene FaGalLDH of claim 1 for increasing the vitamin C content in a plant.
7. The use as claimed in claim 6 wherein the expression vector for the gene FaGalLDH is used to express the protein after purification at 25 ℃ and pH 4.0.
8. The use of the strawberry vitamin C synthesis-associated gene FaGalLDH of claim 1 for increasing salt tolerance in a plant.
9. The use as claimed in claim 8, wherein the gene FaGalLDH is overexpressed in Arabidopsis thaliana treated with 50-200 mM NaCl.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010988819.9A CN112080509A (en) | 2020-09-18 | 2020-09-18 | Strawberry vitamin C synthesis related gene FaGalLDH and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010988819.9A CN112080509A (en) | 2020-09-18 | 2020-09-18 | Strawberry vitamin C synthesis related gene FaGalLDH and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112080509A true CN112080509A (en) | 2020-12-15 |
Family
ID=73739290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010988819.9A Pending CN112080509A (en) | 2020-09-18 | 2020-09-18 | Strawberry vitamin C synthesis related gene FaGalLDH and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112080509A (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006104503A1 (en) * | 2005-03-28 | 2006-10-05 | Virginia Tech Intellectual Properties, Inc. | Stress tolerant transgenic plants over-expressing genes of ascorbic acid synthesis-cell wall |
| CN104372015A (en) * | 2014-11-03 | 2015-02-25 | 青岛农业大学 | Peanut vitamin C synthesis related gene Ah PMM and application thereof |
| US20150322442A1 (en) * | 2012-12-21 | 2015-11-12 | Algenol Biofuels Inc. | Novel Shuttle Vector Capable of Transforming Multiple Genera of Cyanobacteria |
| CN105755018A (en) * | 2016-05-13 | 2016-07-13 | 中国农业科学院特产研究所 | Actinidia arguta L-galactonolactone dehydrogenase gene and expression method thereof |
| CN107164392A (en) * | 2017-07-11 | 2017-09-15 | 沈阳农业大学 | A kind of strawberry salt stress related genes FvDIV and its application |
| CN109182292A (en) * | 2018-09-25 | 2019-01-11 | 安徽农业大学 | A kind of strawberry glutathione transferase FaGST gene and its expression albumen and application |
| CN109337923A (en) * | 2018-11-07 | 2019-02-15 | 华中农业大学 | The method for improving Tomato Quality component Vitamin C content by multiple gene polymerization |
| CN110511272A (en) * | 2019-08-30 | 2019-11-29 | 南通大学 | A kind of corn ZmbHLH55 transcription factor and its application |
-
2020
- 2020-09-18 CN CN202010988819.9A patent/CN112080509A/en active Pending
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006104503A1 (en) * | 2005-03-28 | 2006-10-05 | Virginia Tech Intellectual Properties, Inc. | Stress tolerant transgenic plants over-expressing genes of ascorbic acid synthesis-cell wall |
| US20150322442A1 (en) * | 2012-12-21 | 2015-11-12 | Algenol Biofuels Inc. | Novel Shuttle Vector Capable of Transforming Multiple Genera of Cyanobacteria |
| CN104372015A (en) * | 2014-11-03 | 2015-02-25 | 青岛农业大学 | Peanut vitamin C synthesis related gene Ah PMM and application thereof |
| CN105755018A (en) * | 2016-05-13 | 2016-07-13 | 中国农业科学院特产研究所 | Actinidia arguta L-galactonolactone dehydrogenase gene and expression method thereof |
| CN107164392A (en) * | 2017-07-11 | 2017-09-15 | 沈阳农业大学 | A kind of strawberry salt stress related genes FvDIV and its application |
| CN109182292A (en) * | 2018-09-25 | 2019-01-11 | 安徽农业大学 | A kind of strawberry glutathione transferase FaGST gene and its expression albumen and application |
| CN109337923A (en) * | 2018-11-07 | 2019-02-15 | 华中农业大学 | The method for improving Tomato Quality component Vitamin C content by multiple gene polymerization |
| CN110511272A (en) * | 2019-08-30 | 2019-11-29 | 南通大学 | A kind of corn ZmbHLH55 transcription factor and its application |
Non-Patent Citations (5)
| Title |
|---|
| NCBI: "PREDICTED: Fragaria vesca subsp. vesca L-galactono-1,4-lactone dehydrogenase, mitochondrial (LOC101296499), mRNA", 《GENBANK DATABASE》 * |
| ZHANG GUIYUN等: "Manipulation of the rice L-galactose pathway: evaluation of the effects of transgene overexpression on ascorbate accumulation and abiotic stress tolerance", 《PLOS ONE》 * |
| ZHU LIN等: "Enhanced expression of EsWAX1 improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis", 《PLANT PHYSIOLOGY AND BIOCHEMISTRY》 * |
| 刘拥海等: "GLDH超表达水稻愈伤组织的耐盐性研究", 《中国农学通报》 * |
| 董玉梅: "马铃薯L-半乳糖酸-1，4-内酯脱氢酶基因的克隆和功能分析", 《中国博士学位论文全文数据库农业科技辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TW201000634A (en) | Proline-specific protease | |
| CN106591322A (en) | Gingko MADS-box transcription factor gene GbMADS9 for controlling blossoming of plants and encoding protein and application of Gingko MADS-box transcription factor gene GbMADS9 | |
| CN110184247B (en) | Alfalfa melatonin synthetic gene MsASMT and application thereof in regulation and control of plant melatonin and flavonoid synthesis | |
| CN112111510B (en) | Application of Oscpy and encoded protein thereof in improving rice quality | |
| CN112080509A (en) | Strawberry vitamin C synthesis related gene FaGalLDH and application thereof | |
| CN112322600A (en) | Alfalfa salt-tolerant gene MsSnRK2.3 and encoding protein and application thereof | |
| CN113005138B (en) | Arabidopsis PHO1; application of H10 protein and coding gene thereof in regulation and control of plant leaf anthocyanin synthesis | |
| CN110129335B (en) | Grape fruit maturation related gene VvNAC and application thereof | |
| CN108004248B (en) | Application of cucumber calcium binding protein gene CsCaM in improvement of plant heat resistance | |
| JP2005534301A (en) | Methods for enhancing nutritional value in plant extracts | |
| CN114317562B (en) | Coding gene PvEXO70 of common fusarium solani wilt disease resistance related protein and application thereof | |
| CN115161332B (en) | Vitis spinosa VdERF2 gene and encoding protein and application thereof | |
| CN116496373A (en) | Application of MYBHv33 transcription factor in plant salt resistance | |
| CN114507674B (en) | Application of circadian rhythm gene LUX of tea tree in improving cold resistance of plants | |
| KR100346928B1 (en) | Antimicrobial protein | |
| CN101200726B (en) | Monosomic addition line M14 in sugarbeet strain small gtpase gene | |
| CN114231540A (en) | Application of Chinese wild rice ZLRc gene in improving content of procyanidine in rice seeds | |
| JPH10512451A (en) | Deoxyribonucleic acid encoding glutathione S-transferase and use thereof | |
| CN111518185A (en) | Transcription factor for regulating and controlling tomato fruit quality and application thereof | |
| CN110358774A (en) | Control gene, protein, expression casette, expression vector, host cell, method and the application of Rice Flowering time | |
| CN114214341B (en) | Application of tomato SlSERAT1, 1 gene or fragment thereof in plant development process | |
| CN109628468A (en) | A kind of Chunlan CgWRKY53 gene and its application | |
| JPH09201190A (en) | Highly iron-containing plant produced by molecular breeding and method for producing the plant | |
| CN113528552B (en) | Gene combination for synergetic catalysis of tea tree ester type catechin biosynthesis and application thereof | |
| JPH10295380A (en) | New thionine gene induced by salt stress |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20201215 |
|
| WD01 | Invention patent application deemed withdrawn after publication |