CN112074612A

CN112074612A - Nucleic acid amplification method with higher specificity

Info

Publication number: CN112074612A
Application number: CN201980028245.6A
Authority: CN
Inventors: 德米特里·切尔科索夫; 克里斯蒂安·格伦沃尔德
Original assignee: AGCT GmbH
Current assignee: AGCT GmbH
Priority date: 2018-02-26
Filing date: 2019-02-26
Publication date: 2020-12-11
Also published as: WO2019162530A1; EP3759248A1; JP2021514637A

Abstract

The present invention relates to a method for amplifying nucleic acids with higher specificity using specific oligonucleotide primers and control nucleotides. Wherein in the first amplification, the control oligonucleotide enables sequence-specific opening of a strand in the amplification product. The invention also relates to a corresponding kit for carrying out the method according to the invention.

Description

Nucleic acid amplification method with higher specificity

The present invention relates to a nucleic acid amplification method with higher specificity.

This application claims priority from the following applications: european patent application EP18158722.1, 26 months 2 2018; EP18195312.6, 2018, month 9, day 18; EP 18159337.7, year 2018, month 2 and day 28; german patent application 102018001586.7, 2018, month 2 and day 28. These and all other patent documents referred to herein are to be considered as being incorporated by reference into this specification (incorporated by reference).

Background

The synthesis of nucleic acid strands is central in today's biotechnology. Methods such as PCR have greatly advanced the research field and the industrial application field (e.g., diagnostics and food industry). The combination of PCR with sequencing, real-time detection, microarray technology, microfluidic management and other technologies promotes the development of the technology and partially overcomes the defects of the original PCR. Other amplification methods, such as isothermal amplification techniques, have also been developed. They are particularly suitable for point-of-care testing (POCT). Despite the great progress made in the above field, PCR still plays a central role and thus defines various technical barriers relating to its application.

During the amplification procedure, the amplified sequence segment located between the primers is not controlled in the PCR. The emphasis on the optimization of the PCR method is primer binding. At the start of and during PCR, synthesis of major and by-products is continuously initiated, for example, by non-specific binding or extension of primers. In the case where a reverse synthesis reaction occurs, the non-specifically extended primer is read as a template, thereby generally forming an intact primer binding site. Thus, erroneous sequence information passes from one synthesis cycle to the next, which not only leads to the initial synthesis, but also leads first to an exponential growth of the by-products.

Such side reactions may lead to exponential growth of fragments interfering with the main reaction (amplification of the target sequence) and to interference with subsequent analytical steps, respectively. Such by-products typically comprise left and right primer sequences, so that their amplification can be performed in parallel with the main reaction. However, this by-product does not comprise the target sequence, but another nucleic acid target sequence.

First, specificity of PCR amplification is achieved by optimizing the binding of primers to the target sequence. For example, additional oligonucleotides may be used that are partially bound to the primer and thus may be competitively involved in binding the primer to other nucleic acid strands.

Such probes typically bind to a sequence segment of a primer, leaving the single-stranded sequence segment unoccupied, so that the primer with the segment can bind to the target nucleic acid and initiate the synthesis reaction. Primer template mismatches can be competitively displaced by such oligonucleotides, thereby increasing priming specificity. Such additional oligonucleotides do not interact with the nucleic acid strand to be amplified in the section between the two primers. However, due to the molar excess of primers, non-specific interactions between the primers and the template may occur during the amplification process, thereby forming fully functional primer binding sites through synthesis of complementary strands of by-products. The presence of such fully functional primer binding sites in the by-product results in a loss of the competitive effect of such additional oligonucleotides on primer binding. Thus, control of the specificity of primer binding to template by such oligonucleotides only reduces the incidence of side reactions, and once by-products are formed, they do not affect exponential amplification.

The side reactions of PCR increase with the number of synthesis cycles performed, with up to 40 PCR cycles typically being performed. Following PCR amplification, other methods such as detection, library construction, cloning, sequencing, etc. may be linked. The method is only tolerant to a certain extent to by-products or sequence deviations generated during the PCR amplification. Often, the specificity of such methods is also affected by problems with side reactions during PCR.

Improving the synthetic specificity of amplification methods and reducing the occurrence of by-products and co-amplification contribute to improved diagnostic methods.

It is an object of the present invention to provide methods and means for improving the specificity of enzymatic amplification of nucleic acid strands.

It is another object of the invention to provide an amplification method in combination with a PCR amplification, wherein in the acquisition of the signal (monitoring or detection, respectively) or amplification of the target sequence is performed first a controlled amplification using a control oligonucleotide and a corresponding set of specific primers and then a PCR, in particular using PCR specific primers.

It is yet another object of the present invention to reduce the number of PCR synthesis cycles required to obtain a sufficient number of PCR products.

It is a further object of the present invention to provide novel enzymatic methods and components for the synthesis and amplification of nucleic acid strands, wherein continuous (on-line) signal acquisition is performed, wherein said signal acquisition (monitoring/detection) is mediated or supported by sequence specific probe oligonucleotides.

The object is achieved by a method and a kit as described in the independent claims. Further advantageous embodiments of the invention are set forth in the dependent claims and in the following description.

Disclosure of Invention

The first aspect of the present invention relates to a method for amplifying a nucleic acid, comprising the steps of:

a) A first amplification comprising the steps of:

-hybridizing a first oligonucleotide primer (P1.1) to the nucleic acid to be amplified comprising the target sequence, wherein said first oligonucleotide primer (P1.1) comprises the following regions:

a first region (P1.1.1) which can bind sequence-specifically to a region of the nucleic acid to be amplified, wherein the region of the nucleic acid to be amplified comprises at least the 5 'end of the target sequence or is located in the 5' direction of the target sequence;

a second region (P1.1.2) adjacent to the 5' end of the first region or linked by a linker, wherein said second region is capable of binding to a control oligonucleotide and is substantially not replicated by the polymerase used under the selected reaction conditions;

-extending the first oligonucleotide primer (P1.1) by a first polymerase to obtain a first primer extension product (P1.1-Ext), the first primer extension product (P1.1-Ext) comprising, in addition to the first oligonucleotide primer (P1.1), a synthesis region substantially complementary to a nucleic acid or target sequence to be amplified, wherein the first primer extension product and the nucleic acid to be amplified are present in double stranded form;

-a control oligonucleotide (C1.1) is bound to said first primer extension product (P1.1-Ext), wherein said control oligonucleotide (C1.1) comprises the following regions:

A first region (C1.1.1) which can bind to a second region (overhang) of the first primer extension product (P1.1-Ext);

a second region (C1.1.2) substantially complementary to the first region of the first oligonucleotide primer (P1.1); and

a third region (C1.1.3) that is substantially complementary to at least a portion of the synthesis region of the first primer extension product (P1.1-Ext);

wherein the control oligonucleotide (C1.1) is not used as a template for primer extension of the first oligonucleotide primer (P1.1) and the first control oligonucleotide (C1.1) binds to the first and second regions of the first primer extension product (P1.1-Ext) while displacing (the region complementary to the first and second regions) the nucleic acid to be amplified;

-hybridizing a second oligonucleotide primer (P2.1) to said first primer extension product, wherein said second oligonucleotide primer (P21) comprises a region (P2.1.1) that can sequence-specifically bind to a synthetic region of said first primer extension product (P1.1-Ext) that is complementary to at least the 5 'end of said target sequence or is located in its 3' direction;

-extending the second oligonucleotide primer (P2.1) by a first polymerase to obtain a second primer extension product (P2.1-Ext), the second primer extension product (P2.1-Ext) comprising, in addition to the second oligonucleotide primer (P2.1), a synthetic region substantially identical to a nucleic acid or target sequence to be amplified, wherein the first primer extension product (P1.1-Ext) and the second primer extension product (P2.1) form a first double stranded amplification product;

b) A second amplification comprising the steps of:

-hybridizing a third oligonucleotide primer (P3.1; P3.2) to the second primer extension product (P1.1-Ext) of the first amplification product, wherein the third oligonucleotide primer (P3.1; P3.2) has a first region (P3.1.1) which is sequence-specifically bindable to a region of the second primer extension product (P1.1-Ext) and comprises at least the 5 'end of the target sequence or is located in the 5' direction thereof;

-extending the third oligonucleotide primer (P3.1; P3.2) by a second polymerase to obtain a third primer extension product (P3.1/2-Ext), which third primer extension product (P3.1/2-Ext) comprises, in addition to the third oligonucleotide primer (P3.1; P3.2), a synthesis region substantially complementary to the second primer extension product (P2.1-Ext) or the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) are present in double stranded form;

-hybridizing a fourth oligonucleotide primer (P4.1; P4.2) to said first primer extension product (P1.1-Ext), wherein said fourth oligonucleotide primer (P4.1; P4.2) has a first region (P4.1.1) that binds sequence specifically to a synthetic region of said first primer extension product (P1.1-Ext) that is complementary to at least the 5 'end of said target sequence or is located in its 3' direction;

-extending the fourth oligonucleotide primer (P4.1; P4.2) by the second polymerase to obtain a fourth primer extension product (P4.1/2-Ext) comprising, in addition to the fourth oligonucleotide primer, a synthetic region substantially complementary to the first primer extension product (P1.1-Ext) or substantially identical to the target sequence, wherein the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.1/2-Ext) are present in double stranded form;

-separating the first primer extension product (P1.1-Ext) from the double strand constituted by the fourth primer extension product (P4.1/2-Ext), and the second primer extension product (P2.1) from the double strand constituted by the third primer extension product (P3.1);

-hybridizing the third oligonucleotide primer (P3.2) with a fourth primer extension product (P4.2-Ext) and extending the third oligonucleotide primer (P3.2) by a second polymerase; and

-hybridizing the fourth oligonucleotide primer to the third primer extension product (P3.2-Ext) and extending the fourth oligonucleotide primer (P4.1; P4.2) by the second polymerase.

Alternatively, the invention can also be expressed in one aspect as a method for amplifying nucleic acids (fig. 1, 55-56), wherein the sample comprises a first nucleic acid polymer comprising a first target sequence M1[ and a sequence M1 ' complementary to M1 ], wherein M comprises, in the 5' -3 ' direction, consecutive sequence segments M1.5, M1.4, M1.3, M1.2, and M1.1.

In a first amplification step with the following components:

i. a first template-dependent nucleic acid polymerase (especially a DNA polymerase), and a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor (e.g. a Mg salt) for the template-dependent nucleic acid polymerase;

a first (right) oligonucleotide primer P1.1 comprising in the 5' -3 ' direction consecutive sequence segments P1.1.2 and P1.1.1, wherein P1.1.1 has a [ hybridizing ] sequence complementary to [ substantially sequence-specifically binds ] M1.1, whereas sequence segment P1.1.2 is not capable of binding to M1[ or to the sequence of M1.1 in the immediately 3 ' direction relative to sequence M1 ];

wherein P1.1 (especially in the segment p1.1.2) comprises a modified nucleotide building block such that p1.1.2 cannot serve as a template for a first template-dependent nucleic acid polymerase activity;

a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1.5 [ and which can sequence-specifically bind to the reverse complement of M1.5 on the reverse strand of M1 or the extension product P1.1-Ext of P1.1 (herein referred to as P1.1E1) ];

iv control oligonucleotide C1.2, comprising in 5' -3 ' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1, wherein segment C1.2.3 is identical to segment M1.2 of M1 and segment M1.2 is located in the 5' direction of M1.1 [ and is read first upon polymerase initiation of P1.1, so C1.2.3 can bind to the polymerization product of primers P1.1-Ext ], C1.2.2 is complementary to P1.1.1 (and identical to M1.1) and C1.2.1 is complementary to P1.1.2;

Wherein C1.2 contains a nucleotide building block modified at C1.2.1, such that C1.2.1 cannot be used as a template for template-dependent nucleic acid polymerase activity;

wherein the sample is contacted with the following components in a second amplification step:

v. a third (right) oligonucleotide primer P3.1 comprising at the 3' end a sequence segment 3.1.1[ or consisting essentially of 3.1.1 ] and being complementary to M1.1 (reverse) of M1 [ capable of binding complementarily to P2.1-Ext ];

a fourth (left) oligonucleotide primer P4.1 comprising at the 3' end a sequence segment 4.1.1[ or consisting essentially of 4.1.1 ] and being identical and/or essentially identical to M1.5 of M1 [ capable of binding complementarily to P1.1-Ext ];

a second template-dependent nucleic acid polymerase (especially a DNA polymerase), and (optionally) a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor for the template-dependent nucleic acid polymerase.

In the first amplification step, a first primer extension product P1.1-Ext is obtained which comprises in addition to the sequence regions P1.1.2 and P1.1.1 in the 5 '-3' direction a synthesis region comprising sequence segments P1.1E4, P1.1E3, P1.1E2 and P1.1E1 in the 5 '-3' direction, wherein P1.1E4 is substantially complementary to sequence segment M1.2 of the target sequence M1, P1.1E3 is substantially complementary to M1.3, P1.1E2 is substantially complementary to M1.4 and P1.1E1 is substantially complementary to M1.5. Likewise, a second primer extension product P2.1-Ext is obtained, which, in addition to the sequence region P2.1.1, comprises a synthesis region P2.1-Ext, which synthesis region P2.1-Ext is essentially identical to the target sequence M1 in the region after M1.5 in the 3' direction. The reaction conditions and/or length or melting temperature of P1.1.2 and, optionally, M1.4, M1.3, M1.2 and M1.1 of the first amplification step are selected such that P1.1-Ext can form a duplex with M1 or P2.1-Ext, and P1.1-Ext can form a duplex with C1.2, and the duplex formed by P1.1-Ext with C1.2 is preferred over the duplex formed by P2.1-Ext.

More generally, the invention can also be expressed as a method for amplifying nucleic acids, wherein in a first amplification step a sample comprising a first nucleic acid polymer comprising a first target sequence M1 is contacted with:

a. a first template-dependent nucleic acid polymerase (especially a first DNA polymerase), and a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor for the template-dependent nucleic acid polymerase;

b. a first (right) oligonucleotide primer P1.1 comprising in the 5 ' -3 ' direction consecutive sequence segments p1.1.2 and p1.1.1, wherein at least the 3 ' segment of p1.1.1 is capable of (substantially) sequence-specific binding to a segment of M1, whereas the sequence segment p1.1.2 is not capable of binding to M1; wherein P1.1 (especially in the segment p1.1.2) comprises a modified nucleotide building block such that p1.1.2 cannot serve as a template for a first template-dependent nucleic acid polymerase activity;

c. a second (left) oligonucleotide primer P2.1 comprising at least one 3 'segment that is (substantially) identical to the segment of the M1 sequence located 5' to the binding site of P1.1; or it comprises a binding site capable of binding to the reverse complement on the reverse strand of M1 or to the extension product of P1.1 [ herein referred to as P1.1-Ext, also P1.1E1 ];

d. Control oligonucleotide C1.2, comprising in 5 '-3' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1:

i. a third region (C1.2.3) of the control oligonucleotide which is substantially complementary to at least part of the synthesis region of the first primer extension product (P1.1-Ext) formed during the amplification reaction, in other words, the third region is identical to the segment M1, which segment M1 is located in the 5' direction of the first primer binding site with respect to the polarity of the strand that is read [ and that is read first upon polymerase initiation of P1.1 ], the third region of the control being thus capable of binding to at least part of the oligonucleotide bound to the polymerization product of the first primer [ P1.1-Ext ];

a second region of the control oligonucleotide (C1.2.2) that is substantially complementary to the first region of the first oligonucleotide primer (P1.1) (and at least partially identical to the binding site of the first primer on the target sequence M1);

a first region (C1.2.1) of a control oligonucleotide that can bind to a sequence segment P1.1.2 of a first primer or a 5' terminal region of a first primer extension product (P1.1-Ext) formed during an amplification reaction;

wherein C1.2 contains at least a nucleotide building block modified at C1.2.1, such that C1.2.1 cannot be used as a template for template-dependent nucleic acid polymerase activity;

Incubating the sample with the above components under conditions that allow a first amplification, wherein an amplification product comprising a primer extension product of the first oligonucleotide primer (P1.1-Ext) and a primer extension product of the second oligonucleotide primer (P2.1-Ext) is formed, which comprises the target sequence M or at least a part thereof and the corresponding complementary sequence; wherein the sample is subsequently or simultaneously contacted in a second amplification step with the following components:

e. a third (right) oligonucleotide primer P3.1 comprising at the 3 'end a sequence segment 3.1.1[ or consisting essentially of 3.1.1 ] and which is (reverse-) complementary to the amplification product formed in the first amplification step, in other words which is sequence specific and capable of binding to the 3' end region of the second primer extension product formed in the first amplification reaction;

f. a fourth (left) oligonucleotide primer P4.1 comprising at the 3 'end a sequence segment 4.1.1[ or consisting essentially of 4.1.1 ] and which is capable of binding (reverse) complementarily to the amplification product formed in the first amplification step, in other words, which is capable of binding specifically to the 3' end region of the first primer extension product formed in the first amplification reaction; and

g. a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and (optionally) a substrate for the template-dependent nucleic acid polymerase, in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates, and a suitable cofactor.

Incubating the sample with the above components under conditions allowing a second amplification, wherein an amplification product comprising a primer extension product of the third oligonucleotide primer (P3.1-Ext) and a primer extension product of the fourth oligonucleotide primer (P4.1-Ext) is formed, which comprises the target sequence M or at least a part thereof and the corresponding complementary sequence.

However, the present invention is not necessarily limited to the topography shown in FIGS. 50-56.

Another aspect of the invention relates to a kit comprising the following components:

a. a first (right) oligonucleotide primer P1.1 comprising two consecutive sequence segments P1.1.2 and P1.1.1 in the 5 '-3' direction, wherein:

p1.1.1 is an arbitrary sequence segment which is complementary [ hybridised ] to the sequence [ M1.1] to be amplified;

the sequence segment P1.1.2 cannot bind to the sequence to be amplified [ or the sequence in the immediately 3' direction with respect to the sequence to be amplified ]; and

wherein P1.1.2 comprises a modified nucleotide building block such that P1.1.2 cannot be used as a template for template-dependent nucleic acid polymerase activity;

b. a second (left) oligonucleotide primer P2.1 which binds sequence specifically to a sequence on the opposite strand of the sequence to which the first oligonucleotide primer binds;

c. a control oligonucleotide C1.2 comprising in the 5 '-3' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1, wherein:

C1.2.3 is identical to segment M1.2 of the sequence to be amplified [ M1], and segment M1.2 is located in the 5' direction of [ M1.1] P1.1.1 binding site [ and is read first upon polymerase initiation of P1.1, so C1.2.3 can bind to the polymerization product of oligonucleotide primers P1.1-Ext ];

c1.2.2 is complementary to p1.1.1 (and identical to M1.1); and

c1.2.1 is complementary to p 1.1.2;

d. a first template-dependent nucleic acid polymerase (especially a DNA polymerase), and (optionally) a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor (e.g. a Mg salt) for the template-dependent nucleic acid polymerase;

e. a third (right) oligonucleotide primer P3.1 which is different from the first oligonucleotide primer P1.1, in particular is free of its segment P1.1.2 and which comprises at the 3' end a sequence segment 3.1.1[ or consists essentially of 3.1.1 ], which sequence segment 3.1.1 is complementary to segment M1.1] (reverse) of the target sequence [ M1] [;

f. a fourth (left) oligonucleotide primer P4.1 which comprises at the 3' end a sequence segment 4.1.1[ or consists essentially of 4.1.1 ] and which can sequence specifically bind to a sequence on the opposite strand of the sequence to which the third oligonucleotide primer binds; and

In a further aspect, the invention relates to a method for amplifying a nucleic acid, wherein in a first amplification step a sample containing a nucleic acid (which nucleic acid comprises a first target sequence M1, which comprises consecutive sequence segments M1.5, M1.4, M1.3, M1.2 and M1.1 in the 5 '-3' direction) is contacted with:

-a first template-dependent nucleic acid polymerase (especially a DNA polymerase), and a substrate for the template-dependent nucleic acid polymerase;

-a first (right) oligonucleotide primer P1.1 comprising in the 5 '-3' direction consecutive sequence segments P1.1.2 and P1.1.1, wherein P1.1.1 has a [ hybridizing ] sequence complementary to M1.1 and sequence segment P1.1.2 is not capable of binding to M1;

-wherein P1.1 (especially in the segment p1.1.2) comprises a modified nucleotide building block such that p1.1.2 cannot serve as a template for a first template-dependent nucleic acid polymerase activity;

-a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1.5; and

control oligonucleotide C1.2, comprising in 5' -3 ' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1, in which C1.2.3 is identical to segment M1.2 of M1 located in the 5' direction of M1.1, C1.2.2 is complementary to p1.1.1 (and identical to M1.1), and C1.2.1 is complementary to p1.1.2;

wherein the sample is further contacted with a first probe oligonucleotide that:

a. comprises a sequence section which:

i. identical to the sequence of M1 located on sequence sections M1.2, M1.3 and M1.4; or

Complementary to the sequence of M1 located on sequence sections M1.3 and M1.4,

b. in combination with a fluorescent dye, the fluorescent dye:

i. forming a donor-quencher pair or a FRET pair with a second probe oligonucleotide to which the first probe oligonucleotide is linked; or

Forming a donor-quencher pair or a FRET pair, wherein the fluorescent dye is linked to a second probe oligonucleotide that is capable of binding sufficiently close to the binding site of the first probe oligonucleotide.

Furthermore, the present invention can be expressed in one aspect as a method comprising the steps of:

A) a nucleic acid fragment (comprising the first target sequence), hereinafter also referred to as starting nucleic acid strand, is provided.

B) A first amplification system is provided comprising a first oligonucleotide primer, a second oligonucleotide primer, a control oligonucleotide, a first DNA polymerase, a substrate for a first polymerase (dNTP), and an appropriate buffer.

C) A second amplification system is provided comprising a third oligonucleotide primer, a fourth oligonucleotide primer, a second thermostable polymerase, a substrate for a second polymerase (dNTP) and a suitable buffer.

Optionally, a detection system is further provided, as long as the object of the present invention also comprises the detection (especially the detection using probes) of the nucleic acid fragments amplified by the first and/or second amplification system.

D) Performing a first amplification using the starting nucleic acid strand as an initial template strand and a first amplification system to obtain a first amplified fragment 1.1; the first amplification segment 1.1 comprises a first target sequence and comprises a first primer extension product and a second primer extension product that can form a complementary double strand; wherein the first primer extension product is obtained by template-dependent extension of a first primer by a polymerase using a starting nucleic acid strand and/or a second primer extension product is obtained by template-dependent extension of a second primer by a polymerase using a first primer extension product as a template; wherein the first and second primer extension products are mutually available as templates for extension of the respective primers; wherein the two complementary strands of the first amplification product 1.1 can be at least partially converted to single stranded form by the control oligonucleotide, thereby making it possible for a new primer to bind to each complementary segment of the synthesized primer extension product.

The reaction conditions for the first amplification comprise at least one temperature step wherein the two primers of the first amplification system are allowed to undergo hybridization and template-dependent primer extension; and at least one temperature step, wherein the first primer extension product is separated from the second primer extension product in the presence of a control oligonucleotide. In the absence of the control oligonucleotide, the reaction conditions used do not allow spontaneous separation of the first primer extension product from the second primer extension product. The first amplification is performed until the desired amount of first amplification product 1.1 is synthesized.

E) Second amplifying by a second amplification system using at least one of the two strands of the first amplified fragment 1.1 as an initial template strand to obtain a second amplified fragment 2.1 comprising a third primer extension product and a fourth primer extension product that can form a complementary double strand; the two strands of the amplified fragment 2.1 may act as templates for each other during primer extension; wherein the reaction conditions for the second amplification allow for hybridization of the two primers of the second amplification system and template-dependent primer extension of the primers of the second amplification system bound to the complementary region in at least one temperature step and double-stranded (including third primer extension product and fourth primer extension product) separation in at least one further temperature step; wherein the third and fourth primer extension products are converted to single stranded form so that primer binding and extension can be performed again. A second amplification is performed until the desired amount of second amplification product 2.1 has been synthesized.

In particular, the nature of the components of each amplification system, the nucleic acid fragment comprising the first target sequence, and the reaction conditions used determine the course of the two amplification reactions.

Typically, the first amplification is performed in the presence of a control oligonucleotide. The separation of the two synthesized primer extension products depends at least in part on the sequence of the first primer extension product and its complementarity to the control oligonucleotide sequence.

During the second amplification, amplification of the second amplified fragment is performed substantially without reference to the control oligonucleotide.

During both amplification reactions, the desired amplification products (amplified fragment 1.1 and amplified fragment 2.1) and their intermediates (intermediates) are formed.

The composition of the intermediate is substantially dependent on the components of the first and second amplification systems provided.

Drawings

FIG. 1 schematically illustrates the components of certain embodiments of the amplification methods of the invention in multiphase form; A) a first amplification system; B) a second amplification system.

FIG. 2 schematically illustrates components of certain embodiments of a first amplification system.

Figure 3 shows the temperature profile of certain embodiments of the process of the present invention in multiphase form.

Figure 4 shows the temperature profile of some embodiments of the process of the present invention in multiphase form.

FIG. 5 shows the components of certain embodiments of the amplification methods of the invention in homogeneous form; A) a first amplification system; B) a second amplification system.

Fig. 6-11 show temperature profiles of embodiments of the method of the present invention.

FIG. 12 schematically shows (A) the structure of a first oligonucleotide primer; (B) the first primer binds complementarily to the nucleic acid strand to be amplified; (C) complementary binding of the first primer to the nucleic acid strand to be amplified and extension of the primer.

FIG. 13 schematically shows (A) the relationship between components in the synthesis of a first primer extension product; (B) synthesis of a first primer extension product; 1 ═ nucleic acid to be amplified in the first amplification; 2 ═ control oligonucleotide; 3 ═ first oligonucleotide primer; 4 ═ extension products of the first oligonucleotide primer.

FIG. 14 schematically shows the synthesis of a second primer extension product; reference numerals 1-4 are shown in fig. 13; 5 ═ second oligonucleotide primer; 6 ═ extension products of the second oligonucleotide primers.

FIG. 15 schematically shows the synthesis of third and fourth primer extension products: P3.1-Ext part 1 ═ extension product of P3.1 (intermediate product) synthesized using P2.1-Ext as template; P4.1-Ext part 1 ═ extension product of P4.1 (intermediate product) synthesized using P1.1-Ext as template; P3.1-Ext ═ extension products of P3.1 synthesized using P4.1-Ext-Part 1 or P4.1-Ext as template; P4.1-Ext ═ extension products of P4.1 synthesized using P3.1-Ext-Part 1 or P3.1-Ext as template.

FIG. 16 schematically shows the synthesis of a portion of a third primer extension product (P3.1-Ext-Part 1); 7 ═ region P3.1 complementary to the second primer extension product (P2.1-Ext); segment P3.1 that is not complementary to the second primer extension product (P2.1-Ext); P3.1-Ext-Part 1 ═ extension product of third primer (P3.1) synthesized using P2.1-Ext as template.

FIG. 17 schematically shows the synthesis of an intact fourth primer extension product; P2.1-Ext ═

segments

5 and 6; P3.1-Ext part 1 ═ extension product of P3.1 synthesized using P2.1-Ext as template; p4.1 ═ fourth primer; segment P4.1, which can bind complementarily to P3.1-Ext-part 1; segment P4.1, which cannot bind complementarily to P3.1-Ext-part 1; P4.1-Ext ═ extension product of P4.1 synthesized using P3.1-Ext-part 1 as template.

FIG. 18 schematically shows (A) the synthesis of an intermediate product (P3.1-Ext part 1) of a third primer extension product using a second primer extension product (P2.1-Ext); (B) the complete third primer extension product (P3.1-Ext) was synthesized using P4.1-Ext as a template: P4.1-Ext ═ extension product of P4.1 synthesized using P3.1-Ext-part 1 as template; P3.1-Ext ═ extension product of P3.1 synthesized using P4.1-Ext as template.

FIGS. 19-26 schematically show the relationship between components during synthesis of the first primer extension product and the third PCR primer: 1 ═ P2.1 extension in the first amplification; 2 ═ control oligonucleotide; 3 ═ first oligonucleotide primer; primer 3.1, 4 ═ primer.

FIGS. 27-31 schematically show the components of different embodiments of the first amplification system: (A) components of a first amplification system; (B) components of a second amplification system. FIGS. 27-29: the fourth primer is the same as the second primer, and the third primer is different from the first primer; the binding of which is displaceable relative to the first oligonucleotide primer. FIG. 30: the fourth primer is different from the second oligonucleotide primer; the 3 'end of the fourth primer may be displaced relative to the 3' end of the second oligonucleotide primer; the fourth primer comprises a segment of replicable sequence that is not complementary to the target sequence or does not bind to P1.1-Ext. FIG. 31: the third oligonucleotide primer comprises a segment of replicable sequence that is not complementary to the target sequence or that binds to P2.1-Ext.

FIG. 32 schematically shows (A) a first oligonucleotide primer and (B) a nucleic acid to be amplified (P1.1-Ext and P2.1-Ext).

FIG. 33 schematically shows strand displacement by control oligonucleotides.

FIG. 34 schematically shows the interaction between components in a reaction of the process of the invention; this figure shows the intermediate step of isolating the second primer extension product from the complex having the double strand consisting of the first primer extension product and the control oligonucleotide.

FIG. 35 schematically shows amplification by simultaneous synthesis of both strands and isolation of the synthesized amplified fragments.

FIGS. 36-49 show the results of sample experiments.

FIGS. 50 and 51 schematically illustrate some types of preparation of starting nucleic acid strands from genomic DNA.

FIGS. 52-54 schematically illustrate certain embodiments of amplification based on the present invention.

FIGS. 55-57 schematically illustrate certain embodiments of the morphology of components of the first and second amplification systems.

FIGS. 58-59 schematically illustrate certain embodiments of possible localization regions of a probe oligonucleotide.

FIG. 60 schematically illustrates certain embodiments of probe segment localization that can bind predominantly complementarily to third (and possibly first) primer extension products (P3.1-Ext and P1.1-Ext).

FIG. 61 schematically illustrates certain embodiments of probe segment localization that can bind predominantly complementarily to fourth (and possibly second) primer extension products (P4.1-Ext and P2.1-Ext).

Figures 62-67 schematically illustrate certain embodiments of the probe.

FIGS. 68-71 schematically illustrate certain embodiments of the localization of target sequences 1-3 in the starting nucleic acid 1.1, amplified fragment 1.1(P1.1-Ext and P2.1-Ext) and second amplified fragment 2.1(P3.1-Ext and P4.1-Ext).

Detailed Description

The first-mentioned object of the invention is achieved in particular by the combination of two successive amplifications, the PCR amplification being the last step.

In certain aspects and embodiments, other objects of the present invention are achieved by using the probe system described below.

In the following, some molecular processes and their resulting products and their potential intermediate stages are explained in an exemplary and schematic way. According to a first aspect of the present invention, there is provided a method of amplification. The method comprises the following steps:

1) a first amplification comprising the steps of:

a) hybridizing a first oligonucleotide primer to a 3' segment of a nucleic acid fragment (template strand, starting nucleic acid strand) that is a template for a first nucleic acid to be amplified, said first nucleic acid to be amplified comprising a target sequence, wherein said first oligonucleotide primer comprises the following regions:

-a first region that can specifically bind to a 3' segment of a template strand of a first nucleic acid to be amplified and is complementary to at least a portion of a target sequence; and

-a second region adjacent to the 5' end of the first region or linked by a linker, wherein the second region can bind to a control oligonucleotide and is substantially not replicated by the polymerase used under the selected reaction conditions in the first amplification;

1.B) extending a first oligonucleotide primer when said first oligonucleotide primer is hybridized to a complementary segment of a first nucleic acid to be amplified by a first template-dependent polymerase to obtain a first primer extension product; wherein the first primer extension product comprises a region synthesized by the polymerase in addition to the first oligonucleotide primer and is substantially complementary to the template strand of the target sequence; wherein the first primer extension product and the template strand of the first nucleic acid to be amplified are present substantially in double stranded form under the reaction conditions used for the first amplification;

1.C) binding a control oligonucleotide to the first primer extension product, wherein the control oligonucleotide comprises the following regions:

a first region which can bind to a second region of the first oligonucleotide primer and/or the first primer extension product;

a second region which is substantially complementary or fully complementary to the first region of the first oligonucleotide primer and/or the first primer extension product; and

a third region which is at least partially complementary or substantially complementary to a region of a primer extension product synthesised by the polymerase;

wherein the control oligonucleotide does not serve as a template for primer extension of the first oligonucleotide primer;

The control oligonucleotide comprises a sequence segment that is identical or substantially identical to one strand of the template strand (the target sequence);

binding a control oligonucleotide to the first region of the first primer extension product; and

a control oligonucleotide binds to the second region of the first primer extension product and at least partially binds to the synthesis region of the first primer extension product, thereby displacing a complementary portion of the template strand of the first nucleic acid to be amplified; wherein the polymerase synthesis region of the first primer extension product (comprising the segment of the first primer extension product that is complementary to the second oligonucleotide primer) becomes single-stranded under reaction conditions;

d) hybridizing a second oligonucleotide primer to the single-stranded complementary segment of the first primer extension product, wherein the second oligonucleotide primer comprises a region that can sequence-specifically hybridize to the synthesis region of the first primer extension product and comprises at least a portion of a target sequence;

e) extending a second oligonucleotide primer by a first polymerase using the first primer extension product as a template to obtain a second primer extension product; the second primer extension product comprising, in addition to the second oligonucleotide primer, a polymerase synthesis region comprising at least a portion of the first target sequence; wherein the first primer extension product and the second primer extension product form a first double-stranded amplification product under reaction conditions of a first amplification; and

F) repeating (including repeating a plurality of times) the step of the first amplification, if necessary.

2) A second amplification comprising the following steps (FIG. 15):

a) hybridizing a third oligonucleotide primer to a second primer extension product of the first amplification product, wherein the third oligonucleotide primer comprises a first region that can substantially sequence-specifically bind to a segment of the second primer extension product;

b) extending the third oligonucleotide primer by a second polymerase using the second primer extension product as a template to obtain a third primer extension product (P3.1-Ext part 1); wherein the third primer extension product (P3.1-Ext part 1) comprises, in addition to the third oligonucleotide primer, a sequence segment that is substantially complementary to the second oligonucleotide primer or to the nucleic acid to be amplified or to a portion of the target sequence; wherein the second oligonucleotide primer and the third primer extension product (P3.1-Ext part 1) are present in a double stranded form;

c) hybridizing a fourth oligonucleotide primer to the first primer extension product of the first amplification product, wherein the fourth oligonucleotide primer comprises a first region that can substantially sequence specifically bind to the polymerase synthesis region of the first primer extension product;

D) extending the fourth oligonucleotide primer by the second polymerase using the first primer extension product as a template to obtain a fourth primer extension product (P4.1-Ext part 1); wherein the fourth primer extension product (P4.1-Ext part 1) comprises, in addition to the fourth oligonucleotide primer, a region synthesized by the polymerase that is substantially complementary to the first oligonucleotide primer and comprises a portion of the target sequence; wherein the first primer extension product and the fourth primer extension product (P4.1-Ext part 1) are present in a double-stranded form;

e) separating the first primer extension product from the duplex of the fourth primer extension product (P4.1-Ext part 1) and the second primer extension product from the duplex of the third primer extension product (P3.1-Ext part 1);

f) hybridizing a third oligonucleotide primer to a fourth primer extension product (obtained in step 2.D, P4.1-Ext part 1), wherein said third oligonucleotide primer comprises a first region that can substantially sequence-specifically bind to a segment of said fourth primer extension product (P4.1-Ext part 1);

g) extending the third oligonucleotide primer by the second polymerase using the fourth primer extension product (P4.1-Ext part 1) as a template to obtain a complete third primer extension product (P3.1-Ext), wherein the third primer extension product (P3.1-Ext) and the fourth primer extension product (P4.1-Ext part 1) are present in a double stranded form;

H) hybridizing a fourth oligonucleotide primer to the third primer extension product (obtained in step 2B, P3.1-Ext part 1), wherein said fourth oligonucleotide primer comprises a first region that substantially sequence-specifically binds to the polymerase synthesis region of said third primer extension product;

i) extending the fourth oligonucleotide primer by the second polymerase using the third primer extension product (P3.1-Ext part 1) as a template to obtain an intact fourth primer extension product (P4.1-Ext), wherein the third primer extension product (P3.1-Ext part 1) and the fourth primer extension product (P4.1-Ext) are present in double stranded form;

j) separating the third primer extension product (P3.1-Ext Part 1) from the double strand consisting of the complete fourth primer extension product (P4.1-Ext) and the fourth primer extension product (P4.1-Ext Part 1) from the double strand consisting of the complete third primer extension product (P3.1-Ext);

k) hybridizing a third oligonucleotide primer to a fourth primer extension product (obtained in step 2I, P4.1-Ext), wherein said third oligonucleotide primer comprises a first region that can substantially sequence specifically bind to a segment of said fourth primer extension product (P4.1-Ext);

L) extending the third oligonucleotide primer by a second polymerase using the intact fourth primer extension product (P4.1-Ext) as a template to obtain an intact third primer extension product (P3.1-Ext), wherein the intact third primer extension product (P3.1-Ext) and the intact fourth primer extension product (P4.1-Ext) are present in double stranded form;

m) hybridizing a fourth oligonucleotide primer to the complete third primer extension product (obtained in step 2G, P3.1-Ext), wherein said fourth oligonucleotide primer comprises a first region that can substantially sequence-specifically bind to the polymerase synthesis region of said complete third primer extension product;

n) extending the fourth oligonucleotide primer by the second polymerase using the intact third primer extension product (P3.1-Ext) as a template to obtain an intact fourth primer extension product (P4.1-Ext), wherein the intact third primer extension product (P3.1-Ext) and the intact fourth primer extension product (P4.1-Ext) are present in double stranded form;

o) separating the double strand formed in steps 2.L and 2.N consisting of the complete third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext); and

P), optionally repeating the second amplification step, if necessary, proliferating the complete third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext), and optionally repeating several times.

In aspects and embodiments related to the detection of the obtained amplification product, particularly detection using a probe, it may be intended to add a detection system to the reaction mixture.

Alternatively, the aspect of the present invention can also be expressed as a method for amplifying a nucleic acid (fig. 1, 5):

1) performing a first amplification to propagate a first amplified fragment 1.1 comprising a target sequence, wherein the first amplification comprises the steps of:

a) hybridizing a first oligonucleotide primer to a 3' segment of a strand of a nucleic acid strand to be amplified, wherein said nucleic acid strand to be amplified comprises a target sequence;

wherein the first oligonucleotide primer comprises the following regions:

a first primer region which is in the 3' segment of the first oligonucleotide primer and which is sequence-specifically bindable to a strand of the nucleic acid strand to be amplified; and

a second region coupled to the 5' end of the first primer region of the first oligonucleotide primer, either directly or via a linker, and comprising a polynucleotide tail suitable for binding to a control oligonucleotide and supporting strand displacement by the control oligonucleotide (step c); wherein, under the selected reaction conditions, the polynucleotide tail of the polymerase is substantially not replicated;

b) Extending a first oligonucleotide primer by a polymerase to form a first primer extension product comprising a sequence complementary to the target sequence (a) of the nucleic acid strand to be amplified;

c) binding a control oligonucleotide to the polynucleotide tail of the second region of the first extension oligonucleotide primer, wherein the control oligonucleotide comprises the following regions:

a first single stranded region which is bindable to the polynucleotide tail of the second region of the first oligonucleotide primer;

a second single-stranded region which is substantially complementary to and bindable to the first region of the first oligonucleotide primer; and

a third single-stranded region substantially complementary to at least a segment of the polymerase-synthesized extension product of the first primer extension product;

d) binding said control oligonucleotide to the first primer region of said first extension oligonucleotide primer, thereby displacing said complementary strand to said first primer region of said amplified nucleic acid strand;

e) combining the control oligonucleotide with the complementary segment of the extension product of the first extension oligonucleotide primer, thereby displacing the strand of the amplified nucleic acid strand that is complementary to the extension product, wherein the 3' segment of the first primer extension product becomes single-stranded;

f) Hybridizing a second oligonucleotide primer to the first primer extension product, wherein the 3' segment of the second oligonucleotide primer comprises a sequence that is hybridizable to the first primer extension product;

g) extending a second oligonucleotide primer using a polymerase to form a second primer extension product, wherein the extension comprises a first primer region of the first oligonucleotide primer and the first primer region is replicated by the polymerase, wherein a polynucleotide tail of the second region is not replicated; and

h) repeating steps (a) - (g) until a desired level of amplification is achieved.

2) Performing a second amplification using the first amplified fragment 1.1 obtained in the first amplification reaction as template and a third and fourth primer and a second polymerase and suitable cofactors such that a second amplified fragment 2.1 is increased, the second amplified segment 2.1 comprising the target sequence or at least one segment of the target sequence (or its complement), wherein:

the third oligonucleotide primer can bind substantially sequence-specifically to the second primer extension product and/or fourth primer extension product and can be extended by the second polymerase; and

Said fourth oligonucleotide primer can bind substantially sequence-specifically to said first primer extension product and/or third primer extension product and can be extended by said second polymerase;

the primer extension products from the third and fourth primers can be used as templates for exponential amplification of the second amplified fragment 2.1.

Furthermore, the method according to any of the above aspects may be characterized in that the second amplification is a PCR (polymerase chain reaction, also referred to as PCR amplification) and is performed under conditions allowing amplification of the second amplified fragment 2.1 comprising the target sequence.

Furthermore, the method according to any of the above aspects may be characterized in that at least the second amplification is a PCR amplification carried out in the presence of a detection system comprising probe oligonucleotides.

Furthermore, the method according to any of the above aspects may be characterized in that the second amplification is a PCR amplification and is performed under the following conditions: comprising at least one step wherein a primer is hybridized and/or extended by a polymerase; and comprising at least one step wherein the resulting primer extension product is converted (denatured) into a single stranded form.

Furthermore, the method according to any of the above aspects may be characterized in that the second amplification is a PCR amplification and is performed until a desired number of amplified fragments 2.1 are synthesized.

Furthermore, the method according to any of the above aspects may be characterized in that the second amplified third oligonucleotide primer may bind in the 3 'segment of the second primer extension product and/or the 3' segment of the fourth primer extension product and may be extended by a polymerase.

Furthermore, the method according to any of the preceding aspects, may be characterized in that the second amplified fourth oligonucleotide primer may bind in the 3 'segment of the first primer extension product and/or the 3' segment of the third primer extension product and may be extended by a polymerase.

Furthermore, the method according to any of the above aspects, may be characterized in that the second amplified third oligonucleotide primer is capable of binding with its 3' segment to the second primer extension product and/or the fourth primer extension product and is extendable by a polymerase.

Furthermore, the method according to any of the above aspects, may be characterized in that the second amplified fourth oligonucleotide primer is capable of binding with its 3' segment to the first primer extension product and/or the third primer extension product and is extendable by a polymerase.

Furthermore, the method according to any of the preceding aspects, wherein the extension product of the second amplified third oligonucleotide primer and/or the extension product of the fourth oligonucleotide primer comprises at least a segment of the target sequence or its complement.

The method of any preceding aspect, wherein the third single stranded region of the control oligonucleotide is substantially complementary to a segment of the extension product of the first primer synthesized by the polymerase, and said segment is immediately adjacent to the first primer region.

Furthermore, the method according to any of the above aspects may be characterized in that the nucleic acid strand to be amplified complementary to the first primer extension product is displaced until the complementary strand of the nucleic acid to be amplified is separated from the first primer extension product.

Furthermore, the method according to any of the preceding aspects may be characterised in that step (f) of the method is modified to include hybridisation of a second oligonucleotide primer to the first primer extension product, wherein the control oligonucleotide is at least partially displaced from binding to the first extension product by strand displacement at the same time.

Furthermore, the method of any one of the preceding aspects, may be characterised in that step (g) of the method is modified to include displacing the control oligonucleotide from binding to the first primer extension product under the control of the polymerase.

Furthermore, the method of any of the above aspects may be characterised in that step (h) of the method is modified to include binding of a control oligonucleotide to the non-replicated polynucleotide tail of the first extension oligonucleotide primer and displacing the second primer extension product from binding to the first primer extension product, whilst the control oligonucleotide simultaneously forms a complementary double strand with the segment of the first specific extension product of the first oligonucleotide primer.

Furthermore, the method according to any of the above aspects may be characterized in that the steps (a) to (g) are repeated under conditions allowing the steps to be repeated.

Furthermore, the method according to any of the preceding aspects, may be characterized in that it comprises simultaneously amplifying said first and second primer extension products in an exponential reaction using said first and second oligonucleotide primers and said control oligonucleotide, wherein said primer extension products serve as templates for the synthesis of each other.

The yield of each product and intermediate depends on several factors. For example, higher concentrations of each oligonucleotide primer generally favor product/intermediate yields. In addition, product/intermediate formation can be influenced by the choice of reaction temperature and the binding affinity of the reactants to each other (the affinity between each primer and its complementary primer binding site within the template strand): for example, longer oligonucleotides generally bind better than shorter oligonucleotides at higher temperatures; and CG levels may also play a role in complementary sequence segments: AT higher temperatures, CG-rich sequences also bind more strongly than AT-rich sequences. In addition, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength between the primers and their respective complementary segments, which also allows preferential binding of the oligonucleotide primers at higher temperatures.

Thus, it can be concluded that by designing the sequence segments of each primer sequence, the yield of certain products/intermediates can be influenced, thereby influencing their enrichment during the amplification process.

Further, the nucleic acid amplification method (FIGS. 1, 5, 55-57) according to the present invention can be expressed as including the steps of:

a) a first amplification comprising the steps of:

-providing a starting nucleic acid 1.1 comprising a target sequence;

-hybridizing a first oligonucleotide primer (P1.1) to the nucleic acid to be amplified (starting nucleic acid 1.1 or P2.1-Ext) carrying the target sequence, wherein said first oligonucleotide primer (P1.1) comprises the following regions:

a first region (P1.1.1) which can bind sequence-specifically to a region (P2.1E1) of the nucleic acid to be amplified; and

-extending the first oligonucleotide primer (P1.1) by a first polymerase to obtain a first primer extension product (P1.1-Ext), the first primer extension product (P1.1-Ext) comprising, in addition to the first oligonucleotide primer (P1.1), a synthesis region (P1.1E1 to P1.1E4) substantially complementary to a nucleic acid or target sequence to be amplified, wherein the first primer extension product and the nucleic acid to be amplified are present in double stranded form;

-a control oligonucleotide (C1.2) is bound to the first primer extension product (P1.1-Ext), wherein the control oligonucleotide (C1.2) comprises the following regions:

a first region (C1.2.1) that can bind to a second region (overhang) of the first primer extension product (P1.1E6);

a second region (C1.2.2) complementary to the first region of the first oligonucleotide primer (P1.1.1); and

a third region (C1.2.3) that is substantially complementary to at least a portion of the synthesis region of the first primer extension product (P1.1E4);

wherein the control oligonucleotide (C1.1) does not act as a template for primer extension of the first oligonucleotide primer (P1.1) and the control oligonucleotide (C1.1) binds to the first primer extension product (P1.1E6, P1.1E5, P1.1E4) thereby displacing the complementary region (P2.1E1, P2.1E2) of the nucleic acid to be amplified;

-hybridizing a second oligonucleotide primer (P1.1) to said first primer extension product, wherein said second oligonucleotide primer (P21) comprises a region (P2.1.1) that can sequence-specifically bind to the synthesis region of the first primer extension product (P1.1E1);

-extending the second oligonucleotide primer (P21) by a first polymerase to obtain a second primer extension product (P2.1-Ext), the second primer extension product (P2.1-Ext) comprising, in addition to the second oligonucleotide primer (P2.1), a synthetic region (P2.1E4 to P2.1E1) substantially identical to the nucleic acid or target sequence to be amplified, wherein the first primer extension product (P1.1-Ext) and the second primer extension product (P21) form a first double stranded amplification product; and

-repeating the step of first amplification until a desired amount of first amplification product has been synthesized.

b) A second amplification comprising the steps of:

-hybridizing a third oligonucleotide primer (P32) to said second primer extension product (P1.1-Ext), wherein said third oligonucleotide primer (P3.2) comprises a first region (P3.1.1) which region (P3.1.1) can sequence-specifically bind to a region of a second primer extension product (P2.1E1);

-extending the third oligonucleotide primer (P32) by a second polymerase to obtain a third primer extension product (P32-Ext), which third primer extension product (P3.1/2-Ext) comprises, in addition to the third oligonucleotide primer (P3.1; P3.2), a synthetic region (P3.1E5 to P3.1E2, or P3.1E5 to P3.1E1) substantially complementary to the second primer extension product (P2.1-Ext) or the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) are present in double stranded form;

-hybridizing a fourth oligonucleotide primer (P4.2) to the first primer extension product (P1.1-Ext) and/or to the third primer extension product (P3.1-Ext), wherein said fourth oligonucleotide primer (P4.2) comprises a first region (P4.1.1) that can sequence-specifically bind to the synthesis region of the first primer extension product (P1.1E1) and the third primer extension product (P3.1E2);

-extending the fourth oligonucleotide primer (P4.2) by the second polymerase to obtain a fourth primer extension product (P4.2-Ext) comprising, in addition to the fourth oligonucleotide primer, a synthetic region (P4.1E5 to P4.1E2, or P4.1E5 to P4.1E1) substantially complementary to the first primer extension product (P1.1-Ext) or substantially identical to the target sequence, wherein the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.1-Ext) are present in double stranded form;

-separating the first primer extension product (P1.1-Ext) from the double strand of the fourth primer extension product (P4.2-Ext), and separating the second primer extension product (P2.1-Ext) from the double strand of the third primer extension product (P3.1-Ext), and separating the fourth primer extension product (P4.1-Ext) from the double strand of the third primer extension product (P3.1-Ext);

-hybridizing the third oligonucleotide primer (P32) with a fourth primer extension product (P4.2-Ext) and extending the third oligonucleotide primer (P3.2) by a second polymerase; and

-hybridizing said fourth oligonucleotide primer to the third primer extension product (P3.2-Ext) and extending the fourth oligonucleotide primer (P4.2) by the second polymerase.

Furthermore, the present invention also includes the following aspects:

the method of the first aspect, wherein the nucleic acid fragment comprises the target sequence in single stranded form.

The method of the first aspect, wherein the nucleic acid fragment comprising the target sequence is present in double-stranded form (comprising the nucleic acid fragment comprising the first target sequence, the starting nucleic acid strand, and the nucleic acid fragment complementary thereto), and the double-stranded nucleic acid fragment is converted to single-stranded form prior to the first amplification.

The method of the first aspect, wherein the second amplification is performed by Polymerase Chain Reaction (PCR) using the third and fourth primers.

The method of the first aspect, wherein the separation of the synthesized strands during the first amplification is performed predominantly in a sequence-specific manner and involves a control oligonucleotide.

The method of the first aspect, wherein the separation of the synthetic strands during the second amplification is performed at a temperature that causes the separation of the synthetic strands. For example, the temperature ranges from 80 ℃ to 105 ℃.

The method of the first aspect, wherein the hybridization and primer extension during the second amplification are performed at a temperature that allows the primer to bind predominantly complementarily to the complementary sequence segment of the synthesized strand, and allows the primer to be extended by the second polymerase. For example, the temperature ranges from 20 ℃ to about 80 ℃.

The method of the first aspect, wherein prior to the second amplification, the first and second primer extension products synthesized during the first amplification are separated such that both primer extension products are single-stranded.

The method of the first aspect, wherein the first oligonucleotide primer comprises a sequence segment in its first region that binds complementarily to the first target sequence in its 3' segment.

The method of the first aspect, wherein the second oligonucleotide primer comprises in its 3 'region a sequence segment that is substantially identical to a portion of the first target sequence, and the portion is located in the 5' segment of the target sequence.

The method of the first aspect, wherein the control oligonucleotide comprises in its second and third regions a sequence segment that is substantially identical to a portion of the target sequence.

The method of the first aspect, wherein the first target sequence and the strand complementary to the first target sequence flank a primer pair consisting of a first oligonucleotide primer and a second oligonucleotide primer.

The method of the first aspect, wherein the third oligonucleotide primer comprises a sequence segment in its 3' region that binds substantially complementary to the second primer extension product of the first amplified fragment 1.1.

The method of the first aspect, wherein the third oligonucleotide primer comprises a sequence segment in its 3 'region that binds substantially complementary to the second primer extension product of the first amplified fragment 1.1, and the 3' region comprises a segment that is complementary to the first target sequence.

The method of the first aspect, wherein the fourth oligonucleotide primer comprises a sequence segment in its 3' region that binds substantially complementary to the first primer extension product of the first amplified fragment 1.1.

The method of the first aspect, wherein the fourth oligonucleotide primer comprises a sequence segment in its 3 ' region that binds substantially complementary to the first primer extension product of the first amplified fragment 1.1, and the 3 ' region comprises a segment that is substantially identical to a portion of the first target sequence, and the portion is located in the 5 ' region of the target sequence.

The method of the first aspect, wherein the first target sequence and the strand complementary to the target sequence flank, at least in part, a primer pair formed by a third oligonucleotide primer and a fourth oligonucleotide primer.

The method of the first aspect, wherein the first oligonucleotide primer and the third oligonucleotide primer are the same.

The method according to the first aspect, wherein the first oligonucleotide primer and the third oligonucleotide primer are the same, wherein the primer extension products (P4.1-Ext part 1) and (P4.1-Ext) obtained during the second amplification are the same.

The method of the first aspect, wherein the first oligonucleotide primer and the third oligonucleotide primer are the same, but the second and fourth primers are different.

The method according to the first aspect, wherein the first oligonucleotide primer and the third oligonucleotide primer are the same, wherein the primer extension products obtained during the second amplification (P4.1-Ext part 1) and (P4.1-Ext) are the same, but the primer extension products of the second and fourth primers are different.

The method of the first aspect, wherein the second oligonucleotide primer and the fourth oligonucleotide primer are the same.

The method according to the first aspect, wherein the second oligonucleotide primer and the fourth oligonucleotide primer are the same, wherein the primer extension products (P3.1-Ext part 1) and (P3.1-Ext) obtained during the second amplification are the same.

The method of the first aspect, wherein the second oligonucleotide primer and the fourth oligonucleotide primer are the same, but the first and third oligonucleotide primers are different.

The method according to the first aspect, wherein the second oligonucleotide primer and the fourth oligonucleotide primer are the same, wherein the primer extension products obtained during the second amplification (P3.1-Ext part 1) and (P3.1-Ext) are the same, but the primer extension products of the first and third oligonucleotide primers are different.

The method of the first aspect, wherein the first and third oligonucleotide primers and the second and fourth oligonucleotide primers are the same.

The method of the first aspect, wherein the first oligonucleotide primer and the third oligonucleotide primer and the second and fourth oligonucleotide primers are the same, wherein in the second amplification process, the resulting primer extension products (P4.1-Ext part 1) and (P4.1-Ext) are the same, and the resulting primer extension products (P3.1-Ext part 1) and (P3.1-Ext) are the same.

The method of the first aspect, wherein the second region of the first oligonucleotide primer comprises a polynucleotide tail that does not bind to the first target sequence.

The foregoing embodiments relating to the first aspect may be combined with each other.

The nucleic acid to be amplified in the first amplification comprises a first target sequence. Prior to initiating the first amplification, at least one starting nucleic acid strand 1.1 is added to the reaction, which starting nucleic acid strand 1.1 comprises the target sequence and can serve as a template for the synthesis of the first amplified fragment.

The first amplified synthetic primer extension product (first amplified fragment 1.1) comprises the target sequence. The first amplified fragment 1.1 can be used as a starting nucleic acid strand 2.1, which starting nucleic acid strand 2.1 has the function of a template for the second amplification.

The primer extension products (P3.1-Ext and P4.1-Ext) synthesized in the second amplification (second amplified fragment 2.1) comprise at least part of the first target sequence.

In the context of the present specification, the term "substantially complementary" means that two nucleic acids (in particular their regions of mutual complementarity) are mismatched with respect to each other by no more than 5, 4, 3, 2 or 1.

In certain embodiments of the methods of the invention, the step of first amplifying is repeated until the copy number of the first amplified fragment (1.1) is from 10 to 1E12, particularly from 100 to 10E9, particularly from 1,000 to 10E9(10E9 ═ 1,000,000,000).

In certain embodiments of the methods of the present invention, the step of first amplifying is repeated at least twice.

In certain embodiments of the methods of the invention, the second amplification begins with multiple copies of the first amplified segment (1.1) with a copy number of 10-1E12 copies, specifically 100-1E10 copies, specifically 10E3-10E9 copies of the first amplified segment (11).

In certain embodiments of the methods of the invention, the second amplification step is repeated until the number of copies of the amplified fragment (2.1) is from 10E5 to 1E16 copies, particularly from 10E5 to 1E14 copies, particularly from 10E6 to 1E14 copies.

In certain embodiments of the methods of the present invention, the step of second amplifying is repeated at least twice.

In another embodiment, the detection system comprises at least one probe oligonucleotide labeled with a fluorescent reporter.

In another embodiment, the detection system comprises at least one probe oligonucleotide labeled with a fluorescent reporter and a fluorescent quencher.

In another embodiment, the detection system comprises at least one probe oligonucleotide labeled with a donor fluorophore that can form a FRET pair with a fluorescent reporter.

In another embodiment, the probe oligonucleotide comprises a sequence segment that is substantially complementary to the formed at least one primer extension product (P1.1-Ext, P2.1-Ext, P3.1-Ext, P4.1-Ext) that can hybridize under suitable conditions (hybridization conditions) to the formed at least one primer extension product.

In another embodiment, the sequence segment is complementary to the first and/or third primer extension products.

In another embodiment, the sequence segment is complementary to the first and/or third primer extension products, wherein the probe oligonucleotide can complementarily bind at the 3' segment of each primer extension product that is not complementarily bound to the control oligonucleotide.

In another embodiment, the sequence segment is complementary to the second and/or fourth primer extension product.

In another embodiment, the sequence section of the probe oligonucleotide is 10 to 50 nucleotides, in particular 15 to 40 nucleotides, in particular 15 to 30 nucleotides in length.

In another embodiment, the sequence segment of the probe oligonucleotide does not comprise a sequence segment that is substantially complementary to a control oligonucleotide.

In another embodiment, said sequence segment of the probe oligonucleotide comprises a sequence segment substantially complementary to a control oligonucleotide, said segment having a length of less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides.

In another embodiment, said sequence segment of the probe oligonucleotide does not comprise a sequence segment that is substantially complementary to one of the oligonucleotide primers.

In another embodiment, said sequence segment of the probe oligonucleotide comprises a sequence region which is substantially complementary to one of the oligonucleotide primers, wherein said segment has a length of less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides.

In another embodiment, the sequence segment of the probe oligonucleotide does not comprise a sequence region that is substantially identical to the sequence of the third region of the control oligonucleotide.

In another embodiment, said sequence section of the probe oligonucleotide comprises a sequence region which is substantially identical to the sequence of the third region of the control oligonucleotide, said section having a length of less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides.

In one embodiment, the control oligonucleotide comprises one of the following components (a fluorescence reporter and/or a fluorescence quencher and/or a donor fluorophore), and at least one of the components is located in the third region of the control oligonucleotide.

In one embodiment, the probe oligonucleotide is at least partially cleavable by a 5 '-3' nuclease.

In another embodiment, the probe oligonucleotide comprises a segment of sequence substantially complementary to a portion comprised by the target sequence or one of its amplification products, said segment having a length of 5-50 nucleotides, in particular 10-40 nucleotides, in particular 15-30 nucleotides.

In another embodiment, the probe oligonucleotide does not comprise a sequence segment that is substantially complementary to the target sequence or its complementary strand.

In another embodiment, the probe oligonucleotide comprises a sequence segment that is not substantially complementary to the target sequence or its complementary strand.

Under suitable hybridization conditions, binding of the probe oligonucleotide to each complementary segment of the formed primer extension product results in the formation of a double strand. Hybridization conditions exist during the method.

At an appropriate point in time during the method, the reaction is illuminated with light of an appropriate wavelength to generate a fluorescent signal, and the fluorescent signal is detected by a fluorescent reporter, wherein the intensity of the fluorescent signal is measured.

The detection of the fluorescent signal is performed by suitable optical/physical means, wherein the increase or decrease of the fluorescent signal is measured. Using a suitable sensor, the intensity of the fluorescent signal can be converted into a measurement and, after appropriate calibration, it can be determined whether the desired target sequence is present in the reaction mixture.

An important aspect of fluorescent detection systems is the reporter-quencher pair. If the quencher is in close proximity to the reporter, no signal is emitted when exposed to the excitation light. If the reporter and quencher molecules are held in close proximity by the complementary stem sequence, no fluorescent signal will be emitted even under light. However, if the fluorescence system is modified so that the nucleotide sequence located between the reporter and the quencher can hybridize to the target sequence, the reporter and quencher are located so far apart in space that the reporter molecule is capable of generating fluorescent radiation when the reaction mixture is illuminated with an excitation light source. The distance between the reporter and the quencher depends on the molecule used. Typically, when the distance between the quencher and the reporter is less than 25 nucleotides, the light emission upon irradiation of the fluorescent reporter decreases or almost completely disappears. The distance may be due to the nucleotide sequence or to the specific molecule (e.g. linker or spacer) responsible for the distance.

In another embodiment, the fluorescent reporter may form a specific reporter-donor pair (FRET pair) with the donor fluorophore, which can transfer absorbed energy to the fluorescent reporter via Fluorescence Resonance Energy Transfer (FRET).

A reporter-donor pair comprising a fluorescent reporter and a matched donor fluorophore and forming a fluorescence resonance energy transfer pair may allow only one partner of such a FRET pair to be coupled to a probe oligonucleotide while the other partner is coupled to a control oligonucleotide. Both the fluorescent reporter and the donor fluorophore are coupled to the respective oligonucleotide to an extent such that in the non-hybridized state of the probe oligonucleotide, the donor fluorophore is unable to transfer the absorbed energy to the fluorescent reporter.

In one embodiment, the control oligonucleotide is a component of the detection system and comprises a fluorescent reporter and/or a fluorescent quencher and/or a donor fluorophore. By simultaneously hybridizing the control oligonucleotide to the synthesized first or third primer extension product and the probe oligonucleotide to the 3' segment of the same first and/or third primer extension product, binding occurs at adjacent sequence positions of the first and/or third primer extension product resulting in spatial proximity of the donor fluorophore and the fluorescent reporter. This reduces the distance between the fluorescent reporter and the donor fluorophore to such an extent that FRET can be performed from donor fluorophore to fluorescent reporter. This causes the fluorescent reporter to generate a fluorescent signal and results in a fluorescent signal of the fluorescent reporter having an increased amount that can be detected.

After hybridization, the distance between the donor fluorophore and the fluorescent reporter should be less than 25 nucleotides, in particular less than 15 nucleotides, in particular less than 5 nucleotides. The wavelength of light upon excitation is absorbed by the donor fluorophore and transmitted to the reporter, thereby emitting light that can be detected. With regard to the arrangement of the detection system in the amplification product, the following embodiment is preferred (wherein the fluorescence reporter or fluorescence quencher or donor fluorophore is coupled to the control oligonucleotide, in particular in the third region of the control oligonucleotide):

-the coupling at the control oligonucleotide is preferably performed in the third region of the control oligonucleotide;

the coupling at the control oligonucleotide is preferably performed at or near the 5 'end or the third region (e.g. 2 to about 10 nucleotides from the 5' end of the third region);

the coupling with the probe oligonucleotide is preferably carried out in the middle region of the probe oligonucleotide; and

the coupling to the probe oligonucleotide is preferably carried out in the 3' section of the probe oligonucleotide.

In the application of the present invention, the following embodiments have proved to be particularly advantageous:

-the distance between the two members of the FRET pair is less than about 30 nucleotides in the hybridized state of the oligonucleotide hybridized to the first primer extension product;

-modifying a probe oligonucleotide comprising a 3 'segment complementary to one of the primer extension products such that the polymerase cannot extend the 3' end;

-the probe oligonucleotide comprises a 3 'segment complementary to one of the primer extension products such that a polymerase can extend said 3' end, wherein said probe oligonucleotide serves as a PCR primer;

-a method for detecting amplification, wherein two or more nucleic acid strands are amplified, wherein a specific detection system is used for each nucleic acid strand to be amplified;

-a method for detecting amplification, wherein two or more nucleic acid strands to be amplified are amplified, wherein the amplification of at least two nucleic acid strands to be amplified is detected by a unified detection system;

-said amplification comprises asymmetric amplification of one of the primer extension products;

-exciting the fluorescent reporter and measuring the fluorescent signal of the fluorescent reporter during amplification;

-exciting the donor fluorophore and measuring the fluorescent signal of the fluorescent reporter during amplification;

-exciting the fluorescent reporter and measuring the fluorescent signal of the fluorescent reporter after amplification;

-exciting the donor fluorophore and measuring the fluorescent signal of the fluorescent reporter after amplification;

-the probe oligonucleotide is a DNA oligonucleotide;

The probe oligonucleotide is a DNA oligonucleotide, the 3' end of which is blocked so that the polymerase cannot extend it;

-the probe oligonucleotide comprises a sequence segment complementary to the first and/or third primer extension product, wherein the sequence segment is 8 to about 60 nucleotides in length; and

-the probe oligonucleotide comprises a sequence segment complementary to a 3' segment of the first and/or third primer extension product, wherein the complementary sequence segment does not bind to the control oligonucleotide, wherein the segment is 8 to about 40 nucleotides in length.

The probe oligonucleotide comprises at least one additional modification selected from: linkers (e.g. HEG, C3, C6), sugar phosphate backbone modifications (e.g. PTO, 2' -O-Me, RNA, PNA, LNA modifications).

In certain embodiments of the methods of the invention, the third oligonucleotide primer and/or the fourth oligonucleotide primer has a second region adjacent to the 5' end of the first region or joined by a linker, wherein the second region is incapable of complementarily binding to the first primer extension product or the second primer extension product.

In certain embodiments of the methods of the present invention, the second region of the third and/or fourth oligonucleotide primer is located 5' to the first region of the third and/or fourth oligonucleotide primer.

In certain embodiments of the methods of the invention, the third oligonucleotide primer and/or the fourth oligonucleotide primer comprises a barcode sequence.

In certain embodiments of the methods of the invention, separating the first primer extension product from the duplex formed by the fourth primer extension product and separating the second primer extension product from the duplex formed by the third primer extension product is performed by heat denaturation, in particular at a temperature in the range of 85 ℃ to 105 ℃.

In certain embodiments of the methods of the present invention, the first polymerase is capable of strand displacement during synthesis.

In certain embodiments of the methods of the present invention, the second polymerase is a thermostable polymerase.

In certain embodiments of the methods of the invention, the first polymerase and the second polymerase are the same.

In certain embodiments of the methods of the present invention, the first oligonucleotide primer and the third oligonucleotide primer are substantially identical.

In certain embodiments of the methods of the present invention, the second oligonucleotide primer (P2.1) and the third oligonucleotide primer (P4.2) are substantially identical.

In the context of the present specification, the term "substantially identical" especially means that two nucleic acid sequences are mismatched with respect to each other by no more than 5, 4, 3, 2 or 1.

In certain embodiments of the methods of the present invention, the reaction conditions of the first amplification are selected such that spontaneous dissociation of the first amplification product does not occur.

In certain embodiments of the methods of the invention, the second amplification is performed at two or more temperatures, wherein at a first temperature the third and/or fourth oligonucleotide primer hybridizes to and extends the first and/or second and/or third and/or fourth primer extension product, and at a second temperature the resulting duplexes separate.

In certain embodiments of the methods of the invention, the second amplification is performed at three or more temperatures, wherein at a first temperature the third and/or fourth oligonucleotide primer hybridizes to the first and/or second and/or third and/or fourth primer extension product, at a second temperature the third and/or fourth primer extends, and at a third temperature the resulting duplexes separate.

In certain embodiments of the methods of the present invention, the first amplification and the second amplification are performed in the same reaction batch.

In certain embodiments of the methods of the present invention, the second polymerase, the third oligonucleotide primer, and/or the fourth oligonucleotide primer can be activated, and/or the control oligonucleotide can be inactivated.

For example, the activatable polymerase may be a reversibly inactivated polymerase, such as a thermostable polymerase (hot start polymerase), or a polymerase reversibly inactivated by an antibody or chemical modification.

The activatable primer may be a reversibly inactivated primer, such as an oligonucleotide having a protected 3 '-OH group, wherein the protecting group may be removed, particularly by a polymerase having 5' exonuclease activity. Here, it would be advantageous to use a polymerase without 5' exonuclease activity in the first amplification.

For example, the control oligonucleotide may be inactivated or cleaved by a polymerase having 5' exonuclease activity. Alternatively, the control oligonucleotide may also be removed by cleaving it by other enzymatic or chemical means prior to the second amplification.

In certain embodiments of the methods of the present invention, the first polymerase is inactivated prior to performing the second amplification. For example, if the first polymerase is a thermolabile polymerase, the inactivation may be achieved by heat denaturation.

In certain embodiments of the methods of the present invention, it is contemplated that the first amplification is performed in a first reaction batch and the second amplification is performed in a second reaction batch.

In certain embodiments of the methods of the present invention, it is contemplated that an aliquot of the first reaction mixture is added to the second reaction mixture.

In certain embodiments of the methods of the present invention, it is contemplated that the entire first reaction mixture is added to the second reaction mixture.

In certain embodiments of the methods of the invention, the third region of the control oligonucleotide is substantially complementary to the portion of the synthesis region of the first primer extension product immediately adjacent to the oligonucleotide primer portion of the first oligonucleotide extension product. This is advantageous for improving sequence-specific substitutions of the nucleic acid to be amplified.

In certain embodiments of the methods of the present invention, it is contemplated that the control oligonucleotide comprises a fourth region capable of binding substantially sequence-specifically to the 3' region of the third oligonucleotide primer. The fourth region may be located within the second region and/or the third region of the control oligonucleotide or may comprise a sequence segment of the second and/or third region and is in particular 9-30 nucleotides, in particular 10-20 nucleotides or 12-16 nucleotides in length.

In the context of the present specification, the term "substantially sequence-specifically" means that the regions of the oligonucleotide primer and the nucleic acid to be amplified which are substantially complementary to each other comprise no more than 5, 4, 3, 2 or 1 mismatches.

In certain embodiments of the invention, the control oligonucleotide comprises one or more nucleotide modifications suitable to prevent extension of a primer bound to the control oligonucleotide. For example, multiple 2' -O-alkyl modifications can prevent or prevent such extension. In particular, the plurality of nucleotide modifications are located in the second and/or third region of the control oligonucleotide. In particular, the control oligonucleotide comprises at least 5 such modifications, better still at least 10 modifications.

In one embodiment, the control oligonucleotide consists entirely of nucleotide modifications.

In certain embodiments of the methods of the invention, the portion of the region of the first primer extension product synthesized by the polymerase that is substantially complementary to the third region of the control nucleotides is 5-70 nucleotides in length.

In certain embodiments, the third single stranded region of the control oligonucleotide is fully complementary to the 5' segment of the first primer extension product, wherein the complementary sequence segments can have the following lengths: from at least 3 nucleotides to 70 nucleotides, or from at least 5 nucleotides to 50 nucleotides, especially from 5 nucleotides to 40 nucleotides, from 5 nucleotides to 30 nucleotides, especially from 5 nucleotides to 20 nucleotides.

In certain embodiments of the methods of the invention, it is contemplated that the first amplification is performed substantially isothermally.

In certain embodiments of the methods of the invention, the second amplification is performed at three temperatures, wherein hybridization of the third or fourth oligonucleotide primer and (optionally) initial extension of the primer is performed at a first temperature, full extension of the primer is performed at a second temperature, and the formed primer extension product is separated from its respective template strand at a third temperature. In particular, the first temperature is from 25 ℃ to 65 ℃, the second temperature is from 65 ℃ to 80 ℃, and the third temperature is from 85 ℃ to 105 ℃.

In certain embodiments of the methods of the present invention, the nucleic acid to be amplified is 20 to 300 nucleotides in length.

In certain embodiments of the methods of the present invention, the first segment of the oligonucleotide primer is 15-100 nucleotides in length.

In certain embodiments of the methods of the present invention, the second oligonucleotide primer is 15-100 nucleotides in length.

In certain embodiments of the methods of the invention, the control oligonucleotide is 20-100 nucleotides in length.

In certain embodiments of the methods of the present invention, the third oligonucleotide primer is 15-60 nucleotides in length.

In certain embodiments of the methods of the present invention, the fourth oligonucleotide primer is 15-60 nucleotides in length.

In certain embodiments of the methods of the invention, the third oligonucleotide primer has at least one nuclease-resistant nucleotide modification, such as a PTO (phosphorothioate) or 2' -O-alkyl modification.

In certain embodiments of the methods of the invention, the fourth oligonucleotide primer has at least one nuclease-resistant nucleotide modification, such as a PTO or a 2' -O-alkyl modification.

In certain embodiments of the methods of the present invention, the first oligonucleotide primer has one or more modifications in the second region (particularly the first region immediately following the first oligonucleotide primer) that prevent the polymerase used from replicating the second region. Advantageously, only the first region of the first oligonucleotide primer is copied.

In certain embodiments, this can be achieved by using nucleotide modifications that can bind complementarily to the first primer extension product, but which do not accept a polymerase as a template. Examples of such nucleotide modifications are nucleotide compounds with modified sugar phosphate backbone moieties, such as 2 '-O-alkyl RNA modifications (e.g. 2' -OMe), LNA modifications or morpholino modifications. Typically, the presence of such a modification in the strand prevents a DNA-dependent polymerase from transcribing the strand. The number of such modifications may vary, and typically several modifications (1-20) are sufficient to prevent the polymerase from reading such strands. For example, such nucleotide modifications may be used at or near the binding site of the first oligonucleotide primer to the control oligonucleotide and/or as a component of the second region of the first oligonucleotide primer.

As a result of the use of such modifications, the function of the polymerase is partially hindered, so that certain segments of the structure used cannot be replicated by the polymerase and remain predominantly single-stranded. They can be combined with more reactive components in the single-stranded form to perform their functions.

Various features of the methods of the invention in certain embodiments have been discussed above. Those skilled in the art will recognize that the described features may be combined in more particular embodiments. This applies to all features discussed in the context of this specification, unless their combination is clearly meaningless, for example in the case of mutually exclusive parameter overlaps.

According to a further aspect of the present invention, there is provided a kit for carrying out the method of the present invention according to the above aspect or specific embodiments or alternatives thereof. The kit of the invention comprises:

-a first oligonucleotide primer comprising the following regions:

a first region which can bind sequence-specifically to a region of the nucleic acid to be amplified;

a second region adjacent to the 5' end of the first region or linked by a linker, wherein the second region can bind to the first control oligonucleotide and is not substantially replicated by the polymerase used for amplification under the selected reaction conditions; and

Wherein the first oligonucleotide primer is extendable by a polymerase to a first primer extension product comprising the synthesis region and the first oligonucleotide primer;

-a second oligonucleotide primer, wherein said second oligonucleotide primer comprises a region which binds sequence specifically to the synthesis region of said first primer extension product and is extendable by a polymerase to a second primer extension product comprising a synthesis region in addition to said second oligonucleotide primer;

-a control oligonucleotide comprising the following regions:

a first region which can bind to a second region of the first primer extension product;

a second region which is substantially or completely complementary to the first region of the first oligonucleotide primer; and

a third region which is substantially or fully complementary to at least a portion of the synthesis region of the primer extension product;

wherein the control oligonucleotide does not serve as a template for primer extension of the first oligonucleotide primer, and the control oligonucleotide can bind to the primer extension product while displacing the complementary region of the second primer extension product;

-a third oligonucleotide primer comprising a first region which can sequence-specifically bind to a segment of said second primer extension product and which can be extended by a polymerase to a third primer extension product (P3.1-Ext) comprising a synthesis region and a third oligonucleotide primer; and

-a fourth oligonucleotide primer comprising a first region which can sequence-specifically bind to the synthesis region of the first primer extension product and which can be extended by a polymerase to a fourth primer extension product comprising the synthesis region and the fourth oligonucleotide primer.

In certain embodiments of the kits of the present invention, the kit further comprises at least one polymerase.

In certain embodiments of the kits of the invention, the kit comprises a first polymerase for extending the first and second oligonucleotide primers and a second polymerase for extending the third and fourth primers.

In certain embodiments of the kits of the invention, the first polymerase does not have 5 'exonuclease activity and the second polymerase does not have 5' exonuclease activity. In particular, the second polymerase may be a thermostable polymerase.

In certain embodiments of the kits of the invention, the second polymerase, the third oligonucleotide primer, and/or the fourth oligonucleotide primer can be activated, and/or the control oligonucleotide can be inactivated.

According to a further aspect of the present invention, there is provided the use of a kit as described in the above aspects or specific embodiments or alternatives thereof in the practice of the methods of the present invention.

Further details and advantages of the invention will be described, without limitation, by the figures and the detailed description of selected embodiments.

The combination according to the invention comprises two amplification methods to be carried out one after the other. During the first partial amplification (first amplification method), a nucleic acid strand comprising the target sequence is amplified. Thereby, an amplified nucleic acid strand is produced, which is subsequently used as a template in the second partial amplification (second amplification method). The second partial amplification will in many cases be conventional PCR. During the second partial amplification, amplification continues from the target nucleic acid or the nucleic acid comprising the target nucleic acid amplified in the first partial amplification. The PCR fragment was amplified. The PCR fragment comprises inter alia a target sequence or a part of a target sequence. In addition, specific changes can be made to the amplifiable nucleic acid strands during the second amplification procedure. For example, the target sequence may be flanked by the use of barcode primers or detection-specific oligonucleotide primers. Detection can also be carried out using PCR probes, such as the so-called Taqman probe. Furthermore, during the PCR stage, immobilized oligonucleotide primers can be used to immobilize the target sequence on a solid phase, thereby allowing PCR to proceed as a solid phase PCR.

By using the first amplification method described in the present invention, it should be possible to synthesize or amplify a nucleic acid strand having a defined sequence composition, wherein the resulting product can be used as a starting nucleic acid strand having a template function for a subsequent PCR, and the PCR amplification is carried out using at least one unique PCR primer.

The object of the invention is further achieved by providing a first amplification method (first partial amplification) and a corresponding apparatus for carrying out the method. The implementation of the first amplification procedure has been described in PCT application PCT/EP2017/071011 and European application 16185624.0. For details of the amplification, reference is made to said application.

The second amplification method (second sub-amplification) may in particular be performed by PCR, wherein at least one of the primers used has a different composition and/or structure than the oligonucleotide primers used in the first amplification method. This results in the amplification of at least one nucleic acid strand comprising the specific target sequence or part thereof.

PCR amplification itself is generally capable of generating well-characterized amplification products from an initial template with copy numbers in excess of about 1,000 copies (and better, copy numbers in excess of about 100,000 copies), or of generating specific signals in real time. If the number of copies is reduced to less than 1000 copies (e.g., to 100 or 10 copies), the PCR must contain more synthesis cycles, thereby increasingly leading to erroneous amplification products or signals. This is especially the case if the PCR has to amplify sequence variants (e.g. mutations or allelic variants of the sequence) that are present in small amounts in the batch, and the PCR amplification is performed in the presence of a large number of other sequence variants (e.g. wild-type sequences or allelic variants). Although many methods have been developed to improve the specificity of PCR, amplification-dependent detection methods can benefit from the higher specificity of amplification methods, for example in the field of liquid biopsies. In clinical diagnostics in particular, there is a need to improve the specificity of the measurement method.

Due to the widespread use of PCR technology, a number of modifications to the technology or extensions to the basic PCR methodology have been made, and these modifications or extensions have been used in many areas of molecular biology. For example, the specificity of the signal or the specificity of the PCR product can be improved in said application by upstream ligation of another first amplification method.

The present invention describes the combination of a prior high specificity amplification method with downstream PCR. This combination makes it possible to increase the initial copy number of the nucleic acid strand to be amplified to the desired number under the highly selective amplification conditions of the first amplification method and then, if desired, to amplify it further under the less specific conditions of PCR amplification. Therefore, the first amplification method (first partial amplification) has the function of a first amplifier with high specificity. The number of synthetic copies in the first segment ranges, for example, from about 10 to about 1E11 copies, more preferably from about 100 to about 1.0E10 copies, and preferably from about 1000 to about 10E8 copies. The number of target sequences is increased by the first amplification. The amplification (based on the initial number of target sequences in the batch) is for example in the following range: from about 2 times to about 1E10 times, better from about 10 times to about 10E9 times, even better from about 10 times to about 10E8 times, preferably from about 10 times to about 10E7 times, especially preferably from about 100 times to about 10E6 times. The following concentration ranges with respect to the reaction volume can be achieved: from about 10amol/l to about 10nmol/l, better from about 1fmol/l to about 1nmol/l, even better from about 10fmol/l to about 0.1nmol/l, especially from about 10fmol/l to about 10 pmol/l.

The second amplification method (second sub-amplification, used as a PCR method or modification thereof) acts as a second amplicon and allows the use of existing PCR-based methods, such as probe insertion or barcode coding or sequence coding in NGS library construction or solid phase PCR in combination with the specific products of the first amplification.

The advantage of such a combination is on the one hand that the number of PCR cycles required for amplification is reduced to the required amount of the final product, thereby reducing the likelihood or extent of synthesis of defective products by PCR. Thus, the synthetic results may have higher specificity than PCR amplification alone.

In a specific embodiment, during the first amplification reaction, a first amplification with the desired component of the first amplification system is first performed in the same reaction batch in the absence of at least one essential component of the second amplification system. For example, PCR primers or thermostable polymerases are added just prior to PCR amplification.

After the first amplification reaction is complete, the reaction mixture is contacted with the components of the second amplification system and PCR amplification is performed.

In certain embodiments, the reaction components of a particular amplification system are present in separate reaction batches and/or in separate reaction vessels prior to initiation of amplification.

For example, a first amplification reaction is performed in one reaction vessel, and the resultant of the reaction is then (fully or partially) transferred to a second reaction vessel, followed by a second amplification.

In other embodiments, the reaction components are added sequentially such that the components of the first amplification system are added first and the first amplification reaction is performed. The components of the second amplification system are then added so that a second amplification can be performed. In other embodiments, the components of the second amplification system are added to the first amplification system such that the reactions are performed substantially in the same reaction vessel. Thus, the order of the two amplification methods depends on the chronological order of addition of the components.

Both reactions can be carried out in particular in a closed system in order to reduce the possibility of contamination. For example, such a system may comprise at least two separate reaction vessels. In certain embodiments, the batch material is also transferred from one reaction vessel to another using a closed system. For example, in a closed reaction vessel system, such separation of the two reactions is referred to as separate reaction vessels, which are combined to form a cartridge system, an array system, or a microfluidic system.

In certain embodiments, a first amplification method comprising amplifying a nucleic acid of a first amplification is used for a second amplification without splitting the first method. Thus, the first batch is substantially completely transferred to the second amplification reaction. The large number of synthetic copies from the first amplification procedure are transferred therewith to the second amplification system and range in number from, for example, about 10 to about 1E11 copies, more preferably about 100 to about 1E10 copies, preferably about 1000 to about 10E9 copies. Thus, the number of target sequences is increased by the first amplification. The increase (relative to the initial number of target sequences in the batch) is for example in the following range: from about 2 times to about 1E11 times, more preferably from about 10 times to about 1,000,000,000 times, even more preferably from about 10 times to about 100,000,000 times, preferably from about 10 times to about 10,000,000 times, especially preferably from about 100 times to about 1,000,000 times. The following concentration ranges with respect to the reaction volume can be achieved: from about 10amol/l to about 10nmol/l, better from about 1fmol/l to about 1nmol/l, even better from about 10fmol/l to about 0.1nmol/l, preferably from about 10fmol/l to about 10 pmol/l.

In another embodiment, it is preferred to use only a portion (aliquot or partial amount) of the first amplification batch in the second amplification reaction. The number of nucleic acid strands comprising at least one target sequence is increased as a result of amplification by the first amplification system. In the second amplification reaction, a portion of the amount may be used as starting material. For example, the portion may be transferred or added to the second reaction batch. For example, the portion may be relatively small and substantially dependent on the requirements of the desired application. Due to the amplification effect of PCR, the second amplification can in particular start with more than about 1000 copies of a nucleic acid strand that was sequence-specifically amplified in the first amplification procedure.

Thus, PCR amplification can be initiated when a sufficient number of amplified nucleic acid strands have been synthesized in the first amplification procedure. The number of synthetic nucleic acid chains may range as follows: for example from about 10,000 to about 1E11 copies, more preferably from about 10,000 to about 1E10 copies, and especially from about 10,000 to about 1E9 copies. The number of target sequences is increased by the first amplification as needed. The amplification (relative to the initial number of target sequences in the batch) can be measured as N-fold the initial number and is, for example, in the following ranges: from about 2 times to about 1E11 times, better from about 10 times to about 1E10 times, even better from about 10 times to about 1E9 times, especially from about 10 times to about 1E8 times, especially from about 100 times to 1E6 times. The following concentration ranges with respect to the reaction volume can be achieved: from about 10amol/l to about 10nmol/l, better from about 1fmol/l to about 1nmol/l, even better from about 10fmol/l to about 0.1nmol/l, especially from about 10fmol/l to about 10 pmol/l.

Since more than 1000 copies of a specific nucleic acid strand comprising the target sequence can be generated in the first amplification reaction, a portion (or aliquot or portion) of that number can be used for the second amplification reaction.

For example, PCR can start with the following number ranges: for example from about 100 to about 1E11 copies, more preferably from about 1,000 to about 1E10 copies, and especially from about 1,000 to about 1E9 copies. Said amount is understood to be the quantum of the synthetic nucleic acid strand comprising said target sequence, which nucleic acid strand is amplified by said first amplification.

The concentration ranges of the first amplified synthesis product relative to the reaction volume provided are as follows: from about 10 to about 100nmol/l, better from about 1 to about 10nmol/l, even better from about 10 to about 1nmol/l, especially from about 10 to about 10 pmol/l. PCR amplification can be started from said concentration of the synthesis product of the first amplification. During the PCR amplification, the product is further propagated, wherein the final concentration of the PCR fragment is 0.01nmol/l to 5. mu. mol/l, more preferably 1nmol/l to 1. mu. mol/l.

In addition, only a part of the nucleic acid strand specifically synthesized in the first amplification method can be used in the second amplification method. Thus, in certain embodiments, the first amplification provides a number of copies that is relatively redundant with respect to the number of copies necessary or desired as starting material for the PCR.

A portion is transferred from the first amplification reaction to a second amplification reaction in which the incorporated synthetic nucleic acid strand serves as a template to begin the PCR reaction.

For example, a portion of the first reaction batch can be obtained by diluting the first reaction batch and transferring a volume fraction comprising the synthetic nucleic acid strands to a second reaction. The portion of the nucleic acid strand specifically synthesized thus transferred can be used as a template for generating PCR fragments, and therefore the range of this portion (calculated from the total amount of synthesized product in the first amplification) can be as follows: from about 1E-7% to about 90%, better from about 1E-6% to about 90%, even better from about 0.0001% to about 50%, especially from about 0.001% to about 50%, or from about 0.01% to about 50%, especially from 0.1% to about 20%.

This will not only dilute the synthetic nucleic acid strand comprising the target sequence, but will also dilute the components of the first amplification system (e.g., primers and control oligonucleotides). Any by-products that may be formed are also diluted. The resulting reduction in the concentration of the first amplification system components is acceptable and may even have a positive effect on the performance of the PCR. For example, dilution of the primers and control oligonucleotides may result in a higher concentration of oligonucleotide primers or oligonucleotide probes used during the PCR reaction than the concentration of transfer oligonucleotide primers of the first amplification system. This facilitates the PCR reaction and minimizes interference with the amplification procedure.

Furthermore, dilution of the control oligonucleotide can also have a positive effect on the PCR reaction because, although the control oligonucleotide is present in the batch during the second amplification reaction, its concentration is reduced during the second amplification such that its binding to the synthetic product or reaction component is sufficiently slowed, or interaction with the complementary sequence segment is reduced or does not occur sufficiently, thus reducing its effect on the total reaction sequence by the dilution effect.

Thus, when providing nucleic acid strands for the second amplification, it is generally also possible to dilute the reaction components of the first amplification system at the same time as the provided specific nucleic acid strands are diluted. The relative amounts of the first amplification system components transferred into the second amplification reaction may be expressed in parts. The parts refer to the amount of the components used in the first amplification reaction (100%). For example, in the second amplification reaction, the transfer fraction of the first amplification system component ranges as follows: from about 1E-7% to about 50%, better still from about 1E-6% to about 30%, even better still from about 0.0001% to about 20%, especially from about 0.001% to about 10%, especially preferably from 0.1% to about 10%. Thus, the concentration of the first amplification system component is significantly reduced such that its effect in the second amplification step is reduced or negligible.

For example, the transferred parts of the first reaction batch may refer to the concentrations or parts by volume used. For example, one microliter (1. mu.l) of the batch containing the first amplification system is transferred (after completion of one amplification) to 49. mu.l of the batch containing the second amplification system, so that the dilution ratio is 2% (v/v) or 1: 50. Higher dilution levels can be achieved by using dilution series.

For example, the concentration of the control oligonucleotide in the first amplification system can be reduced from about 10. mu. mol/l to about 10nmol/l at a dilution of 1: 1000. Therefore, the number of transferred parts was only 0.01%. At such dilution, the same proportion of synthetic nucleic acid chains comprising the target sequence can be transferred simultaneously. For example, in the first amplification reaction, about 10,000,000 copies were amplified, wherein the amount of product transferred into the PCR reaction at a dilution of 1: 1000 resulted in a fractional amount of about 10,000 copies. The initial number of copies is usually sufficient to allow the PCR to proceed with a stable and sufficiently specific amplification reaction.

It may also be advantageous to dilute potentially interfering nucleic acid strands, such as wild-type molecules or allelic variants. During the sequence-specific first amplification, the target molecule is mainly specifically amplified. The other nucleic acid strands are not amplified or not significantly amplified.

Upon dilution, the dilution effect also applies to such sequences that may interfere with the PCR reaction. For example, the number of wild-type sequences is reduced from 100,000 to about 100. This can have a positive effect on the specificity of the PCR reaction.

In certain embodiments, in particular, both methods are performed in one manner (as a "homogeneous assay"). For this reason, the components of both amplification systems must be supplied in one batch at the beginning of the first amplification. Thus, the components required for both amplification systems are added to the reaction batch before the first amplification is started.

In a specific embodiment, during the first amplification reaction, a first amplification with the desired component of the first amplification system is first performed in the same reaction batch in the presence of at least one necessary component of the second amplification system.

Combining two amplification systems into one reaction batch may require adjustment of the components or concentrations and reaction conditions.

The presence of the components of the second amplification system should not prevent the first amplification reaction.

In certain embodiments, the length of the 3' segment of the third oligonucleotide primer that can complementarily bind to the control oligonucleotide is selected such that the segment does not prevent strand displacement by the control oligonucleotide. This is basically achieved based on the fact that: under the reaction conditions in which the control oligonucleotide displaces the strand (e.g., 65 ℃ step during the first amplification), the stability of the duplex complex of the control oligonucleotide and the 3' segment of the third primer is sufficiently low that binding of the third primer to the control oligonucleotide is only temporary and does not prevent strand displacement. For example, this may be affected by the length of the 3' segment of the third primer that is capable of forming such a complex with the control oligonucleotide. For example, the complex is 8-20 nucleotides in length. In addition, the 3' segment of the third primer may have one or more mismatches with the sequence composition of the control oligonucleotide in the corresponding segment, resulting in instability of the complex. In particular, 1-3 mismatches are located at positions-10 to-20 relative to the 3' terminal nucleotide of the third primer. This does not significantly affect the primer function of the third primer while reducing the stability of the complex with the control oligonucleotide.

In addition, neither the primers of the second amplification system nor the control oligonucleotides of the polymerase are used as templates. This is particularly important for the third oligonucleotide primer as it comprises a sequence segment that can bind complementarily to the control oligonucleotide. Thus, the structure of the control oligonucleotide in the region where it is likely to bind complementarily to the third oligonucleotide primer can be designed to be similar to the first primer of the first set. In certain embodiments, the control oligonucleotide uses nucleotide modifications to prevent primer extension of the third oligonucleotide primer to prevent polymerase extension of the third primer bound to the control oligonucleotide. For example, several 2' -O-alkyl modifications may mediate this blocking effect.

In order to avoid unnecessary interference between the two amplification systems, it may also be advantageous to keep the components of the second amplification system completely or partially in an "inert" or "inactive" or "reversibly inactivated" or "non-reactive" state during the first partial amplification. Only in order to perform the second amplification should this component be converted to an active (i.e. functional) state.

In certain embodiments, at least one of the PCR components is present in a reversibly inactivated form during the first amplification such that the component does not participate or does not participate significantly in the first amplification reaction. After the first amplification is completed, the reversibly inactivated component is then first activated, thereby removing the inactivation phenomenon, and the component is now present in active form in the second amplification reaction, and is thus able to play its role in the amplification.

For example, reversibly inactivated PCR primers or reversibly inactivated thermostable polymerases (so-called hot start polymerases) are used. For example, the step of converting from the first amplification to the second amplification uses reaction conditions that allow activation of the components of the inactive form. In other embodiments, the activation of the components is performed continuously under PCR conditions.

Some examples of reversibly inactivated Primers are known to the skilled person (e.g.termolale Primers, so-called CleanAmp Primers Trilink-Technologies). Such primers can be activated by heating so that a polymerase can synthesize from the primer. Other examples of reversibly inactivated primers include primers with a 3 ' terminal nucleotide comprising a modified sugar residue, such as a blocked 3 ' -OH group (e.g., via a C3 linker at the 3 ' position or a primer with a terminal dideoxynucleotide, Sambrook et al, NAR 1998, p.3073).

In certain embodiments, such primers exhibit a mismatch with the 3' end of the template. When such a primer is used, a polymerase (e.g., Bst polymerase or a modification thereof) which does not exhibit 3 '-5' exonuclease activity is used in the first amplification, in particular. Thus, these primers remain inactivated during the first phase. Therefore, when such primers are used in the PCR stage, it is necessary to activate them. Activation is typically achieved by cleaving the 3' terminal nucleotide with the modified sugar residue. For the reasons mentioned above, it is advantageous to use these primers in combination with a thermostable polymerase having 3 '-5' exonuclease activity (so-called proofreading polymerase). In certain embodiments that include primers with a 3 ' end mismatch, such end mismatch promotes the 3 ' -5 ' exonuclease function of the polymerase. After PCR amplification has begun, such "inactive" primers bind to their complementary positions on the template. After binding to the template, the terminal nucleotide comprising the blocking group can be removed by exonuclease activity (in relation to the polymerase). This generates a complementarily bound oligonucleotide primer and a free 3' -OH group that can be extended by a polymerase. Such "activated" primers can now be extended by a polymerase, so that strands complementary to the respective template can be synthesized. Polymerases capable of activating such primers under PCR conditions include Vent polymerase, Deep Vent polymerase, Pfu polymerase, and Phusion polymerase. Activation of such primers (e.g., for Pfu polymerase or Phusion polymerase) can often be accelerated by designing PCR primers that do not match the respective template at the 3 'end (or are located at-1 or-2 positions, e.g., relative to the 3' terminal nucleotide). Other thermostable polymerases (e.g., Vent polymerase or Deep Vent polymerase) can also cleave modified terminal nucleotides with blocked 3' -OH groups even if they are complementary to the template. Such primers may, for example, comprise a 3 '-5' nuclease non-cleavable bond, such as one or more Phosphorothioate (PTO) modifications, at the "-2" or "-3" position or from "-2" to "-7" position, in order to limit the degradation of the PCR primer by the polymerase. Thus preventing excessive degradation of the primer.

For example, reversibly activated polymerases include those that are reversibly inactivated by an antibody or by chemical modification (AmpliTaq polymerase). Several vendors have developed this "hot start" polymerase for PCR (Qiagen, Thermofoisher, Roche). In particular, Taq polymerase and its modifications are supplied in different reversibly inactivated states, referred to as hot start Taq polymerase. Especially preferred is a hot start polymerase, which is converted to an active form, e.g. by initial heating of the formulation to 95 ℃ for 1-10 min. Since antibodies can shield different epitopes in the polymerase, different activities of the polymerase can be reversibly inactivated to varying degrees (Scale et al, J.Immunol. methods, 1994, p.147-, Lyamichev et al PNAS, 1999, p.6143).

For certain types of amplification in homogeneous form, the polymerase that exponentially amplifies the nucleic acid strand to be amplified in the first amplification reaction is inactivated by heating before the second amplification begins. For example, the inactivation may be achieved by heating the formulation to above 80 ℃ (preferably to above 90 ℃, especially to 95 ℃) for 1-10 min. In this way, mesophilic polymerases (e.g., Bst polymerase or Bsm polymerase or Gst polymerase) can be inactivated. This inactivation facilitates the transition from the course of the first amplification reaction to the second amplification reaction. Such a temperature step allows for simultaneous polymerase inactivation of the first amplification reaction and polymerase activation of the second amplification reaction.

Due to this heat inactivation of the first polymerase, the first polymerase can no longer bind to the primer or template to the same extent. Thus, during the second amplification reaction, the primer-template complex is used, inter alia, by the polymerase to be synthesized in the second amplification step.

By switching from one polymerase to another in this manner, other activities associated with the polymerase, such as strand displacement by Bst polymerase, or 5 '-3' exonuclease activity of Taq polymerase can also be "turned off.

In certain embodiments, the 5' segment of the control oligonucleotide hybridized to the first primer extension product can be cleaved by a 5' -3 ' nuclease of a polymerase (e.g., a 5' -3 ' nuclease of Taq polymerase) during the second amplification reaction. Such processes are well known and are commonly used for probe degradation and real-time monitoring of PCR reactions (US Pat 5, 210,015). Here, the polymerase may extend the fourth PCR primer complementarily by incorporating nucleotides using the third primer extension product under appropriate reaction conditions, while the polymerase may cleave the control oligonucleotide in its 5' segment of the third region hybridized to the third primer extension product. During synthesis, the strand extended by the polymerase forms an overlap of at least one 3 ' terminal nucleotide, in particular with the control oligonucleotide, so that under the reaction conditions used a structure recognizable by the 5' -3 ' nuclease activity of the Taq polymerase is formed and can be cleaved. The 5 '-3' exonuclease activity results in the cleavage of the phosphodiester bond between nucleotides of the third region of the control oligonucleotide. Although some sugar phosphate backbone modifications (e.g., 2' -OMe ribonucleotides or PTO modifications or PNAs) can slow or even prevent the cleavage, 5' -3 ' exonuclease-induced cleavage occurs especially on the DNA strand. For the reasons mentioned above, in particular a polymerase having 5' -3 ' exonuclease activity (e.g. Taq polymerase) is used in the embodiments in combination with a control oligonucleotide which in the 5' segment of its third region comprises predominantly nucleotides or analogues thereof which are cleavable by a nuclease (e.g. DNA). The 5' segment of the control oligonucleotide is, for example, 5 to 50 (especially 10 to 30) nucleotides in length.

By degrading the control oligonucleotide bound to the first primer extension product, the polymerase can extend the second primer, even without strand displacement properties, thereby synthesizing a second primer extension product.

In certain embodiments, the presence of the components of the second amplification system during the first amplification is considered as follows:

in one aspect, the effect of the components of the second amplification system may be reduced by their reversible inactivation prior to the first amplification. On the other hand, during the first amplification, the individual sequence members should not appear as a non-specific matrix for primer extension. Therefore, the primers of the first and second amplification systems should be checked for the presence of self-complementary structures to avoid primer dimer formation.

The third PCR primer typically comprises in its 3' segment a sequence segment comprising a region complementary to the control oligonucleotide. This allows the third PCR primer to bind complementarily to the control oligonucleotide. To perform the first amplification, the third PCR primer must not prevent strand displacement of the control oligonucleotide during the first amplification. To this end, the sequence length or sequence composition of the 3' segment of the third PCR primer is adjusted so that it does not substantially bind to the control oligonucleotide under the reaction conditions of the strand displacement step (e.g., 65 ℃). This can be achieved, for example, by ensuring that the melting temperature of the complex consisting of the control oligonucleotide and the 3' segment of the third oligonucleotide primer is substantially lower than the reaction temperature of the strand displacement step (e.g., between 45 ℃ and 60 ℃). This third PCR primer is still able to bind its 3' segment to its template and initiate the primer extension reaction. This can be achieved, for example, so that the 3' segment of the third PCR primer, which can bind complementarily to the control oligonucleotide, comprises a region of 9-30 nucleotides in length (better 12-20 nucleotides, in particular 12-16 nucleotides). The 3' segment of the third PCR primer may comprise one or more mismatches with the corresponding position of the control oligonucleotide, such that the binding strength is continuously reduced.

The sequence segment of the control oligonucleotide that is substantially complementary to the third PCR primer is referred to as the fourth region of the control oligonucleotide. Said fourth region of the control oligonucleotide may comprise a sequence segment of the second region and/or the third region.

The fourth region of the control oligonucleotide comprises a region of 9-30 nucleotides in length, more preferably 12-20 nucleotides, especially 12-16 nucleotides. The fourth region of the control oligonucleotide may comprise one or more mismatches to the 3' segment of the third PCR primer. In particular, the fourth region comprises a nucleotide modification that prevents a polymerase of the first and/or second amplification system from extending the third PCR primer by using the control oligonucleotide as a template. Such modifications have been described for the combination of the first primer and the control oligonucleotide. For example, they comprise a sequence segment with a 2 '-O-alkyl modification, wherein the segment may be 6-30 modifications in length, and the nucleotide of the control oligonucleotide that is complementary to the 3' terminal nucleotide of the third PCR primer itself comprises in particular such modifications, and is also flanked on both sides by at least three nucleotides with such modifications. This ensures that the control oligonucleotides of the third and fourth primers and the polymerase of the second amplification system are not used as templates.

The generation of first and second primer extension products of defined length can play a role in separating the two products using a control oligonucleotide. Thus, it is advantageous to prevent a possible premature extension of the 3' end (of the first and second primer extension products, respectively) that occurs during the first amplification reaction by the third or fourth primer of the second amplification system as template.

Possible undesired over-extension of the 3' end of the first primer extension product can be reduced or prevented by using the fourth PCR primer as a template in different ways: in certain embodiments, this is achieved by a fourth PCR primer that, when bound to the 3 'segment of the first primer extension product, is unable to form a perfectly matched complementary binding to the 3' terminal nucleotide of the synthesized first primer extension product. This may prevent or at least reduce over-extension of the 3' terminal nucleotide of the first primer extension product.

In certain embodiments, this is achieved by the fact that the fourth PCR primer, when bound to the 3' segment of the first primer extension product, is unable to form a perfectly matched complementary binding to at least one terminal nucleotide of the synthesized first primer extension product. The position of the at least one mismatch generated is in particular at a position from-1 to-5 relative to the terminal nucleotide of the first primer extension product.

Possible undesired over-extension of the 3' end of the second primer extension product can be reduced or prevented by using the third PCR primer as a template in different ways: in certain embodiments, this is achieved by the fact that the third PCR primer, when bound to the 3 'segment of the second oligonucleotide extension product, is unable to form a perfectly matched complementary binding to the 3' terminal nucleotide of the synthesized first primer extension product. This may prevent or at least reduce over-extension of the 3' terminal nucleotide of the second primer extension product.

In certain embodiments, this is achieved by a third PCR primer that, when bound to the 3' segment of the second primer extension product, is unable to form a perfectly matched complementary binding to at least one terminal nucleotide of the synthesized second primer extension product. The position of the at least one mismatch generated is in particular at a position from-1 to-5 relative to the terminal nucleotide of the extension product of the second primer.

The presence of the components of the first amplification system during the second amplification is believed to be as follows:

in one aspect, the effect of the components of the first amplification system may be reduced by their dilution prior to the second amplification. On the other hand, during the second amplification, each member should not appear as a non-specific template for primer extension. Therefore, the primers of the first and second amplification systems should be checked for the presence of self-complementary structures to avoid the formation of primer dimers.

In one embodiment, the second amplification is performed in the presence of a control oligonucleotide of the first amplification system. Thus, the design of the control oligonucleotide, the second set of primers, and the reaction conditions must be adjusted so that the presence of the control oligonucleotide does not significantly interfere with the second amplification reaction.

First, neither the primer of the second amplification system nor the control oligonucleotide of the polymerase are used as templates. This is particularly important for the third oligonucleotide primer as it comprises a sequence segment that can bind complementarily to the control oligonucleotide in the fourth region. The structure of the control oligonucleotide in the fourth region comprises, inter alia, modifications that prevent potential primer extension. For example, several 2' -O-alkyl modifications may mediate this synthesis blocking effect.

The control oligonucleotide may be attached to the third primer extension product during the second amplification, thereby forming a complementary strand with the third primer extension product. In certain instances, such a double-stranded fragment can prevent the polymerase from completely synthesizing a complementary strand from the fourth PCR primer, and can prevent the polymerase from copying the 5' segment of the third primer extension product. Thus, the polymerase and reaction conditions are selected such that binding of the control oligonucleotide does not prevent synthesis of the fourth primer extension product.

For example, the length of the segment of the third primer extension product that can bind complementarily to the control oligonucleotide is determined by the location of the third primer. In particular, the third primer is positioned in such a way that the length of the resulting fully complementary portion of the intended third primer extension product and the control oligonucleotide is in particular in the range: from about 15 to about 60 nucleotides, or from about 20 to about 40 nucleotides, especially from about 20 to about 30 nucleotides.

In certain embodiments, a thermostable polymerase having strand displacement activity is selected particularly in the second amplification reaction, for example, a thermostable polymerase such as Vent Exo minus polymerase or Pyrophage polymerase can be used. This allows the control oligonucleotide to be separated from the third primer extension product during the second amplification and the fourth primer extension product can be synthesized in full length.

In certain embodiments, a polymerase is selected that can cleave the control oligonucleotide by the 5 '-3' exonuclease activity of the polymerase, particularly in the second amplification reaction, wherein primer extension is performed simultaneously (see above). A control oligonucleotide is used which is cleavable at least in its 5 ' segment by a 5 ' -3 ' exonuclease. Degradation gradually results in a shortening of the control oligonucleotide hybridized to the third primer extension product, which under appropriate reaction conditions (e.g., temperatures of about 65 ℃ to 75 ℃) can lead to instability of the binding, and ultimately separation of the binding to the third primer extension product. Thus, the fourth primer extension product can be synthesized in full length.

In certain embodiments, the concentration of the control oligonucleotide and the concentration of the fourth primer of the second primer set are selected such that primer binding and primer extension occur faster than the binding of the control oligonucleotide to the third primer extension product under the selected reaction conditions. For example, the concentration of the control oligonucleotide used is 0.01 to 0.3. mu. mol/l. Meanwhile, the concentration of the fourth oligonucleotide primer used is from about 0.5. mu. mol/l to 2. mu. mol/l. Particularly in the second amplification reaction, a polymerase having a high processing power (e.g., Phusion polymerase) is used. Primer binding and extension is generally faster than control oligonucleotides, so primer extension reactions have kinetic advantages.

In certain embodiments, the primer extension reaction is performed in a second amplification reaction at two or more temperatures. First, the fourth primer complementarily binds to its complementary segment in the 3' segment of the third primer extension product and initial extension occurs by a polymerase, typically at lower temperatures, e.g., in the temperature range of 45 ℃ to 65 ℃. This produces a partially extended primer extension product that is sufficiently stable with the third primer extension product such that upon increasing to a second temperature range (e.g., about 70 ℃ to about 80 ℃), the partially extended fourth primer extension product can be extended by a polymerase. At that temperature, the control oligonucleotide may spontaneously dissociate from its binding to the third primer extension product, allowing the polymerase to continue to synthesize the fourth primer extension product until (and including) the 5' segment of the third primer extension product is replicated by the polymerase. Particularly, a polymerase having a high processing power (e.g., phusion polymerase) is used in the second amplification reaction.

For example, methods for processing the composition of a reaction mixture in "homogeneous form" are particularly suitable when the division of the first reaction batch is not practical or technically very complex, for example in the "microdroplet or nanodroplet reaction" (also referred to as digital PCR).

Other members may also be added to the amplification, for example a solid phase comprising oligonucleotides suitable for specific binding of the formed product and/or also present as immobilized primers, thereby allowing solid phase PCR to be performed with primer extension products immobilized on the solid phase. The solid phase comprising the specific oligonucleotide may be contacted before, during or after the first amplification.

The reaction batch may be divided into a large number of reaction volumes (partitions) before the first amplification reaction is initiated, such that amplification of the reaction batch is simultaneously divided into about 100 or 1000 or more partitions of equal volume. The partitioning may occur in the form of droplets (e.g., as an emulsion). Amplification may be performed in parallel in the plurality of droplets (e.g., in the manner of digital PCR).

The order of the amplification reactions (first sequence-specific amplification and then PCR) plays an important role. Sequence-specific amplification (first amplification) using control oligonucleotides is performed, in particular, prior to PCR amplification. This is to avoid PCR-based distortions in the target sequence and side reactions prior to the first amplification. Thus, PCR-based amplification is only performed as a second step.

Thus, in a specific embodiment, a DNA fragment generated by PCR or any other amplification method is not used as the starting nucleic acid strand for the first amplification reaction.

In the following, a first amplification method (first partial amplification) and the required components of the first amplification system are schematically described, followed by a second amplification method (second partial amplification) and the components of the second amplification system, followed by a combination of the first and second amplification methods, and advantageous embodiments are given. A second amplification procedure (also called PCR) is performed after the first amplification.

In particular, the first amplification is performed in an exponential amplification mode, wherein the newly synthesized products of the two primers (primer extension products) serve as templates for further synthesis steps. Thus, the primer sequences are at least partially replicated, thereby forming complementary primer binding sites, which are present as double-stranded sequence segments immediately after synthesis. In the first amplification method, the steps of synthesizing both strands and opening the double strand of the newly synthesized sequence segment are alternated. Sufficient separation of the double strands after synthesis is an important prerequisite for further synthesis. In general, this alternation of synthesis steps and double strand separation steps can result in exponential amplification.

In the first amplification method described in the present invention, the opening of the double strand of the main product of amplification (amplification of a nucleic acid strand comprising a target sequence) is carried out, in particular, by means of an oligonucleotide referred to as a control oligonucleotide. The control oligonucleotide comprises, inter alia, a sequence segment corresponding to the target sequence.

In detail, the strand separation according to the invention is achieved by using control oligonucleotides having respective predetermined sequences, which separate newly synthesized double strands consisting of two specific primer extension products, in particular by sequence-dependent nucleic acid-mediated strand separation. The resulting single-stranded segment of the primer extension product contains the target sequence and corresponding primer binding sites that can serve as binding sites for other oligonucleotide primers to effect exponential amplification of the nucleic acid strand to be amplified. Basically, the primer extension reaction and the strand displacement reaction are preferably performed simultaneously. Amplification occurs especially under reaction conditions that do not allow spontaneous separation of the two specific synthetic primer extension products.

The first amplification of a nucleic acid strand comprising a target sequence comprises repetition of a synthesis step and a double strand opening step (activation step of a primer binding site), which are mandatory prerequisites for amplifying a nucleic acid strand.

The opening of the synthetic duplex is performed as a reaction step that will be affected by the sequence specificity of the control oligonucleotide. The opening may be completely completed until dissociation of the two complementary primer extension products occurs, or may be partially completed.

According to the invention, the control oligonucleotide comprises a sequence segment which can interact with the target sequence and further sequence segments which can cause, allow or promote said interaction, respectively. During interaction with the control oligonucleotide, the double-stranded portion of the synthesized primer extension product is converted to single-stranded form by sequence-specific strand displacement. The process is sequence dependent: only when the sequence of the synthesized duplex has a certain amount of complementarity with the corresponding sequence of the control oligonucleotide will enough of the duplex be opened so that the sequence segment essential for continued synthesis (e.g., the primer binding site) is converted into a single-stranded form corresponding to the "active state". Thus, the control oligonucleotide specifically "activates" a newly synthesized primer extension product comprising the target sequence for further synthetic steps.

In contrast, a sequence segment that does not contain the target sequence is not converted to a single-stranded state, but remains double-stranded corresponding to an "inactive" state. Potential primer binding sites in such duplexes are at an unfavorable level or completely incapable of interacting with the new primer, and therefore further synthesis steps are not typically performed on such "non-activated" strands. The absence or reduced activation (i.e., transition to a single-stranded state) of the synthetic nucleic acid strand after the synthesis step results in the following fact: in subsequent synthesis steps, only a smaller amount of primer can successfully participate in the primer extension reaction.

Due to the exponential first amplification of the main product (the nucleic acid strand to be amplified containing the target sequence), several synthesis steps and activation steps (double strand opening steps) are combined in one amplification method and performed separately or repeated until the desired number of specific nucleic acid strands is obtained.

During the use of the first amplification method, the reaction conditions (e.g., temperature) are designed such that spontaneous separation of complementary primer extension products is less likely or significantly slowed in the absence of the control oligonucleotide.

Thus, the improvement in amplification specificity is due to the sequence dependence of the isolation of complementary primer extension products comprising the target sequence: the control oligonucleotide enables or facilitates the double strand separation due to its sequence segment matching a given sequence segment of the primer extension product. The match was verified by control oligonucleotides after each synthesis cycle. Thus, exponential amplification is achieved due to successful repetition of the synthesis process and sequence-specific strand displacement by the control oligonucleotide, i.e., "activation" of the newly synthesized primer extension product (double-strand opening/double-strand separation/strand displacement process resulting in a single-stranded form of the corresponding primer binding site).

Thus, the use of predetermined control oligonucleotides enables sequence-dependent verification of the amount of primer extension product between synthesis steps during exponential amplification and allows for sequence selection for subsequent synthesis steps. Here, a distinction can be made between the "active" single-stranded state of a newly synthesized specific primer extension product due to successful interaction with a control oligonucleotide and the "inactive" double-stranded state of a newly synthesized non-specific primer extension product due to lack and/or deficiency and/or reduced and/or slowed interaction with a control oligonucleotide.

Exponential amplification produces the following effects:

under non-denaturing conditions, the separation of the specifically synthesized strands is performed in the presence of control oligonucleotides.

Exponential amplification of nucleic acid strands comprising a target sequence is sequence controlled (main reaction). The sequence control is performed after each synthesis step and includes a sequence segment located between the primers and comprising the target sequence. Successful validation of the synthesis results after each synthesis step leads to the separation of the two specific primer extension products, which is a prerequisite for further specific synthesis steps.

During the first amplification, non-specific primer extension products (by-products) initially produced cannot be substantially excluded. Due to the template dependency, such non-specific primer extension products are usually present in a double-stranded form immediately after synthesis. However, the interaction with the control oligonucleotide either failed completely or was limited, so that chain separation did not occur or slowed in the main reaction. Therefore, the sequence information without errors is transferred from one synthesis cycle to the next.

Thus, by selecting reaction conditions and designing control oligonucleotides, it is possible to specifically influence the efficiency of regeneration of the correct nucleic acid strand template between individual synthesis steps during the amplification process. Generally, the more successful the isolation of the synthetic product and the regeneration of the correct template from one synthetic step to the next, the greater the degree of identity between the synthetic sequence and a given sequence of a control oligonucleotide. On the other hand, sequence differences in the by-products lead to insufficient regeneration of the template strand, resulting in a slow down of the synthesis initiation and a decrease in yield in each subsequent cycle. The overall exponential amplification of the by-products either proceeds more slowly, or does not occur at all and/or remains at undetectable levels.

This method thus enables the sequence of the synthesis to be verified in real time (i.e. without termination of the reaction) and therefore represents the potential for the development of homogeneous assays in which all analytical components are already present in the reaction mixture a at the start of the reaction.

As a result of the first partial amplification, a sufficient number of highly specific amplified fragments are provided, which can be used as templates for the second partial amplification (PCR).

After a sufficient reaction time or number of cycles, the first amplification method is terminated or the reaction conditions are changed so that the second amplification method (PCR) can be initiated. In the second amplification method, the nucleic acid strand produced in the first amplification method and at least one other PCR-specific component (e.g., an oligonucleotide primer and/or a PCR polymerase) are used to amplify the target sequence. Since the number of specific nucleic acid strands is sufficiently high at the beginning of the second amplification, the PCR process requires fewer cycles until the desired total amount of product is obtained. The PCR product thus produced has less error as a whole.

By sequentially switching the first amplification method of high specificity at the start of amplification and then performing PCR, the overall specificity of the resulting PCR product can be improved as compared to conventional PCR methods, which are performed under PCR conditions from the beginning.

In particular, the components of both amplification methods are already available at the beginning of the amplification procedure.

In certain embodiments, the components of the first amplification system are different from the components of the second amplification system (PCR).

In certain embodiments, the components of the first amplification system are different from the components of the second amplification system, and the PCR components (of the second amplification system) are at least partially in an inactive form (e.g., as a hot start polymerase) under the reaction conditions of the first amplification method. Thus, switching from a first amplification to a second amplification requires an additional PCR component (e.g., polymerase) activation step.

In certain embodiments, the polymerase of the first amplification system is inactivated after completion of the first amplification, such that a different polymerase is used in the second amplification (PCR).

In certain embodiments, the second amplification system also uses, in part, components of the first amplification system, wherein at least one additional PCR-specific component (e.g., an additional oligonucleotide primer or polymerase) is used that is not part of the first system.

The present invention describes some embodiments of both methods and oligonucleotide primer arrangements that are advantageous for performing both amplification methods. By appropriately arranging the members of the first and second amplification systems on nucleic acid strands comprising the target sequence, homogeneous assays with higher overall specificity can be performed.

Terms and definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Molecular Biology or biochemical methods employ standard techniques (see e.g. Sambrook et al, Molecular Cloning: A Laboratory Manual, 2d Ed (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Autosubel et al, Short Protocols in Molecular Biology (1999)4th Ed, John Wiley & Sons, Inc.).

If the sequences shown in the description and the sequence listing are different from each other, the sequences shown in the description can be used in case of doubt.

The terms used in the context of the present invention have the following meanings:

as used herein with respect to primers, control oligonucleotides, probes, nucleic acid strands to be amplified, the term "oligonucleotide" is defined as a molecule comprising two or more (preferably three or more) deoxyribonucleotides and/or ribonucleotides and/or nucleotide modifications and/or non-nucleotide modifications. The length thereof is, for example, a region comprising 3 to 300 nucleotide units or an analog thereof (particularly 5 to 200 nucleotide units or an analog thereof). Its exact size depends on many factors, which in turn depend on the ultimate function or use of the oligonucleotide.

As used herein, the term "primer" relates to an oligonucleotide, whether naturally occurring (e.g., in a purified restriction cleavage) or artificially synthesized. If a primer is used under conditions that induce synthesis of a primer extension product complementary to a nucleic acid strand, i.e., in the presence of nucleotides and an inducing agent (e.g., a DNA polymerase), the primer can serve as a point of initiation of synthesis at a suitable temperature and a suitable pH. Preferably, the primer is single stranded for maximum efficacy in amplification. The primer must be long enough to prime the synthesis of extension products in the presence of the inducing agent. The exact length of the primer depends on many factors, including the reaction temperature and the source of the primer and the application of the method. For example, depending on the complexity of the target sequence, oligonucleotide primers in diagnostic applications are 5 to 100 nucleotides, preferably 6 to 40 nucleotides, particularly preferably 7 to 30 nucleotides in length. Short primer molecules typically require lower reaction temperatures to perform their primer function in order to form a sufficiently stable complex with the template, or require higher concentrations of other reaction components (e.g., DNA polymerase) in order to sufficiently extend the formed primer-template complex.

The primers used herein are selected to be "substantially" complementary to the various strands of each specific sequence to be amplified. This means that the primers must have sufficient complementarity to hybridize to their respective strands and initiate a primer extension reaction. Thus, for example, the primer sequence need not reflect the exact sequence of the target sequence. For example, a non-complementary nucleotide fragment can be ligated to the 5' end of a primer, with the remaining primer sequence being complementary to the strand. In another embodiment, a single non-complementary base or longer non-complementary sequence may be inserted into the primer, provided that the primer sequence has sufficient complementarity with the strand sequence to be amplified so as to hybridize therewith, thereby generating a primer-template complex that can be used to synthesize an extension product.

During enzymatic synthesis of the strand complementary to the template, a primer extension product is generated that is fully complementary to the template strand.

Tm-melting temperature

The melting temperature of a complementary or partially complementary double strand is generally understood as a measure of the reaction temperature at which about half of the strands are present in double-stranded form and the other half in single-stranded form. The system (association and dissociation of the chains) is in equilibrium.

Since many factors affect the Tm of a double strand (e.g., sequence length, CG level of the sequence, buffer conditions, concentration of divalent metal cations, etc.), the Tm of the nucleic acid to be amplified is determined under the same conditions as the intended amplification reaction.

Since the measurable melting temperature depends on a number of reaction parameters, such as the respective buffer conditions and the respective concentrations of the reactants, the melting temperature refers to the temperature value measured in the same reaction buffer as the exponential amplification, wherein the concentration of the two complementary components of the double strand is from about 0.1. mu. mol/l to about 10. mu. mol/l, preferably from about 0.3. mu. mol/l to about 3. mu. mol/l, preferably about 1. mu. mol/l. Each melting temperature value is a guide value related to the stability of the corresponding duplex.

Deoxyribonucleoside triphosphates

Deoxyribonucleoside triphosphates dATP, dCTP, dGTP and TTP (or dUTP, or dUTP/TTP mixture) are added in the appropriate amounts to the synthesis mixture. In certain embodiments, at least one other type of dNTP analog can be added to the synthesis mixture in addition to the dntps. In certain embodiments, the dNTP analogs comprise, for example, a signature marker (e.g., biotin or a fluorescent dye) that can be built into the nucleic acid strand. In another embodiment, the dNTP analogs comprise at least one modification of the sugar phosphate ratio of the nucleotide, such as α -phosphorothioate-2 ' -deoxyribonucleoside triphosphate (or other modification that confers nuclease resistance to a nucleic acid strand), 2 ', 3 ' -dideoxyribonucleoside triphosphate, acyclic nucleoside triphosphate (or other modification that results in termination of synthesis). In certain embodiments, the dNTP analogs comprise at least one modification of a nucleobase, such as isocytosine, isoguanosine (or other modification of a nucleobase that extends genetic letters), 2-aminoadenosine, 2-thiouridine, inosine, 7-deazaadenosine, 7-deazaguanosine, 5-methylcytosine, 5-propyluridine, 5-propylcytosine (or other modification of a nucleobase that can be constructed by a polymerase compared to a native nucleobase and can alter the stability of the strand). In certain embodiments, the dNTP analogs comprise both a modification of the nucleobase and a modification of the sugar phosphate ratio. In certain embodiments, at least one other type of dNTP analog is added to the synthesis mixture instead of at least one natural dNTP substrate.

The nucleic acid synthesis inducing agent may be an enzyme or system whose action is to cause synthesis of a primer extension product.

Suitable enzymes for the first amplification for this purpose include, but are not limited to, for example, DNA polymerases such as Bst polymerase and modifications thereof, Vent polymerase, and the like, especially thermostable DNA polymerases capable of incorporating nucleotides in the correct manner, wherein primer extension products complementary to each synthesized nucleic acid strand are formed. Typically, synthesis begins at the 3 'end of each primer and proceeds in the 5' direction along the template strand until synthesis is complete or interrupted.

In the first amplification, in particular, a template-dependent DNA polymerase capable of strand displacement is used. These include the large fragment Bst polymerase or modifications thereof (e.g., Bst 2.0 DNA polymerase), Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, the large fragment Bsu DNA polymerase, and the large fragment Bsm DNA polymerase.

In certain embodiments, polymerases that do not exhibit 5 '-3' exonuclease activity or 5 '-3' FEN activity are particularly used.

For the second amplification, in particular a thermostable template-dependent DNA polymerase is used, for example Taq polymerase or a modification thereof (e.g.Ampli-Taq), or a polymerase with proofreading function (Pfu and a modification thereof or Vent polymerase and a modification thereof). Polymerases such as Phusion polymerase that have been fused to another protein to increase its processing power may be used. There are a large number of polymerases on the market.

Combinations of polymerases can also be used, e.g., OneTaq polymerase (NEB) is a combination of Taq polymerase and vent polymerase. This combination of polymerases helps to improve the synthesis accuracy in the second amplification.

In certain embodiments, at least two different polymerases are used, such as a polymerase capable of strand displacement and a polymerase having 3 '-5' proofreading activity.

In a specific embodiment, a polymerase with hot start functionality is used, which polymerase can only exert its function when a certain temperature is reached.

The first amplification system comprises the components necessary to perform a specific first amplification: a first oligonucleotide primer, a second oligonucleotide primer, a control oligonucleotide, and a first polymerase.

In addition, nucleotide mixtures and buffer systems may also be included, as long as they are necessary for carrying out the specific first amplification (e.g.a specific buffer system for the first polymerase).

The first amplification system supports the synthesis of the first amplification fragment 1.1 (or first amplification product 1.1, also referred to as the first amplified nucleic acid strand to be amplified) during a first amplification (also referred to as a first partial amplification).

The second amplification system comprises the components necessary to perform a specific second amplification: a third oligonucleotide primer, a fourth oligonucleotide primer, and a second polymerase.

In addition, nucleotide mixtures and buffer systems may also be included, provided they are necessary for carrying out a specific second amplification (e.g.a specific buffer system for a second polymerase).

The second amplification system supports the synthesis of the second amplified fragment 2.1 (or second amplified product 2.1) during a second amplification (also referred to as a second sub-amplification).

First oligonucleotide primer (component of the first amplification system):

the first oligonucleotide primer (FIGS. 12-16) comprises a first primer region and a second region. The first primer region can bind to a substantially complementary sequence within the nucleic acid to be amplified or an equivalent thereof and prime a primer extension reaction.

The second region comprises a polynucleotide tail that is capable of binding to the control oligonucleotide such that the control oligonucleotide is sufficiently close to the remainder of the first primer extension product to prime a strand displacement by the control oligonucleotide. The second region of the first oligonucleotide primer further comprises at least one modification (nucleotide modification or non-nucleotide modification) that prevents a polymerase from replicating a polynucleotide tail by inhibiting the progression of polymerase-dependent synthesis. The modification is for example located at the transition between the first and second region of the first oligonucleotide primer. Thus, the first primer region of the oligonucleotide primer can be replicated by the polymerase, so that the polymerase can generate the complementary sequence of the region during synthesis of the second primer extension product (see below for details). The polynucleotide tail of the second region of the first oligonucleotide primer is not copied, particularly by a polymerase. In certain embodiments, this is achieved by a modification in the second segment that terminates the polymerase prior to the polynucleotide tail. In certain embodiments, this is achieved by nucleotide modifications in the second region, wherein the entire polynucleotide tail consists essentially of such nucleotide modifications and is therefore not replicable to the polymerase.

In certain embodiments, each first oligonucleotide primer is specific for one nucleic acid to be amplified.

In certain embodiments, each first oligonucleotide primer is specific for at least two nucleic acids to be amplified, wherein each nucleic acid to be amplified comprises a substantially different sequence.

In certain embodiments, the first oligonucleotide primer is labeled with a signature label, such as a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity label (e.g., biotin, digoxigenin) or an additional sequence fragment, such as for binding to a specific oligonucleotide probe for detection or immobilization or barcode labeling.

The first oligonucleotide primer is particularly useful as a primer in the first amplification.

In certain embodiments, it may be used as a primer in both the first and second amplifications.

Second oligonucleotide primer (component of the first amplification system):

an oligonucleotide having a 3' segment capable of binding to a substantially complementary sequence in a nucleic acid to be amplified or an equivalent thereof and priming a specific second primer extension reaction. Thus, the second oligonucleotide primer is capable of binding to the 3' segment of the first specific primer extension product of the first oligonucleotide primer and priming polymerase dependent synthesis of the second primer extension product.

The length of the second oligonucleotide primer may be 15 to 100 nucleotides, in particular 20 to 60 nucleotides, in particular 30 to 50 nucleotides.

In certain embodiments, each second oligonucleotide primer is specific for a respective one of the nucleic acids to be amplified.

In certain embodiments, each second oligonucleotide primer is specific for at least two nucleic acids to be amplified, wherein each nucleic acid to be amplified comprises a different sequence.

In certain embodiments, the second oligonucleotide primer is labeled with a signature label, such as a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity label (e.g., biotin, digoxigenin) or an additional sequence fragment, such as for binding to a specific oligonucleotide probe for detection or immobilization or barcode labeling.

The second oligonucleotide primer is particularly useful as a primer in the first amplification. In certain embodiments, it may be used as a primer in both the first and second amplifications.

Primer extension product

Primer extension products are formed by enzymatic (polymerase-dependent) extension of oligonucleotide primers as a result of polymerase-catalyzed, template-dependent synthesis.

Primer extension products include the sequence of the oligonucleotide primer in its 5' segment and the sequence of the extension product that has been synthesized by the polymerase in a template-dependent fashion. The extension product synthesized by the polymerase is complementary to the template strand from which it was synthesized.

The first amplified specific primer extension products (e.g., P1.1-Ext and P2.1-Ext) (the main products) comprise the sequence of the nucleic acid strand to be amplified. This is the result of the specific synthesis or correct performance of the intended primer extension reaction in which the nucleic acid strand to be specifically amplified serves as a template. In one embodiment, the sequence of the synthesized primer extension product matches exactly the expected sequence of the nucleic acid to be amplified. In another embodiment, deviations between the resulting sequence and the theoretically expected sequence can be tolerated. In certain embodiments, the degree of identity between the sequence obtained from amplification and the theoretically expected sequence of the nucleic acid to be amplified is, for example, 90% to 100%, particularly above 95%, ideally above 98% (measured as the proportion of synthetic bases).

The extension product of a specific primer extension product may be 10-300 nucleotides, especially 10-180 nucleotides, especially 20-120 nucleotides, especially 30-80 nucleotides in length.

For example, in the second amplification, the products of the specific template-dependent primer extension reaction of the third primer and the fourth primer represent the main product and each intermediate product: a partial third primer extension product (P3.1-Ext part 1, FIGS. 15-18), or a complete primer extension product (P3.1-Ext, FIGS. 15-18), a partial fourth primer extension product (P4.1-Ext part 1, FIGS. 15-18), or a complete primer extension product (P4.1-Ext, FIGS. 15-18). In certain embodiments, the product comprises a target sequence or an equivalent thereof. In another embodiment, the second primer extension product comprises the target sequence and the first primer extension product comprises the equivalent of said target sequence, i.e. the complementary strand. In certain embodiments, the fourth primer extension product comprises the target sequence and the third primer extension product comprises the equivalent of the target sequence, i.e., the complementary strand. In certain embodiments, the fourth primer extension product comprises a portion of the target sequence and the third primer extension product comprises the equivalent of said portion of the target sequence, i.e., the complementary strand.

The first primer extension product (P1.1-Ext) and the second primer extension product (P2.1-Ext) together represent the first amplified fragment 1.1 (also referred to as amplification product 1.1) (FIG. 1).

The third primer extension product (P3.1-Ext) and the fourth primer extension product (P4.1-Ext) together represent a second amplified fragment 2.1 (also referred to as amplification product 21) (FIG. 1).

The third primer extension product (P3.1-Ext) may also be referred to as the complete third primer extension product. The product is obtained by using a fourth primer extension product (P4.1-Ext) as a template. The fourth primer extension product (P4.1-Ext) may also be referred to as the complete fourth primer extension product. The product was obtained using the third primer extension product (P3.1-Ext) as a template (FIGS. 15-18).

In contrast, a portion of the third primer extension product (P3.1-Ext-Part 1) is an intermediate product generated using the second primer extension product (P2.1-Ext) as a template. A Part of the fourth primer extension product (P4.1-Ext-Part 1) is an intermediate product generated using the first primer extension product (P1.1-Ext) as a template (FIGS. 15-18).

For example, non-specific primer extension products (by-products) comprise sequences generated by non-specific or incorrect or undesired primer extension reactions. For example, these products include primer extension products resulting from a false priming event (mis-priming) or other side reactions including polymerase dependent sequence changes such as base substitutions, deletions, and the like. The degree of sequence deviation of the non-specific primer extension product typically exceeds the ability of the control oligonucleotide to successfully displace such double-stranded byproducts from its template, making amplification of such byproducts slower or completely absent. The degree of acceptance or tolerance for deviations depends, for example, on the reaction temperature and on the type and manner of sequence deviation. Examples of non-specific primer extension products are primer dimers or sequence variants that do not correspond to the nucleic acid to be amplified, e.g., sequences that do not comprise the target sequence.

Assessment of the adequacy of amplification specificity is often associated with the task at hand. In many amplification methods, a degree of non-specificity of the amplification reaction is tolerated as long as the desired results are obtained. In a specific embodiment, the proportion of the nucleic acid strand to be amplified in the total result of the reaction is more than 1%, in particular more than 10%, in particular more than 30%, based on the total amount of newly synthesized strands.

Nucleic acid to be amplified (expected result of first amplification)

The nucleic acid to be amplified represents the nucleic acid strand to be sequence-specifically or at least predominantly sequence-specifically amplified by the polymerase in the first amplification by the primers and the control oligonucleotide. The nucleic acid to be amplified comprises both strands of the first amplified fragment 1.1 (also referred to as first amplification product 1.1) (FIG. 1). It can be used as starting nucleic acid strand 2.1, at least one of which can be used to initiate a second amplification.

The length of the nucleic acid to be amplified can be from 20 to 300 nucleotides, in particular from 30 to 200 nucleotides, in particular from 40 to 150 nucleotides, in particular from 50 to 100 nucleotides.

The nucleic acid strand to be amplified may comprise one or more target sequences or equivalents thereof. In addition, the nucleic acid to be amplified may comprise a sequence that is substantially complementary to the target sequence, which is amplified with similar efficiency as the target sequence in the amplification reaction and comprises the target sequence or a segment thereof. In addition to the target sequence, the nucleic acid to be amplified may comprise further sequence segments, for example primer sequences, sequences with primer binding sites, and/or sequence segments for binding to detection probes, and/or sequence segments for sequence encoding of the strands by barcode sequences, and/or sequence segments for binding to a solid phase. The oligonucleotide primer sequence or sequence part thereof and the primer binding site or sequence part thereof may for example belong to a sequence segment of the target sequence.

In certain embodiments, the nucleic acid to be amplified corresponds to a target sequence.

In another embodiment, the target sequence forms part of the sequence of the first amplified nucleic acid strand to be amplified. Such target sequences may be flanked on the 3 'side and/or 5' side by additional sequences. The additional sequences may comprise, for example, binding sites for oligonucleotide primers or portions thereof, primer sequences or portions thereof, binding sites for detection probes, adapter sequences for complementary binding to a solid phase (e.g., in a microarray or microbead-based assay), and/or barcode sequences for digital signature of sequences.

To start amplification, nucleic acid strands must be added to the reaction mixture at the beginning of the reaction, which serve as initial templates in the synthesis of the nucleic acid strands to be amplified. The nucleic acid strand is referred to as the starting nucleic acid strand. The starting nucleic acid strand defines the arrangement of the individual sequence members, which is important for the formation/synthesis/exponential amplification of the nucleic acid strand to be amplified.

In one embodiment, the initial template (starting nucleic acid strand) initially provided to the amplification reaction or added to the reaction mixture corresponds to the sequence composition of the nucleic acid strand to be amplified.

During the initial phase of the amplification reaction and its subsequent stages, each primer binds to a corresponding binding site in the starting nucleic acid strand and initiates synthesis of a specific primer extension product. Such specific primer extension products accumulate exponentially during amplification and increasingly serve as templates in the synthesis of complementary primer extension products during exponential amplification.

Thus, the nucleic acid strand to be amplified is formed by a repeated template-dependent synthesis process in exponential amplification.

Towards the end of the amplification reaction, the main product of the reaction (the nucleic acid to be amplified) may be predominantly single-stranded or may form predominantly a complementary double strand. This can be determined, for example, by the relative concentrations of the oligonucleotide primers and the corresponding reaction conditions.

Equivalents of nucleic acids to be amplified include nucleic acids having substantially the same information content. For example, complementary strands of a nucleic acid to be amplified have the same information content and thus may be referred to as equivalents.

Target sequence

In certain embodiments, the target sequence is a segment of a nucleic acid strand to be amplified that can serve as a signature sequence for the nucleic acid to be amplified. The target sequence may serve as a marker for the presence or absence of another nucleic acid. Thus, the additional nucleic acid serves as a source of the target sequence and may, for example, be genomic DNA or RNA or a portion of genomic DNA or RNA (e.g., mRNA), or an equivalent of genomic DNA or RNA of an organism (e.g., cDNA, modified RNA (e.g., rRNA, tRNA, microRNA), etc.), or comprise a definite change in genomic DNA or RNA of an organism, such as a mutation (e.g., a deletion, an insertion, a substitution, an addition, a proliferation of sequences (e.g., a proliferation of repeats in the case of microsatellite instability)), a splice variant, a rearrangement variant (e.g., a T cell receptor variant), etc. Each target sequence may represent a phenotypic trait (e.g., antibiotic resistance), or have prognostic information, and thus may be of interest for diagnostic analysis/testing. Such nucleic acids may comprise, for example, a target sequence that is a sequence member of its strand as a source/origin of the target sequence. Thus, the target sequence may serve as a signature for the specific sequence content of another nucleic acid.

The target sequence may be single-stranded or double-stranded. It may be substantially the same as the first amplified nucleic acid to be amplified, or may represent only a portion of the nucleic acid to be amplified.

Equivalents of target sequences include nucleic acids having substantially the same information content. For example, the complementary strands of the target sequence have the same information content and may be referred to as equivalents; RNA and DNA variants of the sequence are also examples of equivalent information content.

Such target sequences can be isolated from their original sequence context during the preparation of the material prior to the amplification reaction and are ready for use in the amplification reaction.

In one embodiment, the nucleic acid to be amplified comprises a target sequence. In certain embodiments, the target sequence corresponds to a nucleic acid to be amplified. In another embodiment, the starting nucleic acid strand 1.1 comprises a target sequence. In certain embodiments, the target sequence corresponds to the starting nucleic acid strand 1.1.

During the first amplification, the target sequence may become in whole or in part of the first amplified fragment 1.1. For example, the second primer extension product comprises the target sequence or a portion thereof, and thus the second primer extension product comprises a strand complementary to the target sequence. The chains have identical information content.

During the second amplification, the target sequence may become in whole or in part of the second amplified fragment 2.1. For example, the fourth primer extension product comprises the target sequence or a portion thereof, and thus the third primer extension product comprises a strand complementary to the target sequence. The chains have identical information content.

Initial nucleic acid chain

To begin the first amplification, the nucleic acid strand must be added to the reaction mixture at the beginning of the reaction, which serves as an initial template in the synthesis of the nucleic acid strand to be amplified (FIG. 1). Said nucleic acid strand is referred to as the first amplified starting nucleic acid strand (starting nucleic acid strand 1.1). The starting nucleic acid strand defines the arrangement of the individual sequence members, which is very important for the formation/synthesis/exponential amplification of the nucleic acid strand to be amplified.

This starting nucleic acid strand may be single-stranded or double-stranded at the beginning of the reaction. If the complementary strands of the starting nucleic acid strand are separated from each other, these strands can serve as templates for the synthesis of specific complementary primer extension products, regardless of whether the nucleic acid is initially double-stranded or single-stranded.

In certain embodiments, the starting nucleic acid strand 1.1 comprises a target sequence.

The starting nucleic acid strand further comprises at least one predominantly single-stranded sequence segment, and at least one primer of the amplification system is capable of binding with its 3' segment predominantly complementary to said sequence segment. Thus, when hybridized to a starting nucleic acid strand, the polymerase used can extend this primer template-specifically by introducing dNTPs.

The starting nucleic acid strand may also contain a segment that is not the target sequence but can bind to an oligonucleotide primer.

To begin the second amplification, the nucleic acid strand must be present in the reaction mixture or added to the second amplification reaction at the beginning of the second amplification reaction as an initial template for the synthesis of the second amplified fragment (FIG. 1).

The starting nucleic acid strand 2.1 defines the arrangement of the individual sequence members, which is very important for the formation/synthesis/exponential amplification of the nucleic acid strand to be amplified.

Here, the first amplified fragment 1.1 (also referred to as the nucleic acid strand to be amplified) generated during the first amplification serves as the starting nucleic acid strand 2.1 for the second amplification. Thus, the starting nucleic acid strand 2.1 contains or consists of the first primer extension product generated in the first amplification. In certain embodiments, the starting nucleic acid strand 2.1 comprises a target sequence.

PCR amplification (also called second amplification)

PCR is a polymerase chain reaction, and is commonly used to amplify DNA fragments. Many variants of PCR reactions are known in the art. Among these, allele-specific PCR, genotyping PCR, asymmetric PCR, solid-phase PCR, digital PCR (partition/microdroplet PCR), multiplex PCR, real-time PCR using probes or intercalating dyes (e.g., molecular beacons or 5 '-3' exonucleases or two oligonucleotide probes with FRET pairs), PCR clamping using blocking probes, quantitative PCR, nested PCR, etc. The skilled worker is referred to a large review describing the respective PCR method.

Typically, nucleic acid fragments determined by the position of the oligonucleotide primers are amplified during PCR. At least two temperature ranges are generally used: a low temperature range in which the primer binds to its primary specific sequence segment and extends to form a complementary strand; and at least one temperature range in which strands are separated primarily by sequence non-selective separation, thereby separating newly synthesized primer extension products from their templates.

Many techniques have been developed to influence the progress of PCR, such as hot-start polymerases, hot-start oligonucleotides, activatable primers (e.g., by the 3 '-5' proofreading activity of the polymerase).

PCR can be performed in liquid phase, also in solid phase or in microfluidic systems or in situ by using PCR tubes/microtiter plates.

PCR primer set (third and fourth oligonucleotide primers)

(Components of the second amplification)

Typically, a PCR primer pair comprises two oligonucleotides, which are capable of supporting amplification of a nucleic acid fragment by a PCR method.

Typically, the PCR primer pair includes a third and a fourth oligonucleotide primer. Such oligonucleotide primers are well known in the scientific community.

For clarity, the PCR primers are generally referred to herein as P3 and P4 (as opposed to control-dependent amplifications P1 and P2).

Many variants of PCR primers are known to the skilled person. Typically, they are oligonucleotides of about 15 to about 60 nucleotides in length, which comprise, at least in their 3' segment, a sequence capable of binding to a complementary segment of a target sequence and initiating template-dependent synthesis by a polymerase using said target sequence as a template.

Many other functions, such as dye labeling (e.g., using FAM, TAMRA, Cy5) or quenching (e.g., BHQ1), affinity labeling (e.g., biotin, digoxigenin), or many other functions of additional sequences (e.g., sequences for sequence barcodes (using specific labeling sequences) or for library construction) are known to the skilled artisan. PCR primers can be used in solution or coupled to a solid phase (e.g., microbeads, microtiter plate). Such variants are also well known to the skilled person.

Control oligonucleotides:

the control oligonucleotide (FIG. 1, C1.1) is a single-stranded nucleic acid strand comprising a predetermined substantially complementary sequence of a segment of the first primer extension product that is specifically generated during amplification of the nucleic acid to be amplified (first amplification). This allows the control oligonucleotide to bind substantially complementarily to the first oligonucleotide primer and to bind at least to the 5' segment of the specific extension product of the first oligonucleotide primer. In certain embodiments, the control oligonucleotide comprises nucleotide modifications in its internal sequence segment; when the first and/or third oligonucleotide primers are complementarily bound to the control oligonucleotide, the nucleotide modification prevents the polymerase from using the control oligonucleotide as a template to synthesize a complementary strand. In certain embodiments, it is advantageous if the control oligonucleotide consists entirely of modified nucleotides that block its template function. In certain embodiments, it is advantageous if the control oligonucleotide consists only partially of modified nucleotides that block the function of its template. The control oligonucleotide is also capable of displacing, either completely or partially, the second specific primer extension product from binding to the first specific primer extension product by strand displacement under the selected reaction conditions. Thus, the control oligonucleotide, along with its complementary region, ligates itself to the first specific primer extension product. If the binding between the control oligonucleotide and the first specific primer extension product is successful, this will result in the restoration of the single stranded state of the 3' segment of the second specific primer extension product, which state is suitable for binding to the first oligonucleotide primer, so that a new primer extension reaction can take place. During synthesis of the second primer extension product, the control oligonucleotide may be separated from binding to the first primer extension product by strand displacement (e.g., by a polymerase and/or by a second oligonucleotide primer).

The detection system comprises:

the detection system includes at least one oligonucleotide probe and at least one fluorescent reporter (fluorophore). The detection system should be able to detect the synthesis of the first and/or second and/or third and/or fourth primer extension products (P1.1-Ext, P2.1-Ext, P3.1-Ext, P4.1-Ext). This is accomplished by using oligonucleotide probes that are capable of binding to each primer extension product to generate a specific signal or cause a change in signal. The change may be an increase or decrease in fluorescence intensity. The detection system may also include additional components. Such components include, inter alia, fluorescence quenchers and/or donor fluorophores. In addition, the detection system may further comprise a control oligonucleotide. The arrangement of the fluorescent reporter, fluorescent quencher, donor fluorophore on the oligonucleotide probe or on the oligonucleotide probe-control oligonucleotide pair enables detection of the binding event to the first primer extension product.

Fluorescent reporter

A fluorophore is a compound or molecule that is capable of emitting electromagnetic radiation (light) (emission) when excited by electromagnetic radiation. The radiation (emission) emitted by the fluorophore can be detected as a fluorescent signal by suitable technical means. Such a reporter may be covalently bound to the oligonucleotide. Many fluorophores that can be coupled to oligonucleotides are known (e.g., FAM, TAMRA, HEX, ROX, Cy dyes, Alexa dyes).

Fluorescence quenching agent

A quencher is a compound/molecule that is capable of reducing emission of a fluorophore either by direct contact (contact quenching) or by energy transfer (e.g., as FRET). Typically, a quencher must be placed in close proximity to the fluorophore in order to significantly reduce the signal.

It is advantageous for the signal of the fluorescent reporter to be significantly reduced by the quencher that the distance between the reporter and the quencher is less than 25 nucleotides, in particular less than 15 nucleotides, in particular less than 5 nucleotides.

To overcome the decrease in signal of the fluorescent reporter caused by the quencher, the distance between the components must be increased accordingly. It is advantageous here for the distance between the reporter and the quencher to be increased to more than 15 nucleotides, in particular to more than 20 nucleotides, in particular to more than 40 nucleotides. In this case, the distance caused by the nucleotide sequence must be due to extension of the nucleotide sequence. For example, if a hairpin structure is formed, there may no longer be a spatial distance.

Especially for FRET-based quenchers, it is advantageous to have sufficient spectral overlap between the emission spectrum of the fluorophore and the absorption spectrum of the quencher. Thus, fluorophore-quencher pairs whose spectra overlap by more than 25% (e.g., FAM/TAMRA) are preferred.

Donor fluorophores

A donor fluorophore is a compound/molecule that is capable of absorbing electromagnetic radiation and transferring it to another fluorophore (acceptor) by energy transfer (e.g. as FRET) to an extent sufficient for the fluorophore to be excited and thus to produce light emission itself. A fluorescent signal is generated during the emission. Typically, the donor and acceptor form a fluorescence resonance energy transfer pair (FRET pair). Generally, the donor must be placed in close proximity to the acceptor (fluorophore) in order to generate the signal to a large extent.

It is advantageous for the signal generation of the fluorescent reporter due to FRET from the donor fluorophore that the distance between the reporter and the donor is less than 25 nucleotides, in particular less than 15 nucleotides, in particular less than 5 nucleotides.

The FRET effect from donor to acceptor is usually eliminated by increasing the distance between the two partners of the FRET pair. Advantageously, the distance between the reporter and the donor is increased to more than 15 nucleotides, in particular to more than 20 nucleotides, in particular to more than 40 nucleotides.

Furthermore, it is often advantageous to have sufficient spectral overlap between the emission spectrum of the donor and the absorption spectrum of the acceptor. Therefore, a FRET pair (e.g., FAM/Cy3) whose spectra overlap by more than 25% is preferred.

According to the invention, the spatial distance between the components is caused in particular by the two components being linked by a nucleotide sequence which can hybridize with a specific part of the target sequence.

Strand displacement:

a process in which, by using suitable tools, the first double strand (consisting for example of the a1 and B1 strands) is completely or partially separated and a new second double strand is formed simultaneously/in parallel, at least one of the strands (a1 or B1) participating in the formation of said new second strand. Two forms of strand displacement can be distinguished here.

In the first form of strand displacement, a new second double strand can be formed using an already existing complementary strand, which is usually in single-stranded form at the start of the reaction. In this case, a means of strand displacement (e.g., a preformed single stranded C1 having a sequence complementary to strand a 1) acts on the first double strand already formed (a1 and B1) and binds complementarily to strand a1, thereby releasing strand B1 from binding to strand a 1. If the substitution of B1 is complete, the result of the action of C1 is a new double strand (A1: C1) and a single strand B1. If the substitution of B1 is incomplete, the result depends on several factors. For example, a complex of partially double stranded A1: B1 and A1: C1 may be present as an intermediate product.

In the second form of strand displacement, a new second double strand may be formed with simultaneous enzymatic synthesis of the complementary strand, with one strand of the first preformed double strand serving as a template for polymerase synthesis. Thus, a strand displacing agent (e.g., a polymerase having strand displacement ability) acts on the first double strand (A1 and B1) that has been previously formed, and synthesizes a new complementary strand D1 of strand A1, in which strand B1 is simultaneously displaced from binding to strand A1.

The term "nucleic acid-mediated strand displacement" is used to describe the sum/series of intermediate steps that may equilibrate with each other and result in the temporary or permanent opening of a first preformed duplex (consisting of complementary strands B1 and a 1) and the formation of a new second duplex (consisting of complementary strands a1 and C1) in which a1 and C1 are complementary to each other.

The basic structural condition for strand displacement is known to be the establishment of spatial proximity between the ends of the duplex (preformed first duplex of a1 and B1) and the strand displacing single-stranded (C1) (where a1 and C1 may form complementary strands). This proximity can be achieved, inter alia, by single-stranded overhangs (examples with short overhangs are known in the literature, known as "toehold", see above), which bind complementary to single strands (C1) either temporarily or permanently, so that the complementary segments of C1 and a1 are brought into sufficient proximity to initiate successful displacement of strand B1. Generally, the closer the complementary segments of strands A1 and C1 are spaced, the more efficient the priming of nucleic acid-mediated strand displacement.

Another basic structure premise for efficient continuation of nucleic acid-mediated strand displacement in the internal segment is the high degree of complementarity between strands (e.g., between a1 and C1) that must form a new double strand. For example, a single nucleotide mutation (in C1) can result in disruption of strand displacement (e.g., as described in branch migration).

The present invention takes advantage of the ability of complementary nucleic acids to perform sequence-dependent nucleic acid-mediated strand displacement.

The embodiments of the invention are further explained in the figures and examples.

Detailed Description

Reaction conditions for the first amplification

The reaction conditions include buffer conditions, temperature conditions, duration of the reaction, and concentrations of the individual reaction components.

During the reaction, the number of specifically generated nucleic acids to be amplified accumulates exponentially. Reactions involving synthesis of extension products can be performed as necessary to generate the desired number of specific nucleic acid sequences. The process according to the invention is in particular carried out continuously. In a preferred embodiment, the amplification reaction is carried out at the same reaction temperature, wherein the temperature is in particular between 50 ℃ and 70 ℃. In another embodiment, the reaction temperature may also be varied under control such that the individual steps of amplification are each performed at a different temperature.

The reagents required for the exponential amplification are present, in particular, already at the beginning of the same batch of reactions. In another embodiment, the reagents may also be added at a later stage of the process.

In particular, no helicase or recombinase is used in the reaction mixture to separate the newly synthesized double strand of the nucleic acid to be amplified.

In one embodiment, the reaction mixture is free of biochemical enabling compounds, such as ATP.

The number of nucleic acids to be amplified present in a batch at the beginning of the reaction may be several copies to several billion copies. In the case of use in diagnosis, the number of nucleic acid strands to be amplified may be unknown.

In this reaction, there may also be other nucleic acids that are not amplified. The nucleic acid may be derived from natural DNA or RNA or equivalents thereof. In certain embodiments, the control sequence that must be amplified in parallel with the nucleic acid to be amplified is present in the same batch.

In particular, the molar excess is about 10³1 to about 10¹⁵1 (primer: template ratio) is added to a reaction mixture comprising the template strand for synthesizing the nucleic acid strand to be amplified.

If the method of the invention is used in diagnostics, the amount of target nucleic acid may be unknown and the relative amounts of primer and control oligonucleotide with respect to the complementary strand cannot be determined. If the sequence to be amplified is contained in a mixture of complex long-chain nucleic acid strands, the amount of primer added is usually present in molar excess relative to the amount of complementary strand (template). To increase the efficacy of the process, a large molar excess is preferred.

The concentration of primer 1, primer 2 and control oligonucleotide used is, for example, 0.01 to 100. mu. mol/l, in particular 0.1 to 50. mu. mol/l, in particular 0.1 to 20. mu. mol/l. High concentrations of components can increase the amplification rate. The respective concentrations of the components can be varied independently to achieve the desired reaction results.

The concentration of the polymerase is 0.001-50. mu. mol/l, preferably 0.01-20. mu. mol/l, in particular 0.1-10. mu. mol/l.

The concentration of each dNTP substrate is 10. mu. mol/l to 10mmol/l, particularly 50. mu. mol/l to 2mmol/l, more preferably 100. mu. mol/l to 1 mmol/l. The concentration of dntps can affect the concentration of divalent metal cations. Optionally this is adjusted accordingly.

For divalent metal cations, e.g. Mg²⁺. For the corresponding anion Cl^-For example, acetate, sulfate, glutamate, and the like can be used.

The concentration range of the divalent metal cation is adapted, for example, to the optimum range of the corresponding polymerase and is from 0.1 to 50mmol/l, preferably from 0.5 to 20mmol/l, preferably from 1 to 15 mmol/l.

Typically, the enzymatic synthesis is performed in an aqueous buffer solution. As the buffer solution, conventional buffer substances such as Tris HCl, Tris acetate, potassium glutamate, HEPES buffer, sodium glutamate, dissolved at conventional concentrations, can be used. The pH of the solution is generally from 7 to 9.5, preferably from about 8 to 8.5. The buffer conditions can be adjusted, for example, according to the recommendations of the manufacturer of the polymerase used.

Other substances such as so-called Tm inhibitors (e.g. DMSO, betaine, TPAC) may be added to the buffer. This substance lowers the melting temperature of the duplex ("Tm inhibitor") and can therefore have a positive effect on the opening of the duplex. Polymerase stabilizing components (e.g., Tween 20 or Triton 100) may also be added to the buffer in conventional amounts. EDTA or EGTA may be added to the complexed heavy metals in conventional amounts. A polymerase stabilizing substance (e.g., trehalose or PEG 6000) may also be added to the reaction mixture.

In particular, the reaction mixture does not comprise any inhibitor of a strand displacement reaction, nor of a polymerase-dependent primer extension.

In certain embodiments, the reaction mixture contains a DNA binding dye, particularly an intercalating dye, such as EvaGreen or SybrGreen. Such dyes may enable the detection of the formation of new nucleic acid strands.

The reaction mixture may also contain, for example, proteins or other substances that originate from the starting material and do not affect amplification.

Detailed description of the reaction conditions

Temperature has a significant effect on the stability of the duplex.

In one embodiment, no temperature conditions are used during the amplification reaction, which essentially results in the separation of the nucleic acid duplex to be amplified in the absence of the control oligonucleotide. This is to ensure that the separation of the strands of nucleic acid to be amplified is dependent on the presence of the control oligonucleotide during the entire amplification procedure.

The two strands of the nucleic acid to be amplified spontaneously separate at a temperature about equal to the measured melting temperature (Tm) of the nucleic acid to be amplified, thereby minimizing or limiting the effect of the control oligonucleotide on the separation of the synthetic strands and thus on the sequence specificity of the amplification.

In the case of exponential amplification, which must be less sequence specific (i.e., less dependent on the control oligonucleotide), the reaction temperature may be about the melting temperature of the nucleic acid to be amplified (i.e., Tm ± (3-5) ° C). At such temperatures, sequence differences between the control oligonucleotide and the synthesized primer extension product in a strand displacement reaction are generally well tolerated.

Even in the temperature range of about (Tm-3 ℃) to about (Tm-10 ℃), spontaneous strand separation of the synthesized primer extension product occurs, although the efficiency is low. The control oligonucleotide has a higher effect on the sequence specificity of the nucleic acid to be amplified than under temperature conditions in the vicinity of the melting temperature (Tm) of the nucleic acid strand to be amplified.

Strand separation, although occurring as the reaction temperature is lowered, is primarily due to the interaction between the newly synthesized duplex and the control oligonucleotide. However, under the above conditions, the duplex generated by the primer at the extension temperature may also dissociate spontaneously, i.e., without sequence-dependent strand displacement by the control oligonucleotide. For example, the reaction temperature for reducing sequence specific amplification is from about (Tm-3 ℃) to about (Tm-10 ℃), and particularly from about (Tm-5 ℃) to about (Tm-10 ℃). At such temperatures, sequence differences between the control oligonucleotide and the synthesized primer extension product are less tolerated in the strand displacement reaction.

The high sequence specificity of the amplification of the method is mainly achieved if the newly synthesized nucleic acid strand to be amplified cannot spontaneously dissociate into single strands under the reaction conditions. In this case, the sequence-specific strand displacement of the control oligonucleotide plays a decisive role in the sequence-specific strand separation and leads to a large degree to the sequence specificity of the amplification reaction. This is generally achieved if the reaction temperature is significantly below the melting temperature of both strands of the nucleic acid to be amplified and no other components are used for strand separation, e.g. no helicase or recombinase. For example, in sequence specific amplification, the reaction temperature is from about (Tm-10 ℃) to about (Tm-50 ℃), particularly from about (Tm-15 ℃) to about (Tm-40 ℃), particularly from about (Tm-50 ℃) to about (Tm-30 ℃).

In one embodiment of amplification, the maximum reaction temperature is not higher than the melting temperature of the nucleic acid strand to be amplified during the entire amplification reaction.

In certain embodiments of amplification, the reaction temperature may be increased at least once above the melting temperature of the nucleic acid strand to be amplified. For example, the temperature may be increased at the beginning of the amplification reaction and result in double-stranded denaturation of the genomic DNA. It should be noted that in such a step, the dependence of the double-stranded separation on the action of the control oligonucleotide is eliminated or at least significantly reduced.

The reaction temperature for each step of the amplification reaction may be from about 15 ℃ to about 85 ℃, more preferably from about 15 ℃ to about 75 ℃, and especially from about 25 ℃ to about 70 ℃.

In the following examples 2, 3, the amplification reaction was carried out using a reaction temperature of 65 ℃ wherein the Tm of the nucleic acid to be amplified is about 75 ℃ to about 80 ℃. Thus, the double strand of the nucleic acid to be amplified is stable under the reaction conditions and the amplification reaction is sequence specific.

In general, the reaction temperature can be optimally adjusted for each individual reaction step, so that such a temperature can be reached in each reaction step. Thus, the amplification reaction involves cyclic, repeated changes in temperature. In an advantageous embodiment of the process, the reaction conditions of the several reaction steps are standardized such that the number of temperature steps is less than the number of reaction steps. In this embodiment of the invention, at least one step of amplification occurs at a reaction temperature that is different from the reaction temperature of the other steps of amplification. Therefore, the reaction does not proceed isothermally, but the reaction temperature changes cyclically.

For example, at least two temperature ranges are used during amplification, the two temperature ranges being alternately realized (temperature cycling between the temperature ranges). In certain embodiments, the lower temperature range is, for example, 25 ℃ to 60 ℃, particularly 35 ℃ to 60 ℃, particularly 50 ℃ to 60 ℃, and the higher temperature range is, for example, 60 ℃ to 75 ℃, particularly 60 ℃ to 70 ℃.

In certain embodiments, the lower temperature range is, for example, from 15 ℃ to 50 ℃, particularly from 25 ℃ to 50 ℃, particularly from 30 ℃ to 50 ℃, and the higher temperature range is, for example, from 50 ℃ to 75 ℃, particularly from 50 ℃ to 65 ℃.

In certain embodiments, the lower temperature range is, for example, from 15 ℃ to 40 ℃, particularly from 25 ℃ to 40 ℃, particularly from 30 ℃ to 40 ℃, and the higher temperature range is, for example, from 40 ℃ to 75 ℃, particularly from 40 ℃ to 65 ℃.

The temperature may be kept constant within each range, or may be changed (decreased or increased) in accordance with a temperature gradient.

The setting of the temperature is explained in further detail in the following section of the embodiments.

Each temperature reached may be maintained for a certain period of time, resulting in an incubation step. Thus, the reaction mixture may be incubated at a selected temperature for a certain time during amplification. The time may be different for each incubation step and may depend on the progress of the respective reaction (e.g. primer extension or strand displacement, etc.) at a given temperature. The time of the incubation step may include the following ranges: from 0.1 to 10,000s, in particular from 0.1 to 1,000s, in particular from 1 to 300s, in particular from 1 to 100 s.

By varying the temperature in the manner described, the individual reaction steps can be carried out, in particular at the selected temperature. In this way, the yield of each reaction step can be increased. Within a synthesis cycle, several temperature changes or temperature switches between ranges may be made, if necessary. Thus, a synthesis cycle may include at least one temperature change. For example, such temperature changes can be routinely performed as a time program in a PCR instrument/thermal cycler.

In certain embodiments, an amplification method is preferred in which at least one step comprising strand displacement and at least one step comprising a primer extension reaction are performed simultaneously or concurrently under the same reaction conditions. In such embodiments, for example, a primer extension reaction of at least one oligonucleotide primer (e.g., a first oligonucleotide primer) can be performed, inter alia, in a lower temperature range. In contrast, strand displacement is performed in coordination with the control oligonucleotide, and further primer extension reactions (e.g., extension reactions of the second oligonucleotide primer) occur, especially in reaction steps in the higher temperature range.

In certain embodiments, an amplification method is preferred in which at least one step comprising strand displacement of a control oligonucleotide and at least one step comprising a primer extension reaction are performed at different temperatures. In such embodiments, for example, a primer extension reaction of at least one oligonucleotide primer (e.g., a first oligonucleotide primer and/or a second oligonucleotide primer) can be performed, inter alia, in a lower temperature range. On the other hand, strand displacement occurs in the presence of the control oligonucleotide, especially in the reaction step in the higher temperature range.

In another embodiment, all steps of the amplification reaction are performed under the same reaction conditions.

In such embodiments, the amplification procedure may be performed under isothermal conditions, i.e., without temperature changes. In this embodiment of the invention, the entire amplification reaction is carried out isothermally, i.e.the reaction is isothermal. For example, the time of such reaction includes the following ranges: 100-.

In the section "examples", it is shown that the structure of the individual reaction components and the corresponding reaction steps can be matched in an isothermal reaction.

The sum of all method steps which leads to a doubling of the number of nucleic acid strands to be amplified can be referred to as a synthesis cycle. This cycle may be isothermal, or there may be a temperature change in the course of it. The temperature change may be repeated between each cycle and is the same.

Some amplification methods, in which the maximum achievable temperature only allows strand separation in the presence of the control oligonucleotide, are particularly advantageous if more than 5, in particular more than 10, nucleotides of the third region of the control oligonucleotide can bind complementarily to the first primer extension product, in particular if more than 20 nucleotides of the control oligonucleotide bind to the first oligonucleotide extension product. In general, the longer the binding time required between the control oligonucleotide and the complementary strand of the first primer extension product before the synthetic strand dissociates under the reaction conditions, the greater the specificity of the amplification reaction. In detail, the desired degree of specificity can be determined by lengthening or shortening the third portion of the control oligonucleotide.

The process steps may be repeated at a constant temperature or at different temperatures throughout the process.

The method steps can be carried out sequentially by adding the components. In one embodiment, all reaction components required for the amplification procedure are present in the reaction mixture at the beginning of the amplification procedure.

The amplification reaction can be initiated by adding a component, for example by adding a nucleic acid strand comprising the target sequence (e.g., a starting nucleic acid strand), a polymerase, or a divalent metal ion, or by inducing the reaction conditions required for amplification, for example setting the reaction temperature required for one or more process steps.

Amplification may be performed until the desired amount of nucleic acid to be amplified is obtained. In another embodiment, the amplification reaction is carried out for a time sufficient to obtain a sufficient amount of nucleic acid to be amplified. In another embodiment, the amplification reaction is performed in a number of synthesis cycles (doubling) sufficient to obtain a sufficient amount of nucleic acid to be amplified.

This reaction can be prevented by various intervention measures. For example by changing the temperature (e.g. cooling or heating, where the function of the polymerase is disrupted) or by adding a substance that prevents the polymerase reaction, such as EDTA or formamide.

After amplification, the amplified nucleic acid strands can be used for further analysis. The synthesized nucleic acid strand can be analyzed by various detection methods. For example, fluorescently labeled oligonucleotide probes, or sequencing methods (Sanger sequencing or next generation sequencing), solid phase assays (e.g., microarray or bead array assays), and the like may be used. The synthesized nucleic acid strand can be used as a substrate/template in further oligonucleotide extension reactions.

In one embodiment, the progress of the synthesis reaction is monitored during the reaction. This can be accomplished by using intercalating dyes (e.g., Sybrgreen or Evagreen), labeled primers (e.g., Lux-oligonucleotide primers or Scorpion-oligonucleotide primers), or fluorescently labeled oligonucleotide probes.

The detection of the change in fluorescence during amplification is performed in the detection step of the procedure. The temperature and duration of the steps may be adapted to the respective requirements of the oligonucleotide probes. For example, the temperature of the detection step is 20 ℃ to 75 ℃, particularly 40 ℃ to 70 ℃, particularly 55 ℃ to 70 ℃.

In the detection step, the reaction is irradiated with light having a wavelength capable of exciting the fluorophore (donor or fluorescent reporter) used in the detection system. Signal acquisition is typically performed in parallel with excitation, wherein a specific fluorescent signal is detected and its intensity quantified.

As part of a diagnostic procedure, amplification methods can be used to verify the presence of target nucleic acid strands in a biological or diagnostic material.

Embodiments of the second amplification reaction conditions

The reaction conditions for PCR are well known to the skilled person.

Accordingly, some embodiments will be presented herein by way of example.

In certain embodiments, the temperatures shown in fig. 3-11 include the following ranges:

T1＝55℃(±5℃)

T2＝65℃(±5℃)

T3＝95℃(±5℃)

T4＝45℃(±5℃)

T5＝70℃(±5℃)

T1＝55℃(±10℃)

T2＝65℃(±10℃)

T3＝95℃(±10℃)

T4＝45℃(±10℃)

T5＝70℃(±10℃)

T1＝55℃(±15℃)

T2＝65℃(±10℃)

T3＝95℃(±10℃)

T4＝45℃(±20℃)

T5＝70℃(±10℃)

T1＝55℃(±5℃)

T2＝65℃(±3℃)

T3＝95℃(±10℃)

T4＝45℃(±5℃)

T5＝70℃(±3℃)

in some cases, the incubation time in a single temperature step may be from 0.1s to 60min, in particular from 1s to 10min, in particular from 1s to 5 min.

Cycling temperature variations are commonly referred to as PCR cycling. For example, PCR cycles include complete changes in temperature from T1, T2 to T3.

The temperature range used was mainly used to support the following steps of the second amplification:

t1, T2, T4 and T5 temperatures: hybridization of the third and fourth primers to their complementary segments in their respective template strands, and extension of the extension products of the third and fourth primers.

The T3 temperature is used to separate double strands comprising at least one primer extension product. All nucleic acid strands present in double-stranded form (for example, the double-stranded target sequence, the first amplified fragment 1.1, the second amplified fragment 2.1 and the intermediate product comprising P1.1-Ext and P4.1-Ext-part 1 or P2.1-Ext and P3.1-Ext-part 1) are converted into single-stranded form by the effect of temperature.

In addition, the T3 temperature can be used to activate a hot-start form of a second polymerase (e.g., one that is inactivated by an antibody), or to inactivate a first polymerase. In addition, thermolabile control oligonucleotides can be cleaved at the temperature (T3). In addition, third and fourth oligonucleotide primers that can be heat activated can be activated.

Thus, different temperatures may be used in the reaction control.

In addition, the choice of reaction temperature for binding to each PCR primer (the third and fourth primers of the second amplification) will affect the product formation/intermediate formation during the second amplification.

The yield range for each product and intermediate depends on several factors. For example, higher concentrations of each primer generally favor product/intermediate yields. In addition, the formation of products/intermediates is influenced by the reaction temperature and the binding/affinity of the reactants to each other (the affinity between each primer and its complementary primer binding site within the template strand): generally, for example, longer oligonucleotides bind better at higher temperatures than shorter oligonucleotides; and CG levels may also play a role in complementary sequence segments: AT higher temperatures, CG-rich sequences also bind more strongly than AT-rich sequences. Furthermore, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength between the primers and their respective complementary segments, which also results in preferential binding of the oligonucleotide primers at higher temperatures.

For example, longer oligonucleotide primers (e.g., 25-60 nucleotides, with CG levels over 40%) are used for PCR, which have relatively high Tm (e.g., 60 ℃ to 70 ℃) due to their complementary segments. This allows the hybridization step and primer extension step of the second amplification to be performed at higher temperatures (e.g., T2 or T5). By combining shorter first and second primers (from the first amplification), the reaction can be controlled such that primer extension products P4.1-Ext and P3.1-Ext are preferentially formed and co-amplification of primer extension products from P1.1 and P2.1 during PCR amplification can be greatly suppressed.

When using, for example, third and fourth primers that only comprise a short 3' segment (e.g., the segment is 6-15 nucleotides in length) that can bind to the target sequence or its equivalent, it may be advantageous to first perform several cycles at low temperature (fig. 10A, 10B, a2.1 stage). Similar applies to the PCR primers which, for example, only contain a mismatch of the substantially complementary first amplified fragment 1.1.

At this relatively low temperature (T1 and T4) stage, primer binding of the third primer and/or the fourth primer occurs to the complementary segment of its first amplified fragment. Thus, despite the short length of the complementary segment and/or the presence of mismatches, the polymerase can perform template-dependent primer extension starting from the primer hybridized to each strand of the first amplified fragment, and can synthesize a primer extension product comprising the third and fourth oligonucleotide primers.

The PCR cycle is repeated at least twice, so that a complementary strand can also be synthesized. When the cycle is repeated, the third and fourth primers themselves are thus also copied as template, resulting in the formation of complete primer binding sites for the third and/or fourth oligonucleotide primers.

The temperature may then be increased (A2.2 stage) so that the third and fourth primers can bind to the fully formed primer binding sites at higher temperatures.

Higher temperatures (T2 and T5) are advantageously used, for example in homogeneous assays (when both amplification systems are in the same reaction batch). This can be used, for example, to reduce the effect of binding of a control oligonucleotide to the complementary region of the target sequence of a third primer extension product (P3.1-Ext or P3.1-Ext part).

In the second amplification, the enzymatic synthesis is usually also carried out in a buffered aqueous solution. As the buffer solution, a conventional buffer substance such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, sodium glutamate, dissolved at a conventional concentration, can be used. The pH of the solution is generally from 7 to 9.5, in particular from about 8 to 8.5. For example, the buffer conditions may be adjusted according to the manufacturer's recommendations for the polymerase used.

Other substances such as so-called Tm inhibitors (e.g. DMSO, betaine, TPAC) may be added to the buffer. This substance lowers the melting temperature of the duplex ("Tm inhibitor") and can therefore have a positive effect on the opening of the duplex. In addition, polymerase stabilizing components (e.g., Tween 20 or Triton 100) may be added to the buffer in conventional amounts. EDTA or EGTA may be added in conventional amounts to complex heavy metals. In addition, a polymerase stabilizing substance (e.g., trehalose or PEG 6000) may be added to the reaction mixture.

Specific embodiments of the starting nucleic acid strand: for the first amplification

The nucleic acid strand used or to be used at the beginning of the amplification reaction can be referred to as the starting nucleic acid strand (FIG. 1).

It can be seen that it functions in that it represents an initial template that allows for the correct positioning of the primers, the synthesis segment between the two primers, and the initiation of the binding and extension process. In one embodiment, the starting nucleic acid strand comprises the target sequence.

By binding the primers to their respective primer binding sites (PBS 1 and PBS 2) and initiating the appropriate primer extension reaction, a first primer extension product is generated. These are synthesized as specific copies of the nucleic acid strands present at the beginning of the reaction.

In certain embodiments, the nucleic acid strand used in the reaction mixture prior to the initiation of the amplification reaction (the starting nucleic acid strand) can be the same as the nucleic acid strand to be amplified. Only the number of such nucleic acid strands is increased by the amplification reaction.

In certain embodiments, the nucleic acid to be amplified and the starting nucleic acid strand differ in that the starting nucleic acid strand indicates the arrangement of the sequence members of the nucleic acid strand to be amplified, and the sequence composition of the starting nucleic acid strand may differ from the sequence of the nucleic acid strand to be amplified. For example, in the case of primer binding and extension during amplification, new sequence content (with respect to the starting nucleic acid strand) can be integrated into the nucleic acid strand to be amplified. In addition, the sequence members of the nucleic acid strand to be amplified can differ in their sequence composition (e.g., primer binding site or primer sequence) from such sequence members of the starting nucleic acid strand. The starting nucleic acid serves only as an initial template for the specific synthesis of the nucleic acid strand to be amplified. The initial template may remain in the reaction mixture until the end of amplification. However, due to the exponential nature of amplification, the number of nucleic acid strands to be amplified at the end of the amplification reaction exceeds the number of starting nucleic acid strands added to the reaction.

In certain embodiments, the starting nucleic acid strand may comprise at least one portion of sequence that is not amplified. Thus, this starting nucleic acid strand is different from the sequence to be amplified. For example, such a segment that is not amplified may represent a sequence segment of the starting nucleic acid strand due to a sequence preparation step or due to a previous sequence manipulation step, respectively.

In a specific embodiment, the starting nucleic acid strand to be added to the reaction mixture before the reaction begins comprises at least one target sequence.

In certain embodiments, such a starting nucleic acid strand comprises sequences of at least one target sequence and other non-target sequences. During amplification, the sequence segments comprising the target sequence are exponentially multiplied, so that other sequence segments are either not exponentially multiplied at all or are only partially multiplied.

Structure of the starting nucleic acid strand (for the first amplification)

An example of such a starting nucleic acid strand is a nucleic acid strand comprising a target sequence, sequence segment A and sequence segment B.

The sequence segment a of the starting nucleic acid strand comprises a sequence that has significant homology with the sequence of one of the two primers used for amplification, or is substantially identical to the replicable portion of the 3' segment of one of the primers. During synthesis of the complementary strand of this segment, complementary sequences representing the respective primer binding sites are generated.

The sequence segment B of the starting nucleic acid strand comprises a sequence suitable for binding complementarily to a corresponding further primer or 3' segment thereof to form an extendable primer template complex, wherein the sequence segments A and B are predominantly/especially non-complementary to each other.

In one embodiment, a starting nucleic acid strand is added to a reaction mixture of an amplification method having the following properties:

in particular, sequence segment a is in the 5' segment of the starting nucleic acid strand. In particular, the sequence segment a forms a restriction to a nucleic acid strand segment in the 5' direction.

In particular, sequence segment B is located 3' to sequence segment a with respect to the binding site of the first primer and with respect to the polarity of the first primer ("downstream").

In a specific embodiment, the sequence segment B forms a restriction to a nucleic acid strand segment in the 3' direction. In certain embodiments, the sequence segment B does not represent a restriction to the strand of the nucleic acid strand in the 3 'direction, but is flanked on both sides by other sequences on the 3' side. In particular, the sequence is not the target sequence and is not involved in exponential amplification.

In certain embodiments, the target sequence comprises at least one of sequence segments a and B. In certain embodiments, the target sequence is located between sequence segment a and sequence segment B.

In certain embodiments (FIG. 50), such a starting nucleic acid strand can be used as a template for the synthesis of a first primer extension product. Here, for example, during a primer extension reaction using the second oligonucleotide primer, the starting nucleic acid strand can serve as a sequence segment of a longer starting nucleic acid strand in a preparation step prior to exponential amplification and can be converted into a single-stranded form. For example, the starting nucleic acid strand can be genomic DNA or RNA, and can serve as a source of the target sequence. The starting nucleic acid strand in the 5 'segment of the nucleic acid strand comprises segment 1 containing the sequence segment of the second oligonucleotide primer and representing a restriction in the 5' direction, segment 2 containing the target sequence or a portion thereof, segment 3 containing the primer binding site of the first oligonucleotide primer, and segment 4 containing a non-target sequence located in the 3 'segment of the starting nucleic acid strand and thus flanking segment 3 on the 3' side.

During the start of amplification, a first primer having at least the 3' segment of its first region can bind to this starting nucleic acid strand in segment 3 and extend appropriately in the presence of a polymerase and nucleotides. Thereby, a first primer extension product is generated that is complementary to the template strand of the starting nucleic acid strand and is of limited length. During the amplification reaction, such primer extension products can be sequence-specifically separated from their template strands by the control oligonucleotide, and thus the corresponding sequence segment in the 3' segment of the first primer extension product synthesized herein can serve as a binding site for the second oligonucleotide primer.

In one embodiment, the starting nucleic acid strand thus comprises the following sequence segments (FIG. 50):

sequence segment 1 (referred to as segment 1) comprising a sequence having significant homology to the sequence of the second primer or substantially identical to a replicable portion of the 3' segment of the second primer. Said sequence segment 1 forms a restriction of the nucleic acid strand in the 5 'segment of the starting nucleic acid strand, in particular said sequence segment 1 in the 5' direction.

Sequence segment 3 (referred to as segment 3) comprising a sequence suitable for binding complementarily to the first region of the first primer or a 3' segment thereof to form an extendable primer template complex. In particular, the sequence segment 3 is in the 3 direction ("upstream") of sequence segment 1.

A target sequence located partially or entirely between segment 1 and segment 3 (this part of the target sequence is referred to as segment 2). In one embodiment, the target sequence comprises segment 2 and segment 1 and/or segment 3.

Alternatively, the starting nucleic acid strand in the 3' segment comprises a segment of unamplified flanking sequence (referred to as segment 4).

In certain embodiments (FIG. 51), the starting nucleic acid strand can be used as a template for synthesis of a second primer extension product.

Here, for example, during a primer extension reaction using the first oligonucleotide primer, the starting nucleic acid strand can serve as a sequence segment of a longer starting nucleic acid strand in a preparation step prior to exponential amplification, and can be converted into a single-stranded form. For example, the starting nucleic acid strand can be genomic DNA or RNA, and can serve as a source of the target sequence (shown schematically as double stranded). The starting nucleic acid strand in the 5 'segment of the nucleic acid strand comprises segment 5 which contains the sequence segment of the first oligonucleotide primer and represents a restriction in the 5' direction, segment 6 which contains the target sequence or a portion thereof, segment 7 which contains the primer binding site of the second oligonucleotide primer, and segment 8 which contains a non-target sequence located in the 3 'segment of the starting nucleic acid strand and thus flanking segment 7 on the 3' side.

During the start of amplification, a first primer having at least the 3' segment of its first region may bind to this starting nucleic acid strand in segment 7 and suitably extend up to the terminating portion of the first oligonucleotide primer in the presence of a polymerase and nucleotides. Thereby, a second primer extension product is generated that is complementary to the template strand of the starting nucleic acid strand and is of limited length. During the amplification reaction, such primer extension products can be sequence-specifically separated from their template strands by the control oligonucleotide, and thus the corresponding sequence segment in the 3' segment of the second primer extension product synthesized therein can serve as a binding site for the first oligonucleotide primer.

In such embodiments, the starting nucleic acid strand comprises the following sequence segments:

sequence segment 5 (referred to as segment 5) comprising a sequence having significant homology to the sequence of the region of the first primer or being substantially identical to a replicable part of the first region of the first primer. The sequence segment 5 is in the 5 'segment of the starting nucleic acid strand and is flanked on both sides by a non-replicable oligonucleotide tail (similar to the first oligonucleotide primer), in particular the sequence segment 5 forms a restriction to the non-replicable nucleic acid strand segment in the 5' direction.

Sequence segment 7 (referred to as segment 7) comprising a sequence suitable for binding complementarily to the second primer or a 3' segment thereof to form an extendable primer template complex. In particular, segment 7 is in the 3' direction ("upstream") of sequence segment 5.

The target sequence located partially or entirely between segment 5 and segment 7 (in FIG. 23, this portion of the target sequence is referred to as segment 6). In one embodiment, the target sequence comprises segment 6 and segment 5 and/or segment 7.

Alternatively, the starting nucleic acid strand in the 3' segment comprises a segment of unamplified flanking sequence (referred to as segment 8).

Mode of action of the initiating nucleic acid strand in the first amplification reaction

At the beginning of the amplification reaction, the initial nucleic acid strand serves as a template for the initial generation of each primer extension product. Thus, it represents the starting template for the nucleic acid strand to be amplified. The starting nucleic acid strand does not have to be identical to the nucleic acid strand to be amplified. By binding and extending the two primers during the amplification reaction, essentially both primers are indicative of the sequences generated during amplification on both end segments of the nucleic acid strand to be amplified.

In one embodiment of the method, reaction conditions that do not denature the double strand are maintained during the exponential amplification procedure. Thus, it is advantageous if the starting nucleic acid strand has a restriction in its 5' sequence segment that can be extended by a polymerase, which will result in termination of the enzymatic extension of each primer. Therefore, the length of the primer extension fragment generated under the reaction conditions is limited. This can have a beneficial effect on strand displacement of the control oligonucleotide and lead to dissociation of the individual strands, thereby shifting the primer binding site to the single-stranded stage and thus can be used for new binding of the primer.

Specific embodiment of the first oligonucleotide primer (primer 1)

The first oligonucleotide primer (primer 1) is a nucleic acid strand comprising at least the following regions (FIGS. 12-14):

a first primer region in the 3' segment of the first oligonucleotide primer and capable of binding substantially sequence-specifically to a strand of the nucleic acid strand to be amplified; and

a second region linked directly or via a linker to the 5' end of the first primer region of the first oligonucleotide primer and comprising a polynucleotide tail suitable for binding to a control oligonucleotide and supporting strand displacement by the control oligonucleotide (step c); wherein the polynucleotide tail remains substantially single stranded (i.e., does not form a stable hairpin structure or ds structure) under reaction conditions and is substantially not replicated by the polymerase.

The first oligonucleotide primer has a full length of 10 to 80 nucleotides, particularly 15 to 50 nucleotides, and more preferably 20 to 30 nucleotides or an equivalent thereof (e.g., nucleotide modification). The structure of the first oligonucleotide primer is adapted such that it is capable of reversibly binding to the control oligonucleotide under the selected reaction conditions. Furthermore, the structure of the first oligonucleotide primer is adapted to its primer function. Furthermore, the structure is adjusted so that strand displacement can be performed by the control oligonucleotide. In general, the structures of the first region and the second region are adjusted so that exponential amplification can be performed.

In an advantageous embodiment of the invention, the first and second regions of the primer are coupled in a conventional 5 '-3' arrangement. In certain embodiments of the invention, the coupling of the two moieties is accomplished via a 5 '-5' bond such that the second region has an opposite orientation to the first region.

The coupling regions with one another are obtained in particular covalently. In certain embodiments, the coupling between the first and second regions is a 5 '-3' phosphodiester coupling that is conventional for DNA. In certain embodiments, it is a 5 '-5' phosphodiester coupling. In certain embodiments, it is a 5 '-3' phosphodiester coupling in which at least one linker (e.g., a C3, C6, C12, or HEG linker or a abasic modification) is positioned between adjacent terminal nucleotides or nucleotide modifications of the two regions.

Each region may comprise different nucleotide modifications. Here, each member of the nucleotides that can be modified: nucleobases and backbone (sugar content and/or phosphate content). Furthermore, modifications or modified modifications of at least one component lacking standard nucleotide building blocks, such as PNA, can be used.

In certain embodiments, the second region of the first oligonucleotide primer comprises additional sequences that do not bind to the control oligonucleotide. These sequences can be used for other purposes, for example for binding to a solid phase. These sequences are located, inter alia, 5' to the tail of the polynucleotide.

In certain embodiments, the first oligonucleotide primer may comprise a signature. Examples of such labels are dyes (e.g. FAM, TAMRA, Cy3, Alexa 488, etc.) or biotin or other specifically binding groups, such as digoxigenin.

A first primer region of a first oligonucleotide primer

The sequence is about 3 to 30 nucleotides in length, particularly 5 to 20 nucleotides, wherein the sequence is predominantly complementary to the 3' segment of the nucleic acid strand to be amplified. In detail, the primer region must be capable of specifically binding to the complementary 3' segment of the second primer extension product. The first region is replicable in reverse synthesis and also serves as a template for the second strand. In particular, the nucleotide building blocks are linked to one another by a common 5 '-3' phosphodiester or phosphothioester bond.

The first primer region comprises, inter alia, nucleotide monomers which do not or only slightly influence the function of the polymerase, for example:

natural nucleotides (dA, dT, dC, dG, etc.) or modifications thereof, and unchanged base pairing; and

modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with different base pairing.

In a specific embodiment, the 3 '-OH end of the region is especially unmodified and has a 3' -OH functional group that is recognized by a polymerase. The first primer region serves as an initiator for the synthesis of the first primer extension product in the amplification. In another embodiment, the first region comprises at least one phosphorothioate compound such that degradation of the 3 'end of the primer due to the 3' exonuclease activity of the polymerase does not occur.

The sequence of the first region of the first oligonucleotide primer is complementary to the sequence of the second region of the control oligonucleotide, among others.

In certain embodiments, the first primer region or 3' segment thereof can bind to a sequence segment of the target sequence.

Second region of the first oligonucleotide primer

The second region of the first oligonucleotide primer is in particular a nucleic acid sequence comprising at least one polynucleotide tail which is in particular not copied by a polymerase during the synthesis reaction and which is capable of binding to the first region of the control oligonucleotide. The segment of the second region that binds predominantly to the control oligonucleotide may be referred to as the polynucleotide tail.

Furthermore, the second region of the first oligonucleotide primer must not only bind specifically to the control oligonucleotide under the reaction conditions, but must also participate in the strand displacement process by the control oligonucleotide. Thus, the structure of the second region must be suitable for bringing the control oligonucleotide and the corresponding double-stranded end (in particular, the 3' end of the second primer extension product) into close proximity to each other.

The structural configuration of the second region of the first oligonucleotide primer is detailed in several embodiments. Here, the arrangement of the oligonucleotide segments and the modifications used which lead to the termination of the polymerase-catalyzed synthesis are taken into account.

The second region is 3 to 60 nucleotides, especially 5 to 40 nucleotides, especially 6 to 15 nucleotides in length or an equivalent thereof.

The sequence of the second region may be arbitrarily selected. In particular, the sequence is not complementary to the first region of the nucleic acid to be amplified and/or the second oligonucleotide primer and/or the first oligonucleotide primer. Furthermore, it does not comprise any self-complementary segments, such as hairpins or stem loops, among others.

The sequence of the second region is particularly suitable for the sequence of the first region of the control oligonucleotide, so that the two sequences can bind under the reaction conditions. In a specific embodiment, the binding is reversible under reaction conditions, such that there is an equilibrium between the components bound to each other and the components not bound.

The sequence of the second region of the first oligonucleotide primer is especially chosen such that the number of complementary bases capable of binding to the first region of the control oligonucleotide is between 1 and 40, better between 3 and 20, especially between 6 and 15.

The function of the second region is, inter alia, binding to a control oligonucleotide. In certain embodiments, in particular, the binding is specific such that the second region of the first oligonucleotide primer is capable of binding to a specific control oligonucleotide. In another embodiment, the second region is capable of binding to more than one control oligonucleotide under the reaction conditions.

Typically, there need not be a perfect match in sequence between the second region of the first oligonucleotide primer and the first region of the control oligonucleotide. The degree of complementarity between the second region of the first oligonucleotide primer and the first region of the control oligonucleotide may be from 20% to 100%, better from 50% to 100%, in particular from 80% to 100%. The complementary regions may be directly adjacent to each other or may also comprise a non-complementary sequence segment between them.

In certain embodiments, the second region of the first oligonucleotide primer may comprise at least one modification that alters Tm. By introducing such a modification, the stability of the bond between the second region of the first oligonucleotide primer and the first region of the control oligonucleotide can be altered. For example, modifications (nucleotide modifications or non-nucleotide modifications) that raise Tm may be used, such as LNA nucleotides, 2-aminoadenosine or MGB modifications. Alternatively, modifications that lower Tm, such as inosine nucleotides, may also be used. In the structure of the second region, a linker (e.g., C3, C6, HEG linker) may also be integrated.

For strand displacement, the control oligonucleotide must be spatially close to the double-stranded end of the nucleic acid to be amplified. The double-stranded ends consist of a segment of the first primer region of the first primer extension product and a corresponding complementary 3' segment of the second primer extension product.

The polynucleotide tail binds predominantly complementarily to the control oligonucleotide under the reaction conditions, thus causing a transient approach of the second region of the control oligonucleotide and the first region of the extended primer extension product, which can prime complementary binding between the members during strand displacement.

In certain embodiments, binding of the control oligonucleotide to the polynucleotide tail of the first oligonucleotide primer directly results in such contact. This means that the polynucleotide tail of the first oligonucleotide primer and the first primer region must be coupled directly to each other. Due to this arrangement, there may be direct contact between the complementary base of the second region of the control oligonucleotide and the corresponding base of the first primer region after the control oligonucleotide has bound in its first region, and thus strand displacement may be initiated.

In certain embodiments, the second region of the first oligonucleotide primer has additional structure between the structure of the polynucleotide tail and the first primer region. Thus, after the control oligonucleotide has bound to the polynucleotide tail, it is not located directly at the first primer region, but rather at a distance therefrom. Such a distance can be created by the structure between the non-replicable polynucleotide tail and the replicable first primer region of the oligonucleotide primer. The distance is from 0.1 to 20nm, in particular from 0.1 to 5nm, in particular from 0.1 to 1 nm.

Such structures represent, for example, linkers (e.g., C3, C6, HEG linkers) or segments that are not complementary (e.g., in the form of non-complementary, non-replicable nucleotide modifications) to a control oligonucleotide. The length of these structures can generally be measured in chain atoms. The length is from 1 to 200 chain atoms, in particular from 1 to 50 chain atoms, in particular from 1 to 10 chain atoms.

In order for the polynucleotide tail of the polymerase to be non-replicable under amplification conditions, the second region of the first oligonucleotide primer typically contains a sequence alignment or structure, respectively, that will cause the polymerase to terminate in the synthesis of the extension product of the second primer after the first primer region has been successfully replicated. The structure is to prevent the polynucleotide tail of the second region from being copied. Thus, the polynucleotide tail is not replicated, inter alia, by the polymerase.

In certain embodiments, such a structure is located between the first primer region and the polynucleotide tail.

In certain embodiments, the sequence of the polynucleotide tail may comprise nucleotide modifications that result in polymerase termination. Thus, the sequence segment of the second region of the first oligonucleotide primer may comprise two functions: it is both the tail of the polynucleotide and the nucleotide modification sequence that leads to termination of the polymerase.

The term "first blocking unit or termination region" encompasses modifications in the second region of the first oligonucleotide primer that result in termination of synthesis and thus rendering the polynucleotide tail unreplicated in this application. In the following, further embodiments of structures that can lead to the termination of the synthesis of the second strand are given.

Several building blocks in oligonucleotide synthesis are known to prevent the polymerase from reading the template and to cause termination of polymerase synthesis. For example, nucleotide modifications or non-nucleotide modifications that are not replicable are known. Synthetic types/alignments of nucleotide monomers that result in polymerase termination (e.g., 5 ' -5 alignments or 3 ' -3 ' alignments) are also present in the oligonucleotides. Oligonucleotide primers with non-replicable polynucleotide tails are also known in the art (e.g., Scorpion primer structures or primers for binding to a solid phase). Both primer variants demonstrate oligonucleotide primer structures capable of priming strand synthesis leading to primer extension reactions. The result is that the first strand also integrates the primer structure with the tail in the primer extension product. In the synthesis of the complementary strand of the first primer extension product, for example during a PCR reaction, the second strand is extended to the "blocking unit/termination structure" of the primer structure. The two primer structures are designed so that the 5' portion of the oligonucleotide primer remains single stranded and is not replicated by the polymerase.

In certain embodiments, the second region of the oligonucleotide primer comprises a polynucleotide tail having a conventional alignment from 5 'to 3' over its entire length and comprising non-replicable nucleotide modifications. Examples of such non-replicable nucleotide modifications are 2' -O-alkyl RNA modification, PNA, morpholino. The modifications can be distributed in different ways in the second primer region.

The non-replicatable part of a nucleotide modification in a polynucleotide tail may constitute 20% to 100%, in particular more than 50%, of the nucleotide building block. In particular, these nucleotide modifications are located in the 3' segment of the second region and thus flank the first region of the first oligonucleotide primer.

In certain embodiments, the sequence of the non-replicable nucleotide modifications is at least partially complementary to a sequence in the template strand, such that binding of the primer to the template is accomplished by including at least a portion of the nucleotide modifications. In certain embodiments, the sequence of the non-replicable nucleotide modifications is not complementary to a sequence in the template strand.

The nucleotide modifications that are not replicable are in particular covalently coupled to one another and thus represent a sequence segment in the second region. The length of the segment is 1-40 nucleotide modifications, especially 1-20 nucleotide modifications, especially 3-10 nucleotide modifications.

In certain embodiments, the second region of the first oligonucleotide primer comprises a polynucleotide tail having a 5 ' -3 ' regular alignment over its entire length and comprising a non-replicatable nucleotide modification (e.g., a 2' -O-alkyl modification) and at least one non-nucleotide linker (e.g., a C3, C6, HEG linker). The function of a non-nucleotide linker is to covalently link adjacent nucleotides or nucleotide modifications, while site-specifically interrupting the synthetic function of the polymerase.

Such a non-nucleotide linker does not cause the structures of the polynucleotide tail and the first primer region to be too far from each other. Instead, the polynucleotide tail should be spatially adjacent to the first primer region. The non-nucleotide linker comprises a modification of no more than 200 chain atoms in length, even more advantageously no more than 50 chain atoms, especially preferably no more than 10 chain atoms. The minimum length of such a linker may be one atom. Examples of such non-nucleotidic linkers are straight or branched alkyl linkers, the alkyl chain of which comprises at least one carbon atom, especially at least 2 to 30 carbon atoms, more especially 4 to 18 carbon atoms. Such linkers are well known in oligonucleotide chemistry (e.g., C3, C6, or C12 linkers) and may be incorporated between the sequence of the polynucleotide tail and the sequence of the first region of the first oligonucleotide primer during solid phase synthesis of the oligonucleotide. Other examples of such non-nucleotidic linkers are linear or branched polyethylene glycol derivatives. A known example in oligonucleotide chemistry is hexaethylene glycol (HEG). Other examples of such non-nucleotide linkers are no base modifications (e.g., THF modifications as analogs of dRibose).

If one or more such modifications are incorporated into the second region, they may effectively interfere with the replication function of the polymerase during synthesis of the second primer extension product by the polymerase, such that the segment in the 3' direction remains unreplicated after the modification. The number of such modifications in the second region may be from 1 to 100, in particular from 1 to 10, in particular from 1 to 3.

The position of such a non-nucleotide linker may be 3' to the second region, thus representing a transition to the first and second regions of the oligonucleotide primer.

In addition, the position of the non-nucleotide linker in the middle segment of the second region may be used. Thus, the polynucleotide tail is divided into at least two segments. In this embodiment, the 3' segment of the polynucleotide tail comprises at least one (particularly more, e.g., 2-20, particularly 2-10) non-replicable nucleotide modification. These non-replicable nucleotide modifications are located in particular at the transition between the first region and the second region of the oligonucleotide primer.

In certain embodiments, the second region of the oligonucleotide primer comprises polynucleotide tails aligned from 5 'to 3' over the full length and comprises at least one nucleotide monomer aligned from 3 'to 5' "reverse" at the transition between the first and second regions of the first oligonucleotide primer.

In certain embodiments, the second region of the oligonucleotide primer comprises a polynucleotide tail, wherein the polynucleotide tail consists entirely of nucleotides that flank the first region of the first oligonucleotide primer in reverse alignment, thereby effecting coupling of the first and second regions through the 5 '-5' position. The advantage of this alignment is that the polymerase after copying the first region encounters an "inverse" alignment of nucleotides, which usually results in the termination of synthesis at that site.

In an "inverted" alignment of the full length nucleotides of a polynucleotide tail, especially the 3 'terminal nucleotide of the polynucleotide tail, will be blocked at its 3' -OH end to prevent side reactions. Alternatively, terminal nucleotides, such as dideoxynucleotides, which have no 3' -OH group at all, may also be used.

Of course, in such embodiments, the corresponding nucleotide alignment in the control oligonucleotide will also be adjusted. In this case, the first and second regions of the control oligonucleotide must be linked in a 3 '-3' alignment.

In certain embodiments, the second region of the oligonucleotide primer comprises a polynucleotide tail having a regular alignment from 5 'to 3' over its entire length; the second region of the oligonucleotide primer further comprises at least one nucleotide modification that does not represent a nucleobase complementary to the polymerase (if synthesized using only native dntps (dATP, dCTP, dGTP, dTTP, or dUTP)).

For example, the Iso-dG or Iso-dC nucleotide modification may be incorporated as a single (but especially several (at least 2-20)) nucleotide modification in the second region of the first oligonucleotide primer. Other examples of nucleobase modifications are various modifications of the extended genetic alphabet. Such nucleotide modifications do not support, inter alia, complementary base pairing with the natural nucleotides, so that the polymerase (at least theoretically) does not insert the series of nucleotides (dATP, dCTP, dGTP, dTTP or dUTP). In practice, however, there may be preliminary insertions, especially at higher concentrations of dNTP substrate and prolonged incubation times (e.g., 60min or more). Thus, in particular, some such nucleotide modifications at adjacent positions will be used. Termination of polymerase synthesis is achieved by the absence of appropriate complementary substrates for these modifications. Oligonucleotides with Iso-dC or Iso-dG can be synthesized by standard methods and can be obtained from a variety of vendors (e.g., Trilink-Technologies, Eurogentec, Biomers GmbH). Alternatively, the sequence of the first region of the control oligonucleotide may be adapted to the sequence of such a second primer region. Here, the complementary nucleobases of the extended genetic alphabet can accordingly be integrated in the first region of the control oligonucleotide during chemical synthesis. For example, Iso-dG may be incorporated in the second region of the first primer nucleotide and its complementary nucleotide (Iso-dC-5-Me) may be placed at an appropriate site in the first region of the control oligonucleotide.

In general, the synthesis of the polymerase in the second region can be terminated in different ways. However, it is preferred that such blocking only occurs when the polymerase has replicated the first region of the first oligonucleotide primer. In this way, it is ensured that the second primer extension product has an appropriate primer binding site at its 3' segment. This primer binding site is exposed during strand displacement and is therefore available for new binding of another first oligonucleotide primer.

Upon synthesis of the complementary strand of the first primer extension product, the primer extension reaction terminates prior to the polynucleotide tail. Since the polynucleotide tail thus remains single stranded to interact with the control oligonucleotide and thus be available for binding, it supports the control oligonucleotide in priming the strand displacement reaction by having the corresponding complementary segment of the control oligonucleotide immediately adjacent to the end of the appropriate duplex. In this way, the distance between the complementary portion of the control oligonucleotide (the second region) and the complementary portion of the extension oligonucleotide primer (the first region) is reduced to a minimum. This spatial proximity helps to initiate strand displacement.

Now, in the schematic depiction of the nucleic acid-mediated strand displacement reaction, the complementary sequence of the control oligonucleotide is immediately adjacent to the appropriate duplex end. This results in competition between the strand of the control oligonucleotide and the template strand complementary to the primer for binding to the first region of the first oligonucleotide primer. The nucleic acid-mediated strand displacement process is initiated by repeated closure and base pairing between the primer region and the complementary segment of the control oligonucleotide (the second region of the control nucleotide) or the complementary segment of the template strand, respectively.

Generally, the closer the corresponding complementary sequence portion of the control oligonucleotide is to the complementary segment of the primer region, the higher the yield of strand displacement priming. However, when the distance is increased, the yield of the strand displacement initiation is decreased.

In the context of the present invention, it is not mandatory to carry out the strand displacement in the highest yield. Thus, the distance between the 5' segment of the first primer region of the first oligonucleotide primer that binds to the complementary strand of the template and forms a complementary duplex and the corresponding complementary sequence portion in the control oligonucleotide (when bound to the polynucleotide tail of the second region of the first oligonucleotide primer) may be in the range: 0.1 to 20nm, especially 0.1 to 5nm, especially 0.1 to 1 nm. In a particular case, the distance is less than 1 nm. Said distances expressed in other units correspond to trajectories of less than 200 atoms, in particular less than 50 atoms, in particular less than 10 atoms. In a particular case, the distance is one atom. The distance information is only used for orientation and illustrates that shorter distances between these structures are preferred. In many cases, the distance can only be measured by analyzing the exact structure of the oligonucleotide and evaluating the measurement of the sequence distance or linker length.

The first primer may also comprise other sequence segments that are not required in the interaction with the control oligonucleotide or the template strand. Such sequence segments can be bound, for example, to further oligonucleotides which serve as detection probes or immobilization partners in the binding to the solid phase.

Primer function of the first oligonucleotide primer

The first oligonucleotide primer can be used in several separate steps. First, it functions as a primer in amplification. Thereby, a primer extension reaction is performed using the second primer extension product as a template. In certain embodiments, the first oligonucleotide primer can use the starting nucleic acid strand as a template at the beginning of the amplification reaction. In certain embodiments, a first oligonucleotide primer can be used to design/provide an initial nucleic acid strand. During amplification, the first primer uses the second primer extension product as a template, acting as an initiator in the synthesis of the first primer extension product. The 3' segment of the first primer comprises a sequence that binds predominantly complementarily to the extension product of the second primer. Enzymatically extending the first oligonucleotide primer using the second primer extension product as a template, thereby forming a first primer extension product. Such first primer extension product comprises the target sequence or a sequence portion thereof. During synthesis of the second primer extension product, the sequence of the replicable portion of the first oligonucleotide primer is recognized by the polymerase as a template and the corresponding complementary sequence is synthesized, thereby generating each primer binding site of the first oligonucleotide primer. The synthesis of the first primer extension product proceeds up to and including the 5' segment of the second oligonucleotide primer. Immediately after synthesis of the first primer extension product, the product binds to the second primer extension product and forms a double stranded complex. The second primer extension product is sequence-specifically displaced from the complex by the control oligonucleotide. Thus, the control oligonucleotide binds to the first primer extension product. After successful strand displacement by the control oligonucleotide, the second primer extension product can in turn serve as the template itself for synthesis of the first primer extension product. The now free 3' segment of the first primer extension product can bind to another second oligonucleotide primer, which can prime the new synthesis of a second primer extension product.

In addition, the first oligonucleotide primer can function as an initiator in the synthesis of a first primer extension product from an initial nucleic acid strand at the beginning of amplification. In certain embodiments, the sequence of the first primer is fully complementary to the corresponding sequence segment of the starting nucleic acid strand. In certain embodiments, the sequence of the first oligonucleotide primer is only partially complementary to the corresponding sequence segment of the starting nucleic acid strand. However, the differential complementarity does not prevent the first oligonucleotide primer from initiating a primer extension reaction that is primarily sequence-specific. The respective differences in complementarity of the respective positions in the first oligonucleotide primer and the starting nucleic acid strand are particularly in the 5 'segment of the first region of the first oligonucleotide primer, so that base pairing and initiation of synthesis, which are predominantly complementary in the 3' segment, are possible. For example, for the start of synthesis, especially the first 4-10 positions in the 3' segment will be fully complementary to the template (starting nucleic acid strand). The remaining nucleotide positions may deviate from perfect complementarity. Thus, the degree of perfect complementarity in the remaining 5' segment of the first region of the first oligonucleotide primer may be 50% to 100%, in particular 80% to 100%, of the base composition. The sequence difference is 1 to at most 15 positions, in particular 1 to at most 5 positions, depending on the length of the first region of the first oligonucleotide primer. Thus, the first oligonucleotide primer can prime the synthesis of the initial nucleic acid strand. In a subsequent synthesis of the second primer extension product, the replicable sequence segment of the first oligonucleotide primer is replicated by the polymerase, such that in turn a fully complementary primer binding site is formed within the second primer extension product in a subsequent synthesis cycle, for binding of the first oligonucleotide primer, and is available for use in a subsequent synthesis cycle.

In certain embodiments, a first oligonucleotide primer can be used to prepare a starting nucleic acid strand. Thus, such a first oligonucleotide primer is capable of binding predominantly/especially sequence-specifically to a nucleic acid (e.g., a single-stranded genomic DNA or RNA comprising a target sequence or an equivalent thereof) and priming a template-dependent primer extension reaction in the presence of a polymerase. The binding site is selected such that the primer extension product comprises the desired target sequence. Extension of the first oligonucleotide primer results in the generation of a nucleic acid strand having a sequence complementary to the template. Such strands may be separated from the template (e.g., by heating or base) and converted to single-stranded form. Such a single-stranded nucleic acid strand can be used as a starting nucleic acid strand at the start of amplification. Such an initial nucleic acid strand comprises in its 5' segment the sequence portion of the first oligonucleotide primer, and further comprises the target sequence or equivalent thereof and the primer binding site of the second oligonucleotide primer. Other steps are described in the section "starting nucleic acid strand".

The synthesis of the first primer extension product is a primer extension reaction and constitutes a separate step in the amplification. The reaction conditions in this step are adjusted accordingly. The reaction temperature and reaction time are chosen such that the reaction can be carried out continuously. The preferred temperature in this step depends on the polymerase used and the strength of binding of the respective first oligonucleotide primer to its primer binding site and is, for example, from 15 ℃ to 75 ℃, in particular from 20 ℃ to 65 ℃, in particular from 25 ℃ to 65 ℃. The concentration of the first oligonucleotide primer is 0.01-50. mu. mol/l, especially 0.1-20. mu. mol/l, especially 0.1-10. mu. mol/l.

In certain embodiments, all steps of amplification are performed under stringent conditions to prevent or delay the formation of non-specific products/byproducts. Such conditions are, for example, relatively high temperatures, in particular above 50 ℃.

If more than one specific nucleic acid strand is to be amplified in a batch, in certain embodiments, sequence-specific oligonucleotide primers are used, inter alia, to amplify the corresponding target sequences.

In particular, the sequences of the first oligonucleotide primer, the second oligonucleotide primer and the control oligonucleotide are adapted to each other to minimize side reactions (e.g., primer dimer formation). To this end, for example, the sequences of the first and second oligonucleotide primers are adapted to each other such that neither oligonucleotide primer is capable of initiating or supporting an amplification reaction, respectively, in the absence of a suitable template and/or target sequence and/or starting nucleic acid strand. This can be achieved, for example, because the second oligonucleotide primer does not comprise a primer binding site of the first oligonucleotide primer and the first oligonucleotide primer does not comprise a primer binding site of the second oligonucleotide primer. Furthermore, it should be avoided that the primer sequence comprises an extended self-complementary structure (self-complement).

In certain embodiments, the synthesis of the first and second primer extension products is performed at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products is performed at different temperatures. In certain embodiments, the synthesis of the first primer extension product and the strand displacement of the control oligonucleotide are performed at the same temperature. In certain embodiments, the synthesis of the first primer extension product and the strand displacement of the control oligonucleotide are performed at different temperatures.

Embodiments of control oligonucleotides

Control oligonucleotides (FIGS. 19-26) included:

a second single-stranded region which can bind substantially complementarily to the first region of the first oligonucleotide primer; and

a third single-stranded region which is substantially complementary to at least a segment of the extension product of the first primer extension product;

wherein the control oligonucleotide does not serve as a template for primer extension of the first or second oligonucleotide primer.

Typically, the sequence of the third region of the control oligonucleotide is compatible with the sequence of the nucleic acid to be amplified, as this relates to the template of nucleotide sequences in the extension product of the first primer. The sequence of the second region of the control oligonucleotide corresponds to the sequence of the first primer region. The structure of the first region of the control oligonucleotide is adapted to the sequence of the second region of the first oligonucleotide primer, in particular to the nature of the polynucleotide tail.

The control oligonucleotide may also comprise additional sequence segments not belonging to the first, second or third region. These sequences may be added as flanking sequences to the 3 'and 5' ends. In particular, these sequence segments do not interfere with the function of the control oligonucleotide.

The structure of the control oligonucleotide has inter alia the following properties:

the regions are covalently bound to each other. For example, binding can be by conventional 5 '-3' binding. For example, phosphodiester binding or nuclease-resistant phosphothioester binding may be used.

The control oligonucleotide may bind to the polynucleotide tail of the first oligonucleotide primer through its first region, wherein binding is mediated primarily by hybridization to a complementary base. The length of the first region is 3 to 80 nucleotides, in particular 4 to 40 nucleotides, particularly preferably 6 to 20 nucleotides. The degree of sequence match between the sequence of the first region of the control oligonucleotide and the sequence of the second region of the first oligonucleotide primer may be from 20% to 100%, in particular from 50% to 100%, in particular from 80% to 100%. The binding of the first region of the control oligonucleotide is specific for the second region of the first oligonucleotide primer, in particular, under the reaction conditions.

The sequence of the first region of the control oligonucleotide is in particular chosen such that the number of complementary bases capable of binding complementarily to the second region of the first oligonucleotide primer is 1 to 40, in particular 3 to 20, in particular 6 to 15.

Since the control oligonucleotide does not represent a template for a polymerase, it may comprise nucleotide modifications that do not support the function of the polymerase, which modifications may be base modifications and/or sugar phosphate backbone modifications. The control oligonucleotide in its first region may for example comprise the following nucleotides and/or nucleotide modifications: DNA, RNA, LNA (a "locked nucleic acid" analog having a 2' -4 ' bridge linkage in the sugar residue), UNA ("unlocked nucleic acid", no linkage between the 2' -3 ' atoms of the sugar residue), PNA ("peptide nucleic acid" analog), PTO (phosphorothioate), morpholino analog, 2' -O-alkyl RNA modification (e.g., 2' -OMe, 2' -O propargyl, 2' -O- (2-methoxyethyl), 2' -O-propylamine), 2' -halogenated RNA, 2' -amino RNA, and the like. These nucleotides or nucleotide modifications are linked to each other, for example, by conventional 5 '-3' binding or 5 '-2' binding. For example, phosphodiester binding or nuclease-resistant phosphothioester binding may be used.

The control oligonucleotide nucleotide in its first region may comprise nucleotide and/or nucleotide modifications, wherein the nucleobase is selected from the group consisting of: adenine and its analogs, guanine and its analogs, cytosine and its analogs, uracil and its analogs, thymine and its analogs, inosine or other universal bases (e.g., nitroindole), 2-aminoadenine and its analogs, isocytosine and its analogs, isoguanine and its analogs.

The control oligonucleotide in its first region may comprise a non-nucleotide compound selected from: inserts that can affect the strength of binding between the control oligonucleotide and the first oligonucleotide primer, such as MGB, naphthalene, and the like. The same members may also be used for the second region of the first primer.

The control oligonucleotide in its first region may comprise a non-nucleotide compound, for example a linker such as C3, C6, HEG linker that can link the segments of the first region to each other.

The control oligonucleotide may bind to the first primer region of the first oligonucleotide primer via its second region, wherein binding is substantially mediated by hybridization of complementary bases.

The length of the second region of the control oligonucleotide is adapted to and in particular corresponds to the length of the first region of the first oligonucleotide primer. The length is 3 to 30 nucleotides, especially 5 to 20 nucleotides. The sequence of the second region of the control oligonucleotide is in particular complementary to the first region of the first oligonucleotide primer. The degree of matching of the complementarity is 80% to 100%, in particular 95% to 100%, in particular 100%. The second region of the control oligonucleotide comprises inter alia nucleotide modifications that block polymerase during extension of the first oligonucleotide primer but do not block or substantially block the formation of complementary double strands (e.g. 2' -O-alkyl RNA analogues such as 2' -O-Me, 2' -O- (2-methoxyethyl), 2' -O-propyl, 2' -O-propargyl nucleotide modifications, LNA, PNA or morpholino nucleotide modifications). The individual nucleotide monomers are linked, inter alia, by 5 '-3' linkages, but 5 '-2' linkages between nucleotide monomers may also be used.

The sequence length of the first and second region of the control oligonucleotide and its properties are in particular selected such that the binding of said regions to the first oligonucleotide primer is reversible in at least one reaction step of the method under reaction conditions. That is, the control oligonucleotide and the first oligonucleotide primer can of course bind specifically to each other, but such binding does not result in the formation of a complex of the two members that is permanently stable under the reaction conditions.

Rather, an equilibrium between the components in the form of the binding complex of the control oligonucleotide and the first oligonucleotide primer and in the free form is expected or able to be reached under the reaction conditions, at least in one reaction step. This ensures that at least a portion of the first oligonucleotide primer is in free form under the reaction conditions and is capable of interacting with the template to initiate a primer extension reaction. On the other hand, this ensures that each sequence region of the control oligonucleotide is available for binding to the extension oligonucleotide primer.

By selecting the temperature during the reaction, it is possible to influence the fraction of free, single-stranded components and thus the reaction components: by lowering the temperature, the first oligonucleotide primer can bind to the control oligonucleotide, thereby allowing both participants to bind to the complementary double stranded complex. In this way, the concentration of the components in single stranded form can be reduced. The increase in temperature can cause the two components to dissociate into single stranded form. In the melting temperature range of the complex (control oligonucleotide/first oligonucleotide primer), about 50% of the components are present in single stranded form and about 50% are double stranded complexes. Thus, by using an appropriate temperature, the concentration of the single stranded form in the reaction mixture can be influenced.

In embodiments of the amplification method comprising a temperature change between the reaction steps, the desired reaction conditions may be achieved during each reaction step. For example, a portion of the free form of each component can be affected by using a temperature range around the melting temperature of the control oligonucleotide/first oligonucleotide complex. The temperature used here leads to destabilization of the complex comprising the control oligonucleotide/first oligonucleotide primer, so that during this reaction step the individual complex components become at least transiently single-stranded and are thus able to interact with other reactants. For example, the first sequence region of the control oligonucleotide may be released from the duplex complex by the unextended first primer, thereby interacting with the second sequence region of the extended first oligonucleotide primer and thereby initiating strand displacement. On the other hand, release of the first unextended oligonucleotide primer from the complex comprising the control oligonucleotide/first oligonucleotide primer results in the first primer region becoming single stranded and thus available to interact with the template, so that primer extension can be initiated by the polymerase.

The temperature used must not correspond exactly to the melting temperature of the control oligonucleotide/first oligonucleotide primer complex. It is sufficient that the temperature used in one reaction step is approximately in the range of the melting temperature. For example, the temperature range in one reaction step is around the Tm of the control oligonucleotide/first oligonucleotide primer complex, i.e., Tm + -10 ℃, particularly Tm + -5 ℃, particularly Tm + -3 ℃.

For example, such temperatures can be adjusted during the reaction step that includes sequence-specific strand displacement by the control oligonucleotide.

In an embodiment of the amplification method that does not involve temperature changes between the reaction steps and performs amplification under isothermal conditions, the reaction conditions are maintained throughout the duration of the amplification reaction under which equilibrium between the control oligonucleotide and the first oligonucleotide primer in the form of a complex and the components in free form is possible.

The ratio between the control oligonucleotide in the form of a complex and the first oligonucleotide primer and the components in free form will be subject to the reaction conditions (e.g., temperature and Mg)²⁺Concentration) and the structure and concentration of each component.

In certain embodiments, the sequence lengths of the first and second regions of the control oligonucleotide and their properties are selected such that the ratio between the free control oligonucleotide moiety and the control oligonucleotide moiety in the complex with the first oligonucleotide primer under given reaction conditions (e.g., in the reaction step of strand displacement of the control oligonucleotide) is in the following range: from 1: 100 to 100: 1, in particular from 1: 30 to 30: 1, in particular from 1: 10 to 10: 1. In the complex containing the control oligonucleotide, the ratio between the free first oligonucleotide primer portion and the first oligonucleotide primer portion is from 1: 100 to 100: 1, especially from 1: 30 to 30: 1, especially from 1: 10 to 10: 1.

In certain embodiments, the concentration of the first oligonucleotide primer is higher than the concentration of the control oligonucleotide. Thus, an excess of the first primer is present in the reaction, and the control oligonucleotide must be released from binding to the first primer by selection of an appropriate reaction temperature for its effect. Typically, this is done by raising the temperature until a sufficient concentration of the control oligonucleotide in free form is present.

In certain embodiments, the concentration of the first oligonucleotide primer is lower than the concentration of the control oligonucleotide. Thus, there is an excess of control oligonucleotide and the first oligonucleotide primer must be freed from binding to the control oligonucleotide by selection of the appropriate reaction temperature for its effect. Typically, this is done by raising the temperature until a sufficient concentration of the first oligonucleotide primer in free form is present.

Under isothermal conditions, there is an equilibrium: some portions of the first oligonucleotide primer and the control oligonucleotide bind to each other, while other portions are present in the reaction in single stranded form.

The control oligonucleotide may bind to at least a segment of the specifically synthesized extension product of the first oligonucleotide primer via its third region (FIGS. 13-35). Binding is achieved in particular by complementary base hybridization between the control oligonucleotide and the extension product synthesized by the polymerase.

In order to support the strand displacement reaction, the sequence of the third region should have a high complementarity with the extension product, among others. In certain embodiments, the sequence of the third region is 100% complementary to the extension product.

In particular, the third region binds to a segment of the extension product immediately following the first region of the first oligonucleotide primer. Thus, the segment of the extension product is located in particular in the 5' segment of the total extension product of the first oligonucleotide primer.

In particular, the third region of the control oligonucleotide does not bind over the full length of the extension product of the first oligonucleotide primer. In particular, a segment at the 3' end of the extension product remains unbound. The 3' end segment is necessary for binding of the second oligonucleotide primer.

The length of the third region is adjusted accordingly so that the third region binds to the 5 'anchor segment of the extension product, but not to the 3' anchor segment of the extension product.

The third region of the control oligonucleotide has a full length of 2 to 100 (especially 6 to 60, especially preferably 10 to 40) nucleotides or an equivalent thereof. The control oligonucleotide can bind complementarily to the extension product segment over that length and thereby displace the 5' immobilization segment of the extension product from binding to its complementary template strand.

The length of the 3' immobilization segment of the extension product not bound to the control oligonucleotide ranges, for example, from 5 to 60 nucleotides, particularly from 10 to 40 nucleotides, particularly from 15 to 30 nucleotides.

The 3' immobilization segment of the extension product is not displaced from binding to the template strand by the control oligonucleotide. Likewise, since the third region of the control oligonucleotide is fully bound to the complementary segment of the extension product, the first primer extension product may remain bound to the template strand through its 3' immobilization segment. The binding strength of the complex is in particular chosen such that it can, for example, spontaneously dissociate under the reaction conditions (step e). This can be achieved, for example, because, in the respective reaction step (reaction step e), the melting temperature of the complex of the 3' fixed segment of the extension product of the first oligonucleotide primer and its template strand is approximately in the reaction temperature range or below. If the complex is of low stability in the 3 'segment of the extension product, complete binding of the third region of the control oligonucleotide to the 5' immobilised segment of the extension product will result in rapid dissociation of the first primer extension product from its template strand.

The control oligonucleotide has the appropriate structure to perform its function: under the respective reaction conditions, it is capable of sequence-specifically displacing the extended first oligonucleotide primer from binding to the template strand, whereupon the template strand is converted into single-stranded form and is thus available for further binding to a new first oligonucleotide primer and its target sequence-specific extension by a polymerase.

Under reaction conditions,

regions

1, 2 and 3 of the control oligonucleotide are predominantly in single stranded form to achieve the strand displacement function. Therefore, double-stranded self-complementary structures (e.g., hairpins) in these regions should be avoided if possible, as they would reduce the functionality of the control oligonucleotide.

In the methods of the invention, the control oligonucleotide is not present as a template, and thus the first oligonucleotide primer is not extended by the polymerase when ligated to the control oligonucleotide under reaction conditions.

This is achieved, inter alia, by using nucleotide modifications to prevent the polymerase from replicating the strand. In particular, if the first oligonucleotide primer binds to the control oligonucleotide under the reaction conditions, the 3' end of the first oligonucleotide primer remains unextended.

The blocking/slowing/complexity of the reaction may be between full expression of the property (e.g., 100% blocking under a given reaction condition) and partial expression of the property (e.g., 30% to 90% blocking under a given reaction condition). It is preferred that the nucleotide modifications, coupled alone or in tandem (e.g. as a sequence fragment consisting of modified nucleotides) prevent the first primer from extending more than 70%, in particular more than 90%, more in particular more than 95%, and especially 100%.

Nucleotide modifications may include base modifications and/or sugar phosphate residue modifications. Sugar phosphate modification is preferred because any complementary sequence of the control oligonucleotide can be placed by binding to a conventional nucleobase. Those nucleotides with modifications in the sugar phosphate residues that may respectively block or block polymerase synthesis include, for example: 2' -O-alkyl modifications (e.g., 2' -O-methyl, 2' -O- (2-methoxyethyl), 2' -O-propyl, 2' -O-propargyl nucleotide modifications), 2' -amino-2 ' -deoxynucleotide modifications, 2' -aminoalkyl-2 ' -deoxynucleotide modifications, PNA, morpholino modifications, and the like. Blocking can be achieved by a single nucleotide modification or by coupling only several nucleotide modifications in series, for example as a sequence fragment consisting of modified nucleotides. For example, in a control oligonucleotide, at least 2 (particularly at least 5, particularly at least 10) such nucleotide modifications can be coupled adjacent to each other.

The control oligonucleotide may have a uniform type of nucleotide modification or comprise at least two different types of nucleotide modifications.

The location of this nucleotide modification in the control oligonucleotide is especially intended to prevent polymerase extension of the 3' end of the first oligonucleotide primer that binds to the control oligonucleotide.

In certain embodiments, such nucleotide modifications are located in a second region of the control oligonucleotide. In certain embodiments, such nucleotide modifications are located in a third region of the control oligonucleotide. In certain embodiments, such nucleotide modifications are located in the second and third regions of the control oligonucleotide.

For example, at least 20% (especially at least 50%) of the positions of the second region of the control oligonucleotide consist of such nucleotide modifications.

For example, the third region of the control oligonucleotide consists of at least 20% (especially at least 50%, especially at least 90%) of the positions of such nucleotide modifications. In certain embodiments, the entire third region comprises nucleotide modifications that are templated to a control oligonucleotide to prevent polymerase from extending a primer that binds to the region. In certain embodiments, the entire third and second regions comprise such nucleotide modifications. In certain embodiments, the entire first, second, and third regions comprise such nucleotide modifications. Thus, the control oligonucleotide may consist entirely of such nucleotide modifications. Such modified control oligonucleotides can be used, for example, in multiplex assays in which additional oligonucleotide primers are used. This is to prevent accidental primer extension reactions on one or more control oligonucleotides.

The sequence of these nucleotide modified nucleobases is adapted to the requirements of the sequence in the respective region.

The remainder is, for example, natural nucleotides or nucleotide modifications which do not hinder at all or only slightly the function of the polymerase, e.g. DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides. Additional modifications, such as base modifications (e.g., 2-aminoadenosine, 2-aminopurine, 5-methylcytosine, inosine, 5-nitroindole, 7-deazaadenosine, 7-deazaguanosine, 5-propylcytosine, 5-propyluridine) or non-nucleotide modifications (e.g., dye or MGB modifications), can be used herein to adjust the binding strength of the regions of the control oligonucleotide. The individual nucleotide monomers can be coupled to one another by conventional 5 '-3' binding or by 5 '-2' binding.

The segment of the control oligonucleotide with nucleotide modifications that prevents extension of the 3' end of the first oligonucleotide primer to which the control oligonucleotide is bound by the polymerase is referred to as a "second blocking unit". The length of the segment may be 1-50 nucleotide modifications, in particular 4-30 nucleotides. The segment may be located, for example, in a control oligonucleotide such that the 3' end of the bound first oligonucleotide primer is located in the segment. Thus, the section may span both region 2 and region 3.

In certain embodiments, linker or spacer structures such as C3, C6, HEG linkers, among others, are not used to prevent extension of the 3' end of the first oligonucleotide primer bound to the control oligonucleotide.

In certain embodiments, the control oligonucleotide comprises at least one component of the detection system (e.g., a fluorescent reporter or a fluorescent quencher or a donor fluorophore) in a third region thereof. In certain embodiments, the component is positioned 5' to the control oligonucleotide. In another embodiment, the component is located in an internal sequence segment of the third region. Here, the distance to the 5' end of the control oligonucleotide may be from 2 to 50 nucleotides, in particular from 2 to 20 nucleotides, in particular from 2 to 10 nucleotides. If the oligonucleotide probe and the control oligonucleotide bind to the same first primer extension product at the same time, the two components of the detection system will be in close proximity (e.g., between the fluorescent reporter on the oligonucleotide probe and the donor fluorophore on the control oligonucleotide)

In addition to

regions

1, 2 and 3, the control oligonucleotide may also comprise further sequence segments flanking the above-mentioned regions, for example in the 5 'segment or the 3' segment of the control oligonucleotide. Such sequence members may be used, for example, for other functions, such as interaction with probes, binding to a solid phase, and the like. Such a region does not particularly interfere with the function of regions 1-3. These flanking sequences may be, for example, 1-50 nucleotides in length. Furthermore, the control oligonucleotide may comprise at least one member for immobilization to a solid phase, e.g. a biotin residue. In addition, the control oligonucleotide may comprise at least one member for detection, such as a fluorescent dye.

The newly synthesized sequence is checked for its sequence content by interaction with a control oligonucleotide in the presence of the control oligonucleotide.

In the case of a correct match to the content of a given sequence, a strand displacement of the control oligonucleotide occurs, in which the template strand is displaced by the newly synthesized strand. Thus, the primer binding site is converted to a single stranded state, which is available for a new interaction with the primer for further synthesis. Thus, both systems of primer extension products are in an active state. Thus, the control oligonucleotide has an activating effect on the system.

Strand displacement of the template strand, which affects the newly synthesized strand if there is a lack of match with the given sequence content of the control oligonucleotide. Strand displacement and/or separation has been quantitatively slowed or completely eliminated. Thus, the primer binding site is not converted into a single-stranded state at all or hardly converted into a single-stranded state. Therefore, there are few or no primer binding sites available for new interactions with primers. Thus, the system of both primer extension products is rarely or not at all active.

After each individual synthesis step, the double-strand opening efficacy of the newly synthesized primer extension product has an effect on the yield that can be obtained in subsequent cycles: the fewer free/single-stranded primer binding sites provided to the nucleic acid strand to be amplified at the beginning of the synthesis step, the fewer the number of newly synthesized strands of the nucleic acid strand to be amplified in this step. In other words, the yield of a synthesis cycle is proportional to the number of primer binding sites available for interaction with the corresponding complementary primer. In general, this may implement a control loop.

The control loop corresponds to real-time control (real-time/on-line) of the synthesis segment: sequence control is performed in the reaction mixture while amplification occurs. The sequence control is performed according to a given pattern and the oligonucleotide system (by the strand opening effect of the control oligonucleotide) is able to distinguish between "correct" and "incorrect" states without external intervention. Under the correct conditions, the sequence synthesis continues; in the wrong state, the synthesis is either slowed down or prevented altogether. Differences in the yield of "correct" and "incorrect" sequences after each step will have an effect on the overall amplification comprising a plurality of such steps.

In exponential amplification, the dependence is exponential, so that in a single synthesis cycle, even a slight difference in efficacy due to sequence differences may mean a significant delay in the overall amplification time, or result in no detectable amplification at all within a given time frame.

This real-time control effect on the newly synthesized nucleic acid strand is correlated with the use of control oligonucleotides, and the control oligonucleotides thus function in the case of amplification far beyond the region encompassing the length of the oligonucleotide primer.

Reaction conditions for the Strand Displacement reaction

The second primer extension product is displaced from binding to the first primer extension product by sequence dependent strand displacement of the control oligonucleotide, thereby forming a single step in the amplification. The reaction conditions in said step are adjusted accordingly. The reaction temperature and reaction time are chosen such that the reaction can proceed successfully.

In one embodiment, strand displacement by the control oligonucleotide is performed until the second primer extension product is detached/dissociated from binding with the first primer extension product. This dissociation of the 3' segment of the first primer extension product of the complementary portion of the second primer extension product may be spontaneous during the temperature-dependent/temperature-dependent separation of the two primer extension products. This dissociation has a favourable effect on the kinetics of the amplification reaction and can be influenced by the choice of reaction conditions, such as temperature conditions. Thus, the temperature conditions are selected such that successful strand displacement by complementary binding of the control oligonucleotide favors dissociation of the second primer extension product from the 3' segment of the first primer extension product.

This embodiment does not represent a "classical" PCR, but the thermally induced dissociation of the 3' segment is carried out at a temperature well below the typical chain separation-inducing reaction temperature range (> 90 ℃) of classical PCR.

In another embodiment, the control oligonucleotide undergoes strand displacement until the 3' segment of the second primer extension product (P2.1-Ext) is detached/dissociated from complementary binding to the first primer extension product (P1.1-Ext); wherein the 3' segment of the second primer extension product (P2.1-Ext) comprises at least one segment complementary to the first primer and one segment complementary to the first primer extension product (P1.1-Ext), which segment is formed only during enzymatic synthesis. This results in the formation of a complex (C1.1/P1.1-Ext/P2.1-Ext) (FIG. 2B) comprising a first primer extension product (P1.1-Ext), a second primer extension product (P2.1-Ext) and a control oligonucleotide (C1.1). In such a complex, the 3' segment of the second primer extension product is at least temporarily present in single stranded form, as it can be displaced from its binding to the first primer extension product by the control oligonucleotide. The 3' segment of the first primer extension product (P1.1-Ext) is present in the complex hybridized with the second primer extension product (P2.1-Ext) (FIG. 2B).

Due to the partially open primer binding site of the first oligonucleotide primer (the 3' segment of the second primer extension product), a new oligonucleotide primer can bind to the primer binding site of the single stranded sequence segment (P2.1-Ext) it remains complexed to under reaction conditions, thereby initiating synthesis of a new first primer extension product (P1.2-Ext) by the polymerase. Typically, this reaction proceeds at a reduced rate because the 3' segment of P2.1-Ext is not permanently single-stranded, but competes with the control oligonucleotide and thus alternately assumes a single-stranded and double-stranded state by binding to P1.1-Ext.

This new start of P1.2-Ext synthesis is continued using the second primer extension product as template (P2.1-Ext), which also results in dissociation of the complex (C1.1/P1.1-Ext/P2.1.-Ext) due to polymerase-associated strand displacement. Here, the control oligonucleotide, temperature-dependent double strand destabilization, and polymerase-induced strand displacement act synergistically and complementarily. This results in the 3' segment of the first primer extension product (P1.1-Ext) being dissociated from the complementary portion of the second primer extension product (P2.1-Ext).

This dissociation has a favourable effect on the kinetics of the amplification reaction and can be influenced by the choice of reaction conditions, such as temperature conditions. Polymerase-mediated synthesis-dependent strand displacement is involved in the dissociation of P1.1-Ext and P2.1-Ext to facilitate strand separation.

The temperature in said step ranges, for example, from 15 ℃ to 75 ℃, especially from 30 ℃ to 70 ℃, especially from 50 ℃ to 70 ℃.

A strand displacement reaction can often be successfully initiated at a given length of the first region of the control oligonucleotide and the second region of the first oligonucleotide primer (e.g.3-25 nucleotide monomers, in particular 5-15 nucleotide monomers). If the control oligonucleotide is fully complementary to the respective portion of the first primer extension product, the control oligonucleotide can bind to the first primer extension product (except for the 3' segment of the first primer extension product) and displace the second primer extension product. Thus, the second primer extension product remains attached to the 3' segment of the first primer extension product. The strength of the connection may be affected by temperature. When a critical temperature is reached, the linkage may be broken and both primer extension products may be dissociated. The shorter the sequence of the 3' segment, the less stable the ligation, resulting in a lower temperature for spontaneous dissociation.

For example, spontaneous dissociation can be achieved over a temperature range around the melting temperature. In certain embodiments, the temperature at which the control oligonucleotide undergoes the step of strand displacement is around the melting temperature (Tm + -3 ℃) of a complex comprising a 3' segment of the first primer extension product that is not bound to the control oligonucleotide and the second oligonucleotide primer or the second primer extension product, respectively.

In certain embodiments, the temperature at which the control oligonucleotide undergoes the step of strand displacement is around the melting temperature (Tm + -5 ℃) of the complex comprising the 3' segment of the first primer extension product that is not bound to the control oligonucleotide and the second oligonucleotide primer or the second primer extension product, respectively.

In certain embodiments, the temperature at which the control oligonucleotide undergoes the step of strand displacement is above the melting temperature of a complex comprising a 3' segment of the first primer extension product that is not bound to the control oligonucleotide and the second oligonucleotide primer or the second primer extension product, respectively. Such temperatures are from about Tm +5 ℃ to Tm +20 ℃, more preferably Tm +5 ℃ to Tm +10 ℃. By using higher temperatures, the equilibrium in the reaction step can be shifted towards dissociation. Thereby, the kinetics of the reaction can be favorably influenced. Use of too low a temperature in the strand displacement step by the control oligonucleotide will significantly slow down the amplification.

In certain embodiments, the first primer extension product comprises a 3' segment that is not bound to a control oligonucleotide, the segment having a sequence length of 4-6 (preferably 7-8, especially 1 to about 18) nucleotides. In such embodiments, it is generally possible that spontaneous dissociation has been achieved within a temperature range of 40 ℃ to 65 ℃. Higher temperatures also lead to dissociation.

In certain embodiments, the first primer extension product comprises a 3' segment that is not bound to a control oligonucleotide, the segment having a sequence length of 15 to about 25 nucleotides. In this embodiment, it is generally possible that spontaneous dissociation has been achieved in a temperature range of 50 ℃ to 70 ℃. Higher temperatures also lead to dissociation.

In certain embodiments, the first primer extension product comprises a 3' segment that is not bound to a control oligonucleotide, the segment having a sequence length of 20 to about 40 nucleotides. In this embodiment, it is generally possible that spontaneous dissociation has been achieved in a temperature range of 50 ℃ to 75 ℃. Higher temperatures also lead to dissociation.

The composition of the 3' segment of the first primer extension product and optionally the addition of oligonucleotide modifications (e.g., MGB) or reaction conditions (e.g., TPAC, betaine) that affect the melting temperature will have an effect on the choice of temperature. Accordingly, a corresponding adjustment may be made.

In certain embodiments, all steps of amplification are performed under stringent conditions to prevent or slow the formation of non-specific products/byproducts. Such conditions are, for example, higher temperatures, for example above 50 ℃.

In certain embodiments, each step of strand displacement of the control oligonucleotide is performed at the same temperature as the synthesis of the first and second primer extension products. In another embodiment, each step of strand displacement of the control oligonucleotide is performed at a temperature different from the respective synthesis of the first and second primer extension products. In another embodiment, the synthesis of the first primer extension product and the strand displacement of the control oligonucleotide are performed at the same temperature. In another embodiment, the synthesis of the first primer extension product and the strand displacement of the control oligonucleotide are performed at the same temperature.

The concentration of the control oligonucleotide is 0.01-50. mu. mol/l, preferably 0.1-20. mu. mol/l, preferably 0.1-10. mu. mol/l.

Specific embodiment of the second oligonucleotide primer (primer 2)

An oligonucleotide whose 3' segment is capable of binding to a substantially complementary sequence within a nucleic acid to be amplified or an equivalent sequence thereof and priming a specific second primer extension reaction (FIGS. 14, 27-29, 55, 68-71). Thus, the second oligonucleotide primer is capable of binding to the 3' segment of the first specific primer extension product of the first oligonucleotide primer and priming polymerase dependent synthesis of the second primer extension product. In certain embodiments, each second oligonucleotide primer is specific for one nucleic acid to be amplified.

The second oligonucleotide primer will be replicable upon reverse synthesis and also serves as a template itself during synthesis of the first primer extension product.

The length of the second oligonucleotide primer may be 15 to 100 nucleotides, in particular 20 to 60 nucleotides, particularly preferably 30 to 50 nucleotides. The nucleotide building blocks are linked to one another in particular by the usual 5 '-3' phosphodiester or phosphothioester binding. Such oligonucleotide primers can be chemically synthesized in a desired manner.

In certain embodiments, the second oligonucleotide primer may comprise nucleotide monomers that do not affect, or only slightly affect, polymerase function, such as:

modified nucleotides, 2-amino-dA, 2-thio-dT, or other nucleotide modifications with different base pairing (e.g., a universal base pair such as inosine 5-nitroindole).

In one embodiment, the 3 '-OH end of the region is especially unmodified and has a 3' -OH functional group that is recognized by a polymerase and can be extended according to a template. In another embodiment, the 3 ' segment of the second primer comprises at least one phosphorothioate compound such that degradation of the 3 ' end of the primer due to the 3 ' exonuclease activity of the polymerase does not occur.

The second oligonucleotide primer can be used in several separate steps. First, it functions as a primer in amplification. Thus, a primer extension reaction is performed using the first primer extension product as a template. In certain embodiments, the second oligonucleotide primer can use the starting nucleic acid strand as a template at the beginning of the amplification reaction. In certain embodiments, the second oligonucleotide primer can be used to design/provide an initial nucleic acid strand.

In the amplification range, the second primer uses the first primer extension product as a template, acting as an initiator in the synthesis of the second primer extension product. The 3' segment of the second primer comprises a sequence that binds predominantly complementarily to the extension product of the first primer. Enzymatically extending a second oligonucleotide primer using the first primer extension product as a template, thereby forming a second primer extension product. This synthesis is typically performed in parallel with the displacement of the control oligonucleotide from its binding to the first primer extension product. The displacement is mainly achieved by a polymerase and may be accomplished in part by a second oligonucleotide primer. Such second extension products comprise the target sequence or a segment thereof. During synthesis of the second primer extension product, the sequence of the replicable portion of the first oligonucleotide primer is recognized by the polymerase as a template and the respective complementary sequences are synthesized. The sequence is located in the 3' segment of the second primer extension product and comprises the primer binding site of the first oligonucleotide primer. The synthesis of the second primer extension product proceeds up to the termination position in the first oligonucleotide primer. Immediately after synthesis of the second primer extension product, the product binds to the first primer extension product and forms a double stranded complex. The second primer extension product is sequence-specifically displaced from the complex by the control oligonucleotide. After successful strand displacement by the control oligonucleotide, the second primer extension product can in turn serve as the template itself for synthesis of the first primer extension product.

In addition, the second oligonucleotide primer can function as an initiator in the synthesis of a second primer extension product from the starting nucleic acid strand at the beginning of amplification. In certain embodiments, the sequence of the second primer is fully complementary to the corresponding sequence segment of the starting nucleic acid strand. In certain embodiments, the sequence of the second oligonucleotide primer is only partially complementary to the corresponding sequence segment of the starting nucleic acid strand. However, the differential complementarity does not prevent the second oligonucleotide primer from initiating a primer extension reaction that is primarily sequence-specific. The respective difference in complementarity of the respective positions in the second oligonucleotide primer and the starting nucleic acid strand is in particular in the 5 'segment of the second oligonucleotide primer, so that base pairing and initiation of synthesis which is predominantly complementary in the 3' segment is possible. For example, for the initiation of synthesis, especially the first 4-10 positions in the 3' segment will be fully complementary to the template (the starting nucleic acid strand). The remaining nucleotide positions may deviate from perfect complementarity. Thus, the degree of perfect complementarity in the 5' segment may be 10% to 100%, especially 30% to 100% of the base composition. Depending on the length of the second oligonucleotide primer, these deviations from complete complementarity in the 5' segment are between 1 and 40 (in particular between 1 and 20) nucleotide positions. In certain embodiments, the second oligonucleotide primer binds to the initial nucleic acid strand only in its 3 'segment and not through its 5' segment. Such a 3' segment of the second oligonucleotide primer which is fully complementary to the starting nucleic acid strand is 6-40 nucleotides, in particular 6-30 nucleotides, in particular 6-20 nucleotides in length. The corresponding 5' segment of the second oligonucleotide primer that is not complementary to the starting nucleic acid strand is 5-60 (especially 10-40) nucleotides in length. Thus, the second oligonucleotide primer is capable of priming synthesis of the initial nucleic acid strand. In a subsequent synthesis of the first primer extension product, the sequence segment of the second oligonucleotide primer is replicated by the polymerase, thereby in turn forming a fully complementary primer binding site within the first primer extension product in a subsequent synthesis cycle, to bind the second oligonucleotide primer and be available for use in a subsequent synthesis cycle.

In certain embodiments, a second oligonucleotide primer can be used to prepare the starting nucleic acid strand. Here, such a second oligonucleotide primer is capable of binding predominantly/preferably sequence-specifically to a nucleic acid (e.g. a single stranded genomic DNA or RNA comprising the target sequence or an equivalent thereof) and priming a template-dependent primer extension reaction in the presence of a polymerase. The binding site is selected such that the primer extension product comprises the desired target sequence. Extension of the second oligonucleotide primer generates a strand having a sequence complementary to the template. Such strands may be separated by a template (e.g., by heat or base) and converted to single-stranded form. Such a single-stranded nucleic acid strand can be used as a starting nucleic acid strand at the start of amplification. Such an initial nucleic acid strand comprises in its 5' segment the sequence portion of the second oligonucleotide primer, and further comprises the target sequence or equivalent thereof and the primer binding site of the first oligonucleotide primer. Other steps are described in the section "starting nucleic acid strand".

In one embodiment, the second oligonucleotide primer comprises at least in its 3' segment a sequence portion capable of binding complementary and sequence-specific to a sequence segment of the target sequence and initiating/supporting a successful primer extension reaction by a polymerase. Such sequence segments are 6 to 40 nucleotides, in particular 8 to 30 nucleotides, in particular 10 to 25 nucleotides in length.

In certain embodiments, the second oligonucleotide primer comprises in its 3 'and 5' segments replicable sequence segments that are replicated by a polymerase in the synthesis of the first primer extension product. Thus, all sequence segments of the second primer are replicated by the polymerase. This results in the formation of a primer binding site in the 3' segment of the first primer extension product.

In certain embodiments, the second oligonucleotide primer having a reproducible portion over its length corresponds to a 3' segment of the first primer extension product that is not bound to the control oligonucleotide. In a complex comprising a second oligonucleotide primer and a first primer extension product, the 3' end of such second oligonucleotide primer is flanked by control oligonucleotides that bind to the first primer extension product. Extension of such a primer is accomplished by using the first primer extension product as a template. In extension of such a primer, the control oligonucleotide is displaced from binding to the first primer extension product by polymerase dependent strand displacement.

In certain embodiments, the second oligonucleotide primer having a portion of replicable sequence is shorter than the 3' segment of the first primer extension product that is not bound to the control oligonucleotide. In a complex comprising a second oligonucleotide primer and a first primer extension product, there is a single stranded portion of the first primer extension product between the 3' end of such primer and the control oligonucleotide to which the first primer extension product binds. Extension of such a primer is accomplished by using the first primer extension product as a template. In extension of such a primer, the control oligonucleotide is displaced from binding to the first primer extension product by polymerase dependent strand displacement.

In certain embodiments, the second oligonucleotide primer having a replicable portion is longer than the 3' segment of the first primer extension product not bound to the control oligonucleotide. In the complex of the second oligonucleotide primer and the first primer extension product, the 3 'segment of the second primer and the 5' segment of the control oligonucleotide compete for binding to the first primer extension product. Binding of the 3 'segment of the second primer to the first primer extension product required for priming synthesis is accompanied by simultaneous partial displacement of the 5' segment of the control oligonucleotide.

After synthesis is initiated by the polymerase, this primer is displaced using the first primer extension product as a template. In extension of such a primer, the control oligonucleotide is displaced from binding to the first primer extension product by polymerase dependent strand displacement. The sequence length of the 3 'segment of the second oligonucleotide primer (replacing the 5' segment of the control oligonucleotide) may be in the following range: from 1 to 50 nucleotides, in particular from 3 to 30 nucleotides, in particular from 5 to 20 nucleotides. For example, in certain embodiments, it is advantageous to use a second oligonucleotide primer that is longer than the length of the 3' segment of the first primer extension product. Such embodiments include, for example, a first primer extension product whose 3' segment is not bound to a control oligonucleotide that is 5-40 nucleotides in length (particularly 10-30 nucleotides). Especially for shorter 3' segments, longer second oligonucleotide primers may provide higher sequence specificity at the start of synthesis.

The strength of the binding of the second oligonucleotide primer to its primer binding site depends on the length of the primer. Generally, longer second oligonucleotide primers can be used at higher reaction temperatures.

In particular, the sequences of the first oligonucleotide primer, the second oligonucleotide primer and the control oligonucleotide are adapted to each other to minimize side reactions (e.g., primer dimer formation). To this end, for example, the sequences of the first and second oligonucleotide primers are adapted to each other such that neither oligonucleotide primer is able to initiate an amplification reaction in the absence of a suitable template and/or target sequence and/or starting nucleic acid strand. This can be achieved, for example, because the second oligonucleotide primer does not comprise a primer binding site of the first oligonucleotide primer and the first oligonucleotide primer does not comprise a primer binding site of the second oligonucleotide primer. Furthermore, it should be avoided that the primer sequence comprises an extended self-complementary structure (self-complement).

The synthesis of the second primer extension product is a primer extension reaction and forms a step in the first amplification. The reaction conditions in this step are adjusted accordingly. The reaction temperature and reaction time are chosen such that the reaction can proceed successfully. The respective preferred temperature in this step depends on the polymerase used and the strength of the binding of the respective second oligonucleotide primer to its primer binding site and is, for example, from 15 ℃ to 75 ℃, in particular from 20 ℃ to 65 ℃, in particular from 25 ℃ to 65 ℃. The concentration of the second oligonucleotide primer is 0.01-50. mu. mol/l, especially 0.1-20. mu. mol/l, especially 0.1-10. mu. mol/l.

If more than one specific nucleic acid strand has to be amplified in a batch, in certain embodiments, it is preferred to use respective sequence-specific oligonucleotide primers to amplify the respective corresponding target sequences.

In certain embodiments, the synthesis of the first and second primer extension products is performed at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products is performed at different temperatures. In certain embodiments, the synthesis of the first primer extension product and the strand displacement of the control oligonucleotide are performed at the same temperature. In another embodiment, the synthesis of the second primer extension product and the strand displacement of the control oligonucleotide are performed at different temperatures.

Polymerase:

preferably, a template-dependent polymerase capable of strand displacement is used.

In one embodiment, a large fragment of Bst polymerase or a modification thereof (e.g., Bst 2.0 DNA polymerase) can be used. In addition, Klenow fragment, vent exo minus polymerase, vent exo minus DNA polymerase, large-fragment Bsu DNA polymerase, and large-fragment Bsm DNA polymerase can be used. Vent exo minus polymerase, Deepvent exo minus DNA (from NEB) and PyroPhage polymerase (from Lucigen) are heat-resistant enzymes with strand displacement activity.

In one embodiment, a polymerase that does not show activity at room temperature, a so-called hot start polymerase, is used. Bst 2.0 Hot Start polymerase (from NEB) is an example.

Embodiments of the third oligonucleotide primer

(Components of the second amplification System)

In one embodiment, the third oligonucleotide primer is the same as the first oligonucleotide primer of the first amplification system.

In certain embodiments, the third oligonucleotide primer is different from the first oligonucleotide primer of the first amplification system.

The length of the third oligonucleotide primer may be 15 to 100 nucleotides, particularly 20 to 60 nucleotides, particularly 30 to 50 nucleotides. CG levels range, for example, from 20% to 80%, especially from 30% to 79%. The nucleotide building blocks are linked to one another in particular by the usual 5 '-3' phosphodiester or phosphothioester binding. Such oligonucleotide primers can be chemically synthesized in a desired form.

In certain embodiments, the third oligonucleotide primer may comprise nucleotide monomers that have no or little effect on polymerase function, such as:

Modified nucleotides, nuclease-resistant phosphorothioate compound (PTO) modifications, LNA modifications, 2-amino-dA, 2-thio-dT, or other nucleotide modifications with different base pairing (e.g. universal base pairs such as inosine 5-nitroindole).

In one embodiment, the 3 '-OH terminus of the third oligonucleotide primer is, inter alia, unmodified and has a 3' -OH functional group that is recognized by a polymerase and extended according to the template. In another embodiment, the 3 ' segment of the third oligonucleotide primer comprises at least one phosphorothioate compound such that degradation of the 3 ' end of the primer due to the 3 ' exonuclease activity of the polymerase does not occur.

In certain embodiments, the 3 'end of the third oligonucleotide primer is blocked, e.g., by a 3' phosphate group or a C3 linker. In such embodiments, the 3 ' segment of the third oligonucleotide primer is not activated until the second amplification (e.g., using the 3 ' -5 ' exonuclease activity of the second polymerase).

In particular, the third oligonucleotide primer does not comprise any sequence segment that can complementarily bind to the first segment of the control oligonucleotide.

The third oligonucleotide primers (FIGS. 15-31) can be positioned in a different arrangement relative to the first amplified fragment 1.1 (first amplified product 1.1 comprising the target sequence).

To be able to start the second amplification reaction using the first amplified fragment 1.1 as a template (starting nucleic acid strand 2.1), the third primer and the fourth primer must bind within the predetermined sequence of the first amplified fragment and be extended by a polymerase.

In one embodiment, the third oligonucleotide primer can bind to one strand of the first amplified fragment 1.1. In particular, the third oligonucleotide primer binds to the second primer extension product and primer extension can be initiated using an appropriate polymerase and reaction conditions.

In certain embodiments, such binding of the third oligonucleotide primer preferably occurs in the 3' segment of the second primer extension product.

The third oligonucleotide primer preferably comprises in its 3' segment a sequence segment that can bind complementarily or predominantly complementarily to the second primer extension product under the reaction conditions used, such that the polymerase is able to prime the synthesis of the third primer extension product.

The length of this segment is in particular 6 to 30 nucleotides, in particular 8 to 25 nucleotides, in particular 10 to 20 nucleotides, in particular 10 to 15 nucleotides. In certain embodiments, the segment is fully complementary to the corresponding segment of the second primer extension product. In certain embodiments, the segment comprises at least one mismatch to the primer extension product. In particular, the mismatch is located no closer than position-4 with respect to the 3 'end of the third primer, in particular no closer than-5, in particular no closer than-6, in particular no closer than position-8 with respect to the 3' end of the third oligonucleotide primer. Since the third oligonucleotide primer also binds to the control oligonucleotide via the 3' segment, such a mismatch will impair binding of the segment to the control oligonucleotide. Thus, when selecting the length and number of mismatches, it is contemplated that the 3' segment will bind to the second primer extension product and prime the primer extension reaction, but at the same time be inactivated in that the segment will not irreversibly bind to the control oligonucleotide under the reaction conditions employed.

Thus, the selection of position and length takes into account the interaction of the third oligonucleotide primer with the control and with the second primer extension product.

The location of binding of the segment to the second primer extension product can be selected in different ways (FIGS. 27-31, 57).

For example, the third oligonucleotide primer and the first oligonucleotide primer can bind predominantly complementary to the same sequence segment. The position of the 3 'end of the third oligonucleotide primer corresponds to the position of the 3' end of the first oligonucleotide primer. Thus, the third oligonucleotide primer is capable of binding in a complementary manner at least partially (in its 3' segment) to a portion of the target sequence. Thus, the 3' end of the third primer is located within the second blocking unit of the control oligonucleotide and cannot be extended by polymerase using the control as template (fig. 20).

In certain embodiments, the third oligonucleotide primer binds predominantly complementary to the second primer extension product, wherein its 3 'end is displaced relative to the 3' end of the first oligonucleotide primer. In certain embodiments, the 3 'end of the third oligonucleotide primer is displaced in the 3' direction of the second primer extension product by a distance of at least one nucleotide. Thus, the segment of the second primer extension product to which the third oligonucleotide primer can bind predominantly complementarily is displaced in the 3' direction (FIG. 19).

In certain embodiments, the 3 'end of the third oligonucleotide primer is displaced in the 5' direction of the second primer extension product by a distance of at least one nucleotide. Thus, the segment of the second primer extension product to which the third oligonucleotide primer can bind predominantly complementarily is displaced in the 5' direction (FIG. 21).

In certain embodiments, the binding location of the third oligonucleotide primer is shifted in the 5' direction of the second primer extension product such that the third oligonucleotide primer does not overlap with the binding location of the first oligonucleotide primer of the first amplification system. Thus, the segment of the second primer extension product to which the third oligonucleotide primer can bind predominantly complementarily is shifted in the 5' direction relative to the binding position of the first oligonucleotide primer (FIG. 22).

Thus, the third oligonucleotide primer comprises a sequence segment that can bind complementarily to the control oligonucleotide. The segment of the control oligonucleotide to which the third oligonucleotide primer can complementarily bind is referred to as the fourth segment of the control oligonucleotide. To prevent unwanted primer extension of the third oligonucleotide primer on the control, at least the position of the control oligonucleotide located near the 3' end of the third oligonucleotide primer may be modified. This can be done, for example, in a similar manner as the modification of the second blocking unit. The control segment containing such modifications (preventing extension of the third oligonucleotide primer) is referred to as the fourth blocking unit (fig. 19-22). The position of which is determined by the potential binding position of the third oligonucleotide primer in the control.

The third oligonucleotide primer should be able to be replicated during reverse synthesis and also serve as a template for the synthesis of the fourth primer extension product itself.

In certain embodiments, the third oligonucleotide primer comprises at least one sequence segment in its 3' region that binds predominantly complementary to the first target sequence. This segment is capable of binding predominantly complementary to a second primer extension product (comprising the corresponding segment of the target sequence) wherein the polymerase is capable of performing a primer extension reaction.

In one embodiment, the third oligonucleotide primer comprises in its 5' segment at least one segment that is not complementary to the target sequence. For example, the segment may comprise 1-60 nucleotides and may be used for other purposes, such as barcode encoding, cloning, immobilization, probe binding, and the like. The sequence composition of the 5' segment is adjusted so that it does not interfere with the second amplification.

The third oligonucleotide primer may comprise other modifications, such as fluorescent dyes (e.g., FAM, Cy5, etc.), fluorescence quenchers (e.g., BHQ1, BHQ2, etc.), affinity labels (e.g., biotin, digoxigenin, etc.). In one embodiment, the third oligonucleotide primer may comprise an adaptor (e.g., C3 or HEG adaptor) such that its 5' segment is not replicated by the polymerase.

In certain embodiments, the third oligonucleotide primer is immobilized on a solid phase prior to the second amplification reaction. Thus, primer extension of the third oligonucleotide primer results in immobilization of the entire third primer extension product.

The third oligonucleotide primer may be used in a concentration range of 0.01. mu. mol/l to about 10. mu. mol/l, especially 0.1. mu. mol/l to about 2. mu. mol/l.

Embodiments of the fourth oligonucleotide primer (a component of the second amplification System)

In one embodiment, the fourth oligonucleotide primer is the same as the second oligonucleotide primer of the first amplification system.

In certain embodiments, the fourth oligonucleotide primer is different from the second oligonucleotide primer of the first amplification system.

The length of the fourth oligonucleotide primer may be 15 to 100 nucleotides, particularly 20 to 60 nucleotides, particularly 30 to 50 nucleotides. CG levels range, for example, from 20% to 80%, especially from 30% to 79%. The nucleotide building blocks are linked to one another in particular by the usual 5 '-3' phosphodiester or phosphothioester binding. Such oligonucleotide primers can be chemically synthesized in a desired form.

In certain embodiments, the fourth oligonucleotide primer may comprise nucleotide monomers that have no or little effect on polymerase function, such as:

In one embodiment, the 3 '-OH terminus of the fourth oligonucleotide primer is, inter alia, unmodified and has a 3' -OH functional group that is recognized by a polymerase and extended according to the template. In another embodiment, the 3 ' segment of the fourth oligonucleotide primer comprises at least one phosphorothioate compound such that degradation of the 3 ' end of the primer due to the 3 ' exonuclease activity of the polymerase does not occur.

In certain embodiments, the 3 'end of the fourth oligonucleotide primer is blocked, e.g., by a 3' phosphate group or a C3 linker. In these embodiments, the 3 ' segment of the fourth oligonucleotide primer is not activated until the second amplification (e.g., using the 3 ' -5 ' exonuclease activity of the second polymerase).

In particular, the fourth oligonucleotide primer does not comprise any sequence segment that can complementarily bind to the first segment of the control oligonucleotide.

The fourth oligonucleotide primer (FIGS. 15-31) can be positioned in a different arrangement relative to the first amplified fragment 1.1 (first amplified product 1.1 comprising the target sequence).

In order to be able to start the second amplification reaction using the first amplified fragment 1.1 as a template (the starting nucleic acid strand 21), the third primer and the fourth primer must bind within the predetermined sequence of the first amplified fragment and be extended by a polymerase.

In one embodiment, the fourth oligonucleotide primer can bind to one strand of the first amplified fragment 1.1. Preferably, the fourth oligonucleotide primer binds to the first primer extension product and primer extension can be primed using an appropriate polymerase and reaction conditions.

In certain embodiments, such binding of the fourth oligonucleotide primer preferably occurs in the 3' segment of the first primer extension product.

The fourth oligonucleotide primer preferably comprises in its 3' segment a sequence segment that can bind complementarily or primarily complementarily to the first primer extension product under the reaction conditions used, such that the polymerase is able to prime the synthesis of the fourth primer extension product.

The length of the segment is in particular 6 to 40 nucleotides, in particular 8 to 30 nucleotides, in particular 10 to 25 nucleotides, in particular 10 to 20 nucleotides. In certain embodiments, the segment is fully complementary to the corresponding segment of the first primer extension product. In certain embodiments, the segment comprises at least one mismatch to the first primer extension product. In particular, the mismatch is located no closer than position-4 with respect to the 3 'end of the fourth primer, in particular no closer than-5, in particular no closer than-6, in particular no closer than position-8 with respect to the 3' end of the fourth oligonucleotide primer.

The location of binding of the segment to the first primer extension product can be selected in different ways (FIGS. 23-31, 57).

For example, the fourth oligonucleotide primer can bind to the same sequence segment that is primarily complementary to the second oligonucleotide primer. The position of the 3 'end of the fourth oligonucleotide primer corresponds to the position of the 3' end of the second oligonucleotide primer. Thus, the fourth oligonucleotide primer comprises at least in part (in its 3' segment) a portion of the target sequence.

In certain embodiments, the fourth oligonucleotide primer binds predominantly complementary to the first primer extension product, wherein its 3 'end is displaced relative to the 3' end of the second oligonucleotide primer. In certain embodiments, the 3 'end of the fourth oligonucleotide primer is displaced in the 3' direction of the first primer extension product by a distance of at least one nucleotide. Thus, the segment of the first primer extension product to which the fourth oligonucleotide primer can bind predominantly complementarily is displaced in the 3' direction (FIG. 1).

In certain embodiments, the 3 'end of the fourth oligonucleotide primer is displaced in the 5' direction of the first primer extension product by a distance of at least one nucleotide. Thus, the segment of the first primer extension product to which the fourth oligonucleotide primer can bind predominantly complementarily is displaced in the 5' direction.

The fourth oligonucleotide primer in particular does not comprise any sequence segment which can bind complementarily to the control oligonucleotide.

The fourth oligonucleotide primer should be replicable during reverse synthesis and also serve as a template for the extension product of the third primer during synthesis.

In certain embodiments, the fourth oligonucleotide primer comprises in its 3' segment at least one sequence segment that comprises part of the first target sequence and thus can bind to a strand that is complementary to the target sequence. The segment is capable of binding predominantly complementary to a first primer extension product (comprising the corresponding complementary segment of the target sequence) wherein a polymerase is capable of performing a primer extension reaction.

In certain embodiments, the fourth oligonucleotide primer comprises at least one sequence segment in its 5' segment that does not comprise a sequence segment of the first target sequence. For example, the segment may comprise 1-60 nucleotides and may be used for other purposes, such as "barcode coding", cloning, immobilization, probe binding, and the like. The sequence composition of the 5' segment is adjusted so that it does not interfere with the second amplification.

The fourth oligonucleotide primer may comprise other modifications, such as fluorescent dyes (e.g., FAM, Cy5, etc.), fluorescence quenchers (e.g., BHQ1, BHQ2, etc.), affinity labels (e.g., biotin, digoxigenin, etc.). In one embodiment, the fourth oligonucleotide primer may comprise an adaptor (e.g., C3 or HEG adaptor) such that its 5' segment remains non-replicated by the polymerase.

In certain embodiments, the fourth oligonucleotide primer is immobilized on a solid phase prior to the second amplification reaction. Thus, primer extension of this fourth oligonucleotide primer results in immobilization of the entire fourth primer extension product.

The concentration of the fourth oligonucleotide primer may range from 0.01. mu. mol/l to about 10. mu. mol/l, in particular from 0.1. mu. mol/l to about 2. mu. mol/l.

Polymerase of the second amplification system:

a number of polymerases are known to perform PCR.

In certain embodiments, a thermostable template-dependent DNA polymerase having 5 '-3' exonuclease activity is used.

In certain embodiments, Taq polymerase and/or preparations and/or modifications thereof (e.g., Ampli-Taq) are used to perform the second amplification.

In certain embodiments, a thermostable template-dependent DNA polymerase having strand displacement activity is used. For example Vent Exo minus (from NEB), PyroPhage polymerase (from Lucigene), SD polymerase (from Bioron).

In certain embodiments, a thermostable template-dependent DNA polymerase with 3 '-5' proofreading activity is used. For example Vent exo plus, Deep Vent exo plus (from NEB), Pfu polymerase (Jena Biosciences), Phusion polymerase (NEB).

In certain embodiments, a thermostable template-dependent DNA polymerase is used, which is conjugated to another protein, e.g., to increase the processing activity of the polymerase. Such as Phusion polymerase (NEB).

Oligonucleotide primers comprising additional sequence segments:

the above-mentioned structures of the first primer and the second primer can be regarded as a so-called "basic structure of the primer" and "minimum structure of the primer", respectively.

Such a basic structure of an oligonucleotide with primer function (e.g. a first oligonucleotide primer, a second oligonucleotide primer, (optionally) a third oligonucleotide primer, (optionally) a fourth oligonucleotide primer, etc.) comprises sequence segments, e.g. a first and a second segment of the first primer, which facilitate an amplification procedure.

This basic structure of the oligonucleotide primer can be extended by additional sequence segments. Such additional sequence segments include structures that are not necessary for performing the amplification procedure but may be useful for other tasks.

Such additional sequence segments may optionally be introduced into the oligonucleotide primer and used for further functions or reactions. Thus, primer extension products synthesized by the polymerase (e.g., starting from the first and/or second primer) can be ligated to such sequence segments. This enables the integration of such additional sequence segments and primer extension products into the molecular structure. In certain embodiments, such integration may be advantageous. The skilled worker knows a multiplicity of applications of oligonucleotide primer sequences with additional sequence segments.

Several functions are known to the skilled worker, which are supported by additional sequence segments of the oligonucleotide primers.

For example, the introduction of additional structures can be used as a means of mediating intermolecular or intramolecular binding. Several embodiments of such a structure are known to the skilled person. For example, probes can be designed based on the principle of such intramolecular binding (e.g., in Scorpion primers). For example, the sequence segments may still be available for binding to other oligonucleotides. Sequence-specific intermolecular binding can be achieved by using stringent conditions. This interaction can be used, for example, to bind the amplification product to a solid phase by complementary binding to the immobilized oligonucleotide.

Another example is the introduction of so-called adaptor sequences and/or the use of other segments for unique coding or sequence specific labeling of the primers and the resulting primer extension products (so-called primer barcode coding). For example, this is used for NGS library construction (

Et al, Nucleic Acids Res.2016Jun 20; 44(11): e105) in that respect Such a label can be used for later sequence assignment in sequence analysis of the primer extension product.

Another embodiment provides the use of additional sequence segments to introduce specific sequences that bind certain proteins (e.g., restriction endonucleases, etc.).

Another embodiment uses other segments to introduce inter-arm sequences not for binding specific interaction partners but for increasing the distance between adjacent sequences.

Such additional sequences may be located on the replicative portion of the primer or may be added to the non-replicative portion of the oligonucleotide primer. There are several factors that play a role in determining whether to replicate a sequence segment. For example, the positioning of the sequence segments in the respective oligonucleotides, the nucleotide modifications used (e.g., C3, HEG, 2' -OMe, etc.), can determine whether the sequence segments are used as templates in a process step.

In one embodiment, an additional sequence segment is introduced into the replicable region of the primer, e.g., at a segment 5' of the replicable portion of the second primer, such that, e.g., when the primer sequence is read during synthesis of the target sequence, the polymerase also reads the additional sequence segment. Such additional sequence segments are 3-50 nucleotides in length. The composition of these sequence segments allows synthesis by a polymerase in this type of embodiment, and thus the segments serve as templates for polymerase-dependent synthesis. In such a segment, for example, natural nucleotides such as dA, dG, dC, dT are used.

In another embodiment, the additional sequence segment may be located, for example, at the 5' end of an oligonucleotide primer that is not replicated during synthesis of the specific amplified fragment comprising the target sequence. This can be achieved, for example, by locating one or more modifications or chemical groups (e.g., HEG, C3, a region comprising 4-10 nucleotides with 2' -OMe modifications, etc.) that can prevent the polymerase from synthesizing a complementary strand. Such a modification may, for example, be located at the 5' end of the replicable portion of the second primer and prevent the synthesis from continuing. For example, a HEG group can be introduced at the 5' end of the replicable segment of the second primer, and then additional sequence segments can be introduced thereafter.

In addition, an additional sequence segment can be positioned 5' to the second region of the first primer. This positioning of the additional sequence segment prevents the synthesis of complementary strands during conventional synthesis of specific amplification products comprising the target sequence.

Such additional sequence segments are 3-50 nucleotides in length. The base composition may, for example, comprise a natural nucleobase (A, G, C, T, U, inosine) or a modification at different positions of a nucleotide (e.g., at a base such as 2-aminoadenine, isoguanine, isocytosine, 5-propargyluridine, 5-propargylcytosine, or on a sugar phosphate backbone such as LNA, 2'-OMe, 2' -halogen, etc.). In one embodiment, the first primer and the additional sequence segment are combined to form an oligonucleotide primer. In one embodiment, the second primer and the additional sequence segment are combined to form an oligonucleotide.

Such additional sequence segments are designed in the oligonucleotide in a manner that does not prevent amplification of the target sequence. This is achieved, for example, by avoiding or reducing inhibitory interactions with the structure of the primers or controls necessary for the procedure. In certain embodiments, the additional structure may form a complementary double stranded segment with other primer regions under selected reaction conditions. However, especially such double stranded segments do not prevent specific amplification of the target sequence. In certain embodiments, such additional sequence segment does not interact with or bind to the first or second primer region of the first primer. In certain embodiments, these additional segments do not interact with the control oligonucleotide. In certain embodiments, these additional sequence segments do not interact with other primers in the reaction. In certain embodiments, such additional sequence segments do not interact with P1.1-Ext or P2.1-Ext or other amplified fragments comprising the target sequence. In certain embodiments, such additional sequence segments do not form stable double-stranded segments with the first or second region of the first primer under reaction conditions, which completely prevents the first or second region from functioning.

In certain embodiments, such additional segment does not interact or bind with the second primer. In certain embodiments, such additional sequence segments do not interact with, inter alia, the 3' segment of the second primer.

In certain embodiments, the first primer comprises an additional sequence segment of the first primer at the 5' end of its second region (additional sequence variant P1). The segment optionally comprises a sequence of 10-50 nucleotides that does not interfere with the amplification procedure of the target sequence (e.g., does not form secondary structures with the primers). Furthermore, the segment optionally comprises a sequence of about 5-15 nucleotides of the replicable first segment of the first primer. Additional sequence variant P1 contains a natural nucleotide as a monomer (A, C, G, T) and can potentially be used as a template for a polymerase.

In certain embodiments, the second primer comprises an additional segment of the second primer at its 5' end (additional sequence variant P2). Optionally, the segment comprises a sequence of 10-50 nucleotides that does not interfere with the amplification procedure of the target sequence (e.g., does not form secondary structures with the primers). In addition, the segment optionally comprises a sequence of about 5-15 nucleotides of the replicable region of the second primer. Additional sequence variant P2 contains a natural nucleotide as a monomer (A, C, G, T) and can potentially be used as a template for a polymerase.

It has been observed that such an oligonucleotide comprising the first primer and the additional sequence variant P1 or an oligonucleotide comprising the second primer and the additional sequence variant P2 is less susceptible to side reactions than an oligonucleotide comprising the first primer alone or the second primer alone. In certain embodiments, for example, the generation and/or amplification of non-specific primer dimer structures may be delayed. In such side reactions, the formation of by-products which do not comprise the target sequence can thus optionally be reduced or delayed. This may, for example, reduce or delay premature consumption of the primers. For example, it is advantageous to use such oligonucleotides if primer dimers comprising the first primer (PD P1) or primer dimers comprising the second primer (PD P2) are generated by side reactions and lead to premature consumption of the primers in the reaction. When a non-specific reaction is observed in the amplification reaction, in certain embodiments it is advantageous to use a primer with such an additional structure (a first primer with additional sequence variant P1 and/or a second primer with additional sequence variant P2). Several factors contribute to such side effects, including:

longer reaction times (e.g., 1-100 h);

Use of higher concentrations of primers (e.g., 1. mu. mol/l to 1 mmol/l);

use of higher concentrations of polymerase (e.g., concentrations above 10 units/10 μ l);

multiplex reactions (e.g., amplification of more than 10 different target sequences in one reaction method); and

high concentrations of complex nucleic acid strands in the reaction mixture (e.g., concentrations in excess of 1. mu.g of hgDNA per 50. mu.l).

Each factor, alone or in combination with other factors, may contribute to side reactions.

In general, side reactions (e.g., non-specific primer-dimer formation) can be prevented by optimizing reaction components and/or reaction conditions, e.g., by reducing the concentration of individual components, shortening reaction times, designing primer sequences, selecting more stringent reaction conditions. The additional sequence section listed in an advantageous embodiment (oligonucleotide comprising the first primer and the additional sequence variant P1 or oligonucleotide comprising the second primer and the additional sequence variant P2) represents another possibility to delay certain side reactions.

In the examples, oligonucleotide primers with additional sequence segments are shown. In such embodiments, additional sequence segments are used that do not participate in the specific amplification of the target sequence and that help delay side reactions. Thus, an oligonucleotide comprising the first primer and the additional sequence variant P1 and an oligonucleotide comprising the second primer and the additional sequence variant P2 were used.

One skilled in the art will recognize that oligonucleotides may comprise additional sequence segments (e.g., additional sequence variant P1 or additional sequence variant P2) in addition to the primer structure (which structure may also be referred to as the "basic structure" or "minimal structure") that facilitates target sequence-specific amplification. Such additional sequence segments may provide a variety of other advantageous or useful properties or functions.

Certain embodiments of the detection System

The detection system comprises at least one fluorescent reporter (reporter) and at least one oligonucleotide probe capable of hybridizing to at least one primer extension product formed during amplification. In addition, the detection system can include a fluorescence quencher (referred to as a quencher) that is matched to the fluorescent reporter such that the quencher is capable of reducing the fluorescent signal or reducing the intensity of the signal of the fluorescent reporter under certain circumstances. In addition, the detection system may include a donor fluorophore matched to the fluorescent reporter, such that the donor fluorophore is capable of enabling the fluorescent signal of the fluorescent reporter in some cases by energy transfer. In addition, the detection system can include a control oligonucleotide, wherein the control oligonucleotide comprises a fluorescent reporter or donor fluorophore or fluorescent quencher.

The arrangement of the individual members (fluorescence reporter, fluorescence quencher, donor fluorophore) on the oligonucleotide probe and/or control oligonucleotide should result in a change in the fluorescent signal of the fluorescence reporter in the presence of the primer extension product, thereby forming respective complementary complexes.

The skilled artisan is aware of the large number of reporter systems that have been developed in the field of real-time PCR over the last 20 years. These include probes with self-complementary segments, such as molecular beacons, exonuclease degradation based probes (so-called Taqman probes, which specifically cleave using the 5 '-3' nuclease activity of Taq polymerase), probe systems with two oligonucleotides labeled with a FRET pair and capable of binding to one strand to generate a signal, primer based probes (such as LUX primer based probes which change signal intensity when self-complementary structures are unfolded in reverse synthesis), "Scorpion primers" (whose segments are complementary to the strand synthesized by the primer), etc. Some probes may be used as end point measurements (e.g., molecular beacons) during signal acquisition. Some probes are used to detect the kinetics of PCR, such as 5 '-3' nuclease probes. Many different arrangements of probes and fluorescence reporters, fluorescence quenchers and donor fluorophores are known in the literature. A number of fluorescence reporter quenchers and fluorescence reporter-donor fluorophores (also known as donor-acceptor pairs or FRET pairs) are also known ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed. Didenko, 2006, for example Chapter 1 and 2: Product Description "Fluorescent Molecular Probes", published by Gene Link Inc.). Most probes have been developed for PCR-based methods, using specific arrangements of primers, probes, and polymerase used (e.g., with 3' -exonuclease (FEN)).

Typically, such probes may bind more or less specifically to the DNA fragments generated during amplification, wherein the signal is altered only due to this binding or also to other events (e.g. nuclease degradation or binding of another oligonucleotide to an adjacent segment). This change can be detected and quantified.

Since PCR is used in the second amplification, such known techniques and probes can also be used. The sequence of the oligonucleotide probe is adapted to the amplification product generated during the reaction.

The choice of probe also depends, for example, on whether a certain variant of the target sequence has to be detected by a target sequence-specific probe, or whether only the consumption of primers (as a marker for amplification) is recorded. Thus, different probe formats may be selected depending on the task.

Accordingly, details of such modifications for some embodiments will be discussed below.

In multiphase form

The components of both amplification systems are separated at the beginning of the first amplification and therefore the oligonucleotide probes or PCR primers do not affect the first amplification reaction. Conversely, after the first amplification is completed, an aliquot is transferred from the first amplification to the second amplification. The resulting dilution of the reaction components of the first amplification system facilitates the use of known probe structures for PCR reactions. For example, in the presence of a control oligonucleotide at a concentration of less than 100nmol/l (in particular less than 10nmol/l, in particular less than 1nmol/l, in particular less than 0.01nmol/l), the binding of the probe to the complementary segment of the formed primer extension fragment is hardly affected under PCR conditions, so probe-based detection methods known to the skilled person can be used.

The oligonucleotide probe can bind to one of the formed primer extension products (e.g., the third and fourth primer extension products), and this binding event can be detected by various techniques (e.g., by using a Taqman probe and a Taq polymerase or by binding a "molecular beacon" to a complementary segment of the respective primer extension product).

In homogeneous form

In a homogeneous format, the components of both amplification systems are in the same batch at the beginning of the first amplification and can therefore interact with other components and intervene in certain processes. In particular, the presence of an effective concentration of a control oligonucleotide (e.g., an effective concentration of 0.01-10. mu. mol/l) and an oligonucleotide probe (e.g., an effective concentration of 0.01-10. mu. mol/l) can result in interaction between these components, thereby affecting the substeps or results of these steps. Therefore, the following aspects must be considered:

the presence of the control oligonucleotide will affect the binding of the oligonucleotide probe to the formed primer extension product. This is the case, for example, if the probe and control comprise a significant overlap in the segment complementary to the primer extension product (e.g., the third segment of the control and oligonucleotide probe can partially hybridize to the same segment of the first and/or third primer extension product). It is therefore advantageous to limit the extent of this overlap. For example, the length of the segments in the control and probe can be adjusted to minimize overlap. Preferably, the sequence segments do not overlap if they bind complementarily to the formed primer extension product.

The oligonucleotide probe can bind to the control oligonucleotide if necessary and affect it when strand displacement occurs. This can occur, for example, if both the control oligonucleotide and the oligonucleotide probe comprise a segment, thereby resulting in the formation of a duplex complex between the control and the probe. It is therefore advantageous to limit the extent of such complementary segments. For example, the length of the segments in the control and probe can be adjusted so that they exhibit as little complementarity as possible. Preferably, the control and probe do not comprise complementary sequence segments.

For these reasons, it is advantageous, for example, to design the oligonucleotide probe in a homogeneous format such that it preferentially hybridizes to the 3' segment of the first or third primer extension product. These segments did not hybridize to the control oligonucleotide. Another important aspect of the invention is that a polymerase change may occur when switching from a first amplification to a second amplification: the first polymerase may be inactivated and the second polymerase may be activated. For example, this allows the use of 5 '-3' nuclease sensitive probes ("Taqman probes") during the second amplification. For example, in the first amplification, the Bst polymerase large fragment is preferred. This fragment did not cleave the Taqman probe. At the beginning of the second amplification, the Bst polymerase large fragment is inactivated and Taq polymerase (e.g.used as a hot start polymerase) is activated. This allows the use of 5 '-3' nuclease sensitive probes.

Such changes can result in an increase or decrease in the signal intensity of the fluorescent reporter, depending on the conformation selected between the fluorescent reporter and/or donor fluorophore and/or fluorescence quencher. Such changes can be detected by known suitable methods (e.g. in real-time PCR devices such as StepOne-PCR or Lightcycler or Rotorgene, see the instructions provided by the manufacturer) during or after the expiration reaction. Detection of the change in signal leads to conclusions about the course of the reaction: such as signal amplitude, kinetics, time or concentration dependence of the signal appearance. If multiple target sequences are used, the multiplex assay can be correspondingly encoded by different spectral characteristics, so that multiple reactions can be observed in parallel.

The present invention describes various embodiments of oligonucleotide probes that are particularly advantageous for detecting the progress of a reaction.

The oligonucleotide probe is an oligonucleotide preferably composed of DNA nucleotides. In an embodiment other than DNA, the oligonucleotide may be composed of other nucleotide monomers, such as RNA or nucleotide modifications (e.g., with sugar phosphate backbone modifications such as PTO or LNA or 2' -O-Me). In another embodiment, the oligonucleotide sample is a mixed polymer comprising DNA and non-DNA members (e.g., RNA, PTO LNA). The oligonucleotide probe may comprise further oligonucleotide modifications, such as a linker or spacer (e.g. C3, HEG, no base monomer, e.g. THF modification).

The base composition of the oligonucleotide probe preferably comprises a base that binds complementarily to the natural nucleobase (A, C, T, G) under hybridization conditions. In another embodiment, the probe further comprises a modification, for example, comprising a universal base (e.g., inosine, 5-nitroindole). The probe may comprise other modifications that affect the binding behavior of the oligonucleotide, such as MGB modifications.

The length of the oligonucleotide probe is preferably 8 to 80 nucleotides, particularly 12 to 50 nucleotides, particularly 12 to 35 nucleotides. The oligonucleotide probe typically comprises a segment that can complementarily bind to the at least one product formed. In one embodiment, the oligonucleotide probe comprises at least one other segment that is incapable of complementarily binding to one of the formed primer extension products.

The probes may be arranged differently with respect to the other components of the amplification system. Thus, certain embodiments are preferred:

in one embodiment, the oligonucleotide probe comprises a sequence segment that is substantially complementary to at least one of the formed primer extension products (P1.1-Ext, P2.1-Ext, P3.1-Ext, P4.1-Ext), which sequence segment can hybridize under suitable conditions to at least one of the formed primer extension products (hybridization conditions). In another embodiment, the sequence segment is complementary to the first and/or third primer extension products. In another embodiment, the sequence segment is complementary to the first and/or third primer extension products, wherein the oligonucleotide probe can complementarily bind to the 3' segment of each primer extension product that is not complementarily bound to the control oligonucleotide. In another embodiment, the sequence segment is complementary to the second and, or fourth primer extension products. In another embodiment, said sequence segment of the oligonucleotide probe is 10-50 nucleotides, in particular 15-40 nucleotides, in particular 15-30 nucleotides in length. In another embodiment, the sequence segment of the oligonucleotide probe does not comprise a region of sequence that is substantially complementary to a control oligonucleotide. In another embodiment, said segment of the oligonucleotide probe sequence comprises a region of the sequence which is substantially complementary to a control oligonucleotide, wherein said segment is less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides in length.

In another embodiment, said sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially complementary to one of the oligonucleotide primers. In another embodiment, said segment of the oligonucleotide probe comprises a region of sequence substantially complementary to one of the oligonucleotide primers, wherein said segment has a length of less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides.

In another embodiment, the sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially identical to the sequence of the third region of the control oligonucleotide. In another embodiment, said region of the oligonucleotide probe sequence comprises a sequence region which is substantially identical to the sequence of the third region of the control oligonucleotide, wherein said segment is less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides in length.

In one embodiment, the control oligonucleotide comprises one of the following components (fluorescence reporter and/or fluorescence quencher and/or donor fluorophore), wherein at least one of these components is located in the third region of the control oligonucleotide.

In one embodiment, the oligonucleotide probe can be at least partially cleaved by a 5 '-3' nuclease. In one embodiment, the control oligonucleotide is cleavable at least in its 5 ' segment (third region of the control) by a 5 ' -3 ' nuclease.

In another embodiment, the oligonucleotide probe comprises a sequence segment that is substantially complementary to a segment comprised by the target sequence or one of its amplification products, wherein said segment has a length of 5 to 50 nucleotides, in particular 10 to 40 nucleotides, in particular 15 to 30 nucleotides.

In another embodiment, the oligonucleotide probe does not comprise a sequence segment that is substantially complementary to the target sequence or its complementary strand. For example, it may be

In one embodiment, the 3' end of the oligonucleotide probe is blocked by a modification (e.g., a fluorophore or quencher or donor) or another modification (e.g., a phosphate residue or a C3 linker or a dideoxynucleotide modification) that prevents the polymerase from using the oligonucleotide as a primer.

In another embodiment, the 3' end of the oligonucleotide probe is free and can bind complementarily to the first primer extension product and begin synthesis by the polymerase. This allows the oligonucleotide probe to be extended like a primer, thereby forming a probe extension product.

In one embodiment, the sequence composition of the probe corresponds to the sequence composition of the primer.

Depending on the embodiment of the oligonucleotide probe, the location of the fluorescent reporter, fluorescent quencher, or donor fluorophore may vary. The member may be covalently bound to one of the ends or to an intermediate region of the oligonucleotide probe. Many such modifications are known to the skilled person, for example coupling of FAM reporter agents to the 3 'or 5' end of the nucleotides, or coupling of the middle or internal sequence segments of the probe using dT-BHQ1 or dT-FAM or dT-TMR modifications. Such modified oligonucleotide probes can be obtained from commercial vendors (e.g., Sigma-Aldrich, Eurofins, IDT, Eurogentec, Thermofeisher Scientific).

For example, the oligonucleotide probe comprises at least one sequence segment that can bind substantially complementarily to a third or fourth primer extension product formed during amplification under the appropriate reaction conditions of the detection step. In this process, the oligonucleotide probe binds, for example, complementarily to the single-stranded 3 'segment of the synthesized third primer extension product or the synthesized 5' segment of the fourth primer extension product. Such probes do not contain any sequence segment that is identical to or complementary to a control. Thus, a complex comprising the primer extension product and the oligonucleotide probe is generated. The binding of the oligonucleotide probe and the control oligonucleotide to the synthesized third primer extension product is preferably sequence specific. The length of the sequence segment which is complementary to the 3' segment of the first primer extension product ranges, for example, from 8 to 80 nucleotides, particularly from 12 to 50 nucleotides, particularly from 12 to 35 nucleotides, particularly from 15 to 25 nucleotides.

A detection system comprising at least one fluorescent reporter bound to an oligonucleotide probe or a control oligonucleotide can alter the signal generation or signal intensity of the fluorescent reporter based on the binding of the oligonucleotide probe to a complementary sequence. Depending on the implementation of the detection system, this change may result in the generation or increase or decrease of a signal.

During amplification, the third and fourth primer extension products are separated such that the 3' segment of the third primer extension product and the corresponding fragment of the fourth primer extension product are present in single stranded form. The oligonucleotide probe may bind to the 3 'segment of the third primer extension product or the 5' segment of the fourth primer extension product during the reaction or only after the reaction is complete.

This binding is sequence specific in nature, but deviations from complete complementarity can also be tolerated.

The binding of the oligonucleotide probe preferably does not prevent amplification. The concentration of the probe and its length are adjusted so that a sufficient number of primers can prime the synthesis of primer extension products.

As the reaction proceeds, a sufficient number of primer extension products are formed so that the oligonucleotide probes also bind sufficiently to cause a detectable signal change.

In one embodiment, a suitable detection system comprising at least one fluorescent reporter further comprises at least one fluorescence quencher matched to the fluorescent reporter. The fluorescence quencher (also referred to as a quencher) can therefore function as a contact quencher or a FRET quencher. Suitable examples are known in the literature ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed. Didenko, 2006, for example Chapter 1 and 2: Product Description "Fluorescent Molecular Probes", published by Gene Link Inc.). For example, the fluorescent reporter may be Fluorescein (FAM) and a suitable fluorescence quencher may be BHQ-1 or BHQ-2 or TAMRA. In one embodiment, the guanosine nucleobase may act as a quencher (e.g., in combination with FAM as a reporter). When the fluorescent reporter is excited with the appropriate wavelength of light, a fluorescent signal is emitted in the absence of the quencher. However, if the fluorescent reporter and the appropriate quencher are in close proximity, the intensity of the fluorescent reporter will decrease. As the distance/separation of the fluorescent reporter and quencher increases, the signal intensity increases.

In one embodiment, another suitable detection system comprising at least one fluorescent reporter further comprises at least one donor fluorophore (also referred to as donor) matched to the fluorescent reporter, thereby forming a FRET pair. Suitable examples are known in the literature ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed. Didenko, 2006, for example Chapter 1 and 2: Product Description "Fluorescent Molecular Probes", published by Gene Link Inc.). A FRET pair typically includes a donor and an acceptor (typically served by a reporter). For example, the fluorescent reporter may be Tetramethylrhodamine (TAMRA), a suitable partner of the FRET pair may be FAM (donor), and another example is FAM (donor) and Cy3 (as acceptor or reporter). In the case of spatial proximity, excitation of a donor (e.g. FAM) causes energy transfer to a reporter (TAMRA or Cy3), which is therefore itself capable of emitting energy in the form of electromagnetic radiation (a detectable optical or fluorescent signal). Such a fluorescent signal of the reporter can be detected by suitable means. As the spatial distance between the reporter and donor fluorophore increases, the signal gradually decreases and is generally no longer detectable at distances greater than 50 nucleotides (measured as 50 nucleotides of the duplex).

By appropriately positioning the members of the detection system on the oligonucleotide probe and/or control oligonucleotide, the binding events of these components to the first primer extension product can be detected by signal increase or decrease.

Such detection may be performed during amplification (e.g., on-line detection), at appropriate time intervals, or only at the end of the reaction.

The fluorescent signal is obtained in one detection step. In the detection step of the method, it should be checked whether the oligonucleotide probe binds complementarily to the 3' segment of the first primer extension product (P1-Ext). Thus, in the detection step, the reaction temperature is adjusted so that the probe is capable of binding substantially complementarily to the 3' segment of the first primer extension product. The temperature may correspond to one of the temperatures during amplification or may represent a step separate from the amplification temperature step.

During this step, the reaction can be excited by a light source using light of a suitable wavelength. The wavelength is adapted to the absorption spectrum of the fluorescent reporter or donor fluorophore, depending on the design of the detection system. If the oligonucleotide probe can bind to the 3' end of the synthesized first primer extension product, a signal from the fluorescent reporter can be expected. The signal has a characteristic spectrum of wavelengths and can be detected and quantified by a suitable detection system. Current real-time PCR equipment typically includes a light source for excitation and a detection system for detecting reporter fluorescence, as well as a temperature-controlled container for the reaction batch. Real-time PCR equipment (e.g., StepOne or LightCycler or RotorGene) is a good example.

This detection can be used to quantify the presence of one or more starting nucleic acid strands in the reaction. In addition, the detection can be used to detect the availability of the starting nucleic acid strand at the beginning of the reaction. Furthermore, the detection system may be used in conjunction with internal amplification control.

In another embodiment, two or more nucleic acid strands may be specifically amplified in an amplification batch. For example, a combination of a specific first primer and/or a specific control oligonucleotide and/or a specific second primer may be used. For example, the target sequence and internal amplification controls are amplified in a batch. It is therefore advantageous to carry out the detection of the nucleic acid strands separately and independently during the amplification of each nucleic acid strand.

In one embodiment, a specific detection system is used in each case, so that the amplification of the nucleic acid strand is monitored in each case by means of the specific detection system. Specific signals from the fluorescent reporter can be detected simultaneously. Preferably, the spectral characteristics of the fluorescent reporter differ to the extent that it can be accomplished by detecting the corresponding fluorescent signal at a characteristic wavelength. For example, two or three or four fluorescent reporters may be used. The respective specific wavelength of the fluorescence signal measured at the maximum intensity (fluorescence peak) of the fluorescence spectrum is preferably greater than about 10nm, in particular greater than about 20nm, in particular greater than about 30 nm. Such combinations are known. For example, combinations comprising FAM and/or Cy3 and/or Cy5 or FAM and/or HEX and/or ROX are suitable. The respective quencher is preferably selected for each fluorescent reporter individually such that the signal can be efficiently attenuated by the quencher. For example, a combination of FAM/BHQ-1 and HEX/BHQ-2 or FAM/BHQ-1 and Cy5/BHQ-2 is used.

In another embodiment, a detection system can be used to monitor the amplification of a set of different nucleic acid strands. The group may comprise two or more nucleic acid strands to be amplified. The composition of the detection system is adjusted accordingly. In one embodiment, such a set of different nucleic acid strands to be amplified comprises, for example, at least one uniform sequence segment specific for an oligonucleotide probe for complementary binding to the oligonucleotide probe under the reaction conditions of the detecting step. In another embodiment, such a set of different nucleic acid strands to be amplified for example comprises at least one sequence segment that binds predominantly complementarily to an oligonucleotide probe, wherein the sequence composition of the sequence segments is different within the set. These differences may comprise 1-10 nucleotides, preferably 1-3 nucleotides.

Other aspects and embodiments can be found in the following, which illustrate the invention, but the invention is not limited thereto:

1. a method for amplifying a nucleic acid, wherein:

a) the sample comprises a first nucleic acid polymer comprising a first target sequence M [ and a sequence M ' complementary (reverse) to M ], wherein M comprises the sequence segments MPL, MS and MPR immediately in the 5 ' -3 ' direction in the sequence, and is contacted with:

b) A first template-dependent nucleic acid polymerase (especially a DNA polymerase), and a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor for the template-dependent nucleic acid polymerase;

c) a first left oligonucleotide primer PL1 which is (substantially) identical to MPL;

d) a first right oligonucleotide primer PR1 comprising in the 5' -3 ' direction a contiguous sequence segment PCR and a PMR, wherein the PMR has a [ hybridizing ] sequence that is complementary to the MPR [ can substantially sequence-specifically bind ], and the sequence segment PCR cannot bind to M [ or the sequence of the MPR immediately following the 3 ' direction relative to the sequence M ];

wherein PR1 (especially in segment PCR) comprises a modified nucleotide building block such that PCR cannot be used as a template for a first template-dependent nucleic acid polymerase activity; and

e) a control oligonucleotide CR comprising in the 5' -3 ' direction consecutive sequence segments CSR, CPR and CCR, wherein CSR is identical to the MS segment in the 5' direction of MPR [ and is read first upon initiation of the polymerase of PR, i.e. CSR can bind to the polymerization product of primer PR1 ], CPR is complementary to PMR (and identical to MPR) and CCR is complementary to PCR;

wherein CR comprises a nucleotide building block modified in CSR, and therefore CSR cannot be used as a template for template-dependent nucleic acid polymerase activity.

2. The method for amplifying a nucleic acid according to item 1, wherein a first primer extension product PR1 'comprising, in addition to the sequence region PCR and PMR, a synthetic region PSR substantially complementary to the target sequence M in the 5' -3 'direction is obtained, and the target sequence M is located in a region adjacent to the MPR in the 5' direction; wherein a second primer extension product PL1 'is obtained which, in addition to the sequence region MPL, comprises a synthetic region PSL which is substantially identical to the target sequence M in the region adjacent to MPL in the 3' direction;

wherein:

-selecting the reaction conditions of said first amplification step, and/or

Selecting the length and melting temperature of PCR and MS (if applicable),

so that PR1 'can form a double strand with M [ PL 1' can form a double strand with M ] [ PR1 'can form a double strand with PL1 ], and PR 1' can form a double strand with C, and a double strand of PR1 'and C [ at least in the MPR region ] is preferably formed as compared to forming a PR 1' double strand with M.

3. The method for amplifying a nucleic acid according to item 2, wherein:

-selecting the reaction conditions of said first amplification step, and/or

Selecting the length and melting temperature of the PCR and, where appropriate, the MS and/or the location of the MPL and MPR,

Such that the first primer extension product PR1 'does not separate from the second primer extension product PL 1' in the absence of the control oligonucleotide CR.

4. The method of any one of the preceding items, wherein the sample is contacted with:

a) a second left oligonucleotide primer PL2 identical to first secondary primer binding region MPL 2; and

b) a second right oligonucleotide primer PR2 complementary to region MPR 2;

wherein MPL2 and MPR2 are comprised in M and the 3 ' end (at least 20 positions) of MPL2 is located in the 5 ' direction of the 5 ' end of MPR2 (especially MPL2 is identical to MPL and/or MPR2 is identical to MPR).

5. The method of item 4, wherein PL2 and/or PR2 are respectively [ directly ] contained in the 5' direction of the sequence part identical to MPL2 or complementary to MPR2 (sequence part PCL2 or PCR 2).

6. The method according to any of the preceding items 1 to 5, wherein a second template-dependent nucleic acid polymerase (especially a DNA polymerase) and optionally substrates for the template-dependent nucleic acid polymerase (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates and suitable cofactors) are contacted with the sample in the second amplification step.

7. The method according to any one of items 1 to 6 above, wherein: modified nucleotide building blocks include 2 '-O-alkylribonucleoside building blocks, particularly 2' -O-methylribonucleoside building blocks.

8. The method according to any one of preceding items 1 to 7, wherein: the first amplification step is carried out essentially isothermally.

9. The method according to any of the preceding items 1 to 8, characterized in that: MS is 20-200 nucleotides in length.

10. The method according to any of the preceding items 1 to 9, characterized in that: PR1 was 15-100 nucleotides in length.

11. The method according to any one of preceding items 1 to 10, wherein: the length of the PCR is 5-85 nucleotides, in particular the length of the PCR is 50% to 300% of the length of the sequence segment PMR.

12. The method of any of the preceding items 1-11, wherein: the length of CR (control oligonucleotide) is 20-100 nucleotides.

13. The method according to any of the preceding items 1 to 12, wherein: the first amplification and the second amplification are performed in the same reaction batch.

14. The method according to any one of the preceding items 1 to 13, wherein: the second template-dependent nucleic acid polymerase is a thermostable polymerase, in particular a thermostable DNA polymerase.

15. The method according to any of the preceding items 1 to 14, wherein: the first template-dependent nucleic acid polymerase is heat inactivated, in particular the first template-dependent nucleic acid polymerase is a mesophilic polymerase.

16. The method according to any one of preceding items 1 to 15, wherein: the second template-dependent nucleic acid polymerase, the second right oligonucleotide primer PR2 and/or the second left oligonucleotide primer PL2 may be activated and/or the control oligonucleotide CR may be inactivated.

17. The method according to any of the preceding items 1 to 16, wherein: after completion of the first amplification step, contacting the components of the second amplification step with the sample.

18. The method of any of the preceding items 1-17, wherein: the CR in CSR and CPR comprises a sequence region that can bind sequence specifically to the second right oligonucleotide primer PR 2.

19. The method of any of the preceding items 1-18, wherein: the selected reaction conditions, in particular the reaction conditions of the first amplification step, comprise a reaction temperature in the range of from 25 ℃ to 80 ℃ (in particular from 50 ℃ to 70 ℃).

20. A kit for performing the method of any one of items 1-19, comprising:

-a first right oligonucleotide primer PR1 comprising in 5 '-3' direction consecutive sequence segments PCR and PMR; wherein the PMR is capable of binding to the primer binding site MPR of the genomic sequence M of a (especially mammalian) eukaryote or pathogenic bacterium, especially to a human target sequence; wherein M comprises consecutive sequence segments MPL, MS and MPR in the 5' -3 ' direction and the sequence segment PCR cannot bind to sequences located directly in the 3 ' direction of MPR; wherein:

PR1 (especially in the segment PCR) comprises a modified nucleotide building block such that PCR cannot be used as a template for the activity of the first template-dependent nucleic acid polymerase;

-a first left oligonucleotide primer PL1 which is (substantially) identical to MPL;

a control oligonucleotide CR comprising in 5' -3 ' direction consecutive segments of said sequence CSR, CPR and CCR, wherein CSR is identical to the MS segment in 5' direction of MPR [ and is read first upon initiation of the polymerase of PR, whereby CSR can bind to the polymerization product of primer PR1 ], CPR is complementary to PMR (and identical to MPR) and CCR is complementary to PCR;

wherein the CR in the CSR comprises nucleotide building blocks modified in such a way that the CSR cannot serve as a template for the activity of said template-dependent nucleic acid polymerase;

-a second left oligonucleotide primer PL2 identical to first secondary primer binding region MPL 2; and

-a second right oligonucleotide primer PR2 complementary to the region MPR 2;

wherein MPL2 and MPR2 are comprised in M and the 3 ' end (at least 20 positions) of MPL2 is located in the 5' direction of the 5' end of MPR2 (especially MPL2 is identical to MPL and/or MPR2 is identical to MPR).

21. The kit according to one of items 20 and 21, further comprising a second template-dependent nucleic acid polymerase (especially a DNA polymerase), and (optionally) a substrate for said DNA polymerase (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor, especially a mesophilic template-dependent polymerase without 5 '-3' exonuclease activity.

22. The kit according to one of items 20 and 21, further comprising a second template-dependent nucleic acid polymerase (especially a DNA polymerase), and (optionally) a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) for said template-dependent nucleic acid polymerase and a suitable cofactor, especially a thermophilic template-dependent polymerase having 5 '-3' exonuclease activity.

23. A method for amplifying a nucleic acid comprising the steps of:

a) a first amplification comprising the steps of:

a first region which can bind sequence-specifically to a region of the nucleic acid to be amplified, wherein the region of the nucleic acid to be amplified comprises at least the 5 'end of the target sequence or is located in the 5' direction of the target sequence; and

a second region adjacent to the 5' end of the first region or linked by a linker, wherein the second region can bind to a control oligonucleotide and is not substantially replicated by the polymerase used under the selected reaction conditions;

-extending the first oligonucleotide primer (P1.1) by a first polymerase to obtain a first primer extension product (P1.1-Ext), the first primer extension product (P1.1-Ext) comprising, in addition to the first oligonucleotide primer (P1.1), a synthesis region substantially complementary to the nucleic acid to be amplified or the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present in double stranded form;

a first region which can bind to a second region (overhang) of the first primer extension product (P1.1-Ext);

a second region substantially complementary to said first region of said first oligonucleotide primer (P1.1); and

a third region substantially complementary to at least a portion of the synthesis region of the first segment of the primer extension product (P1.1-Ext);

wherein the control oligonucleotide (C1.1) does not serve as a template for primer extension of the first oligonucleotide primer (P1.1) and the first control oligonucleotide (C1.1) binds to the first and second regions of the first primer extension product (P1.1-Ext) while displacing the region of the nucleic acid to be amplified that is complementary to the first and second regions;

-hybridizing a second oligonucleotide primer (P1.1) to said first primer extension product, wherein said second primer (P2.1) comprises a region capable of sequence-specifically binding to said synthetic region of said first primer extension product (P1.1-Ext) which is complementary to at least the 5 'end of said target sequence or is located in its 3' direction;

-extending the second oligonucleotide primer (P2.1) by the first polymerase to obtain a second primer extension product (P2.1-Ext), the second primer extension product (P2.1-Ext) comprising, in addition to the second oligonucleotide primer (P2.1), a synthesis region substantially identical to the nucleic acid to be amplified or the target sequence, wherein the first primer extension product (P1.1-Ext) and the second primer extension product (P2.1) form a first double stranded amplification product;

(b) a second amplification comprising the steps of:

-hybridizing a third oligonucleotide primer (P3.2) to said second primer extension product (P1.1-Ext) of said first amplification product, wherein said third oligonucleotide primer (P3.2) comprises a first region which is sequence-specifically bindable to a segment of said second primer extension product (P1.1-Ext) and comprises at least the 5 'end of said target sequence or is located in the 5' direction thereof;

-extending said third oligonucleotide primer (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext), which third primer extension product (P3.2-Ext) comprises, in addition to said third oligonucleotide primer (P3.2), a synthetic segment substantially complementary to said second primer extension product (P2.1-Ext) or to said target sequence, wherein said second primer extension product (P2.1) and said third primer extension product (P3.1) are present in double stranded form;

-hybridizing a fourth oligonucleotide primer (P4.2) to said first primer extension product (P1.1-Ext), wherein said fourth primer (P4.2) comprises a first region which can sequence-specifically bind to said synthetic region of said first primer extension product (P1.1-Ext) which is complementary to at least the 5 'end of said target sequence or is located in its 3' direction;

-extending said fourth oligonucleotide primer (P4.2) by said second polymerase to obtain a fourth primer extension product (P4.2-Ext) comprising, in addition to said fourth oligonucleotide primer, a synthetic region substantially complementary to said first primer extension product (P1.1-Ext) or substantially identical to said target sequence, wherein said first primer extension product (P1.1-Ext) and said fourth primer extension product (P4.1-Ext) are present in double stranded form;

-separating the first primer extension product (P1.1-Ext) from the double strand constituted by the fourth primer extension product (P4.2-Ext), and separating the second primer extension product (P2.1) from the double strand constituted by the third primer extension product (P3.1);

-hybridizing the third oligonucleotide primer (P3.2) to the fourth primer extension product (P4.2-Ext) and extending the third oligonucleotide primer (P3.2) by the second polymerase; and

-hybridizing said fourth oligonucleotide primer to said third primer extension product (P3.2-Ext) and extending said fourth oligonucleotide primer (P4.2) by said second polymerase.

24. The method of claim 23, wherein: repeating the first amplification step until the number of copies of the first amplification product is 10 to 100,000,000,0000, specifically 100 to 1,000,000,000, specifically 1,000 to 100,000,000.

25. The method of claim 23 or 24, wherein: the third oligonucleotide primer and/or the fourth oligonucleotide primer has a second region contiguous with the 5' end of the first region or joined by a linker, wherein the second region is incapable of complementarily binding to the first primer extension product (P1.1-Ext) or the second primer extension product (P2.1-Ext).

26. The method according to any of the preceding claims 23-25, wherein: the double-stranded separation of the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext), and the double-stranded separation of the second primer extension product (P2.1) and the third primer extension product (P3.1) is performed by heat denaturation, in particular at a temperature in the range of 85 ℃ to 105 ℃.

27. The method according to any of the preceding claims 23-26, wherein: the first polymerase and the second polymerase are the same.

28. The method according to any of the preceding claims 23-27, wherein:

-said first oligonucleotide primer (P1.1) and said third oligonucleotide primer (P3.2) are substantially identical; and/or

-said second oligonucleotide primer (P2.1) and said third oligonucleotide primer (P4.2) are substantially identical.

29. The method according to any of the preceding claims 23-28, wherein: the first amplification and the second amplification are performed in the same reaction batch.

30. The method of claim 29, wherein: the second polymerase, the third oligonucleotide primer (P3.1) and/or the fourth oligonucleotide primer (P4.1) may be activated and/or the control oligonucleotide may be inactivated.

31. The method according to any of the preceding claims 23-28, wherein: the first amplification is performed in a first reaction batch and the second amplification is performed in a second reaction batch.

32. The method of claim 31, wherein: adding an aliquot of the first reaction batch or the entire first reaction batch to the second reaction batch.

33. The method according to any of the preceding claims 23-32, wherein: the control oligonucleotide (C1.1) comprises a fourth region which can bind sequence specifically to the third oligonucleotide primer (P3.2).

34. The method according to any of the preceding claims 23-33, wherein: the first amplification is performed substantially isothermally.

35. The method according to any of the preceding claims 23-24, wherein: the first oligonucleotide primer (P1.1) has one or more modifications in the second region, in particular the first region immediately following the first oligonucleotide primer, which terminate the first polymerase in the second region.

36. A kit for performing the method of any one of items 23-35, comprising:

-a first oligonucleotide primer (P1.1) comprising the following regions:

a second region adjacent to the 5' end of the first region or linked by a linker, wherein the second region is capable of binding to the first control oligonucleotide and is substantially not replicated by the polymerase used for amplification under the selected reaction conditions;

Wherein the first oligonucleotide primer (P1.1) is extendable by a polymerase to a first primer extension product (P1.1-Ext) comprising a synthesis region and the first oligonucleotide primer (P1.1);

-a second oligonucleotide primer (P2.1), wherein said second oligonucleotide primer (P2.1) comprises a region which can sequence-specifically bind to said synthetic segment of said first primer extension product (P1.1-Ext), which synthetic segment is complementary to or located 3 'to at least the 5' end of said target sequence and is extendable by a polymerase to a second primer extension product (P2.1-Ext), which second primer extension product (P2.1-Ext) comprises a synthetic segment in addition to the second oligonucleotide primer (P2.1);

-a control oligonucleotide (C1.1) comprising the following regions:

a first region which can bind to the second region of the first primer extension product (P1.1-Ext);

a third region substantially complementary to at least a portion of the synthesis region of the first region of the primer extension product (P1.1-Ext);

wherein the control oligonucleotide (C1.1) does not serve as a template for primer extension of the first oligonucleotide primer (P1.1) and the control oligonucleotide (C1.1) can bind to the first and second regions of the first oligonucleotide extension product (P1.1-Ext) while displacing the region of the nucleic acid to be amplified that is complementary to the first and second regions;

-a third oligonucleotide primer (P3.2), wherein said third oligonucleotide primer (P3.2) comprises a first region which sequence-specifically binds to a region of said second primer extension product (P1.1-Ext) which comprises at least the 5 'end of said target sequence or is located in the 5' direction thereof and is extendable by a polymerase to a third primer extension product (P3.2-Ext) which comprises a synthesis region in addition to said third oligonucleotide primer (P3.2); and

-a fourth oligonucleotide primer (P4.2), wherein said fourth oligonucleotide primer (P4.2) comprises a first region which is sequence-specifically bindable to said synthesis region of said first primer extension product (P1.1-Ext), which synthesis region is complementary to or located 3 'to at least the 5' end of said target sequence and is extendable by a polymerase to a fourth primer extension product (P4.2-Ext), which fourth primer extension product (P4.2-Ext) comprises a synthesis region in addition to said fourth oligonucleotide primer (P4.2).

37. Use of a kit according to claim 36 in carrying out a method according to any one of claims 23 to 35.

38. A method for amplifying a nucleic acid comprising the steps of:

a) a first amplification comprising the steps of:

-providing a starting nucleic acid 1.1 comprising a target sequence;

a second region (P1.1.2) contiguous with the 5' end of the first region or linked by a linker, wherein the second region can bind to a control oligonucleotide and is not substantially replicated by the polymerase used under the selected reaction conditions;

-extending the first oligonucleotide primer (P1.1) by a first polymerase to obtain a first primer extension product (P1.1-Ext), the first primer extension product (P1.1-Ext) comprising, in addition to the first oligonucleotide primer (P1.1), a synthetic segment (P1.1E1 to P1.1E4) substantially complementary to the nucleic acid to be amplified or the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present in double stranded form;

-a control oligonucleotide (C1.2) is bound to said first primer extension product (P1.1-Ext), wherein said control oligonucleotide (C1.2) comprises the following regions:

a first region (C1.2.1) that can bind to the second region (overhang) of the first primer extension product (P1.1E6);

a second region (C1.2.2) complementary to said first region of said first oligonucleotide primer (P1.1.1); and

wherein the control oligonucleotide (C1.1) does not act as a template for primer extension of the first oligonucleotide primer (P1.1) and the first control oligonucleotide (C1.1) binds to the first primer extension product (P1.1E6, P1.1E5, P1.1E4) while displacing the complementary region (P2.1E1, P2.1E2) of the nucleic acid to be amplified to said region;

-hybridizing a second oligonucleotide primer (P1.1) to said first primer extension product, wherein said second oligonucleotide primer (P2.1) comprises a region (P2.1.1) that can sequence-specifically bind to said synthesis region (P1.1E1) of said first primer extension product;

-extending the second oligonucleotide primer (P2.1) by the first polymerase to generate a second primer extension product (P2.1-Ext), the second primer extension product (P2.1-Ext) comprising, in addition to the second oligonucleotide primer (P2.1), a synthesis region (P2.1E4 to P2.1E1) that is substantially identical to the nucleic acid to be amplified or the target sequence, wherein the first primer extension product (P1.1-Ext) and the second primer extension product (P2.1) form a first double-stranded amplification product; and

-the step of first amplification should be repeated until the desired amount of first amplification product has been synthesized;

b) a second amplification comprising the steps of:

-bringing a third oligonucleotide primer (P3.2) and said second and/or fourth primer extension product(s) ((S))P1.1-Ext or P4.1-Ext) (ii) hybridizing, wherein said third oligonucleotide primer (P3.2) comprises a first region (p3.1.1) that binds sequence specifically to a region of said second primer extension product (P2.1E1) and said fourth primer extension product (P4.1E2);

-extending the third oligonucleotide primer (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext), which third primer extension product (P3.2-Ext) comprises, in addition to the third oligonucleotide primer (P3.2), a synthesis region (P3.1E5 to P3.1E2, or P3.1E5 to P3.1E1) that is substantially complementary to the second primer extension product (P2.1-Ext) or the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) are present in double stranded form;

-hybridizing a fourth oligonucleotide primer (P4.2) to said first primer extension product (P1.1-Ext) and/or to said third primer extension product (P3.1-Ext), wherein said fourth oligonucleotide primer (P4.2) comprises a first segment (P4.1.1) that can sequence-specifically bind to said synthetic region of said first primer extension product (P1.1E1) and said third primer extension product (P3.1E2);

-extending said fourth oligonucleotide primer (P4.2) by said second polymerase to obtain a fourth primer extension product (P4.2-Ext) comprising, in addition to said fourth oligonucleotide primer, a synthetic region (P4.1E5 to P4.1E2, or P4.1E5 to P4.1E1) substantially complementary to said first primer extension product (P1.1-Ext) or substantially identical to said target sequence, wherein said first primer extension product (P1.1-Ext) and said fourth primer extension product (P4.1-Ext) are present in double stranded form;

-isolating the double strand of the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext), the double strand of the second primer extension product (P2.1-Ext) and the third primer extension product (P3.1-Ext), and the double strand of the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1-Ext);

39. The method of claim 38, wherein: repeating the first amplification step until the number of copies of the first amplification product is from 10 to 100,000,000,000, particularly from 100 to 1000,000,000, particularly from 1000 to 100,000,000.

40. The method of claim 38 or 39, wherein: the third oligonucleotide primer and/or the fourth oligonucleotide primer has a second region (P3.1.2 or P4.1.2, respectively) adjacent to the 5' end of the first region, wherein the second region is incapable of complementarily binding to the first primer extension product (P1.1-Ext) or the second primer extension product (P2.1-Ext).

41. The method of any of the preceding claims 38-40, wherein: the double-stranded separation of the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext), and the double-stranded separation of the second primer extension product (P2.1-Ext) and the third primer extension product (P3.1-Ext), and the double-stranded separation of the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1-Ext) are performed by heat denaturation, in particular at a temperature in the range of 85 ℃ to 105 ℃.

42. The method according to any of the preceding claims 38-40, wherein: the first polymerase and the second polymerase are the same.

43. The method according to one of the preceding items, characterized in that:

said first oligonucleotide primer (P1.1) and said third oligonucleotide primer (P3.2) are substantially identical; and/or

Said second oligonucleotide primer (P2.1) and said fourth oligonucleotide primer (P4.2) are substantially identical.

44. The method according to any of the preceding claims 38-40, wherein: the first amplification and the second amplification are performed in the same reaction batch.

45. The method of claim 44, wherein: the second polymerase, the third oligonucleotide primer (P3.1) and/or the fourth oligonucleotide primer (P4.1) may be activated and/or the control oligonucleotide may be inactivated.

46. The method according to any of the preceding claims 38-45, wherein: a first oligonucleotide probe labeled with a fluorescent dye can complementarily bind to the third primer extension product and detect a signal of the fluorescent dye.

47. The method according to any of the preceding claims 38-46, wherein: a first oligonucleotide probe labeled with a fluorescent dye can complementarily bind to the fourth primer extension product and detect a signal of the fluorescent dye.

Examples

Materials and methods:

reagents were purchased from the following suppliers:

unmodified and modified oligonucleotides (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences); polymerase (NEB, New England Biolabs); dntp (jena bioscience); intercalated EvaGreen dye (Jena Bioscience); buffer substances and other chemicals (Sigma-Aldrich); plastic articles (Sarstedt).

Solution 1 (amplification reaction solution 1):

potassium glutamate, 50mmol/l, pH 8.0; magnesium acetate, 10 mmol/l; dNTPs (dATP, dCTP, dTTP, dGTP), each 200. mu. mol/l; polymerase (Bst 2.0 hot start, 120.000U/ml NEB), 12 units/10 μ l; triton x-100, 0.1% (v/v); EDTA, 0.1 mmol/l; TPAC (tetrapropylammonium chloride), 50mmol/l, pH 8.0; EvaGreen dye (dye was used after dilution at a ratio of 1: 50 according to the manufacturer's instructions).

Solution 2 (amplification reaction solution 2):

1 × isothermal buffer (New England Biolabs); single concentration buffer contained 20mM Tris-HCl, 10mM (NH)₄)₂SO₄、50mM KCl、2mM MgSO₄、0.1％

20; pH at 25 ℃ is 8.8; dNTPs (dATP, dCTP, dUTP, dGTP), each 200. mu. mol/l;

EvaGreen dye (the dye is diluted 1: 50 according to the manufacturer's instructions and then used)

Solution 4 (amplification reaction solution 4); 1 × isothermal buffer (New England Biolabs) see above.

All concentrations were final concentrations in the reaction. Deviations from the standard reaction are indicated accordingly.

At a concentration of 1. mu. mol/l of each component in solution 1, the melting temperature (Tm) of the component concerned is determined. In each case a deviation parameter is given.

General information on the reaction (first amplification)

The reaction was started by heating the reaction solution to the reaction temperature, since at lower temperatures the hot start function of Bst 2.0 polymerase was largely inhibited by the temperature sensitive oligonucleotide (according to the manufacturer's instructions). Polymerases have increasingly higher activity at temperatures above 45 ℃. At a temperature of 65 ℃, the difference between polymerase Bst 2.0 and hot start polymerase Bst 2.0 could not be detected. In order to prevent the formation of a large amount of by-products (e.g., primer dimers) during the preparation of the reaction, hot start polymerase Bst 2.0 was used. The differences are particularly pointed out.

The reaction is terminated by heating the reaction solution to over 80 deg.C (e.g., at 95 deg.C for 10 min). At this temperature, the polymerase Bst 2.0 is irreversibly denatured and the result of the synthesis reaction cannot be changed subsequently.

The reaction is carried out in an isothermal vessel with fluorescence measuring equipment. For this purpose, a commercial real-time PCR apparatus, StepOne Plus (Applied Biosystems, Thermofischer), was used. The standard reaction volume was 10. mu.l. Indicating deviations therefrom.

Endpoint determination and kinetic observations were performed. In the endpoint assay, signals from, for example, dyes that bind to nucleic acids, for example from TMR (tetramethylrhodamine, also known as TAMRA) or FAM (fluorescein), are recorded. The excitation and measurement wavelengths of FAM and TMR fluorescence signals were stored as default settings in a StepOne Plus real-time PCR device. In addition, intercalating dyes (EvaGreen) are also used for end-point measurements (e.g. measurement of melting curves). EvaGreen is an intercalating dye, an analogue of the commonly used dye Sybrgreen, but with slightly less inhibition of the polymerase. The excitation and measurement wavelengths of the SybrGreen and EvaGreen fluorescent signals are the same, and are stored in the StepOne Plus real-time PCR device as factory settings. Fluorescence can be detected continuously (i.e., "on-line" or "in real-time") by a built-in detector. Since the polymerase synthesizes a double strand during synthesis, this technique can be used for kinetic measurements of the reaction (real-time monitoring). Due to some cross-talk between the color channels in the StepOne Plus device, an increase in the intensity of the basal signal is sometimes observed when measurements are performed with TMR marker primers at concentrations above 1. mu. mol/l (e.g.10. mu. mol/l). It was observed that TMR signals in the Sybr-Green channel resulted in an increase in basal signal intensity. The basic value of the increase is taken into account in the calculation.

The kinetic observations of the reaction process are usually recorded using the fluorescence signal of fluorescein (FAM-TAMRA Fret pair) or intercalating dyes (EvaGreen). The time dependence of the signal was recorded (signal was acquired in real time using a StepOne plus PCR instrument). The increase in signal during the reaction compared to the control reaction is explained by the structure of the batch. For example, when the Evagreen dye is used, an increase in signal is interpreted as indicating an increase in the number of double-stranded nucleic acid strands during the reaction, and thus is a result of synthesis by the DNA polymerase.

For some reactions, the melting curve was determined after the reaction. Such measurements may lead to conclusions about the presence of the double strand, e.g. the double strand may absorb the intercalating dye and thus significantly amplify the signal intensity of the dye. As the temperature increases, the proportion of double strands decreases and the signal intensity also decreases. The signal depends on the length and sequence composition of the nucleic acid strand. Such techniques are well known to the skilled person.

When melting curve analysis is used for reactions containing a large number of modified nucleic acid strands (e.g., control oligonucleotides or primers), it was found that the signal from, for example, EvaGreen dye may exhibit different behavior between B-type DNA and a-type modified nucleic acid strands. For example, the signal intensity observed in a type B double-stranded nucleic acid strand (typically used for classical DNA moieties) is higher than the signal intensity observed in a double-stranded nucleic acid strand having the same nucleobase sequence, which can assume a conformation similar to type a (e.g., by several 2' -O-Me modifications of nucleotides). This observation is taken into account when using intercalated dyes.

If necessary, the reaction is analyzed by capillary electrophoresis and the length of the fragment formed is compared to a standard. In preparation for capillary electrophoresis, the reaction mixture was diluted in buffer (Tris-HCl, 20mmol/l, pH 8.0, and EDTA, 20mmol/l, pH 8.0) to a concentration of labeled nucleic acid of about 20 nmol/l. Capillary electrophoresis was performed by GATC-Biotech (Constants, Germany) as a contractual service. Capillary electrophoresis was performed on an ABI 3730 capillary sequence under standard conditions for Sanger sequencing using POP7 gel matrix, at a temperature of about 50 ℃ and at a constant voltage (about 10kV), as described by the supplier. The conditions used result in denaturation of the double strands, and thus the single-stranded form is separated from the nucleic acid strand in capillary electrophoresis. Electrophoresis is a standard technique in genetic analysis. Automated capillary electrophoresis has been routinely used for Sanger sequencing today. The fluorescence signal is recorded continuously during capillary electrophoresis (typically using a virtual filter) to generate an electropherogram, where the signal intensity is related to the electrophoresis duration. For shorter fragments, e.g. unused primers, earlier signal peaks are observed; for longer segments, the time shift of the signal is proportional to the length of the stretch. The length of the extension fragment can be measured by using a control of known length. This technique is known to the skilled person and is also used as a criterion for fragment length polymorphisms.

Unless otherwise defined for a particular sequence, the capital AGCT and the lowercase AGCT both represent deoxyribonucleotide building blocks of DNA, or corresponding ribonucleotides or base analogs. In some embodiments, uracil nucleobases are used in the modified sequence segments, thus 2 '-OMe modifications are used as sugars (ribose with 2' -O-methyl modifications). Other 2' -O-alkyl modifications are also possible. In batches using dUTP (especially the first amplification reaction), amplified fragments containing dump are generated (to prevent contamination). However, in general, uracil bases can be used with 2' -deoxyribose and with ribose; the person obtains from the overall teaching regarding each sequence segment of the sequences used herein to determine at which points classical DNA backbones, RNA or base analogs can be effectively applied.

Example 1 (FIG. 36)

Use of human genomic DNA as a source of target sequence

This example demonstrates the use of human genomic dna (hgdna) as the source of the target sequence. The sequence segment of the factor V Leiden gene (homo sapiens coagulation factor V (F5), mRNA, herein referred to as FVL gene) was selected as the target sequence.

Only the first amplification was performed. This example shows that a first amplification can be performed which is dependent on the control. In this example, no second amplification was performed.

Target sequence:

the binding sequence of the first oligonucleotide primer is underlined. The second oligonucleotide primer binds its 3' segment to the reverse complement of the double underlined sequence.

First, second and control oligonucleotides were designed and synthesized for FVL mutants of this gene.

First oligonucleotide primer: P1F5-200-AE2053

The segments used as primers in the reaction are underlined.

A ═ 2' -deoxyadenosine; c ═ 2' -deoxycytidine; g ═ 2' -deoxyguanosine; t2' -deoxythymidine (thymidine)

The oligonucleotide comprises the following modifications:

a 1 ═ C3 linker for terminating synthesis of second primer extension products.

The segment of primer [ CUCU GAUGCUUC ] in square brackets contained a 2' -O-Me modification and was used as the second primer region to bind to the first region of the control oligonucleotide:

a ═ 2' -O-methyladenosine; g ═ 2' -O-methylguanosine; c ═ 2' -O-methylcytosine; u ═ 2' -O-methyluridine

The oligonucleotide primer comprises a first region (positions 1-12 from the 3 ' end), a second region (C3 linker and positions 13-24 from the 3 ' end), and a segment with an additional sequence variant P1 (positions 25-57 from the 3 ' end). The first region and the second region are necessary for specific amplification, and may be summarized as "the basic structure of the first primer" or "the minimum structure of the first primer". Additional sequence variants P1 provide examples of additional segments that can be incorporated on the first oligonucleotide primer. Positions 1-12 serve as templates for the synthesis of second primer extension products. During synthesis of the second primer extension product, the C3 modification and the second region prevent continued synthesis at positions 25-57.

Primer 2: P2G3-5270-

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

6-HEG linker

The oligonucleotide primer comprises a replicable region and a non-replicable region. The replicable region includes (positions 1-13 and 14-35 from the 3' end, positions 1-13 may bind complementarily to the sequence of the FVL gene within the hgDNA, and positions 14-35 may not bind complementarily to the sequence of the FVL gene but may bind to the first primer extension product during amplification). The replicable region may be summarized as "the basic structure of the second primer" or "the minimum structure of the second primer".

The non-replicable region (positions 36-70 from the 3' end, which does not bind complementarily to the sequence of the FVL gene) is separated from the replicable region by the HEG modification, which prevents continued synthesis at positions 36-70 during synthesis of the first primer extension product. The non-replicable segment is an example of an additional sequence variant P2 that may be incorporated on the second oligonucleotide primer.

The following control oligonucleotides were used: AD-F5-1001-503

The 5 'segment of oligonucleotide [ UAAUCUGUAA GAGCAGAUCC CUGGACAGGCAA GGAAUAC ] in square brackets contained 2' -O-Me nucleotide modifications:

modification: a ═ 2' -O-methyladenosine; g ═ 2' -O-methylguanosine; c ═ 2' -O-methylcytosine; u ═ 2' -O-methyluridine

x-3' phosphate group for blocking possible extension by polymerase.

Nucleotides and nucleotide modifications are linked to each other by phosphodiester bonds. The 3' end of the control oligonucleotide is blocked with a phosphate group to prevent possible extension by the polymerase.

The first primer comprises in its first region a sequence which specifically binds to the sequence of the Factor V Leiden gene within the genomic DNA, so that synthesis can be initiated by the polymerase. The second region of the first primer comprises a sequence that does not specifically hybridize to a sequence of the FVL gene. In addition, the first primer comprises another sequence segment (additional sequence variant P1) linked to the 5' end of the second region. The segment was not involved in the specific amplification of the Factor 5Leiden segment. The effect of the segments is mainly to delay side reactions.

The second primer comprises a segment in its 3' segment that specifically binds to genomic DNA, thereby allowing synthesis to be initiated by the polymerase. The 5' segment of the second primer comprises a sequence that does not specifically hybridize to a sequence of the FVL gene. During reverse synthesis, this sequence segment may be replicated. The second primer comprises another sequence segment that is not capable of specifically hybridizing to the control oligonucleotide, the first primer, or the second primer. The segment is located at the 5 'end of the second primer and is separated from the 5' end of the primer by a HEG linker (additional sequence variant P2). The segment is not involved in specific amplification. The effect of the segments is mainly to delay side reactions.

The control oligonucleotide was constructed in a manner that matched exactly the sequence of the Factor V Leiden mutation of the FVL gene. The control oligonucleotide comprises a first, a second and a third region.

WHO standard for FVL mutation was used as genomic DNA. Before use in the reaction, the DNA was denatured by heating (5 min at 95 ℃) to convert the DNA from a double-stranded state to a single-stranded state. Using this single-stranded hgDNA, an initial nucleic acid strand is first generated by primer extension. Subsequently, exponential amplification is performed starting from the starting nucleic acid strand. The specificity of amplification was determined by melting curve analysis and Sanger sequencing with sequencing primers.

All reactions were performed in amplification solution 1.

The dntps used included: dATP, dGTP, dCTP, dUTP (instead of dTTP).

Hot start polymerase Bst 2.0 from NEB was used as polymerase.

The starting nucleic acid strand was created as follows:

150ng of hgDNA of about 50,000 Haploid Genome Equivalents (HGE) was contacted with a second primer (0.5. mu. mol/l) and Bst 2.0 hot start polymerase (about 1 unit) and dNTPs (about 250. mu. mol/l) in a 50. mu.l reaction volume under hybridization conditions (amplification solution 1, temperature about 60 ℃) and incubated for about 10 min. During this stage, the second primer is extended, with the genomic DNA serving as a template. As a result, a primer extension product which can be used as a starting nucleic acid is obtained. After the reaction is complete, the reaction mixture is heated to 95 ℃ for about 10min to isolate the starting nucleic acid strand. The reaction mixture was frozen and used as a source of starting nucleic acid strands as needed.

The target sequence of the FVL gene was specifically amplified using 5. mu.l of a reaction mixture with the starting nucleic acid strand (corresponding to about 5000 HGE).

After addition of the other reaction components (first primer, second primer, control oligonucleotide, EvaGreen dye, Bst.2.0 Hot Start polymerase, dNTP), a final reaction volume of about 10. mu.l was obtained. The final concentrations of the components were: a first primer: 5 mu mol/l; a second primer: 2 mu mol/l; control oligonucleotides: 1 mu mol/l; EvaGreen dye (1: 50); bst.2.0 hot start polymerase (about 8 units); dNTP: about 250. mu. mol/l.

hgDNA was not added to the control batch.

The reaction was carried out in a Step-One Plus apparatus (Thermofeisher Scientific).

The reaction temperature was first varied by cycling (30 cycles) between 65 ℃ (5min, including the detection step) and 55 ℃ (1min), and then held constant at 65 ℃ for 1h (the detection step was performed every 2 min). The reaction process is followed by signal detection of EvaGreen dye. After completion of the reaction, the reaction mixture was first heated at 95 ℃ for 10min and then the melting curve of the product formed was measured.

First, an initial nucleic acid strand is established (scheme 50). Subsequently, exponential amplification is performed by extending the first and second primers and the control oligonucleotide.

The result of amplification is accumulation of amplified fragments. The detection results of amplification are shown in FIG. 36. As can be seen, the fluorescence increased significantly after approximately 2h of reaction (36A). Subsequent melting curve analysis showed a specific melting curve with a Tm of 84 ℃ (FIG. 36B).

Sequence check (fig. 36C):

sequence verification using sequencing primers:

To verify the sequence, the reaction mixture (after measurement of the melting curve) was diluted with water (from about 1: 10 to about 1: 100) and the resulting aliquot was mixed with sequencing primers (added at a concentration of 2. mu. mol/l). The mixture was shipped by the sequencing vendor (GATC-Biotec) and sequenced using Sanger sequencing as a contract sequencing. The obtained electrophorograms were checked for identity with the FVL sequence gene. As a result of the reaction, the sequence of the FVL gene was identified.

Example 2 (fig. 37):

selective amplification reaction of sequence variants of a target sequence.

In this example, the effect of sequence variations in the template on amplification was investigated. When the first oligonucleotide primer is extended, a complementary strand is formed that has a sequence that is complementary to the template, and thus comprises these sequence variants. The objective was to assess the effect of this mismatch between the resulting first primer extension product and the control oligonucleotide on amplification. The position of the mismatch is in the 3' direction of the first primer and is therefore not assessed by the primer but by the control oligonucleotide.

Thus, each sequence variant of the target sequence is distinguished by the control oligonucleotide using uniform first and second primers.

Only the first amplification was performed. This example shows that a control-dependent first amplification can be performed with a distinction between two target sequence variants. In this example, no second amplification was performed.

The following templates were used:

a template (SEQ ID NO 6) having a sequence composition that generates a first primer extension product that is a perfect match to a control oligonucleotide:

M2SF5-M001-200

The binding sequence of the first oligonucleotide primer is underlined. The second oligonucleotide primer binds to the reverse complement of the double underlined sequence (35 positions at the 5' end).

A template (SEQ ID NO 7) having a sequence composition that produces a first primer extension product that forms a mismatch at a single base position (in bold) with a control oligonucleotide:

The binding sequence of the first oligonucleotide primer is underlined. The second oligonucleotide primer binds to the reverse complement of the double underlined sequence.

The following primers were used:

first oligonucleotide primer:

P1F5-200-AE2053

the segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

The segment of primer [ CUCU GAUGCUUC ] contained a 2' -O-Me modification and served as the second primer region to bind to the first region of the control oligonucleotide:

a ═ 2' -O-methyladenosine; g ═ 2' -O-methylguanosine; c ═ 2' -O-methylcytosine;

u ═ 2' -O-methyluridine

Primer 2: P2G3-5270-

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

6-HEG linker

The following control oligonucleotides were used:

AD-F5-1001-503

The 5 'segment of oligonucleotide [ UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC ] in square brackets contained 2' -O-Me nucleotide modifications:

Modification:

u ═ 2' -O-methyluridine

X-3' phosphate group, which is used to block possible extension by the polymerase.

Four batches were prepared:

the first batch contained a concentration of 300fmol/l (phase)When at about 2X 10⁶Copies/batch) of template M2SF5-M001-200 (perfect match case) as the starting nucleic acid strand.

The second batch contained a concentration of 300amol/l (corresponding to about 2X 10)³Copies/batch) of template M2SF5-M001-200 (perfect match case) as the starting nucleic acid strand.

Batch 3 contained no template, thus forming a control.

Batch 4 contained a concentration of 300pmol/l (corresponding to about 2X 10)⁹Copies/batch) of template M2SF5-WT01-200 (single mismatch case) as the starting nucleic acid strand.

Primer 1 used 5. mu. mol/l, control oligonucleotide 2. mu. mol/l and primer 2 1. mu. mol/l.

Other reaction conditions were: amplification solution 2.

To mimic the presence of genomic DNA in the assay, 100ng of freshly denatured fish DNA (salmon DNA) was added to each reaction.

The thermal reaction conditions were cyclically alternating temperature changes with 2min intervals at 55 ℃ and then 5min intervals at 65 ℃. Amplification was monitored for more than 100 cycles. EvaGreen fluorescent signal was detected at 65 ℃.

Successful amplification depends on the increase of the EvaGreen fluorescence signal over time.

Temperature changes and real-time monitoring were performed by the StepPne Plus real-time PCR device from Thermofisor.

Fig. 37 shows a typical curve of the EvaGreen signal. The Y-axis represents the increase in fluorescence signal (. DELTA.Rn) and the X-axis represents the reaction time (in cycles). Arrows mark the preparation of each reaction. The marked positions belong to the following batches:

arrow 1: 300fmol/l perfectly matched template (approx.2X 10)⁶Copy/batch);

arrow 2: 300amol/l perfectly matched template (ca. 2X 10)³Copy/batch);

arrow 3: no template is used; and

arrow 4: 300pmol/l mismatched template (ca. 2X 10)⁹Copy/batch).

It can be seen that the fluorescence signal increases in the perfect match and mismatch variants of the template, where the signal of the mismatch variant (4) appears later, although there is a 100-fold excess. It can be seen that the mismatch amplified signal is significantly delayed compared to the perfect match amplified signal. For a single mismatch, a delay of about 15 cycles is observed. The delay (cycle number) is a direct measure of the resolution in amplification. The resolution in amplification can be further quantified by comparison to a series of template concentrations under perfectly matched amplification.

When a perfectly matched template is used, the complementary strand of the primer extension product can be synthesized. The extension product is complementary to the perfectly matched template and to the control oligonucleotide used.

In contrast, when a mismatched sequence is used, synthesis of the first segment of the primer extension product results in the production of a complementary strand of the extension product that is fully complementary to the mismatched template, but which therefore deviates from complementarity with the third region of the oligonucleotide control. This deviation occurs in the 5' strand segment of the extension product, which should react with the control oligonucleotide to allow the strand displacement process to proceed. As shown in this example, the mismatch interferes with strand displacement of the control oligonucleotide.

Control reactions with perfectly matched templates (arrows 1 and 2) showed concentration dependence of amplification. As the concentration is reduced, the reaction takes longer to synthesize a sufficient amount of nucleic acid to be amplified to raise the signal above the baseline level.

This result illustrates the importance of base composition in the control oligonucleotide: deviations from complementarity between the control oligonucleotide and the primer extension product can slow or even disrupt amplification.

In this example it is shown that although the sequence ends of the perfect match template and the mismatch template are identical and thus the probability of binding of the two oligonucleotide primers is identical, the two reactions are completely different: if the control oligonucleotide is fully complementary to the 5' segment of the extension product of the first oligonucleotide primer, amplification is performed as intended. The disruption of strand displacement due to sequence bias (in this case, due to mismatches) results in inhibition of amplification.

Example 3 (fig. 38-42):

two amplifications were used: the first amplification is followed by a second amplification

This example shows that the first amplified amplification product can be used as the starting nucleic acid strand for a subsequent classical PCR (second amplification). Thus, a total of two separate amplification reactions were performed: first a first amplification and then a second amplification.

First amplification

Initially, a first amplification is performed in a first amplification system using a single-stranded nucleic acid strand comprising a target sequence (here, a single-stranded starting nucleic acid strand 1.1). In the absence of the control oligonucleotide, the reaction conditions used (temperatures of 55 ℃ and 65 ℃) do not allow spontaneous separation of the duplex comprising the first primer extension product and the second primer extension product formed during the reaction.

The first amplification system comprises the following components:

a first oligonucleotide primer;

a control oligonucleotide;

polymerase with strand displacement properties (Bst 2.0 hot start polymerase); and

substrates required for the polymerase (dNTP': dATP, dCTP, dGTP, dTTP) and a suitable buffer system (the reaction is carried out in isothermal buffer 1 × 1 (NEB)).

The progress of the reaction was detected at 65 ℃ using EvaGreen.

In case a concentration ratio of the first oligonucleotide primer (5. mu. mol/l) and the control oligonucleotide (2. mu. mol/l) is used, the first primer is in relative excess compared to the control oligonucleotide. The complex comprising the first oligonucleotide primer and the control oligonucleotide has a melting temperature of about 63 deg.C (Tm) as measured in the same reaction solution.

For the first amplification reaction, two temperature ranges were used:

55 deg.C (2min) and 65 deg.C (2 min). In a temperature step of 55 ℃, the control oligonucleotide was completely complexed with the first oligonucleotide primer. This prevents binding of the control oligonucleotide to the first primer extension product. In a second temperature step (65 ℃), the complex is at least partially dissociated from the complex, and thus a free single stranded control oligonucleotide can be used in a batch. This free control oligonucleotide can form a complex with the new first oligonucleotide primer and can also anneal to the first primer extension product. Contact with the first primer extension product begins with complementary binding of a sequence segment of the first region of the control oligonucleotide to a corresponding sequence segment of the second region of the primer, and the polymerase does not replicate the corresponding sequence segment.

Each synthesis method and chain separation method basically comprises the following processes:

the first oligonucleotide primer can bind predominantly specifically to the 3' segment of the provided nucleic acid strand (starting nucleic acid strand 1.1) and be extended by a polymerase (this reaction predominantly takes place at 55 ℃). The synthesis proceeds to the end of the template strand (5' region of the starting nucleic acid strand). Thereby generating a first primer extension product. The control oligonucleotide can bind to the first primer extension product by complementary base pairing and displace the template strand (here first the initial nucleic acid strand) by complementary base pairing (this reaction occurs predominantly at 65 ℃). At 65 ℃, the 3 'segment of the first primer extension product (not bound to the control) is separated from the complex with the template strand primarily due to temperature (the Tm of the 3' segment is less than 65 ℃). Thus, the 3' segment of the first primer extension product becomes single-stranded. Thus, the first primer extension product forms a complex with the control oligonucleotide.

The second oligonucleotide primer is now able to bind to the segment of the first primer extension product and initiate synthesis of the second primer extension product by the polymerase (this step may be performed at 55 ℃ and 65 ℃). The synthesis is performed while displacing the control oligonucleotide from binding to the first primer extension product. The polymerase used in the first primer extension reaction (Bst 2.0 hot start) has strand displacement properties. Synthesis of the extension product of the second primer is performed up to and including the first region of the first primer, which is replicated by the polymerase. Synthesis of the second primer extension product is terminated by the C3 linker in the first primer extension product such that the second region of the first primer extension product is not replicated by the polymerase. This produces a second primer extension product that forms a double strand with the first primer extension product (Tm of the double strand is about 79 ℃ c., compared to Tm of the first amplification product). Repeated heating of the reaction mixture to 65 ℃ results in the control oligonucleotide re-binding to the first primer extension product, thereby releasing the second primer extension product from its binding to the first primer extension product.

Due to the release of the second primer extension product, this product can now be used as template: the second primer extension product comprises in its 3' segment a sequence complementary to the first region of the first primer and is therefore capable of binding to a new oligonucleotide primer and starting synthesis by a polymerase.

As a result, a repeated synthesis and strand separation process is performed in which both synthesized primer extension products can serve as templates in subsequent cycles.

The first amplification product can be synthesized starting from the starting nucleic acid strand (1.1) using the primers provided and with the help of the control oligonucleotides provided until the desired number of copies is reached (here, the concentration of the first amplification product 1.1 at the end of the first amplification is about 0.8-1. mu. mol/l, corresponding to about 1,000,000,000 copies in a 10. mu.1 reaction batch). For ease of illustration, copy number is estimated from concentration.

The reaction is terminated by heating to 95 ℃ for 10min, wherein the first polymerase is denatured. Short fusion assays were then performed to confirm specific amplification. The reaction batch was frozen and used for a second amplification if needed.

Second amplification (PCR)

After the first amplification is complete, a portion of the first reaction batch is added to the second amplification. The first amplified fragment (1.1) synthesized in the first amplification serves as the second amplified second starting nucleic acid strand (2.1).

Several dilution steps were added to the first batch in the second amplification reaction to obtain a dilution series.

It should be noted that the first amplified fragment (1.1) formed was not purified, only diluted. Thus, all unused components of the first amplification system are also present in the second amplification step (although diluted).

Standard PCR (second amplification) was performed using PCR reaction conditions (three temperature ranges, i.e., 55 ℃ (1min), 72 ℃ (3min), 95 ℃ (20 s)).

The second amplification system comprises the following components:

a firstIIIAn oligonucleotide primer;

a firstFourthlyAn oligonucleotide primer;

polymerase (Taq polymerase), which is a thermostable polymerase; and

substrates required for the polymerase (dNTPs: dATP, dCTP, dGTP, dTTP) and a suitable buffer system.

For PCR, typical concentrations of the components were used: the final concentration of PCR primers was 0.5. mu. mol/l, the concentration of Taq polymerase (1,100 dilutions, corresponding to about 1 unit/reaction) and the concentration of dNTPs (A, G, C, T) was about 200. mu. mol/l, respectively. The reaction was performed in isothermal buffer 1 × (neb).

This first amplified fragment is used as the starting nucleic acid strand (2.1) and a second amplification is performed using a second amplification system. The synthesis was checked with EvaGreen at 72 ℃. With NTC and the starting nucleic acid strand 1.1 as control reactions, they can also be used as templates in the second amplification system.

The number of cycles required for the second amplification until the specific signal increases is measured and compared with a reference value. By comparing the number of cycles required for detectable amplification, it was concluded that the first amplified fragment (1.1) was successfully used in PCR.

The following operations are specifically implemented:

the first amplification product of the first amplification reaction based on the control oligonucleotide is diluted and amplified as template (input) under typical PCR conditions. In this example, the subsequent detection in PCR was performed using the intercalating dye EvaGreen. By comparison with a number of different control methods, the inventors have shown that if the control oligonucleotide based amplification reaction is successful, a signal is only generated in the subsequent PCR. Thus, the following classical PCR may also be referred to as detection PCR.

The amplification product of the control oligonucleotide-based amplification reaction was generated essentially as described in example 2.

The following oligonucleotide primers were used:

first of allOligonucleotide primers: P1F5-200-AE205

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

2-2' -deoxyinosine

u ═ 2' -O-methyluridine

Second oneOligonucleotide primers: P2G3-5270-

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

6-HEG linker

The following control oligonucleotides (SEQ ID NO: 4) were used:

AD-F5-1001-503

The 5 'segment in square brackets of oligonucleotide [ UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC ] contained 2' -O-Me nucleotide modifications:

u ═ 2' -O-methyluridine

3' phosphate group for blocking possible extension of polymerase

The strand of nucleic acid perfectly matched to the control was initiated (1.1).

M2SF5-M001-200

The starting nucleic acid strand was used at a concentration of about 1 pM.

As a result, the amplified fragment can be expected to generate a second primer extension product having the following sequence:

(the sequence segment of the non-replicable second primer is not shown here)

PCR was performed with 3 pairs of different primers. The primers cover different sequence regions of the amplification product. For better understanding, each pair of primers is also labeled with a primer binding site on the template strand (═ amplification product).

For PCR, use was made of:

PCR primer pair 1 consisting of the third oligonucleotide primer SeqP1F 5300-35 x (SEQ ID NO 8) and the fourth oligonucleotide primer P2-4401-601 TMR (SEQ ID NO 9):

third stepOligonucleotide primer SeqP1F 5300-35 x

Fourth step ofOligonucleotide primer P2-4401-

TMR 5’GCTCATACTACAATGTCACTTAC 3’(SEQ ID NO.9)

Respectively has: a ═ 2' -deoxyadenosine; c ═ 2' -deoxycytidine; g ═ 2' -deoxyguanosine; t2' -deoxythymidine (thymidine)

TMR is tetramethylrhodamine attached to the 5' end of the chain (P2-4401-601 TMR)

The two primers bind to the template strand (shown here as the second primer extension product of the first amplification) as follows:

in the control method, the primer of the primer pair can also bind to the starting nucleic acid strand 1.1 as shown below:

M2SF5-M001-200(SEQ ID NO：006)：

the binding sequence of the first oligonucleotide primer is underlined.

The second oligonucleotide primer binds to the reverse complement of the double underlined sequence.

PCR primer pair 2, which consists of a third oligonucleotide primer P3F5D-600-203(SEQ ID NO XY) and a fourth oligonucleotide primer P2-4401-601 TMR:

third stepOligonucleotide primer

P3F5D-600-203

Fourth step ofOligonucleotide primer P2-4401-601 TMR

TMR-5’GCTCATACTACAATGTCACTTAC 3’(SEQ ID NO 9)

Modification:

TMR is tetramethyl rhodamine connected with chain (P3F5D-600-203) and 5' end of P2-4401-601-TMR

in a control batch, the primer of the primer pair can also bind to the starting nucleic acid strand 1.1 as shown below:

M2SF5-M001-200

the binding sequence of the first oligonucleotide primer is underlined.

PCR primer pair 3 consisting ofThird stepOligonucleotide primers SeqP1F5-35-X02 andfourth step ofThe oligonucleotide primer P2-4401-601 TMR:

third stepOligonucleotide primer SeqP1F5-35-X02

Fourth step ofOligonucleotide primerObject P2-4401-601 TMR

TMR-5’GCTCATACTACAATGTCACTTAC 3’(SEQ ID NO：009)

M2SF5-M001-200：

the binding sequence of the first oligonucleotide primer is underlined.

Nucleotides and nucleotide modifications are linked to each other by phosphodiester bonds.

Taq polymerase (NEB, Cat. No. M0273S) was used in PCR. The polymerase dilution used for each reaction was 1: 100.

The amplification product of the control oligonucleotide-based amplification reaction (first amplification) was used in PCR at a dilution of 1: 5,000 to 1: 500,000,000.

As a control, a reaction mixture without amplified template was also examined (NTC ═ no template control ═ negative control).

In addition, a further control method was used to check whether a control oligonucleotide could be used as a template for the PCR primers. To this end, a control oligonucleotide (SEQ ID NO4 ═ herein referred to as "control 503") previously used during control oligonucleotide-based amplification was provided for amplification in PCR at concentrations ranging from 1 μmol/l to 1 pmol/l.

In another control, a defined amount of template M2SF5-M001-200 was provided for PCR amplification (positive control). The control demonstrates the function of the PCR-primer pair (under ideal conditions). In addition, the sample can be quantified after the first amplification by comparing the received Ct values to a standard dilution series of a positive control. The template M2SF5-M001-200 was tested at concentrations of 1nmol/l to 1 fmol/l.

The third and fourth oligonucleotide primers were each used at a concentration of 0.5. mu. mol/l.

Other reaction conditions were:

1 × isothermal buffer (New England Biolabs); single concentration buffer contained 20mM Tris-HCl, 10mM (NH)₄)₂SO₄、50mM KC1、2mM MgSO₄、0.1％

20; pH at 25 ℃ of 88; dNTPs (dATP, dCTP, dUTP, dGTP), each 200. mu. mol/l;

The thermal reaction conditions chosen were as follows:

20s 95 ℃ activation System

30 cycles, each cycle having the following temperature-time curve

ο1min 55℃

ο3min 72℃

ο20s 95℃

10min 72 ℃ for normalization of amplification products

Melting Curve analysis

Amplification is typically monitored over 30 cycles, 30 × (1min 55 ℃ +3min 72 ℃ +20s 95 ℃) ═ about 30 × 260s ═ 130 min. The success of the amplification depends on the increase of the EvaGreen fluorescent signal over time.

Analysis of detection PCR

The following techniques were used to analytically detect PCR and evaluate the resulting amplification products:

fluorescent signals of intercalating dyes (EvaGreen)

Melting Curve analysis of the resulting amplification product

When analyzing PCR, we only discuss the data obtained with Taq polymerase diluted 1: 100.

In a control experiment using a template (M2SF5-M001-200), it was verified that all three selected PCR primer pairs produced specific PCR products under the PCR conditions used. It was also confirmed that none of the three pairs of primers formed a product starting from the control oligonucleotide. This is the expected result, because all "third" primers used are incorporated in the modified portion of the control oligonucleotide.

Figure 38A shows a typical time course of EvaGreen fluorescent signal obtained by primer pair 1 during amplification in the dilution control oligonucleotide amplification method. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (expressed in cycle number). Arrows mark the different amplification methods. Arrows indicate the following batches:

position of	Detection of dilution of control oligonucleotide amplification batches in PCR batches
		Arrow
1	About 1: 5,000
		Arrow 2	About 1: 50,000
Arrow 3	About 1: 500,000
		Arrow 4	About 1: 5,000,000
Arrow 5	About 1: 50,000,000
		Arrow 6	0mol/l as a negative control

The arrow 6 labeled negative control batch contained no template and therefore did not produce an amplification signal during the experiment.

Depending on the dilution of the control oligonucleotide amplification batch selected, a delayed amplification signal was observed. Dilutions from 1: 5,000 to 1: 50,000,000 can be well resolved under the selected conditions for PCR primer pair 1. The 1: 50,000,000 dilution produced slightly different amplification signals than the negative control (see arrow 5).

Fig. 38B shows the correlated melting curve analysis for reactions 1 to 5 and illustrates the formation of a specific amplification product (Tm — 827 ℃).

FIG. 38B shows a melting curve of the amplification product of primer pair 1 in FIG. 38A. The Y-axis shows the derivative of the fluorescence signal with respect to temperature, while the x-axis shows the temperature. A uniform peak was found, marked with arrow 1. The peak at position 1 with a melting temperature of about 82.7 ℃ belongs to the amplification product of primer pair 1. Melting curve analysis indicated specific amplification.

Figure 39A shows a typical time curve of EvaGreen fluorescent signal obtained by amplification of PCR primer pair 2 from the dilution control oligonucleotide amplification method. On the Y-axis is the fluorescence signal of EvaGreen dye and on the x-axis is the reaction time (in cycles). Arrows mark the different amplification methods. Arrows indicate the following batches:

Position of	Detection of dilution of control oligonucleotide amplification batches in PCR batches
		Arrow
1	About 1: 5,000
		Arrow 2	About 1: 50,000
Arrow 3	About 1: 500,000
		Arrow 4	About 1: 5,000,000
Arrow 5	0mol/l as a negative control

The negative control batch marked by arrow 5 contains no template and therefore does not produce an amplification signal during the experiment.

Depending on the dilution of the control oligonucleotide amplification batch selected, a delayed amplification signal was observed. For PCR primer pair 2, dilutions from 1: 5,000 to 1: 5,000,000 can be well resolved under the selected conditions. A dilution of 1: 5,000,000 produced an amplification signal that was just comparable to that produced by the negative control (arrow 4).

FIG. 39B shows the correlated melting curve analysis of reactions 1 to 4 and clearly shows that specific amplification products have been formed.

FIG. 39B shows a melting curve of the amplification product of PCR primer pair 2 in FIG. 39A. The Y-axis shows the derivative of the fluorescence signal with respect to temperature, while the x-axis shows the temperature. A uniform peak was found, marked with arrow 1. The peak at position 1 with a melting temperature of about 81.9 ℃ belongs to the amplification product of PCR primer pair 2. Melting curve analysis indicated specific amplification.

Figure 40A shows a typical time curve of EvaGreen fluorescent signal obtained from amplification by the dilution control oligonucleotide amplification method by PCR primer pair 3. On the Y-axis is the fluorescence signal of EvaGreen dye and on the x-axis is the reaction time (in cycles). Arrows mark the different amplification methods. Arrows indicate the following batches:

The negative control batch marked by arrow 7 contains no template and therefore does not produce an amplification signal during the experiment.

Depending on the dilution of the control oligonucleotide amplification method chosen, a delayed amplification signal was observed. For primer pair 3, dilutions from 1: 5,000 to 1: 500,000,000 can be well resolved under the selected conditions. The dilution of 1: 500,000,000 produced an amplification signal that was just comparable to that produced by the negative control (see arrows 6, 7).

FIG. 40B shows the correlated melting curve analysis of reactions 1 to 6 and clearly shows that specific amplification products have been formed.

FIG. 40B shows the melting curve of the amplification product of PCR primer pair 3 in FIG. 40A. The Y-axis shows the derivative of the fluorescence signal with respect to temperature, while the x-axis shows the temperature. A uniform peak was found, marked with arrow 1. The peak at position 1, which has a melting temperature of about 81.2 ℃, belongs to the amplification product of PCR primer pair 3. Melting curve analysis indicated specific amplification.

Analysis of the fluorescent signal during amplification (amplification plot) and melting curve analysis at the end of amplification showed that each of the PCR primer pairs 1 to 3 was able to use the diluted amplification product from the first amplification reaction as template.

Depending on the diluent chosen, a delayed amplification signal is produced, which is typical of a dilution series. Using the PCR conditions selected here, amplification products diluted 5,000,000-fold could be detected. The sensitivity of the primer pair 3 is the highest, and even the amplification product diluted by 500,000,000 times can be detected.

FIG. 41 shows a control experiment using a template (M2SF5-M001-200) for 1nmol/l (arrow 1) and 10pmol/l (arrow 2) and an NTC control (arrow 3).

FIG. 41A shows the results of PCR primer pair 1.

FIG. 41B shows the results of PCR primer pair 2.

FIG. 41C shows the results of PCR primer pair 3.

Comparison of the rise time of the fluorescence signal between the control experiment (template) and the second amplification from the first amplified fragment shows that the first amplification results in an increase in amplified fragments that can be used as template in the second amplification.

FIG. 42 shows the course of the first amplification (before PCR).

An increase in signal was visible, which was interpreted as an increase in copy number in the first amplification. Arrow 1 corresponds to the batch with the starting nucleic acid strand 1.1. Arrow 2 ═ NTC control.

Example 4 (fig. 43-47):

combination of first amplification and second amplification in the same batch (homogeneous assay)

In this example, the inventors demonstrate how a control oligonucleotide-based amplification reaction can be combined with a subsequent classical PCR in a homogeneous assay format. Here, the inventors used a highly selective control oligonucleotide-based amplification reaction early in the amplification, and then switched to classical PCR to amplify and detect the amplification product. In contrast to example 3 (heterogeneous assay format), the combination in this example was carried out in a homogeneous assay format. At the beginning of the reaction, all analytical components are available. By varying the temperature control during the reaction, it is possible to switch between control oligonucleotide based amplification and classical PCR.

First, a first amplification product 1.1 is amplified starting from a single stranded starting nucleic acid strand (1.1) using a control oligonucleotide-based amplification reaction, for 15-30 cycles, followed by 30 classical PCR cycles for further amplification and detection of the pre-amplification product. In this example, the intercalating dye EvaGreen was used for detection.

The first amplification system comprises the following components:

·first of allAn oligonucleotide primer;

·second oneAn oligonucleotide primer;

a control oligonucleotide;

The second amplification system comprises the following components:

·third stepAn oligonucleotide primer;

·fourth step ofAn oligonucleotide primer;

polymerase (Taq polymerase), which is a thermostable polymerase; and

Both amplification systems can be used together before the first amplification is started.

In this example, a second oligonucleotide primer was used for both amplifications. Thus, the fourth oligonucleotide primer is identical to the second oligonucleotide primer.

The third oligonucleotide primer is varied.

In this example, the inventors propose 4 different primers, each of which was used individually as a "third oligonucleotide primer".

The respective third oligonucleotide primer is different from the first oligonucleotide primer. Thus, each reaction batch contained three primers: a first oligonucleotide primer and a second oligonucleotide primer (as a component of the first amplification system), and a third oligonucleotide primer that serves as a specific primer for the second amplification system. The second primer of the first amplification system assumes the function of the fourth primer, which is also suitable for the subsequent PCR reaction. For better understanding, the primer binding site of each primer combination is also labeled on the template strand (═ amplification product).

The following starting nucleic acid strands (1.1) were used as single-stranded templates:

M2SF5-M001-200

the binding sequence of the first oligonucleotide primer is underlined.

The second oligonucleotide primer binds to the reverse complement of the double underlined sequence. The binding sequence of the third oligonucleotide primer (P3F5D-600-203) is shown in bold italics.

First amplification System:

first of allOligonucleotide primers: P1F5-200-AE205

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

2-2' -deoxyinosine

One segment of primer [ CUCU GAUGCUUC ] contained a 2' -O-Me modification and served as a second primer region to bind to the first segment of the control oligonucleotide:

u ═ 2' -O-methyluridine

Second oneOligonucleotide primers: P2G3-5270-

The segments used as primers in the reaction are underlined.

The oligonucleotide comprises the following modifications:

6-HEG linker

The following control oligonucleotides were used:

AD-F5--1001--503

Oligonucleotide in brackets [ UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC]The 5 'segment in (a) comprises a 2' -O-Me nucleotide modification:

modification:

u ═ 2' -O-methyluridine

3' phosphate group for blocking possible extension of polymerase

The second amplification system comprises in particular a third oligonucleotide primer (P3 primer) in the following list:

third oligonucleotide primer P3F5D-600-

Modification:

TMR (tetramethylrhodamine) at the 5' position

Third oligonucleotide primer P3F5D-600-

Modification:

TMR (tetramethylrhodamine) at the 5' position

Third oligonucleotide primer P3F5D-600-

Modification:

TMR (tetramethylrhodamine) at the 5' position

Third oligonucleotide primer P3F5D-600-204

A ═ 2' -deoxyadenosine

Modification:

TMR (tetramethylrhodamine) at the 5' position

Nucleotides and nucleotide modifications are linked together by phosphodiester bonds. The 3' end is blocked with a phosphate group to prevent possible extension by the polymerase.

The concentration of the starting nucleic acid strand 1.1 (template) was 1 pmol/l. Concentration at the time of use: primer 1 was 5. mu. mol/l, control oligonucleotide 2. mu. mol/l, primer 2 1. mu. mol/l and primer 3 0.5. mu. mol/l. For amplification, two polymerases were used at dilutions 1: 100 and 1: 200 in batch Taq polymerase (NEB, Cat. No. M0273S2) and in Bst 20 hot start polymerase (NEB, Cat. No. M0538S2), respectively.

In the control reaction, the P3 primer was not used. In a further control reaction, only BST polymerase was used, and no Taq polymerase was used.

Other reaction conditions were:

20; pH at 25 ℃ of 88; dNTPs (dATP, dCTP, dUTP, dGTP), each 200. mu. mol/l;

The thermal reaction conditions were selected according to the following curves:

2min65 ℃ activation System

15 or 30 cycles with the following temperature-time curves (control oligonucleotide-based amplification reaction)

ο2min 55℃

ο2min 65℃

20s 95 ℃ activation System

30 cycles with the following temperature-time curve (detection PCR)

ο1min 55℃

ο3min 72℃

ο20s 95℃

10min 72 ℃ for normalization of amplification products

Melting Curve analysis

The total amplification is usually performed in 45-60 cycles, i.e.:

first amplification: (15 or 30) × (2min 55 ℃ +2min 65 ℃) ═ (15 to 30) × 4min ═ 60 to 120min

The second amplification (PCR) was monitored at 30 × (1min 55 ℃ +3min 72 ℃ +20s 95 ℃) ═ 30 × 260s ═ 130 min. This corresponds to a total time of 190-.

The success of the amplification may depend on the increase in EvaGreen fluorescent signal over time.

The control oligonucleotide-based amplification reaction is analyzed in combination with the detection PCR.

The resulting amplification products were analyzed and evaluated using the following techniques:

fluorescent signals of intercalating dyes (EvaGreen)

Melting Curve analysis of the resulting amplification product

The first partial amplification (15 cycles or 30 cycles) leads to an enrichment of the nucleic acid strand (first amplified fragment 1.1) which can be used as template in the subsequent PCR. This means that less cycles are required for PCR to generate a detectable amount of PCR product. By selecting the number of cycles in the two amplification stages, the amplification fraction of the total amplification of the two amplification reactions can be adjusted.

By comparing this with a number of different control methods, the inventors have shown that by using a first amplification, the number of cycles of a second amplification (PCR) can be reduced until a detectable signal (Ct) is generated. Only when the first amplification (control oligonucleotide based amplification reaction) was successful, the number of PCR cycles would be reduced. Then, a second amplification is performed starting from the first amplification product until detection. Thus, the following classical PCR may also be referred to as detection PCR.

Furthermore, the inventors show that the first amplification system and the second amplification system can be combined in one batch, allowing a homogeneous assay format to be performed.

The results of each reaction batch are shown below.

FIG. 43A shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primer P3F 5D-600-201. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (in cycles). In cycles 1 to 15, control oligonucleotide-based amplification reactions were used. From cycle 15 to cycle 45, classical PCR (detection PCR) was used. The switching time (end of cycle 15) is marked with arrow 1.

Arrow 2 indicates an amplification method in which BST and Taq polymerase were used to amplify the template M2SF5-M001-200 starting at an initial concentration of 1 pmol/l.

Arrow 3 represents a control run containing only BST polymerase. Since the temperature profile in the PCR to be tested is denatured from cycle 16 by the thermosensitive BST polymerase, amplification is omitted. Amplification products that have formed in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

Arrow 4 represents another control method in which the addition of primers P3F5D-600-201 was omitted. An amplified signal is now no longer observed, since exponential amplification in the detection PCR is not possible without the third primer. Amplification products that have been generated in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

FIG. 43B shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primer P3F 5D-600-202. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (in cycles). In cycles 1 to 15, control oligonucleotide-based amplification reactions were used. From cycle 15 to cycle 45, classical PCR (detection PCR) was used. The switching time (end of cycle 15) is marked with arrow 1.

Arrow 4 marks another control method in which the primers P3F5D-600-202 were not added. An amplified signal is now no longer observed, since exponential amplification in the detection PCR is not possible without the third primer. Amplification products that have been generated in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

FIG. 44A shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primer P3F 5D-600-203. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (in cycles). In cycles 1 to 15, control oligonucleotide-based amplification reactions were used. From cycle 15 to cycle 45, classical PCR (detection PCR) was used. The switching time (end of cycle 15) is marked with arrow 1.

Arrow 4 marks another control method in which primers P3F5D-600-203 were not added. An amplified signal is now no longer observed, since exponential amplification in the detection PCR is not possible without the third primer. Amplification products that have been generated in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

FIG. 44B shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primers P3F 5D-600-204. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (in cycles). In cycles 1 to 15, control oligonucleotide-based amplification reactions were used. From cycle 15 to cycle 45, classical PCR (detection PCR) was used. The switching time (end of cycle 15) is marked with arrow 1.

An alternative control method is marked by arrow 4, in which the primers P3F5D-600-204 are not added. An amplified signal is now no longer observed, since exponential amplification in the detection PCR is not possible without the third primer. Amplification products that have been generated in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

It appears that the combination of control oligonucleotide based amplification reaction and (classical) detection PCR with any of the 4 variants of primer 3 (P3F5D-600-201 through P3F5D-600-204) in a homogeneous assay format was successful. The combined use of BST and Taq polymerase is important. Also important is a third primer, without which no amplification signal can be detected. The behavior of the variants of primer 3 was quite independent, as can be seen from the different time points at which the amplified signal started to stand out from baseline. The earlier the amplification signal is detected in the detection PCR, the more effective each variant of primer 3 is in detecting the previously generated control oligonucleotide-based amplification product.

We have now shown that doubling the number of cycles of a control oligonucleotide-based amplification reaction at an early amplification stage leads to qualitatively very similar results.

FIG. 45A shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primer P3F 5D-600-201. The Y-axis shows the fluorescence signal of EvaGreen dye and the X-axis shows the reaction time (in cycles). Control oligonucleotide-based amplification reactions were used for cycles 1 to 30. From cycle 31 to cycle 60, classical PCR (detection PCR) was used. The switching time (end of cycle 30) is marked with arrow 1.

FIG. 45B shows a typical course of EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 and primer P3F 5D-600-203. The Y-axis shows the fluorescence signal of EvaGreen dye and the x-axis shows the reaction time (in cycles). Control oligonucleotide-based amplification reactions were used for cycles 1 to 30. From cycle 31 to cycle 60, classical PCR (detection PCR) was used. The switching time (end of cycle 30) is marked with arrow 1.

Arrow 2 represents an amplification batch in which BST and Taq polymerase amplify the template M2SF5-M001-200 starting at an initial concentration of 1 pmol/l.

Arrow 3 represents a control batch containing only BST polymerase. Since the temperature profile in the PCR to be tested is denatured from cycle 16 by the thermosensitive BST polymerase, amplification is omitted. Amplification products that have formed in control oligonucleotide-based amplification reactions remain hidden below the detection threshold for EG.

Fig. 46 shows a comparison of the time intervals between combined amplification (including first and second amplifications) and PCR alone (second amplification only).

The first amplification was performed as described above. In the second reaction, a third oligonucleotide primer (P3F 5D-600-. The batch was pipetted and the reaction was carried out as described above. As indicated above, control-dependent amplification was first performed in the combined batch (here 15 cycles) and then switched to PCR (arrow 1).

Time intervals

1 and 2 are compared.

Arrow 2 shows the course of combinatorial amplification (both Bst and Taq polymerase in the batch). Before the first amplification started, the batch contained 1pmol/l of starting nucleic acid strands (template). The increase in fluorescence signal occurs after time interval 1.

Arrow 3 represents the course of a control batch in which Bst is omitted, so the first amplification reaction is "terminated" (although all components of the first amplification system are in the batch, the correct polymerase is absent (Bst 20 polymerase in this case)). Before the first amplification started, the batch contained 1pmol/l of starting nucleic acid strands (template). The increase in fluorescence signal occurs after time interval 2. Although Taq polymerase can also synthesize products from the same template, PCR itself requires more cycles.

Arrow 4 shows the course of the combined batch without the starting nucleic acid strand 1.1 (no template ═ NTC control).

Overall, it can be seen that by increasing the number of amplified fragments 1.1 in the first amplification process, which amplified fragments 1.1 can then be used as starting nucleic acid strands 2.1 (templates) in PCR, the PCR fragments reacted in batch 2 are generated more rapidly overall: PCR requires fewer cycles until a detectable amount of the second amplification product is produced (2.1). Time interval 1 is shorter than time interval 2.

Fig. 47 shows a comparison of the time intervals between combined amplification (including first and second amplifications) and PCR alone (second amplification only).

The first amplification was performed as described above. In the second reaction, a third oligonucleotide primer (P3F 5D-600-. The batch was pipetted and the reaction was carried out as described above. As shown above, control-dependent amplification was first performed in the combined batch (here 30 cycles) and then switched to PCR (arrow 1).

Time intervals

3 and 4 are compared.

Arrow 2 shows the course of combinatorial amplification (both Bst and Taq polymerase in the batch). Before the first amplification started, the batch contained 1pmol/l of starting nucleic acid strands (template). The increase in fluorescence signal occurs after time interval 3.

Arrow 3 represents the course of a control batch in which Bst is omitted, so the first amplification reaction is "terminated" (although all components of the first amplification system are in the batch, the correct polymerase is absent (Bst 2.0 polymerase in this case)). Before the first amplification started, the batch contained 1pmol/l of starting nucleic acid strands (template). The increase in fluorescence signal occurs after time interval 4. Although Taq polymerase can also synthesize products from the same template, PCR itself requires more cycles.

As can be seen overall, by increasing the number of amplified fragments 1.1 in the first amplification process, which amplified fragments 1.1 can then be used as starting nucleic acid strands 2.1 (templates) in PCR, the generation of PCR fragments makes the reaction in batch 2 overall faster: PCR requires fewer cycles until a detectable amount of the second amplification product is produced (2.1). Time interval 3 is shorter than time interval 4.

Example 5 (fig. 48-49, 71): amplification of human FVL target sequences with mutations in the presence of human genomic DNA having wild-type sequence variants

This example shows the selective amplification of a target sequence comprising a polymorphic locus comprising two sequence variants (mutant or wild-type) (SNP variant of the coagulation factor V Leiden gene, FVL gene).

The components of the first amplification system (first primer, second primer, control, polymerase) and the reaction conditions are chosen such that the nucleic acid to be amplified (amplified fragment 1.1 comprising the two primer extension products P1.1-Ext and P2.1-Ext)) preferably comprises a sequence variant having a mutation in the FVL gene. The wild type sequence variant (WT sequence) should not be significantly amplified during the first amplification operation. The first amplification starts with a starting nucleic acid 1.1, which starting nucleic acid 1.1 is obtained using single-stranded human gDNA (template comprising the target sequence) as primer extension product. Amplification is performed until the desired level of amplified fragments is reached. The product generated in the first amplification (amplified fragment 1.1) can serve as a template (starting nucleic acid 21) for the second amplification (PCR).

The components of the second amplification system (third primer, fourth primer, polymerase) and the reaction conditions (PCR amplification) are selected such that two variants of the target sequence can be amplified. After the first amplification, a second amplification (PCR) is performed in a separate step.

The schematic morphology of the first and second amplification systems is shown in FIG. 71. The primers of the second amplification system are in a "nested form" relative to the primers of the first amplification system.

The obtained first amplified product (amplified fragment 1.1) and second amplified product (amplified fragment 21) were detected and analyzed by different methods. One detection method comprises real-time detection by intercalating dyes (EvaGreen dyes), another detection method comprises real-time detection by sequence-specific oligonucleotide probes (Taqman probes) which allow to distinguish between the mutations and the wild-type variants according to the sequence variants, and another analysis method comprises Sanger sequencing of the amplified fragments obtained in the amplification.

Sequence-specific amplification was demonstrated in a number of ways. First, amplification of the target sequence comprises a mutant variant (either by the first amplification alone or by combining the first and second amplifications). Second, amplification of a target sequence comprising one mutant variant was achieved in the presence of about 30,000 copies of human gDNA with the wild-type variant (100 or 10 copies). Furthermore, it can be shown that under selected conditions no measurable amplification (5000 copies) of the target sequence with the wild-type variant occurs.

Materials and methods:

target sequence:

the following variants were selected as target sequences with polymorphic loci:

FVL sequence variants with mutations:

wild-type sequence variants:

both sequences are derived based on information available from NCBI:

homo sapiens chromosome 1, grch38.p12 primary assembly, sequence ID: NC _000001.11

Factor V with SNP 1691G > A (substitution), codon 506.

Components of the batch for preparing the starting nucleic acid 1.1

Human gDNA: WHO Standard 04/224 for human gDNA for the FVL Gene

Mutant-carrying variants of human DNA (03/260 factor V Leiden homozygote) (FVL mutation)

Wild type carrying variant human gDNA (03/254 wild type factor V) (WT sequence)

Oligonucleotide primers

P1F5G2-2001-203(SEQ ID NO 19)

1＝C3

The underlined sequence consists of 2'-OMe modified nucleotides (2' -O-methyl nucleotides) and corresponds to the second region of the first primer.

Bst 2.0 Hot Start DNA polymerase (NEB 120,000 units/ml) (1: 1000 dilution used in the reaction), also known as "Bst polymerase"

First amplification System

First oligonucleotide primer P1F5G2-1001-

1＝C3

The underlined sequence consists of 2' -OMe modified nucleotides and corresponds to the second region of the first primer.

Blocking oligonucleotides: B1-P1F5G2-3501-304

2＝HEG

X is 3' -phosphate group

The underlined sequence in parentheses consists of 2' -OMe modified nucleotides.

Control-oligonucleotide: CF5G2-1002-401(SEQ ID NO 22)

X is 3' -phosphate group

The sequence in parentheses consists of 2' -OMe modified nucleotides.

Second oligonucleotide primer

P2-HAF5-081-1051(SEQ ID NO 23)

6＝HEG

Bst 2.0 Hot Start DNA polymerase (NEB 120,000 units/ml), also known as "Bst polymerase"

The concentrations of the components were as follows:

human gDNA (from Promega, "human males") was added in single stranded form to the first amplified batch at a concentration of approximately 100ng per batch (12. mu.l). This simulates a test system with a complex genetic background. Human gDNA contains pooled samples (about 30,000 copies per batch).

Second amplification System (EvaGreen detection)

Third oligonucleotide primer: P3F5G2-1001-

5' -CTCGACACTACTTCAAGGACAAAATacctgtattcc (SEQ ID NO 24) (used at a concentration of 0.5. mu. mol/l)

A fourth oligonucleotide primer: P4F5G2-1001-401

5' -ctc tgggctaata ggactacttc taatatgtaa gagca gat (SEQ ID NO 25) (used at a concentration of 0.5. mu. mol/l)

Taq polymerase Hot Start (NEB 5,000 units/ml) (used in the reaction at a dilution of 1: 100)

Detection Using EvaGreen dye (Jena Biosciences Stock 1: 50)

The third and fourth primers are designed in a "nested fashion" in relation to the first and second primers, respectively.

Oligonucleotide probes for detection of FVL system in the second amplification:

second amplification System (Probe detection)

Third oligonucleotide primer: P3F5G3-1001-3303-4

5' -ACTTCAAGGACAAAATacctgt att (SEQ ID NO 26) (used at a concentration of 0.5. mu. mol/l)

A fourth oligonucleotide primer: P4F5G3-1001-3404-2

5' -ATATGTAA GAGCA GAT CCC (SEQ ID NO 27) (used at a concentration of 0.5. mu. mol/l)

Oligonucleotide probe detection

Probe oligonucleotide S1P4-FVL-1007 for specific detection of FVL mutation

5’-FAM-TTGACAGGCAAGG AA 3' -MGB-NFQ (SEQ ID NO 28) (von Thermofisher) (used at a concentration of 0.2 pmol/l)

Probe oligonucleotides for WT specific detection: S1P4-FVL-1003-1

5’-NED-TTCTGGACAGGCGAGG 3' -MGB-NFQ (SEQ ID NO 29) (von Thermofisher) (used at a concentration of 0.6. mu. mol/l)

The discriminating bases are underlined.

NFQ ═ non-fluorescent quencher (Blackhole series quencher)

These probes are examples of "Taqman probes" with a fluorescence reporter and a fluorescence quencher.

Buffer solution:

all reactions were performed in the same buffer. 1 Xbuffer component (NEB)

20mM Tris-HCl

10mM(NH₄)₂SO₄

50mM KC1

2mM MgSO₄

0.1％

20

pH at 25 ℃ was 8.8

Alternatively, EvaGreen dye (Jena Biosciences) (used in the reaction at a dilution of 1: 50)

dNTP mix of Bst polymerase: dATP, dCTP, dGTP, each 200. mu. mol/L, dUTP 400. mu. mol/L

dNTP mix for Taq polymerase: dATP, dCTP, dGTP, dTTP, each 200. mu. mol/L

The method comprises the following steps:

preparation of starting nucleic acids for the first amplification

First, a starting nucleic acid 1.1 (10 min at 50 ℃) comprising a target sequence starting from a single-stranded human genomic DNA (WHO standard for FVL and WT sequence variants) was synthesized by a primer extension method with Bst polymerase using a primer (P1F5G2-2001-203 with an insertion concentration of 0.2. mu. mol/l); the starting nucleic acid 1.1 is then detached from the template strand by thermal denaturation at 95 ℃ (5 mid). The starting nucleic acid 1.1 of the sequence variant of the target sequence with the FVL mutation and the wild type mutation is produced batchwise. Approximately 100,000 copies of human gDNA were used per batch. The primers used herein are similar in structure to the first oligonucleotide primer P1F5G 2-1001-103.

After primer extension a starting nucleic acid 1.1 is obtained, which comprises a primer extension product having a sequence segment complementary to the target sequence and an overhang at the 5' end. In a first amplification, such starting nucleic acids can serve as templates: the second primer can bind sequence specifically to this starting nucleic acid 1.1 and can be extended by a polymerase. The control oligonucleotide may be bound to the overhang at its first region.

Performing a first amplification and detection:

the starting nucleic acid 1.1 (with FVL mutation and/or WT sequence) was added to the amplification batch at different dilutions (100 copies, FVL mutation 10 copies, WT sequence 5000 copies).

The reaction is carried out under a cyclic temperature variation of 50 ℃ to 65 ℃.

At this temperature, no spontaneous decay of the specific amplification problem occurs. One cycle included incubation at 50 ℃ (2min) and 65 ℃ (4 min). These batches were incubated for various times (up to about 15 h). The signal of the intercalating dye EvaGreen was detected during the reaction. After the reaction was completed, the melting curve was measured. Amplification results in an increase in the amount of double stranded DNA (amplified fragment 1.1) capable of storing intercalating dyes, resulting in an increase in the signal of EvaGreen.

The amplified fragment 1.1 synthesized during this reaction can be used as a template for a second amplification or Sanger sequence analysis.

A second amplification and detection (EvaGreen) was performed:

the products of the first amplification were diluted 1: 6000 before being used in the second amplification. The amplified fragment present in the dilution batch was used as starting nucleic acid 2.1 for the PCR reaction. The PCR reaction was performed for 40 cycles. One cycle includes: 55 ℃ for 1min, 68 ℃ for 3min and 95 ℃ for 20 s. Detection was performed with EvaGreen dye. By observing the increase in signal (Ct value), the relative amount of template added at the beginning of the reaction can be estimated. The amplified fragment 2.1 synthesized in the second amplification can be used for Sanger sequencing.

Second amplification and detection (probe oligonucleotide) was performed:

the products of the first amplification were diluted 1: 6000 before being used in the second amplification. The amplified fragment present in the dilution batch was used as starting nucleic acid 2.1 for the PCR reaction. The PCR reaction was performed for 40 cycles. One cycle includes: 57 ℃ for 1min, 95 ℃ for 20 s. Detection was performed with sequence-specific oligonucleotide probes (Taqman probe with fluorescent reporter and MGB from thermolfisher). By observing the increase in signal (Ct value), the relative amount of template added at the beginning of the reaction and the sequence composition in the relevant sequence portion of the synthetic product can be estimated.

Results and evaluation:

in the first amplification, starting from the starting nucleic acid 1.1 (target sequence with FVL mutant sequence variant), an increase in signal was detectable in batches (EvaGreen dye) at initial concentrations of approximately 100 and 10 copies per batch (fig. 48,

arrows

1 and 2, where a) signal curve during amplification, B) melting curve). In batches starting from the starting nucleic acid (target sequence with WT variant, initial concentration of approximately 5000 copies per batch), no increase in signal was detected (fig. 48, arrow 3). The signal was at the batch level with no starting nucleic acid. After the first amplification is complete, an aliquot is taken, diluted and added to the second amplification.

The second amplification was based on the dilution of the completed batch of the first amplification (final dilution 1: 6000). The second amplification uses third and fourth primers nested on the first and second primers. The second amplification showed an increase in specific signal in all batches of the first amplification, with amplified fragments derived from the starting nucleic acid 1.1, which starting nucleic acid 1.1 had the target sequence of the FVL mutant variant (fig. 49 arrow 2, wherein a) signal progress during amplification, B) melting curve). The signal increase occurred early in the PCR process (Ct values of about 5 or 8), indicating that the first amplification produced a high concentration of amplified fragments. In the batches starting from the starting nucleic acid 1.1 with the wild-type variant target sequence, a signal was observed (FIG. 49, arrow 3, Ct value of about 25), which is at the batch level without starting nucleic acid (FIG. 49, arrow 4, Ct value of about 25). Comparison of the time points of signal increase (Ct values) in these batches shows that the number of amplified fragments with FVL mutation at the end of the first amplification is significantly greater than the number of amplified fragments with wild type DNA. Considering the starting nucleic acid used in the first amplification (10 copies of FVL sequence variant versus 5000 copies of wild type DNA), it was observed that amplification of FVL sequence variants was significantly better than wild type variants. The composition of the amplification products (FVL sequences) of the individual reactions was further confirmed by Sanger analysis and probe-based detection.

This result indicates that the target sequence is specifically amplified during the first amplification. The amplified fragments synthesized in the first amplification can be used as templates in the second amplification.

During the first amplification, the distinction between the two variants of the target sequence is made by the influence of a control oligonucleotide, which is designed to be complementary to the target sequence with the mutation. Thus, the control oligonucleotide comprises a mismatch at one nucleotide position to the wild-type variant of the target sequence. The control oligonucleotide is designed such that the polymorphic locus of the target sequence is located in the third region of the control oligonucleotide. Thus, the polymorphic locus is located in a sequence segment of the target sequence that is 3 'of the first primer and 3' of the second primer. Primers used alone will not be able to distinguish between each sequence variant in the polymorphic locus of the target sequence.

During the first amplification, mainly those products having a sequence that is completely complementary to the third region of the control (having the mutated FVL target sequence) are selectively amplified. In this example, an advantageous embodiment of the reaction conditions is chosen in which on the one hand the primer concentration is lower than the concentration of the control oligonucleotide and on the other hand a cyclic temperature variation (50 ℃ to 65 ℃) is used.

In the oligonucleotides used, the oligonucleotide primers form an interactive pair with a corresponding control oligonucleotide (e.g., a first oligonucleotide primer and a first control oligonucleotide). The interaction pair has a melting temperature of about 63 ℃ under the amplification reaction conditions (measured at a concentration of about 1. mu. mol/l for both components under amplification buffer conditions). At a melting temperature of about 50 ℃, the first region of the oligonucleotide primer forms a complex with the complementary sequence portion of the template (e.g., the first segment of the first primer and the second primer extension product (P2.1-Ext) measured at a concentration of about 1 μmol/l of the two components under amplification buffer conditions).

Depending on the embodiment, the primers and control oligonucleotides may be used in different ratios.

In an advantageous embodiment, a primer-control combination is used, wherein the concentration of the primer is higher than the concentration of the control (e.g.5. mu. mol/l of the first primer and 2. mu. mol/l of the control, see examples 1-3). In this embodiment, there is an excess of primer, so that the primer extension step at a temperature of 50 ℃ gives good yields despite the partial binding of the oligonucleotide primer to the control oligonucleotide.

In another advantageous embodiment (example 5), a mixture of primers and corresponding control oligonucleotides is used, wherein the concentration of the primers is lower than the concentration of the control oligonucleotides (e.g.0.5. mu. mol/l of primers and 2. mu. mol/l of control). Thus, the control oligonucleotide was in excess. In such embodiments, lowering the reaction temperature to 50 ℃ results in rapid binding of the oligonucleotide primer to the control oligonucleotide. This reduces the yield of the primer extension step at 50 ℃ and reduces the amplification rate. In order to maintain a sufficient primer concentration even at low temperatures and thus to increase the yield of the primer extension step, so-called blocking oligonucleotides are used. This blocking oligonucleotide competes with the oligonucleotide primer for binding to the control oligonucleotide, but is not itself extendable by the polymerase.

By using blocking oligonucleotides, a combination of oligonucleotide primers and control oligonucleotides can be used over a range of concentrations and combined with cyclic temperature changes. This results in an increase in the reaction rate.

The structure of the blocking oligonucleotide is substantially similar to that of the oligonucleotide primer, with the following differences:

the blocking oligonucleotide is not extended by the polymerase. This can be achieved, for example, by blocking the 3 'end with modifications (e.g., 3' -phosphate, 3 '-C3, dideoxynucleotides) and/or introducing a terminal mismatch to the 3' end of the blocking oligonucleotide.

The sequence composition of the blocking oligonucleotide may differ from that of its corresponding primer. The number of sequence mismatches can be from 1 to 20 nucleotides.

When designing blocking oligonucleotides, it is advantageous to maintain the Tm of the blocking oligonucleotide to the control oligonucleotide in a range close to the Tm of the oligonucleotide primer and the control oligonucleotide. As a result, the blocking oligonucleotide and the oligonucleotide primer compete for binding to the control oligonucleotide at a similar level (e.g., Tm. + -. 3 ℃ for primer-control complex). By using a higher concentration of blocking oligonucleotide compared to the oligonucleotide primer, the binding rate can be favorably influenced.

Other examples of embodiments of the invention

Fig. 1 schematically shows an extract and product of amplification comprising a first amplification (fig. 1A) (first partial amplification) and a second amplification (fig. 1B) (second partial amplification) using components of the first amplification system and the second amplification system. The reaction starts with a starting nucleic acid 1.1, which starting nucleic acid 1.1 comprises the target sequence and serves as a template to start the first partial amplification.

The components of the first amplification system are, inter alia: a first oligonucleotide primer (P1.1), a second oligonucleotide primer (P2.1), a control oligonucleotide (C1.1) and a first polymerase (Pol 1.1), dNTPs.

Specific amplification of a first amplified fragment 1.1 comprising a first primer extension product P1.1-Ext and a second primer extension product P2.1-Ext occurs during the first partial amplification (A1.1). The primer extension product P1.1-Ext achieves a template-dependent extension of P1.1 by the polymerase under the reaction conditions of the first partial amplification. Primer extension product 2.1-Ext is due to template-dependent extension of P2.1 under the reaction conditions of the first partial amplification. Both primers P1.1 and P2.1 comprise a sequence segment which can bind complementarily to the target sequence or to its complementary sequence segment, so that the primers are located at both ends of the target sequence.

The amplification product 1.1 formed during the first partial amplification can be used as starting nucleic acid 2.1 for the second partial amplification (A2.1). Amplifying a second amplified fragment 2.1 during the second partial amplification, the second amplified fragment 2.1 comprising a third primer extension product P3.1-Ext and a fourth primer extension product P4.1-Ext, wherein the primer extension product P3.1-Ext is formed by template-dependent extension of P3.1 and by a polymerase, and the primer extension product 4.1-Ext results from template-dependent extension of P4.1 under the reaction conditions of the second partial amplification. Both primers P3.1 and P4.1 comprise a sequence segment which binds complementarily to the target sequence or to its complementary sequence segment. Although P1.1 and P3.1 can bind complementarily with their 3' segments to the control oligonucleotides, they are not extended by the polymerase used due to the modification of the control oligonucleotides.

Figure 2 schematically shows the first amplified educts and products. Specific amplification of a first amplified fragment 1.1 comprising a first primer extension product P1.1-Ext and a second primer extension product P2.1-Ext during the first partial amplification. The primer extension product P1.1-Ext is obtained from the template-dependent extension of P1.1, and the primer extension product 2.1-Ext is generated from the template-dependent extension of P2.1.

The synthetic products formed during the reaction (P1.1-Ext and P2.1-Ext) can form complexes of different forms between them and with the control oligonucleotide (depending on the concentration ratio and the reaction conditions). In detail, these forms may comprise complexes of P1.1-Ext/C1.1 and/or P1.1-Ext/C1.1/P2.1-Ext.

P1-Ext comprises a 3' segment comprising a sequence portion that can bind substantially complementarily to the P4.1 primer under the reaction conditions of the second partial amplification. P2-Ext comprises a 3' segment comprising a sequence portion that can bind substantially complementarily to the P3.1 primer under the reaction conditions of the second partial amplification.

FIG. 3 shows a temperature profile (FIG. 3A) and a product accumulation diagram (copy number increased in a time-dependent manner) for two sub-amplifications during the first and second sub-amplifications (FIG. 3B).

The first partial amplification fraction A1.1 is carried out under temperature conditions in which nonspecific spontaneous strand separation is not allowed to occur in the absence of specific control oligonucleotides. Basically, the reaction takes place between temperatures T1 and T2. At a lower temperature (T1), hybridization of at least one primer of the first amplification system and its extension by the polymerase takes place, in particular, and at a second temperature (T2), separation of P1-Ext from P2-Ext takes place, in particular with the aid of a control oligonucleotide. The reaction is carried out with cyclic variations in the reaction temperature, wherein the desired number of cycles can be selected and the extent of amplification can be influenced. Here, a schematic is shown increasing from about 10 copies to about 108 copies (fig. 3B). Furthermore, it is shown here schematically that after the completion of the first partial amplification, a portion of the product formed (amplification product 1.1) has been transferred as an aliquot into the second partial amplification and can be used as starting nucleic acid strand for the second partial amplification. Thus, when the batch is diluted after the first part of the reaction, only a portion of the copy number formed in the first reaction is transferred to the second reaction. The components of the first amplification system are also diluted, thereby reducing their effect on the second amplification system due to the low concentrations that are produced.

FIG. 3A also schematically shows the sequence of the second partial amplification (A2.1), wherein the temperature conditions used are selected such that the isolation of the resulting amplification product at temperature (T3) is predominantly non-specific under the thermal destabilization of the bond between the two strands of the synthesized complementary primer extension product, and without substantial participation of the control oligonucleotide. Primer binding and extension at T1 was similar to that in the first amplification. The reaction proceeds essentially like a PCR, where the necessary number of PCR cycles are performed to generate the desired copy number. The reaction involves binding of the primer to the template, which extends until the corresponding primer extension product is formed and the strands formed are separated by temperature. PCR begins with an initial copy number of a first amplification product 1.1 comprising about 105 target sequences, and amplifies an amplification product 2.1 comprising a target sequence to about 10¹⁰And (4) copying.

The first amplification is carried out in the presence of control oligonucleotides under conditions which lead to sequence-dependent separation of the synthesized strands. The second amplification is performed as a PCR, where strand separation is primarily sequence non-specific.

FIG. 4 schematically shows the temperature profile (FIG. 4A) and product accumulation profile (copy number increased in a time-dependent manner) for two partial amplifications during the first and second partial amplifications (FIG. 4B). The reaction proceeds as shown in FIG. 3, except that the components of the second amplification system are added to the batch of the first partial amplification, so that the number of copies of the first amplified fragment 1.1 formed constitutes the initial amount of starting nucleic acid 2.1 for the second partial amplification and no significant dilution of the components of the first amplification system occurs.

Fig. 5 schematically shows starting materials and products of amplification comprising a first partial amplification (fig. 5A) followed by a second partial amplification (fig. 5B) using components of a first amplification system and a second amplification system. The reaction was carried out essentially as shown in FIG. 1, except that primers P3.2 and P4.2 were used during the second partial amplification, which primers did not contain a sequence fragment essentially complementary to the 3' end of P1.1-Ext and P2.1-Ext, respectively. Thus, the P1.1-Ext and P2.1-Ext products with 3' ends cannot complementarily bind to the primers P3.2 and P4.2, respectively, extended by the polymerase (e.g., Pol 1.1 or Pol 2.1). This prevents excessive extension of P1.1-Ext and P2.1-Ext when primers P3.2 and P4.2 are used under the reaction conditions of the first partial amplification. During the second partial amplification, the complete P3.1-Ext and P4.1-Ext products are formed during the cyclic synthesis process and its proliferation process. By using such a combination of primers (a first set comprising P1.1 and P2.1 and a second set comprising P3.1 and P4.1), a homogeneous reaction can be designed in which both sets of primers are provided in the same reaction batch at the start of amplification.

FIG. 6 schematically shows the temperature profile (FIG. 6A) and product accumulation profile (copy number increased in a time-dependent manner) for two partial amplifications during the first and second partial amplifications (FIG. 6B).

The figure schematically shows a temperature profile where two partial amplifications were performed next to each other (both sets of primers were present in the batch at the beginning of the reaction). Schematically, it is shown that during the first amplification, the copy number of the amplification product 1.1 increases from about 10 to about 10⁴. These products contain the target sequence and serve as starting nucleic acids for the second amplification 2.1. During the second amplification, the number of amplified target sequences is from about 10 of the amplification product 1.1⁴Further increase to about 10 of the resulting amplification product 2.2¹⁰And (4) respectively.

FIG. 7A schematically shows temperature profiles for two partial amplifications. The temperature change sequence in fig. 7A corresponds to the sequence described in fig. 3: the first amplified segment A1.1 is carried out under temperature conditions in which non-specific spontaneous strand separation is not allowed to occur in the absence of specific control oligonucleotides. Basically, the reaction takes place between temperatures T1 and T2. Hybridization of at least one primer of the first amplification system and its extension by the polymerase are carried out, in particular, at a lower temperature (T1), and separation of P1-ext from P2-ext, in particular, with the participation of a control oligonucleotide, is carried out at a second temperature (T2). During the reaction, the first amplification product 1.1 is amplified, which can be used as starting nucleic acid 2.1 in the second partial amplification. The reaction is carried out with cyclic variations in the reaction temperature, wherein the desired number of cycles can be selected and the extent of amplification can be influenced. FIG. 7A also schematically shows the course of a second partial amplification (A2.1) which is carried out immediately after the first partial amplification, wherein the temperature conditions used are such that the isolation of the resulting amplification product at temperature (T3) is predominantly non-specific due to the thermal destabilization of the bonds between the two strands of the synthesized complementary primer extension product, and without the substantial involvement of control oligonucleotides. Primer binding and extension at T1 was similar to that in the first amplification. The reaction proceeds essentially like a PCR, where the necessary number of PCR cycles are performed to generate the desired copy number. The reaction involves binding of the primer to the template, which extends until the corresponding primer extension product is formed and the strands formed are separated by temperature. The first amplification is carried out in the presence of control oligonucleotides under conditions which lead to sequence-dependent separation of the synthesized strands. The second amplification occurs with PCR, where strand separation is primarily sequence non-specific.

FIG. 7B shows the first and second amplifications shown in FIG. 7A. Both reactions are separated by another temperature step (referred to herein as the "temperature switching step") which involves raising the temperature to about T3 over a period of time. During said step, for example, inactivation of the polymerase of the first partial amplification and/or inactivation of the polymerase of the second partial amplification and/or activation of the thermolabile primer may occur. By such a procedure, the activity of the components of the amplification system is also changed.

FIG. 8 schematically shows temperature profiles for two partial amplifications. The first amplified sequence corresponds to the sequence depicted in fig. 7A. The second amplification stage is divided into two stages. During the first phase (a2.1 phase 1), the temperature was varied between T1 and T3. During T1, at least one primer of the second amplification system may bind to its corresponding complementary position in the amplification product 1.1 and be extended. By using lower temperatures, primers with relatively short 3' segments can be used, which can bind complementarily (as shown in FIG. 5). Stage 1 may comprise several cycles, wherein an initial amplification product 2.1 is formed, which comprises a longer complementary segment and is therefore able to bind primers at higher temperatures. This allows the primer binding and primer extension steps (shown here as cyclic extension between T2 and T3) to be performed using higher temperatures in phase 2. By raising the temperature, for example, the development of side reactions can be counteracted.

Fig. 8B schematically shows that the temperature is further reduced to a temperature T4 during phase 1 of a2.1, for example, so that primers of the second set can bind. The use of temperature T4 in stage 1 may be due to the use of a second set of at least one primer comprising at least one mismatch with the complementary sequence segment of the first amplification product. Low temperature (T4) was used to support the initial generation of primer extension products starting from P3.1 and/or P4.1. After this initial generation, the temperature of the step with primer binding and primer extension can be increased (stage 2) since there is now a perfectly complementary primer binding site.

FIG. 9A schematically shows temperature profiles for two partial amplifications. The first amplification was performed at a uniform temperature, here T2. All necessary steps of the first partial amplification are carried out at this temperature. For example, this may be followed by a temperature increase (temperature switching step) (as shown in fig. 7B). The PCR reaction was then performed as a second partial amplification.

The first partial amplification is carried out at a homogeneous temperature, which facilitates sequence-dependent strand separation with the aid of control oligonucleotides.

FIG. 9B schematically shows another temperature profile for the first partial amplification, which includes an isothermal phase (at the beginning) and a subsequent cycling phase. In this case, the first partial amplification is also carried out in the presence of control oligonucleotides at a temperature which promotes the separation of the sequence-dependent strands.

FIG. 10A schematically shows temperature profiles for two partial amplifications. The second partial amplification in stage 2 involves the use of another temperature T5, which is higher than T2. The temperature is between about 68 ℃ and 82 ℃. The use of temperature T5 can impair binding of the control oligonucleotide to P3.1 Ext and thus reduce the effect of such binding on P4.1 extension, such that extension of P4.1 can be more efficient.

FIG. 10B schematically shows temperature profiles for two partial amplifications. During the second partial amplification segment, initial generation of the second amplification product occurs in stage 1. When primers 3.1 and 4.1 are used which bind to the complementary position at a higher temperature (T5) and are extendable by the polymerase, the temperature of the second stage can be varied between T5 and T3. The choice of reaction conditions can affect the formation of intermediate or final products. For example, P3.1-Ext and P4.1-Ext are preferably accumulated by using higher temperatures and longer P3.1 and P4.1 (e.g., 30-40 nucleotides in length) in the primer binding step and primer extension step in the second partial amplification (e.g., at T2 and/or T5).

FIG. 11 schematically shows temperature profiles for two partial amplifications. The transition phase between the two partial amplifications can be designed differently. FIG. 11A shows the continuous increase in temperature towards the end of the first partial amplification. FIG. 11B shows the cyclical decrease in temperature at the end of the first partial amplification. Thus, the two segments of the partial amplification may overlap during the reaction.

FIGS. 12-18 show the relationship between the components of the first amplification system (up to FIG. 14) and the relationship between the components of the first and second amplification systems. FIG. 15A schematically shows the generation of a first amplified fragment (comprising P1.1-Ext and P2.1-Ext) starting from a starting nucleic acid 1.1, which is here schematically added to the reaction as nucleic acid to be amplified. FIG. 15B schematically shows the generation of intermediates generated using first amplified primers P3.1 and P4.1 and P1.1-Ext and P2.1-Ext as templates (P3.1-Ext Part 1 and P4.1-Ext Part 1). These intermediates can be converted to intact P3.1-Ext and P4.1-Ext in subsequent cycles by again performing primer binding and extension using P3.1-Ext Part 1 and P4.1-Ext Part 1 as templates. The choice of conditions will affect the formation of intermediate or final products. For example, P3.1-Ext and P4.1-Ext are preferably accumulated by using higher temperatures and longer P3.1 and P4.1 (e.g., 30-40 nucleotides in length) in the primer binding step and primer extension step in the second partial amplification (e.g., at T2 and/or T5).

FIGS. 19-26 schematically show examples of the arrangement of the sequence segments of the control oligonucleotide (C1.1), the first (P1.1) and third (P3.1) primers and the second primer extension product (P2.1-Ext). P2.1-Ext contains a sequence complementary to P1.1 in the 3' segment and can be used as a template to generate P1.1-Ext in the first amplification. Furthermore, P2.1-Ext comprises another complementary segment of the 3' segment of P3.1, which can bind to P2.1-Ext and be extended by a polymerase, so that P3.1-Ext can be generated in the second partial amplification.

FIGS. 16-26 summarize the examples of the arrangement of segments in the control oligonucleotide and P1.1 and P3.1. P3.1 can bind complementarily with its 3' segment to the control oligonucleotide. This binding occurs in the sequence segment of the control oligonucleotide, referred to herein as the fourth region. Depending on the detailed positioning of P3.1, the fourth area may have a different positioning with respect to the first, second or third area. In some embodiments, the fourth region is located within the second region (fig. 19, 20); in another embodiment, the fourth zone is located at the transition between zone two and zone three (fig. 21); in another embodiment, the fourth region is located in the third region of the control oligonucleotide (fig. 22). In particular, the presence of the control oligonucleotide should not lead to the accidental formation of by-products. In summary, the primer that binds to the control oligonucleotide should not cause the polymerase to catalyze either P1.1 extension or P3.1 extension using the control oligonucleotide. This is typically achieved by using nucleotide modifications in the control oligonucleotide, for example by using 2' -O-alkyl modifications. Such modifications are particularly useful in sequence segments of control oligonucleotides that comprise sequences complementary to at least a 3' segment of the respective primer. In addition, such modifications may extend beyond the sequence segments complementary to the primers, e.g., these sequence segments may comprise positions of about-10 to about +10 nucleotides or positions 3' to the respective primers. A sequence segment having such a nucleotide modification is referred to herein as a "second blocking unit" (which comprises a sequence segment complementary to the first primer (P1.1) (FIGS. 19-22)), or as a "fourth blocking unit" (which comprises a sequence segment complementary to the third primer (P3.1) (FIGS. 19-22)). This modification of the control oligonucleotide prevents the polymerase from initiating template-dependent primer extension when the primer binds to the control oligonucleotide. The composition of the nucleotide modifications may be the same or different in the second and fourth blocking units. The length of each sequence segment that combines to form the second or fourth blocking unit may also be the same or different for each blocking unit. The position of each blocking unit depends on the position of each potential binding site of the primer on the control oligonucleotide (FIGS. 19-22). The possible composition of the second blocking unit for the first primer is shown in detail. The composition of the fourth blocking unit may be similar to that of the second blocking unit. In one embodiment, the third region of the control oligonucleotide consists entirely of 2' -O-alkyl modifications of nucleotides. In another embodiment, the third region of the control oligonucleotide in its 3 'segment (e.g., the nucleotide positions 1-20 adjacent to the second region of the control oligonucleotide) consists entirely of 2' -O-alkyl modifications of nucleotides. In another embodiment, the second region of the control oligonucleotide consists entirely of 2' -O-alkyl modifications of nucleotides. In another embodiment, the second region of the control oligonucleotide and the third region in its 3 'segment (positions 1-20 after the second region) consist entirely of 2' -O-alkyl modifications of nucleotides. Thus, it is not absolutely necessary to provide a single fragment with a modification alone, but the complete sequence segment of the control oligonucleotide can be provided by complementary nucleotides (e.g., with a 2' -O-alkyl modification).

Due to the lack of modification in the complementary sequence segments of the primer extension products due to the enzymatic activity of the polymerase in a template-dependent manner, primers can be recognized and extended upon complementary binding to such sequence segments by the polymerase.

Fig. 27-31 schematically show embodiments including arrangements and potential combinations of first primer sets (P1.1 and P2.1) and second primer sets (P3.1 and P4.1). One of the primers of the first primer set may be identical to one of the primers of the second primer set (e.g., P4.1 corresponds to P2.1 in fig. 27-28). Especially when a dilution of the reaction mixture is used after the first partial amplification and components of the second amplification system are added after the first partial amplification, the length of the primers of the second primer set may be different from the length of the first primer set (fig. 30). Preferably, a structure of primer 3 is used which contains a sequence complementary to the control oligonucleotide only in its 3' segment. The composition of the 5' segment of the third primer does not comprise, inter alia, a sequence segment complementary to the control oligonucleotide (fig. 31).

FIGS. 32-35 schematically illustrate the interaction of components in a first partial amplification.

Fig. 32 shows the components of the structures shown in fig. 33-35.

FIG. 33 schematically shows a strand displacement mechanism.

FIG. 34 schematically shows the interaction of structures during strand displacement.

FIG. 35 schematically shows the interaction of structures during a first nucleic acid amplification, on the one hand by the amplification of a first oligonucleotide primer and a second oligonucleotide primer, on the other hand by the action of a control oligonucleotide and the strand displacement resulting therefrom.

Fig. 36 shows the results of example 1.

Fig. 37 shows the results of example 2.

FIGS. 38-40 show the results of example 3.

FIGS. 41 to 47 show the results of example 4.

FIGS. 48-49 show the results of example 5.

FIGS. 50-51 schematically illustrate the preparation of a starting nucleic acid strand 1.1.

FIGS. 52-54 schematically illustrate certain embodiments of amplification methods.

To initiate the first amplification, a first nucleic acid polymer is provided comprising a first target sequence M [ and a sequence M ' complementary (reverse) to M ], wherein M in the 5' -3 ' direction comprises consecutive sequence segments MPL, MS and MPR.

In one embodiment, the first nucleic acid polymer comprises a starting nucleic acid strand. In another embodiment, the first nucleic acid polymer comprises a first amplified nucleic acid strand to be amplified. In another embodiment, the first nucleic acid polymer comprises a strand of nucleic acid to be amplified from the second amplification.

In this embodiment, the target sequence M [ and the sequence M ' complementary (reverse) to M ] in the 5' -3 ' direction comprises consecutive sequence segments MPL, MS and MPR. In one embodiment, the first nucleic acid polymer comprises such a target sequence M. In another embodiment, the starting nucleic acid strand comprises such a target sequence M. In another embodiment, the nucleic acid strand to be amplified in the first amplification comprises such a target sequence M. In another embodiment, the first amplified fragment 1.1 comprises such a target sequence M. In another embodiment, the second amplified nucleic acid strand to be amplified comprises such a target sequence M. In another embodiment, the second amplified fragment 21 comprises such a target sequence M.

The first left oligonucleotide primer PL1 shown here is (substantially) identical to the MPL of target sequence M. This PL1 is a specific embodiment of the second oligonucleotide primer (P2.1).

The first right oligonucleotide primer PR1 shown here is a specific embodiment of the first oligonucleotide primer (P1.1). PR1 comprises in the 5' -3 ' direction consecutive sequence segments PCR and PMR, wherein PMR (in this embodiment corresponding to the first region of the target sequence M, which is comprised in the nucleic acid to be amplified) has a substantially complementary [ hybridizing ] sequence [ can bind substantially sequence-specifically ], and sequence segment PCR (in the embodiment corresponding to the second region of the first primer) does not bind to the target sequence M [ or to a sequence immediately adjacent to the MPR with respect to sequence M in the 3 ' direction, such as the sequence of the first starting nucleic acid ]; wherein PR1 (especially in the segmented PCR) comprises a modified nucleotide building block such that PCR cannot be used as a template for the activity of the first template-dependent nucleic acid polymerase. The control oligonucleotide CR shown here comprises in the 5 '-3' direction consecutive sequence segments CSR, CPR and CCR. The sequence segment CSR corresponds to the third region of the control oligonucleotide. The sequence segment CPR corresponds to the second region of the control oligonucleotide. Sequence segment CCR corresponds to the first segment of the control oligonucleotide.

In one embodiment, the sequence segment CSR is identical to the MS segment of the target sequence located 5' to the MPR [ and is read first upon polymerase initiation of PR1, i.e. CSR can bind to the polymerization product of primer PR1 (extension product of the first primer) ].

In one embodiment, the sequence segment CPR is complementary to the PMR of the first primer (and is identical to the MPR of the target sequence M).

In one embodiment, the sequence segment CCR (the first segment of the control oligonucleotide) is complementary to the PCR (the second region) of the first primer.

In one embodiment, the control oligonucleotide (CR) comprises a modified nucleotide building block in its third segment (CSR), and thus the CSR cannot be used as a template for template-dependent nucleic acid polymerase activity.

First primer extension product (PR 1'): the first primer extension product comprises, in the 5' -3 ' direction, in addition to the sequence region PCR and PMR (of the first oligonucleotide primer), a synthetic region PSR substantially complementary to the target sequence M, and the region of the target sequence M is adjacent to the MPR in the 5' direction.

Second primer extension product (PL 1'): in addition to the sequence region MPL, the primer extension product also contains a synthetic region PSL that is substantially identical to the target sequence M and is located adjacent to MPL in the 3' direction.

PR1 'and PL 1' together formed amplified fragment 1.1 and served as template for the second amplification (starting nucleic acid 2.1).

Second left oligonucleotide primer PL 2: this PL2 is a specific embodiment of the fourth oligonucleotide primer (P4.1). In one embodiment, the PL2 is identical to first secondary primer binding region MPL 2. In embodiments of this type, the MPL2 is contained in P4.1 Ext of the second amplified fragment 2.1. In another embodiment, MPL2 may be comprised in the second primer extension product. In another embodiment, MPL2 may be comprised in target sequence M.

Second right oligonucleotide primer PR 2: PR2 is a specific embodiment of the third oligonucleotide primer (P3.1), which in one embodiment (P31) is complementary to the region MPR 2. The MPR2 may be included in an embodiment of the second primer extension product. In other embodiments, MPR2 may be included in the fourth primer extension product. In another embodiment, the MPR2 may be included in the target sequence M.

The arrangement of PL2 and PR2 may be different. In one embodiment, MPL2 and MPR2 will consist of the target sequence M. In one embodiment, the 3 ' end (at least 20 positions) of MPL2 is located 5 ' to the 5 ' end of MPR 2. In another embodiment, especially MPL2 is the same as MPL and/or MPR2 is the same as MPR.

In another embodiment, the third (PR2) and fourth (PL2) oligonucleotide primers may comprise additional sequence segments (PCL2 or PCR 2).

In a second amplification, third (PR2) and fourth (PL2) oligonucleotide primers may bind to the respective complementary sites of the first amplified fragment such that these primers are extended by a second polymerase in the second amplification. In the second amplification, the primer extension products (P3.1-Ext and P4.1-Ext) of the third and fourth primers were increased. As a result, a second amplified fragment 2.1 was obtained.

FIG. 55 schematically illustrates certain embodiments of the morphology of components of the first amplification system.

The starting nucleic acid 1.1 comprises (in the 5 '-3' direction) the following segments: m1.Y, M1.5, M1.4, M1.3, M1.2, M1.1, M1. x.

The first oligonucleotide primer comprises (in the 5 '-3' direction) the following segments: a first section (P1.1.1) and a second section (P1.1.2).

The control oligonucleotide (C1.1) comprises (in the 5 '-3' direction) the following segments: a third region (C1.1.3), a second region (C1.1.2), a first region (C1.1.1).

The control oligonucleotide (C1.2) comprises (in the 5 '-3' direction) the following segments: a third section (C1.2.3), a second region (C1.2.2), a first region (C1.2.1).

The second primer P2.1 comprises (in the 5 '-3' direction) the following segments: p2.1.1.

The second primer P2.2 comprises (in the 5 '-3' direction) the following segments: p2.2.1.

The second primer P2.3 comprises (in the 5 '-3' direction) the following segments: p2.3.1.

The first primer extension product (P1.1-Ext) comprises (in the 5 '-3' direction) the following segments: P1.1E6, P1.1E5, P1.1E4, P1.1E3, P1.1E2, P1.1E1.

The second primer extension product (P2.1-Ext) comprises (in the 5 '-3' direction) the following segments: P2.1E5, P2.1E4, P2.1E3, P2.1E2, P2.1E1.

Preferably, the primer extension products P1.1-Ext and P2.1-Ext obtained during the first amplification form a complementary duplex and together represent a second amplified fragment 1.1, which second amplified fragment 1.1 can be used as starting nucleic acid 2.1 for the second amplification.

P1.1.1 can bind predominantly complementarily to M1.1 and can be extended by a polymerase. P2.1.1 can bind complementarily to P1.1E1 and can be extended by a polymerase. P1.1-Ext and P2.1-Ext represent the nucleic acid to be amplified, which serves as the starting nucleic acid 2.1 for the second amplification. P2.1, P2.2 and P2.3 represent variants of the second primer and result in the same amplified fragment.

FIGS. 56-57 schematically illustrate certain embodiments of the topography of the first and second amplification systems:

the third oligonucleotide primer comprises (in the 5 '-3' direction) the following segments: p3.1.2, P3.1.1, wherein P3.1.2 is not complementary to the starting nucleic acid 1.1 or P2.1-Ext. P3.1.1 is substantially complementary to P2.1E1 for P2.1-Ext.

The fourth oligonucleotide primer comprises (in the 5 '-3' direction) the following segments: p4.1.2, P4.1.1, wherein P4.1.2 is not complementary to the complementary strand of the starting nucleic acid 1.1 or to P1.1-Ext. P4.1.1 is substantially complementary to P1.1E1 of P1.1-Ext.

Preferably, the primer extension products P3.1-Ext and P4.1-Ext obtained during the second amplification may form a complementary duplex and together represent the second amplified fragment 2.1.

P3.1-Ext comprises (in the 5 '-3' direction) the following segments: P3.1E7, P3.1E6, P3.1E5, P3.1E4, P3.1E3, P3.1E2, P3.1E1. The segments p3.1.e5 to P3.1E3 are identical in sequence to P1.1E4 to P1.1E2.

P4.1-Ext comprises (in the 5 '-3' direction) the following segments: P4.1E7, P4.1E6, P43.1E5, P4.1E4, P4.1E3, P43.1E2, P4.1E1. The segments p4.1.e5 to P4.1E3 are identical in sequence to P2.1E4 to P2.1E2.

FIG. 57 schematically illustrates certain embodiments of the third (P3.1, P3.2, P3.3) and fourth (P4.1, P4.2, P4.3) primers, wherein the 3' segments of the primers may be shifted with respect to each other.

FIGS. 58-59 schematically illustrate certain embodiments of the localization regions of an oligonucleotide probe:

d1-is located at the 5' end of P4.1 Ext. Thus, primers with probe function, e.g. Scorpion primer, Lux primer, can be used, wherein the structure of the primer in its 3' segment is similar to P4.1.

D4-is located at the 5' end of P3.1 Ext. Thus, primers with probe function, e.g. Scorpion primer, Lux primer, can be used, wherein the structure of the primer in its 3' segment is similar to P3.1.

Regions D2 and D3 were located in the middle of P3.1-Ext and P4.1-Ext, respectively. Thus, hybridization probes (e.g., molecular beacons, Taqman probes (5 '-3' nuclease cleavable probes or 2-oligonucleotide probes with FRET pairs) can be located here.

The D2 region is particularly suitable for potential probe localization (in P3.1-Ext or P4.1-Ext) because the region does not overlap with the control oligonucleotide. Thus, especially for homogeneous assays, probes may be used in the region. The region comprises a 3' segment of the third primer extension product. The probes in region D3 can also be used for P3.1-Ext and P4.1-Ext. However, in the case of higher concentrations of C1.2 (controls, e.g.0.5 mol/l to 5. mu. mol/l, e.g.in homogeneous assays), it must be taken into account that such probes may interact with or be replaced by controls. When the concentration of the control is relatively low (e.g., in a region of less than 1 nmol/l), such interaction with the control can be ignored (e.g., when the first amplification is diluted prior to the second amplification).

FIG. 60 schematically illustrates certain embodiments of probe fragment localization that can bind predominantly complementarily to third (and possibly first) primer extension products (P3.1-Ext and P1.1-Ext). Different embodiments show that there are a variety of potential probe locations possible.

FIG. 61 schematically illustrates certain embodiments of probe fragment localization that can bind predominantly complementarily to fourth (and possibly second) primer extension products (P4.1-Ext and P2.1-Ext). Different embodiments show that there are a variety of potential probe locations possible.

Figures 62-63 schematically illustrate certain embodiments of the probe.

Probe located at D1: s3.1, S3.2 and S3.3. The probe comprises a fluorescent reporter (R)/fluorescent quencher (Q) pair that, when hybridized to the corresponding segment of the primer extension product (spatial separation of reporter/quencher), results in an increase in signal. Probes S3.1 and S3.3 can be extended as primers to obtain primer extension products based on the primers with probe function (S3.1-Ext) and S3.3.Ext (FIG. 63).

FIGS. 64-67 schematically illustrate certain embodiments of oligonucleotide probes and their breadth: s3.4 represents the 5 '-3' nuclease fission probe ("Taqman probe"). The probe is cleavable by Taq polymerase after hybridization with P3.1 Ext, wherein extension of P4.1 occurs simultaneously.

Probe S3.6 represents a probe system in which 2 oligonucleotides can/must bind to P3.1 Ext. Thus, one oligonucleotide is probe S3.6 with a fluorescent reporter (R) and the other probe is a control oligonucleotide C1.2, which contains a donor fluorophore in its 5' region. If both oligonucleotides bind to P3.1-Ext simultaneously, there is sufficient spatial proximity (less than 25NT) for FRET to occur, thereby generating a signal.

Probe S3.7 schematically represents a probe with a self-complementary moiety ("molecular beacon"). In the unbound state, the signal from the fluorescent reporter (R) is preferentially quenched by the fluorescent quencher (Q) under the selected reaction conditions. Complementary binding results in structural deconvolution, which results in spatial separation of R and Q, which generally results in increased signal.

Sequence listing

<110> AGCT Co., Ltd

<120> a nucleic acid amplification method with higher specificity

<130> agc105wo

<160> 29

<170> patent version 3.5

<210> 1

<211> 38

<212> DNA

<213> Intelligent people

<400> 1

gtaagagcag atccctggac aggcaaggaa tacaggta 38

<210> 2

<211> 57

<212> DNA

<213> Artificial sequence

<220>

<223> PCR primer

<220>

<221> other functions

<222> (34)..(45)

<223> 2

<220>

<221> other functions

<222> (45)..(46)

<223> C3 joint

<400> 2

aactcagaca agatgtgatt tttttacctg tatcucugau gcuuctacct gtattcc 57

<210> 3

<211> 70

<212> DNA

<213> Artificial sequence

<220>

<223> PCR primer

<220>

<221> other functions

<222> (35)..(36)

<223> HEG linker

<400> 3

ctacagaact cagacaagat gtgaactaca atgttgctca tactacaatg tcacttactg 60

taagagcaga 70

<210> 4

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> control oligonucleotide

<220>

<221> other functions

<222> (1)..(49)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (56)..(56)

<223> 3' -phosphoric acid group

<400> 4

uaaucuguaa gagcagaucc cuggacaggc aaggaauaca ggtagaagca tcagag 56

<210> 5

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 5

aagctcgaca aaagaactca gagtgtgctc gacactacct gtattccttg cc 52

<210> 6

<211> 67

<212> DNA

<213> Intelligent people

<400> 6

gctcatacta caatgtcact tactgtaaga gcagatccct ggacaggcaa ggaatacagg 60

taaaaaa 67

<210> 7

<211> 67

<212> DNA

<213> Intelligent people

<400> 7

gctcatacta caatgtcact tactgtaaga gcagatccct ggacaggcga ggaatacagg 60

taaaaaa 67

<210> 8

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 8

acgaagctcg caagaactca gagtgtgctc gacactacct gtattcc 47

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (1)..(1)

<223> 5' end tetramethyl rhodamine

<400> 9

gctcatacta caatgtcact tac 23

<210> 10

<211> 62

<212> DNA

<213> Intelligent people

<400> 10

gctcatacta caatgtcact tactgtaaga gcagatccct ggacaggcaa ggaatacagg 60

ta 62

<210> 11

<211> 53

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (1)..(1)

<223> 5' end tetramethyl rhodamine

<400> 11

gtaccgaagc tcgcaggaac tcagagtgtg gagaggacga aaatgtccag gga 53

<210> 12

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 12

aagctcgaca aaagaactca gagtgtgctc gacactacct gtattccttg 50

<210> 13

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (11)..(12)

<223> twice 2

<220>

<221> other functions

<222> (31)..(43)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (43)..(44)

<223> C3 joint

<400> 13

cacttacgac acaagatttt tttacctgta tcucugaugc uuctacctgt attcc 55

<210> 14

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (1)..(1)

<223> 5' end tetramethyl rhodamine

<400> 14

gtaccgaagc tcgcaggaac tcagagtgtg gagaggacga aaactgtcca gggatc 56

<210> 15

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (1)..(1)

<223> 5' end tetramethyl rhodamine

<400> 15

gtaccgaagc tcgcaggaac tcagagtgtg gagaggacga aaaccaggga t 51

<210> 16

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (1)..(1)

<223> 5' end tetramethyl rhodamine

<400> 16

gtaccgaagc tcgcaggaac tcagagtgtg gagaggacga aaactgtcca g 51

<210> 17

<211> 70

<212> DNA

<213> Intelligent people

<400> 17

tgggctaata ggactacttc taatctgtaa gagcagatcc ctggacaggc aaggaataca 60

ggtattttgt 70

<210> 18

<211> 70

<212> DNA

<213> Intelligent people

<400> 18

tgggctaata ggactacttc taatctgtaa gagcagatcc ctggacaggc gaggaataca 60

ggtattttgt 70

<210> 19

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (31)..(42)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (42)..(43)

<223> C3 joint

<400> 19

cacaatcatc aatacttttt tgtcaaaata cucugaugcu cugtcaaaat acctgtatt 59

<210> 20

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (31)..(42)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (42)..(43)

<223> C3 joint

<400> 20

cacaatcatc aatacttttt tgtcaaaata cucugaugcu cugtcaaaat acct 54

<210> 21

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> blocking oligonucleotide

<220>

<221> other functions

<222> (1)..(17)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (17)..(18)

<223> HEG linker

<220>

<221> other functions

<222> (28)..(28)

<223> 3

<400> 21

cucugaugcu cugucaaaat acctgaaa 28

<210> 22

<211> 76

<212> DNA

<213> Artificial sequence

<220>

<223> control oligonucleotide

<220>

<221> other functions

<222> (1)..(57)

<223> 2' -O-methyl modification

<220>

<221> other functions

<222> (76)..(76)

<223> 3

<400> 22

aggacuacuu cuaaucugua agagcagauc ccuggacagg caaggaauac agguauuttg 60

acagagcatc agagag 76

<210> 23

<211> 62

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<220>

<221> other functions

<222> (24)..(25)

<223> HEG linker

<400> 23

cacaatcatc aatactaata ggacctctgg gctaatagga ctacttctaa tctgtaagag 60

ca 62

<210> 24

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 24

ctcgacacta cttcaaggac aaaatacctg tattcc 36

<210> 25

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 25

ctctgggcta ataggactac ttctaatatg taagagcaga t 41

<210> 26

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 26

acttcaagga caaaatacct gtatt 25

<210> 27

<211> 19

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 27

atatgtaaga gcagatccc 19

<210> 28

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> Probe oligonucleotide

<220>

<221> other functions

<222> (1)..(1)

<223> 5' -terminal FAM dye

<220>

<221> other functions

<222> (15)..(15)

<223> MGB-non-fluorescent quencher

<400> 28

ttgacaggca aggaa 15

<210> 29

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Probe oligonucleotide

<220>

<221> other functions

<222> (1)..(1)

<223> 5' terminal NED dye

<220>

<221> other functions

<222> (16)..(16)

<223> MGB-non-fluorescent quencher

<400> 29

ttctggacag gcgagg 16

Claims

1. A method for amplifying a nucleic acid (fig. 56), wherein:

the sample comprises a first nucleic acid polymer comprising a first target sequence M1[ and a sequence M1 ' complementary to M1 (reverse) ], wherein M comprises in the 5 ' -3 ' direction consecutive sequence segments M1.5, M1.4, M1.3, M1.2 and M1.1, and is contacted in a first amplification step with:

A first template-dependent nucleic acid polymerase (especially a DNA polymerase), and a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and a suitable cofactor (especially magnesium ions) for the template-dependent nucleic acid polymerase;

a first (right) oligonucleotide primer P1.1 comprising, in the 5 ' -3 ' direction, consecutive sequence segments P1.1.2 and P1.1.1, wherein P1.1.1 has a [ hybridizing ] sequence complementary to [ substantially sequence-specifically binds ] M1.1, whereas the sequence segment P1.1.2 is not capable of binding to M1[ or to the sequence of M1.1 in the 3 ' direction immediately following sequence M1 ];

wherein P1.1 (especially in the segment p1.1.2) comprises a modified nucleotide building block such that p1.1.2 cannot serve as a template for the first template-dependent nucleic acid polymerase activity;

a second (left) oligonucleotide primer P2.1 (substantially) identical to M1.5 [ and capable of sequence-specifically binding to the reverse complement of M1.5 on the reverse strand of M1 or the extension product P1.1-Ext of P1.1 (referred to herein as P1.1E1) ]; and

control oligonucleotide C1.2, comprising in the 5 ' -3 ' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1, in which C1.2.3 is identical to segment M1.2 of M1 and segment M1.2 is located in the 5 ' direction of M1.1 [ and is read first upon polymerase initiation of P1.1, so C1.2.3 can bind to the polymerization product of primers P1.1-Ext ], C1.2.2 is complementary to P1.1.1 (and identical to M1.1) and C1.2.1 is complementary to P1.1.2;

Wherein C1.2 contains a nucleotide building block modified at C1.2.1, and therefore C1.2.1 cannot be used as a template for template-dependent nucleic acid polymerase activity;

c) a third (right) oligonucleotide primer P3.1 comprising at the 3' end a sequence segment 3.1.1[ or consisting essentially of 3.1.1 ] and complementary to M1.1 (reverse) of M1 [ capable of binding complementarily to P2.1-Ext ];

d) a fourth (left) oligonucleotide primer P4.1 comprising at the 3' end a sequence segment 4.1.1[ or consisting essentially of 4.1.1 ] and being identical and/or essentially identical to M1.5 of M1 [ capable of binding complementarily to P1.1-Ext ]; and

e) a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and (optionally) a substrate for the template-dependent nucleic acid polymerase, in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates, and a suitable cofactor.

2. The method for amplifying a nucleic acid according to claim 1, wherein a first primer extension product P1.1-Ext is obtained which comprises, in addition to sequence regions P1.1.2 and P1.1.1, in the 5 ' -3 ' direction, a synthetic region comprising sequence segments P1.1E4, P1.1E3, P1.1E2 and P1.1E1 in the 5 ' -3 ' direction, wherein P1.1E4 is substantially complementary to sequence segment M1.2 of target sequence M1, P1.1E3 is substantially complementary to M1.3, P1.1E2 is substantially complementary to M1.4, and P1.1E1 is substantially complementary to M1.5, and a second primer extension product P2.1-Ext is obtained which comprises, in addition to sequence region P2.1.1, a synthetic region P2.1-Ext which is substantially identical to the target sequence M1, and a region in which the target sequence M1 is located adjacent to M1.5 in the 3 ' direction;

Wherein:

-selecting the reaction conditions of said first amplification step, and/or

Selecting the length and/or melting temperature of P1.1.2 and, if applicable, of M1.4, M1.3, M1.2 and M1.1,

so that P1.1-Ext can form a double strand with M1 or P2.1-Ext, and P1.1-Ext can form a double strand with C1.2, and the double strand formed by P1.1-Ext and C1.2 is preferred to the double strand formed by P2.1-Ext.

3. The method for amplifying a nucleic acid according to claim 2, wherein:

-selecting the reaction conditions of said first amplification step, and/or

such that in the absence of the control oligonucleotide C1.2, the first primer extension product P1.1-Ext is not separated at all or substantially from the second primer extension product P2.1-Ext.

4. The method according to one of the preceding claims, characterized in that: the modified nucleotide building blocks include 2 '-O-alkylribonucleoside building blocks, particularly 2' -O-methylribonucleoside building blocks.

5. The method according to any one of the preceding claims, wherein the first amplification step is performed substantially isothermally, in particular at a temperature between 20 ℃ and 50 ℃.

6. The method of one of the preceding claims, wherein the first amplification step is performed until the copy number of P1.1-Ext reaches 10 to 1e12, in particular 100 to 1e10, in particular 1000 to 1e 8.

7. The method according to one of the preceding claims, wherein P3.1 and P4.1 comprise second regions P3.1.2 and P4.1.2, respectively; the second regions P3.1.2 and P4.1.2 are adjacent to the 5' ends of the regions P3.1.1 and P4.1.1, respectively, and are not complementary to P1.1-Ext and P2.1-Ext, respectively.

8. The method of one of the preceding claims, wherein during the second amplification step the reaction temperature is increased and decreased cyclically, in particular in a low temperature range between 20 ℃ and 75 ℃ and in a temperature range between 85 ℃ and 105 ℃.

9. The method according to one of the preceding claims, characterized in that: the first polymerase and the second polymerase are the same.

10. The method according to one of the preceding claims, characterized in that:

-P1.1 and P3.1 are substantially identical; and/or

P2.1 and P4.1 are substantially identical.

11. The method according to one of the preceding claims, characterized in that: the first amplification and the second amplification are performed in the same reaction batch.

12. The method of claim 7, wherein: the second polymerase, the third oligonucleotide primer (P3.1) and/or the fourth oligonucleotide primer (P4.1) may be activated and/or the control oligonucleotide may be inactivated.

13. The method according to any of the preceding claims 1-6, characterized in that: the first amplification is performed in a first reaction batch and the second amplification is performed in a second reaction batch.

14. The method of claim 9, wherein: adding an aliquot of the first reaction batch or all of the first reaction batch to the second reaction batch.

15. The method according to one of the preceding claims, characterized in that: the control oligonucleotide (C1.1) comprises a fourth region which can bind sequence specifically to the third oligonucleotide primer (P3.2).

16. The method according to one of the preceding claims, characterized in that: the first oligonucleotide primer (P1.1) has one or more modifications in the second region, in particular the first region immediately following the first primer oligonucleotide, which terminates the first polymerase in the second region.

17. The method of any one of the preceding claims, wherein the sample is further contacted with a first probe oligonucleotide that:

a. comprises a sequence section which:

Complementary to the sequence of M1 located on sequence segments M1.3 and M1.4;

b. in combination with a fluorescent dye, the fluorescent dye:

forming a donor-quencher pair or a FRET pair with a second probe oligonucleotide to which the first probe oligonucleotide is linked; or

Forming a donor-quencher pair or a FRET pair, wherein the fluorescent dye is attached to a second probe oligonucleotide that is capable of binding sufficiently close to the binding site of the first probe oligonucleotide.

18. A method for amplifying a nucleic acid, wherein:

a) in a first amplification step, a first nucleic acid polymerase comprising a first target sequence M1 (wherein M1 comprises consecutive sequence segments M1.5, M1.4, M1.3, M1.2, and M1.1 in the 5 '-3' direction) is contacted with:

b) a first template-dependent nucleic acid polymerase (especially a DNA polymerase), and a substrate for the template-dependent nucleic acid polymerase:

c) A first (right) oligonucleotide primer P1.1 comprising in the 5 '-3' direction contiguous sequence segments P1.1.2 and P1.1.1, wherein P1.1.1 has a [ hybrid ] sequence complementary to M1.1 and sequence segment P1.1.2 is not capable of binding to M1:

wherein P1.1 (especially in segment p1.1.2) comprises a modified nucleotide building block such that p1.1.2 cannot serve as a template for said first template-dependent nucleic acid polymerase activity;

d) a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1.5; and

e) a control oligonucleotide C1.2 comprising in the 5 ' -3 ' direction consecutive sequence segments C1.2.3, C1.2.2 and C1.2.1, wherein C1.2.3 is identical to segment M1.2 of M1 located in the 5 ' direction of M1.1, C1.2.2 is complementary to p1.1.1 (and identical to M1.1), and C1.2.1 is complementary to p1.1.2;

wherein C1.2 contains a nucleotide building block modified at C1.2.1 such that C1.2.1 cannot be used as a template for the template-dependent nucleic acid polymerase activity;

a. comprises a sequence section which:

Complementary to the sequence of M1 located on sequence segments M1.3 and M1.4;

b. in combination with a fluorescent dye, the fluorescent dye:

i. forming a donor-quencher pair or a FRET pair with a second probe oligonucleotide to which said first probe oligonucleotide is linked; or

Forming a donor-quencher pair or a FRET pair, wherein the fluorescent dye is linked to a second probe oligonucleotide that is capable of binding sufficiently close to the binding site of said first probe oligonucleotide.

19. The method of claim 17 or 18, wherein under the reaction conditions of the second amplification step, the sequence segment of the first probe oligonucleotide does not hybridize to P1.1, P2.1, P3.1, and P4.1, nor to C1.2.

20. A kit for carrying out the method of any one of the preceding claims, comprising:

a) a first (right) oligonucleotide primer P1.1 comprising in the 5 '-3' direction consecutive sequence segments p1.1.2 and p1.1.1, wherein p1.1.1 is linked to a primer binding site M1.1, in particular a human target sequence, of the genomic sequence M1 of a eukaryote or a pathogenic bacterium, in particular a mammal; wherein M1 comprises in the 5 ' -3 ' direction consecutive said sequence segments M1.5, M1.4, M1.3, M1.2 and M1.1, and said sequence segment p1.1.2 is unable to bind to M1 [ or unable to bind to a sequence immediately after M1.1 with respect to said sequence M1 in the 3 ' direction;

b) a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1.5 [ and which can bind sequence specifically to the reverse complement of M1.5 on the reverse strand of M1 or to the extension product P1.1-Ext of P1.1 (herein referred to as P1.1E1) ];

c) a control oligonucleotide C1.2 comprising in 5 ' -3 ' direction consecutive said sequence segments C1.2.3, C1.2.2 and C1.2.1, wherein C1.2.3 is identical to segment M1.2 of M1 and said segment M1.2 is located in the 5 ' direction of M1.1 [ and is read first upon polymerase initiation of P1.1, thus C1.2.3 is able to bind to the polymerization product of said primers P1.1-Ext ], C1.2.2 is complementary to P1.1.1 (and identical to M1.1) and C1.2.1 is complementary to P1.1.2;

wherein C1.2 contains a nucleotide building block modified at C1.2.1 such that C1.2.1 cannot be used as a template for a first template-dependent nucleic acid polymerase activity;

f) a third (right) oligonucleotide primer P3.1 comprising at the 3' end a sequence segment 3.1.1[ or consisting essentially of 3.1.1 ] and complementary to M1.1 (reverse) of M1 [ capable of binding complementarily to P2.1-Ext ];

g) A fourth (left) oligonucleotide primer P4.1 comprising at the 3' end a sequence segment 4.1.1[ or consisting essentially of 4.1.1 ] and being identical and/or essentially identical to M1.5 of M1 [ capable of binding complementarily to P1.1-Ext ];

the kit optionally further comprises a second template-dependent nucleic acid polymerase, especially a DNA polymerase, and (optionally) a substrate (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) for the template-dependent nucleic acid polymerase and a suitable cofactor, especially a thermophilic template-dependent polymerase having 5 '-3' exonuclease activity; and/or

Comprising a first probe oligonucleotide that:

a. comprises a sequence section which:

Complementary to the sequence of M1 located on sequence segments M1.3 and M1.4;

b. in combination with a fluorescent dye, the fluorescent dye:

21. The kit of claim 20, further comprising a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and (optionally) a substrate (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) for said DNA polymerase and a suitable cofactor, in particular a mesophilic template-dependent polymerase without 5 '-3' exonuclease activity.

22. The kit according to one of claims 20 and 21, wherein the modified nucleotide building block comprises a 2 '-O-alkylribonucleoside building block, in particular a 2' -O-methylribonucleoside building block.