WO2019162530A1

WO2019162530A1 - Agmethod for amplification of a nucleic acid having improved specificity

Info

Publication number: WO2019162530A1
Application number: PCT/EP2019/054767
Authority: WO
Inventors: Dmitry Cherkasov; Christian GRUNWALD
Original assignee: Agct Gmbh
Priority date: 2018-02-26
Filing date: 2019-02-26
Publication date: 2019-08-29
Also published as: JP2021514637A; CN112074612A; EP3759248A1

Abstract

The invention relates to a method for amplifying a nucleic acid having improved specificity using special primer oligonucleotides and controller nucleotides, wherein in a first amplification the controller oligonucleotides enable a strand opening in the amplificate in a sequence specific manner. The invention furthermore relates to a corresponding kit for carrying out the method according to the invention.

Description

A method of amplifying a nucleic acid of improved specificity

The present invention relates to a method for the amplification of nucleic acids with improved specificity.

The present application claims the priority of the following applications: European Patent Applications EP18158722.1 dated 26.02.18; EP18195312.6 from 18.09.2018; EP 18159337.7 dated 28.02.2018; German Patent Application 10 2018 001586.7 from 28.02.2018; These and all other patent documents mentioned herein are to be considered as incorporated herein by reference.

background

The synthesis of nucleic acid chains plays a central role in biotechnology today. Methods such as PCR have significantly advanced both the research landscape and industrial application fields such as diagnostics and the food industry. The combination of PCR with technologies such as sequencing, real-time detection, microarray technology, microfluidic management etc. has contributed to technological development and has partially overcome disadvantages of the original PCR. Other amplification techniques, such as isothermal amplification techniques have also been developed. Their use was especially intended for POCT (point-of-care testing). Despite tremendous advances in this field, PCR plays the central role in determining the individual technological barriers to its application.

During the amplification process, the PCR does not control the amplified sequence segments located between the primers. The primer binding is in the focus of optimizations of PCR methods. At the beginning of the PCR and in its course, the initiation of the synthesis of major products and by-products, e.g. by non-specific binding or extension of the primer. In case of possible re-synthesis reactions, the unspecifically extended primer is read off as a template, which generally leads to the formation of a complete primer binding site. Thus, a transmission of erroneous sequence information from one synthesis cycle to the next occurs, which in sum leads not only to the initial formation, but above all to the exponential multiplication of by-products.

Such side reactions can lead to the exponential growth of fragments which interfere with the main reaction (amplification of a target sequence) or lead to interferences in subsequent steps of the analysis. Such by-products typically include left and right primer sequences so that their amplification can occur in parallel with the main reaction. However, instead of a target sequence, such by-products include another nucleic acid target sequence. Primarily, the specificity of the PCR amplification is achieved by optimizing the primer binding to target sequences. In this case, for example, additional oligonucleotides can be used, which partially bind to the primer and thus can competitively participate in primer binding to other nucleic acid chains. Such probes typically bind to a sequence portion of the primer and release a single-stranded portion that allows the primer to bind to the target nucleic acid and initiate a synthesis reaction. Primer matrices Mismatches can be competitively displaced by such oligonucleotides, which improves the specificity of the initiation. Such additional oligonucleotides do not interact with the nucleic acid chain to be amplified in portions between the two primers. However, due to a molar excess of the primers, non-specific interactions of primers with templates may occur during amplification, resulting in the formation of a fully functional primer binding site as a result of the synthesis of a complementary strand of the by-product. The presence of such a complete primer binding site in the by-product results in a loss of the competitive effect of such additional oligonucleotides on primer binding. The control of the specificity of the binding of a primer to the template by such oligonucleotides thus makes only the initiation of a side reaction less likely, but can hardly influence its exponential amplification after formation of a byproduct.

The side reactions in a PCR increase with the number of synthetic cycles performed, often up to 40 cycles of PCR being performed. After the PCR amplification, other methods can be connected, e.g. Detection, l / bra / y production, cloning, sequencing, etc. These methods can only tolerate to a certain extent the by-products or sequence deviations produced during PCR amplification. In general, the specificity of such methods is also influenced by the problem of side reactions during a PCR.

The improvement of the specificity of the synthesis of a amplification process with reduced formation and co-amplification of by-products leads to an improvement of diagnostic methods.

It is therefore an object of the present invention to provide methods and agents that enhance the specificity of the enzymatic amplification of nucleic acid chains.

Another object of the invention is to provide a combination of an amplification method with a PCR amplification, wherein the signal acquisition (monitoring or detection), or the amplification of target sequences first by means of controlled amplification using a controller oligonucleotide and corresponding specific primer Sets is carried out and then continued by means of PCR, in particular using PCR-specific primer.

Another object of the invention is to reduce the number of PCR synthesis cycles necessary to obtain a sufficient amount of PCR products. Another object of the invention is to provide a novel enzymatic method and components for the synthesis of nucleic acid chains, as well as the amplification of nucleic acid chains, in which a continuous (on-line) signal detection is provided, wherein the signal acquisition (Monitoring / Detection) by sequence-specific oligonucleotide probes.

These objects are achieved by a method and a kit according to the independent claims. Further advantageous embodiments of the invention are set forth in the dependent claims and the following description.

Summary of the invention

A first aspect of the invention relates to a method for amplifying a nucleic acid, comprising the steps:

a) a first amplification with the steps:

Hybridizing a first primer oligonucleotide (P1.1) to a nucleic acid to be amplified having a target sequence, wherein the first primer oligonucleotide (P1.1) comprises the following ranges:

A first region (P1 .1 .1) which can bind sequence-specifically to a region of the nucleic acid to be amplified, wherein the region of the nucleic acid to be amplified comprises at least the 5 ^' terminus of the target sequence or in the 5 ^' direction of the Target sequence is located;

A second region (P1 .1 .2) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide and for the polymerase used chosen reaction conditions remains essentially unkopiert;

Extension of the first primer oligonucleotide (P1.1) by a first polymerase to yield a first primer extension product (P1 .1 -Ext) which comprises, in addition to the first primer oligonucleotide (P1 .1), a synthesized region which is substantially is complementary to the nucleic acid to be amplified or to the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present as a double strand;

Binding of a controller oligonucleotide (C1 .1) to the first primer extension product (P1 1 -Ext), wherein the controller oligonucleotide (C1 .1) comprises the following ranges:

A first region (C1 .1 .1) that can bind to the second region (overhang) of the first primer extension product (P1 .1 -Ext),

A second region (C1 .1 .2) which is substantially complementary to the first region of the first primer oligonucleotide (P1 .1), and A third region (C1 .1 .3) that is substantially complementary to at least a portion of the synthesized region of the first primer extension product (P1 .1 -Ext); and

wherein the controller oligonucleotide (C1 .1) does not serve as a template for primer extension of the first primer oligonucleotide (P1 .1) and the first controller oligonucleotide (C1 .1) to the first and second regions of the first primer extension product (P1 .1-Ext) under displacement (of the region complementary to the first and second regions) of the nucleic acid to be amplified;

Hybridizing a second primer oligonucleotide (P2.1) to the first primer extension product, wherein the second primer oligonucleotide (P2.1) comprises a region (P2.1.1) which is sequence-specifically attached to the synthesized region of the first primer Extension product (P1 .1 -ext) which is at least complementary to the 5 ^' terminus of the target sequence or located in the 3 ^' direction thereof; Extension of the second primer oligonucleotide (P.2.1) by the first polymerase to obtain a second primer extension product (P2.1 -Ext), which in addition to the second primer oligonucleotide (P2.1) comprises a synthesized region which is substantially identical to the nucleic acid or the target sequence to be amplified, wherein the first primer extension product (P1 .1-Ext) and the second primer extension product (P2.1) form a first double-stranded amplification product; and

b) a second amplification with the steps:

Hybridizing a third primer oligonucleotide (P3.1; P3.2) to the second primer extension product (P1 1-Ext.) Of the first amplification product, wherein the third primer oligonucleotide (P3.1; P3.2) comprises a first region (P3.1 .1) which may sequence-specifically bind to a region of the second primer extension product (P1 1-Ext.) Comprising at least the 5 ^' terminus of the target sequence or in the 5 ^' direction thereof;

Extension of the third primer oligonucleotide (P3.1, P3.2) by a second polymerase to give a third primer extension product (P3.1 / 2-Ext) which is next to the third primer oligonucleotide (P3.1, P3. 2) comprises a synthesized region that is substantially complementary to the second primer extension product (P2.1-Ext) or to the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) present as a double strand;

Hybridizing a fourth primer oligonucleotide (P4.1; P4.2) to the first primer extension product (P1 1 -Ext), wherein the fourth primer oligonucleotide (P4.1; P4.2) has a first region (P4.1 .1) which can sequence-specifically bind to the synthesized region of the first primer extension product (P1.1-Tex) which at least complementary to the 5 ^' terminus of the target sequence or located in the 3 ^' direction thereof;

Extension of the fourth primer oligonucleotide (P4.1; P4.2) by the second polymerase to yield a fourth primer extension product (P4.1 / 2-Ext) which comprises, in addition to the fourth primer oligonucleotide, a synthesized region expressed in the Substantially complementary to the first primer extension product (P1 1 -Ext) or identical to the target sequence, wherein the first primer extension product (P1 1-Ext) and the fourth primer extension product (P4.1 / 2-Ext) are in duplex;

Separation of the double strand from the first primer extension product (P1 1 -Ext) and the fourth primer extension product (P4.1 / 2-Ext) and the double strand from the second primer extension product (P2.1) and the third primer extension product (P3.1);

Hybridization of the third primer oligonucleotide (P3.2) to the fourth primer extension product (P4.2-Ext) and extension of the third primer

Oligonucleotide (P3.2) by the second polymerase; and

Hybridizing the fourth primer oligonucleotide to the third primer

Extension product (P3.2-Ext) and extension of the fourth primer

Oligonucleotide (P4.1, P4.2) by the second polymerase.

Alternatively, one aspect of the invention may also be formulated as a method of amplifying a nucleic acid (Figures 1, 55-56), wherein a sample comprising a first nucleic acid polymer comprising a first target sequence M1 [and the M1 (reverse) complementary sequence M1 ^' ], where M in the 5'-3' orientation comprises in direct sequence the sequence segments M1 .5, M1 .4, M1 .3, M1 .2 and M1 .1,

in a first amplification step is brought into contact with the following components:

i. a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and also substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, such as Mg salts,

ii. a first (right) oligonucleotide primer P1 .1, which in the 5'-3 'orientation directly comprises the sequence segments P1 .1 .2 and P1 .1 .1, P1 .1 .1 having a complement to M1 .1 [ hybridizing] sequence [can bind in a substantially sequence-specific manner] and the P1 .1 .2 sequence portion can not bind to M1 [or a sequence immediately adjacent to M1 .1 with respect to the M1 sequence in 3 '], and P1 .1 (in particular in section P1 .1 .2) modified nucleotide building blocks, so that P1 .1 .2 can not serve as a template for the activity of the first template-dependent nucleic acid polymerase; and iii. a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1 .5 [and sequence-specifically the reverse complementary sequence of M1 .5 on the opposite strand of M1 or the extension product of P1 .1, P1 1 -ext, there as P1 .1 denotes E1, can bind];

iv. a controller oligonucleotide C1 .2, which in the 5'-3 'orientation comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct succession, C1 .2.3 being identical to a section M1 .2 of M1, which lies in 5 'of M1 .1 [and can be read first on initiation of the polymerase of P1 .1, ie C1 .2.3 can bind to the polymerization product of the primer P1 .1-Ext], C1 .2.2 complementary to P1 .1. 1 (and identical to M1 .1) and C1 .2.1 is complementary to P1 .1 .2,

and wherein C1 .2 in C1 .2.1 comprises modified nucleotide building blocks such that C1 .2.1 can not serve as template for the activity of the template-dependent nucleic acid polymerase;

and wherein the sample is subsequently or simultaneously brought into contact with the following components in a second amplification step:

v. a third (right) oligonucleotide primer P3.1, which at the 3 'terminus a

Sequence section 3.1 .1 comprises [or consists essentially of 3.1 .1] that is (reverse) complementary to M1 .1 of M1 [can bind complementarily to P2.1 -hex],

vi. a fourth (left) oligonucleotide primer P4.1, which at the 3 'terminus a

Sequence Section 4.1 .1 comprises [or consists essentially of 4.1 .1] that is identical or substantially identical to M1 .5 of M1 [can complementally bind to P1 1 -ext], vii. a second template-dependent nucleic acid polymerase, in particular a DNA

Polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors.

In the first amplification step, a first primer extension product P1 .1-Ext. obtained in 5'-3 'orientation in addition to the sequence regions P1 .1 .2 and P1 .1 .1 comprises a synthesized region in the 5'-3' orientation, the sequence sections P1 .1 E4, P1 .1 E3 , P1 .1 E2 and P1 .1 E1, where P1 .1 E4 to the sequence section M1 .2 of the target sequence M1, P1 .1 E3 to M1 .3, P1 .1 E2 to M1 .4 and P1 .1 E1 to M1 .5 is substantially complementary. Similarly, a second primer extension product P2.1 -Ext is obtained, which in addition to the sequence area P2.1 .1 a synthesized area P2.1 -Ext. which is substantially identical to the target sequence M1 in the area adjacent to M1 .5 in FIG. 3 '. The reaction conditions and / or the lengths or melting temperatures of P1 .1 .2 and possibly M1 .4, M1 .3, M1 .2 and M1 .1 of the first amplification step are selected such that P1 1-Ext with M1 or with P2.1 -xt can form a double strand, and P1 .1 -Ext can form a double strand with C1 .2 and the formation of the double strand from P1 1 -Ext with C1 .2 compared to the formation of the double strand from P1 1-Ext with P2 .1 text is preferred. In a more general form, the invention may also be formulated as a method of amplifying a nucleic acid wherein a sample comprising a first nucleic acid polymer comprising a first target sequence M1 is contacted in a first amplification step with the following components:

a. a first template-dependent nucleic acid polymerase, in particular a first DNA polymerase, and substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors,

b. a first (right) oligonucleotide primer P1 .1 comprising, in the 5'-3 'orientation, in direct sequence the sequence segments P1 .1 .2 and P1 .1 .1, at least 3 ^' segment of P1 .1 .1 can bind a section of M1 (essentially) sequence-specifically and the sequence section P1 .1 .2 can not bind to M1, and

wherein P1 .1 (in particular in section P1 .1 .2) comprises modified nucleotide units, so that P1 .1 .2 can not serve as template for the activity of the first template-dependent nucleic acid polymerase; and

c. a second (left) oligonucleotide primer P2.1 comprising at least one 3 ^' segment which is (substantially) identical to one in 5' of the binding site of P1 .1. M1 is essentially identical, or a binding site can bind the reverse complementary sequence on the opposite strand of M1 or the extension product of P1 .1 [also referred to as P1 .1-Ext, as P1 .1 E1]; d. a controller oligonucleotide C1 .2 which in the 5'-3 'orientation comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct sequence:

i. a third region (C1 .2.3) of the controller oligonucleotide which is substantially complementary to at least part of the synthesized region of the extension product of the first primer (P1 1 -Ext) formed in an amplification reaction, in other words the third region being identical to one Is the portion of M1 which is located at 5 'of the binding site of the first primer with respect to the polarity of the strand read [and is read first upon initiation of the polymerase of P1 .1, ie the third region of the controller is at least part of the polymerisation product of the first first primer [P1 .1 -xt],

ii. a second region (C1 .2.2) of the controller oligonucleotide which is substantially complementary to the first region of the first primer oligonucleotide (P1 .1) (and identical at least to a portion of the binding site of the first primer on the target sequence M 1) and

iii. a first region (C1 .2.1) of the controller oligonucleotide attached to the sequence section P1 .1 .2 of the first primer or the 5 'terminal region of the first primer can bind to an extension product of the first primer (P1 .1-Tex) formed in an amplification reaction, and

wherein C1 .2 comprises nucleotide building blocks modified at least in C1 .2.1 C1 .2.3 so that C1 .2.1 can not serve as template for the activity of the template-dependent nucleic acid polymerase; the sample is incubated with the above components under conditions permitting a first amplification to form amplification products comprising primer extension products of the first oligonucleotide primer (P1.1-Tex) and the second oligonucleotide primer (P2.1-Ext) containing the target sequence M or at least their proportions and corresponding complementary sequences include; and wherein the sample is subsequently or simultaneously brought into contact with the following components in a second amplification step:

e. a third (right) oligonucleotide primer P3.1, which at the 3 'terminus a

Sequence section 3.1 .1 comprises [or substantially consists of 3.1 .1] which can bind (reversely) complementarily to the amplification product formed in the first amplification step, in other words: the sequence-specifically the 3 'terminal region of the extension product of the extension product of the first amplification reaction can bind second primer,

f. a fourth (left) oligonucleotide primer P4.1, which at the 3 'terminus a

Sequence section 4.1 .1 comprises [or substantially consists of 4.1 .1] which can bind (reversely) complementarily to the amplification product formed in the first amplification step, in other words: the sequence-specifically the 3 'terminal region of the extension product of the extension product of the first amplification reaction can bind first primer,

G. a second template-dependent nucleic acid polymerase, in particular a DNA

Polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (especially ribonucleoside triphosphates or deoxyribonucleoside triphosphate) and suitable cofactors.

The sample is incubated with the above components under conditions permitting a second amplification to form amplification products comprising primer extension products of the third oligonucleotide primer (P3.1-Ext) and the fourth oligonucleotide primer (P4.1-Ext) containing the target sequence M or at least their proportions and corresponding complementary sequences.

However, the invention is not necessarily limited to the topologies shown in FIGS. 50-56.

Another aspect of the invention relates to a kit comprising the following components:

a. a first (right) oligonucleotide primer P1 .1, which in the 5'-3 'orientation comprises in direct sequence two sequence segments P1 .1 .2 and P1 .1 .1, wherein i. P1 .1 .1 is any sequence segment which is complementary to a sequence [M1 .1] to be amplified and ii. the sequence section P1 .1 .2 can not bind to the sequence to be amplified [or a sequence immediately adjacent to the sequence to be amplified in 3 '], and

iii. wherein P1 .1 .2 comprises modified nucleotide units, so that P1 .1 .2 can not serve as template for the activity of a template-dependent nucleic acid polymerase; and

b. a second (left) oligonucleotide primer P2.1 which can sequence-specifically bind a sequence on the opposite strand of the sequence bound by the first oligonucleotide primer;

c. a controller oligonucleotide C1 .2 which comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct sequence in the 5'-3 'orientation, wherein i. C1 .2.3 is identical to a section M1 .2 of the sequence [M1] to be amplified, which lies in 5 'of the binding site of P1 .1 .1 [of M1 .1] [and read on initiation of the polymerase of P1 .1 first Thus, C1 .2.3 can bind to the polymerization product of the primer P1 1-Ext], ii. C1 .2.2 is complementary to P1 .1 .1 (and identical to M1 .1), and iii. C1 .2.1 is complementary to P1 .1 .2,

d. a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors such as Mg salts;

e. a third (right) oligonucleotide primer P3.1, which is different from the first oligonucleotide primer P1 .1, in particular does not have its section P1 .1 .2, and which at the 3 'terminus comprises a sequence section 3.1 .1 [or substantially from 3.1. 1] which is (reverse) complementary to [Section M1.1] of the target sequence [M1];

f. a fourth (left) oligonucleotide primer P4.1 which comprises at the 3 'terminus a sequence segment 4.1 .1 [or consists essentially of 4.1 .1] which can sequence-specifically bind a sequence on the opposite strand of the sequence linked by the third oligonucleotide primer;

G. a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors.

A further aspect of the invention relates to a method for the amplification of a nucleic acid, wherein a sample which contains a nucleic acid comprising a first target sequence M1, in sequence 5'-3 'in immediate sequence, the sequence sections M1 .5, M1 .4, M1 .3, M1 .2 and M1 .1 is brought into contact in a first amplification step with the following components:

a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and substrates of the template-dependent nucleic acid polymerase, a first (right) oligonucleotide primer P1 .1, in sequence 5'-3 'in immediate sequence, the sequence sections P1 .1 .2 and P1 .1 .1, wherein P1 .1 .1 has a [hybridizing] sequence complementary to M1 .1 and the sequence segment P1 .1 .2 can not bind to M1, and

a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1 .5;

a controller oligonucleotide C1 .2, which in the 5'-3 'orientation comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct succession, C1 .2.3 being identical to a section M1 .2 of M1, which is in the 5 'direction of M1 .1, C1 .2.2 is complementary to P1 .1 .1 (and identical to M1 .1) and C1 .2.1 is complementary to P1 .1 .2,

and wherein C1 .2 in C1 .2.1 comprises modified nucleotide units such that C1 .2.1 can not serve as template for the activity of the template-dependent nucleic acid polymerase,

and wherein the sample is further contacted with a first probe oligonucleotide which:

a. comprises a sequence section which

i. with a sequence of M1 located on the sequence sections M1 .2, M1 .3 and M1 .4 identical or

ii. is complementary to a sequence of M1 located on the sequence sections M1 .3 and M1 .4,

b. is bound to a fluorescent dye, the

i. with a second to the first probe oligonucleotide forms a donor-quencher pair or a FRET pair or ii. with a fluorescent dye attached in sufficiently close proximity to the binding site of the first probe oligonucleotide second probe oligonucleotide forms a donor-quencher pair or a FRET pair.

Furthermore, an aspect of the invention may be formulated as a method comprising the following steps:

A) providing a nucleic acid fragment comprising a (first target sequence), hereinafter also referred to as start nucleic acid chain.

B) providing a first amplification system comprising a first primer oligonucleotide, a second primer oligonucleotide, a controller oligonucleotide, a first DNA polymerase, and first polymerase (dNTPs) substrates and a suitable buffer solution

C) providing a second amplification system comprising a third primer oligonucleotide, a fourth primer oligonucleotide, a second thermostable polymerase, and second polymerase (dNTPs) substrates and suitable buffer solution.

Optionally, a detection system is furthermore provided, insofar as the subject matter of the invention also encompasses the detection by the first and / or the second amplification system of amplified nucleic acid fragments, in particular with probes.

D) performing a first amplification using the starting nucleic acid sequence as an initial template strand and the first amplification system to obtain a first amplification fragment 1 .1 comprising the first target sequence, and comprising a first primer extension product and a second primer extension product, which can form a complementary duplex, wherein the first primer extension product results from the template-dependent extension of a first primer by means of polymerase using the starting nucleic acid chain and / or the second primer extension product as template and the second primer extension product from the template-dependent extension a second primer by means of polymerase using the first primer extension product as a template, wherein the first and the second primer extension product mutually serve as templates for the respective primer extension di and wherein both complementary strands of the first amplification product 1 .1 can be converted at least partially into single-stranded form with the assistance of the controller oligonucleotide, so that renewed primer binding to respective complementary segments of the synthesized primer extension product is possible.

The reaction conditions of the first amplification used comprise at least one temperature step which permits hybridization and template-dependent primer extension of both primers of the first amplification system and at least one temperature step in which the first primer extension product of the second primer extension product participates of the controller oligonucleotide is separated. The reaction conditions used do not allow spontaneous separation of the first primer Extension product from the second primer extension product in the absence of the controller oligonucleotide. The first amplification is carried out until the desired amount of the first amplification product 1 .1 has been synthesized.

E) carrying out a second amplification using at least one of the two strands of the first amplification fragment 1 .1 as an initial template strand and using the second amplification system to obtain a second amplification fragment 2.1, comprising a third primer extension product and a fourth Primer extension product which can form a complementary double strand, wherein both strands of the amplification fragments 2.1 can serve as matrices in the primer extension, wherein the reaction conditions of the second amplification used in at least one temperature step, a hybridization of the two primers of the second Allow amplification system and a template-dependent primer extension of each bound to complementary regions primer of the second amplification system and allow at least in a further temperature step, a separation of a double strand, include comprising a third primer extension product and a fourth primer extension product, wherein the third and fourth primer extension products are converted into single stranded form such that re-primer binding and extension may take place. The second amplification is carried out until the desired amount of the second amplification product 2.1 is synthesized.

In detail, the properties of the components of the respective amplification system, the nucleic acid fragment comprising a first target sequence, and the reaction conditions used determine the course of the two amplification reactions.

In general, the first amplification takes place with the assistance of the controller oligonucleotide. In this case, the separation of the two synthesized primer extension products takes place at least in part depending on the sequence of the first primer extension product and its complementarity with the sequence of the controller oligonucleotide.

During the second amplification, a second amplification fragment is amplified substantially without the involvement of the controller oligonucleotide.

In the course of both amplification reactions both desired amplification products (amplification fragment 1 .1 and amplification fragment 2.1) can be formed, as well as their intermediates (intermediates). The composition of the intermediates depends essentially on the provided components of the first and second amplification systems.

Description of the figures

Fig. 1 shows schematically the components of certain embodiments of the amplification method according to the invention in a heterogeneous format; A) of the first amplification system; B) of the second amplification system. Fig. 2 shows schematically the components of certain embodiments of the first

amplification system;

3 shows a temperature profile of certain embodiments of the method according to the invention in heterogeneous format; An aliquot is transferred after amplification 1 .1 in amplification 2.1. This results in a dilution of the first amplification fragments.

4 shows a temperature profile of certain embodiments of the method according to the invention in heterogeneous format; Components of the second amplification system are added. There is no significant dilution of fragments generated by A-1.1.

Fig. 5 shows the components of certain embodiments of the amplification method according to the invention in a homogeneous format; A) of the first amplification system; B) of the second amplification system.

Fig. 6 to 1 1 shows temperature profiles of embodiments of the invention

process;

Fig. 12 schematically shows (A) the structure of a first primer oligonucleotide; (B) the complementary binding of the first primer to the nucleic acid chain to be amplified; (C) the complementary binding of the first primer to the nucleic acid chain to be amplified and the extension of the primer.

Fig. 13 shows schematically (A) the relation between the individual components during the synthesis of the first primer extension product; (B) the synthesis of the first primer extension product; 1 = nucleic acid to be amplified in the first amplification; 2 = controller oligonucleotide; 3 = the first primer oligonucleotide; 4 = the extension product of the first primer oligonucleotide.

Fig. 14 shows schematically the synthesis of the second primer extension product;

Reference numeral 1 -4 as shown in FIG. 13; 5 = the second primer oligonucleotide; 6 = the extension product of the second primer oligonucleotide.

Fig. 15 shows schematically the synthesis of the third and fourth primer extension products; P3.1 -ext part 1 = extension product of P3.1 synthesized on P2.1-Ext as template (intermediate); P4.1 -Ext part 1 = extension product of P4.1 synthesized on P1.1 -Ext as template (intermediate); P3.1 -Ext = extension product of P3.1 synthesized using P4.1 Ext part 1 or at P4.1 -Ext as template; P4.1-Ext = extension product of P4.1 synthesized using P3.1 -xt part 1 or as template at the P3.1 -xt

Fig. 16 shows schematically the synthesis of the partial third primer extension product (P3.1-Ext part 1); 7 = segment of P3.1 complementary to the extension product of the second primer (P2.1 -Ext); 8 = segment of P3.1 not complementary to the extension product of the second primer (P2.1 -Ext) P3.1-Ext part 1 = extension product of the third primer (P3.1) synthesized using P2.1 -Ext as template , Fig. 17 shows schematically the synthesis of the complete fourth primer extension product; P2.1 -Ext = segments 5 and 6; P3.1-Ext part 1 = extension product of P3.1 synthesized on P2.1 -EX as template; P4.1 = fourth primer; 9 = segment of P4.1, which can complementarily bind to P3.1 - Ext-T eil1 complementary; 10 = segment of P4.1 which can not bind complementarily to P3.1. Ext part 1; P4.1 -Ext = extension product of P4.1 synthesized on P3.1 - Ext part 1 as template

Fig. 18 shows schematically the synthesis (A) of an intermediate (P3.1-Ext part 1) of the third primer extension product using the second primer extension product (P2.1-Ext); (B) the complete third primer extension product (P3.1 Ext) using P4.1 Ext as template; P4.1 -Ext = extension product of P4.1 synthesized on P3.1 Ext part 1 as template; P3.1-Ext = extension product of P3.1 synthesized on P4.1-Ext as template

Figures 19 to 26 show schematically the relations between the individual components during the synthesis of the first primer extension product and the third PCR primer; 1 = P2.1 extension in the first amplification; 2 = controller oligonucleotide; 3 = the first primer oligonucleotide; 4 = primer 3.1

Figs. 27 to 31 schematically show the components of various embodiments of the first amplification system; (A) components of the first amplification system; (B) Components of the second amplification system. Figures 27-29: the fourth primer is identical to the second primer, the third primer is different from the first primer. Its binding may be shifted relative to the first primer. Fig. 30: the fourth primer is different from the second primer. 3 ^' end of the fourth primer is optionally shifted with respect to the 3 ^' end of the second primer. The fourth primer comprises copyable sequence segments which are not complementary to the target sequence or do not bind to P1 .1-Ext. FIG. 31: The third primer comprises copyable sequence segments which are not complementary to the target sequence or do not bind to P2.1-Ext.

Fig. 32 shows schematically (A) a first primer oligonucleotide and (B) a nucleic acid to be amplified (P1 1 -Ext and P2.1 -Ext);

Fig. 33 shows schematically the strand displacement by a controller oligonucleotide;

Fig. 34 shows schematically the interactions between components in a reaction of the method according to the invention; The intermediate step of separating the second primer extension product from the double-stranded complex consisting of the first primer extension product and controller oligonucleotide is apparent.

Fig. 35 shows schematically an amplification by simultaneous synthesis of two strands and separation of the synthesized amplification fragments;

Figs. 36 to 49 show the results of example experiments. Figures 50 and 51 schematically show certain embodiments of the preparation of a starting nucleic acid chain starting from genomic DNA.

FIGS. 52 to 54 schematically show certain embodiments of the ampification according to the invention.

Figures 55 to 57 schematically show certain embodiments of the topography of the components of the first amplification system and the second amplification system.

FIGS. 58 to 59 schematically show certain embodiments of the possible localization regions for oligonucleotide probes:

Fig. 60 shows schematically certain embodiments of the localization of probe segments, which can bind predominantly complementary to the third (and possibly the first) primer extension product (P3.1 -Ext and P1 .1-Ext).

FIG. 61 schematically shows certain embodiments of the localization of probe segments which can bind predominantly complementary to the fourth (and possibly the second) primer extension product (P4.1 -Ext and P2.1-Ext).

Figs. 62-67 schematically show certain embodiments of probes.

FIGS. 68-71 schematically show certain embodiments of the localization of a target sequence 1-3 in the starting nucleic acid 1.1, an amplification fragment 1.1 (P1 .1-Ext and P2.1-ext), and the second amplification fragment 2.1 (P3. 1-Ext and P4.1 -xt).

Detailed description of the invention

The above-mentioned objects of the present invention are achieved, in particular, by a combination of two amplifications carried out in succession, PCR amplification being the final step.

Other objects underlying the invention are achieved by the use of the probe system described below in certain aspects and embodiments.

In the following, some molecular processes and resulting products and their potential intermediates are exemplarily and schematically explained.

According to aspect 1 of the invention, a method for amplification is provided. The method comprises the steps:

1) a first amplification with the steps

1.A) hybridizing a first primer oligonucleotide to the 3 'segment of a template nucleic acid fragment (template strand, starting nucleic acid chain) of a first nucleic acid to be amplified which comprises a target sequence, wherein the first primer oligonucleotide comprises the following regions: a first region capable of binding sequence-specifically to the 3 'segment of a template strand of the first nucleic acid to be amplified and being complementary to at least a portion of the target sequence;

a second region which adjoins the 5 'end of the first region or is linked via a linker, which second region can be bound by a controller oligonucleotide and by a polymerase used for the first amplification under the selected reaction conditions in the Essentially remains uncopied;

1.B) extension of the first primer oligonucleotide, when hybridized to a complementary segment of the first nucleic acid to be amplified, by the first template-dependent polymerase to obtain a first primer extension product which synthesizes one of the polymerase in addition to the first primer oligonucleotide Area substantially complementary to the template strand of the target sequence, wherein the first primer extension product and the template strand of the first nucleic acid to be amplified under the reaction conditions of the first amplification used are present substantially as a double strand;

1.C) binding a controller oligonucleotide to the first primer extension product, wherein the controller oligonucleotide comprises the following ranges:

A first region capable of binding to the second region of the first primer and / or the first primer extension product;

A second region that is substantially complementary or fully complementary to the first region of the first primer oligonucleotide and / or the first primer extension product, and

A third region which is substantially complementary or fully complementary at least in part to the polymerase-synthesized portion of the first primer extension product;

wherein the controller oligonucleotide does not serve as a template for primer extension of the first primer oligonucleotide, and

the controller oligonucleotide comprises a sequence segment which is identical or substantially identical to a strand of the template strand (the target sequence), and

the controller oligonucleotide binds to the first region of the first primer extension product and

the controller oligonucleotide binds to the second region of the first primer extension product and at least partially to the synthesized region of the first primer extension product displacing complementary portions of the template strand of the first nucleic acid to be amplified; wherein the polymerase synthesized region of the first primer extension product which is the second primer Oligonucleotide complementary segment of the first primer extension product is single-stranded under the reaction conditions;

1 .D) hybridizing a second primer oligonucleotide to the single-stranded complementary segment of the first primer extension product, wherein the second primer oligonucleotide comprises a region capable of hybridizing sequence-specifically to the synthesized region of the first primer extension product and at least a portion of a target sequence includes;

1.E) extension of the second primer oligonucleotide by the first polymerase using the first primer extension product as a template to obtain a second primer extension product comprising, in addition to the second primer oligonucleotide, a polymerase synthesized region comprising at least a portion of the first target sequence, wherein the first primer extension product and the second primer extension product form a first double-stranded amplification product under reaction conditions of the first amplification, and

1.F) if necessary repetition, also repeated repetition, the steps of the first amplification.

2) a second amplification with the steps (FIG. 15):

2.A) hybridizing a third primer oligonucleotide to the second primer extension product of the first amplification product, the third primer oligonucleotide comprising a first region capable of substantially sequence-specific binding to a segment of the second primer extension product;

2.B) extension of the third primer oligonucleotide by a second polymerase using the second primer extension product as a template to give a third primer extension product (P3.1 - Ext Part 1) which contains one of the three primer oligonucleotide and the third primer oligonucleotide Polymerase comprising a sequence segment which is substantially complementary to the second primer extension product or to the nucleic acid to be amplified or to a portion of the target sequence, wherein the second primer extension product and the third primer extension product (P3.1. Ext part 1) as a double strand;

2.C) hybridizing a fourth primer oligonucleotide to the first primer extension product of the first amplification product, wherein the fourth primer oligonucleotide comprises a first region capable of substantially sequence-specific binding to the polymerase-synthesized region of the first primer extension product;

2.D) extension of the fourth primer oligonucleotide by the second polymerase using the first primer extension product as a template to yield a fourth primer extension product (P4.1 - Ext Part 1) which contains, in addition to the fourth primer oligonucleotide, one of polymerase includes synthesized area in the Is substantially complementary to the first primer extension product and comprises portions of the target sequence, wherein the first primer extension product and the fourth primer extension product (P4.1-Ext part 1) are present as a duplex;

2.E) Separation of the double strand from the first primer extension product and the fourth primer extension product (P4.1-Ext Part 1) and the double strand from the second primer extension product and the third primer extension product (P3.1-Ext part 1 );

2.F) hybridizing a third primer oligonucleotide to the fourth primer

Extension product (obtained in step 2.D, P4.1 -ext part 1), wherein the third primer oligonucleotide comprises a first region substantially sequence-specific to a segment of the fourth primer extension product (P4.1-Ext part 1) can bind; 2.G) extension of the third primer oligonucleotide by a second polymerase using the fourth primer extension product (P4.1-Ext Part 1) as a template to give a complete third primer extension product (P3.1-Ext), the third primer extension product (P3.1 -Ext) and the fourth primer

Extension product (P4.1 -Ext part 1) are present as a double strand;

2.H) hybridizing a fourth primer oligonucleotide to the third primer

Extension product (obtained in step 2B, P3.1 -ext part 1), wherein the fourth primer oligonucleotide comprises a first region capable of substantially sequence-specific binding to the polymerase-synthesized region of the third primer extension product;

2.I) extension of the fourth primer oligonucleotide by the second polymerase using the third primer extension product (P3.1-Ext Part 1) as template to yield a complete fourth primer extension product (P4.1 -Ext), the the third primer extension product (P3.1-Ext Part 1) and the fourth primer extension product (P4.1-Ext) are present as a double strand;

2.J) Separation of the double strand from the third primer extension product (P3.1-Ext part 1) and the complete fourth primer extension product (P4.1 -Ext) and the double strand from the fourth primer extension product (P4.1- Ext part 1) and the complete third primer extension product (P3.1-Ext);

2.K) hybridizing a third primer oligonucleotide to the complete fourth primer extension product (obtained in step 2I, P4.1 -Ext), wherein the third primer oligonucleotide comprises a first region substantially sequence-specific to a segment of the fourth Primer extension product (P4.1-Ext);

2.L) extension of the third primer oligonucleotide by a second polymerase using the complete fourth primer extension product (P4.1 -Ext) as a template to give a complete third primer extension product (P3.1 -Ext), the complete the third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext) are present as a double strand; 2.M) hybridizing a fourth primer oligonucleotide to the complete third primer extension product (obtained in step 2G, P3.1 -Ext), the fourth primer oligonucleotide comprising a first region substantially sequence specific to that of polymerase Area of the complete third primer extension product can bind;

2.N) extension of the fourth primer oligonucleotide by the second polymerase using the complete third primer extension product (P3.1-Ext) as template to give a complete fourth primer extension product (P4.1-Ext), the complete the third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext) are present as a double strand; 2.0) Separation of the double strands formed in step 2.L and 2.N from the complete third primer extension product (P3.1 -Ext) and the complete fourth primer extension product (P4.1 -Ext)

2.P) if necessary, repeating the steps of the second amplification with multiplication of the complete third primer extension product (P3.1-Ext) and of the complete fourth primer extension product (P4.1-Ext), optionally repeated several times.

In aspects and embodiments relating to the detection of the amplification products obtained, in particular with probes, provision may be made for adding a detection system to the reaction mixture.

Alternatively, this aspect of the invention may also be formulated as a method of amplifying a nucleic acid (Figs. 1, 5):

1) carrying out a first amplification for the amplification of first amplification fragments 1.1 comprising a target sequence, wherein the first amplification comprises the following steps: a) hybridization of a first primer oligonucleotide to the 3 'segment of a strand of a nucleic acid to be amplified, the nucleic acid chain to be amplified comprises a target sequence,

wherein the first primer oligonucleotide comprises the following ranges:

A first primer region in the 3 ^' segment of the first primer oligonucleotide which can bind sequence-specifically to a strand of a nucleic acid chain to be amplified

A second region, coupled directly or via a linker, to the 5 ^' end of the first primer region of the first primer oligonucleotide comprising a polynucleotide tail capable of binding a controller oligonucleotide and promoting strand displacement (step c). by controller oligonucleotide, wherein the polynucleotide tail of polymerase remains substantially uncopied under the selected reaction conditions. b) extension of the first primer oligonucleotide with the aid of a polymerase to form a first primer extension product comprising a sequence complementary to the target sequence of the nucleic acid chain to be amplified (a),

c) binding of the controller oligonucleotide to the polynucleotide tail of the second region of the first extended primer oligonucleotide, wherein the controller oligonucleotide comprises the following regions:

A first single-stranded region capable of binding to the polynucleotide tail of the second region of the first primer oligonucleotide

A second single-stranded region which is substantially complementary to the first region of the first primer oligonucleotide and can bind to it

A third single-stranded region which is substantially complementary to at least one segment of the polymerase-synthesized extension product of the first primer extension product,

wherein the controller oligonucleotide does not serve as a template for primer extension of the first primer oligonucleotide,

d) binding of the controller oligonucleotide to the first primer region of the first extended primer oligonucleotide, while displacing the complementary to this first primer region strand of the amplifying nucleic acid chain

e) binding of the controller oligonucleotide to the complementary segment of the extension product of the first extended primer oligonucleotide, displacing the strand complementary to this extension product that to the amplifying nucleic acid chain, wherein the 3 ^' segment of the first primer extension product is single-stranded,

f) hybridizing a second oligonucleotide primer to the first primer extension product, wherein the 3 'segment of the second oligonucleotide primer comprises a sequence capable of hybridizing to the first primer extension product, and

g) extension of the second oligonucleotide primer with polymerase to form a second primer extension product, wherein the extension is up to and including the first primer region of the first primer oligonucleotide and this first primer region is copied from the polymerase, wherein the polynucleotide Tail of the second region remains uncopied; h) repeating steps a) -g) until the desired level of amplification is achieved.

2) carrying out a second amplification, which is carried out by using, in the first amplification reaction, first amplification fragments 1 .1 as templates and using a third primer and a fourth primer and a second polymerase, and suitable cofactors for propagating a second amplification Fragments 2.1 a target sequence or at least a segment of the target sequence (or its complementary sequence), where

The third primer oligonucleotide can bind to the second primer extension product and / or to the fourth primer extension product in a substantially sequence-specific manner and can be extended by the second polymerase,

The fourth primer oligonucleotide can bind to the first primer extension product and / or to the third primer extension product in a substantially sequence-specific manner and can be extended by the second polymerase,

and the resulting primer extension products starting from the third and fourth primers can serve as templates for an exponential amplification of the second amplification fragments 2.1.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the second amplification is a PCR (polymerase chain reaction, polymerase chain reaction, also called PCR amplification) and is carried out under such conditions as an amplification of second amplification fragments 2.1 comprehensively allows a target sequence.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that at least the second amplification is carried out by PCR amplification in the presence of a detection system comprising an oligonucleotide probe.

Furthermore, a method according to any of the above aspects may be characterized in that the second amplification is a PCR amplification and is carried out under conditions which include at least one step in which primers are hybridized and / or extended by polymerase, and at least a step in which the resulting primer extension products are converted into single-stranded form (denatured).

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the second amplification is a PCR amplification and is carried out until the desired amount of amplification fragments 2.1 are synthesized.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the third primer oligonucleotide of the second amplification in the 3 ^' segment of the second primer extension product and / or in the 3 ^' segment of the fourth primer

Extension product and can be extended by a polymerase.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the fourth primer oligonucleotide of the second amplification in the 3 ^' segment of the first primer extension product and / or in the 3 ^' segment of the third primer

Extension product and can be extended by a polymerase. Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the third primer oligonucleotide of the second amplification binds with its 3 ^' segment to the second primer extension product and / or the fourth primer extension product and is extended by a polymerase can.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the fourth primer oligonucleotide of the second amplification binds with its 3 ^' segment to the first primer extension product and / or the third primer extension product and is extended by a polymerase can.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the extension product of the third primer oligonucleotide and / or the extension product of the fourth primer oligonucleotide of the second amplification comprises at least one segment of the target sequence or its complementary sequence.

The method of any one of the above aspects, characterized in that the third single-stranded region of the controller oligonucleotide is substantially complementary to the segment of the polymerase-synthesized extension product of the first primer extension product that immediately adjoins the first primer region.

Furthermore, a method according to one of the above-mentioned aspects may be characterized in that the displacement of the strand complementary to the first primer extension product of the nucleic acid to be amplified takes place until this complementary strand of the nucleic acid to be amplified is detached from the first primer extension product.

Furthermore, a method according to any of the above aspects may be characterized in that step (f) of the method is modified to include hybridizing a second oligonucleotide primer to the first primer extension product, wherein at least a partial displacement of the controller -Oligonukleotides from the bond with the first extension product by strand displacement occurs.

Furthermore, a method according to any one of the above aspects may be characterized in that step (g) of the method is modified to include displacement of the controller oligonucleotide from binding with the first primer extension product with the participation of the polymerase.

Furthermore, a method according to any of the above aspects may be characterized in that step (h) of the method is modified to include binding of the controller oligonucleotide to the uncopied polynucleotide tail of the first extended primer oligonucleotide and displacement of the second Primer extension product from binding to the first primer extension product, with simultaneous formation of a complementary duplex with a segment of the first specific extension product of the first primer oligonucleotide. Furthermore, a method according to any one of the above aspects may be characterized in that the repetition of the steps is carried out under conditions which allow the repetition of steps (a) to (g).

Furthermore, a method according to any one of the above aspects may be characterized by comprising simultaneously amplifying the first and second primer extension products in an exponential reaction using the first and second primer oligonucleotides and the controller oligonucleotide, wherein the formed primers Extension products act as templates for mutual synthesis.

The yield of individual products and intermediates depends on several factors. For example, higher concentrations of individual primers generally favor the yield of products / intermediates. Furthermore, the formation of products / intermediates can be influenced by the choice of the reaction temperature and the binding affinity of individual reactants to each other (affinity of binding of individual primers to their complementary primer binding sites within template strands): in general, longer oligonucleotides, for example, bind better at higher temperatures as shorter oligonucleotides, CG content may also play a role in complementary sequence segments: CG-richer sequences also bind stronger at higher temperatures than AT-rich sequences. Furthermore, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength of primers to their respective complementary segments, which also results in preferential binding of primers at higher temperatures.

From this it can be deduced that the design of sequence segments of individual primer sequences can influence the yields of certain products / intermediates and thus influence their accumulation during amplification.

Furthermore, the method according to the invention for the amplification of a nucleic acid (FIGS. 1, 5, 55-57) can be formulated as a consequence of the following steps:

a) a first amplification with the steps:

Provision of a starting nucleic acid 1.1, which comprises a target sequence

Hybridizing a first primer oligonucleotide (P1.1) to a nucleic acid to be amplified with a target sequence (either starting nucleic acid 1 .1 or P2.1-Ext), wherein the first primer oligonucleotide (P1.1) comprises the following ranges:

A first region (P1.1.1) which can bind sequence-specifically to a region of the nucleic acid to be amplified (P2.1 E1),

A second region (P1 .1.2) which connects to the 5 'end of the first region or is connected via a linker, wherein the second region can be bound by a controller oligonucleotide, and remains essentially uncoated for the polymerase used under the chosen reaction conditions;

Extension of the first primer oligonucleotide (P1.1) by a first polymerase to give a first primer extension product (P1 .1-Ext) which comprises a synthesized region in addition to the first primer oligonucleotide (P1.1) (P1.1 E1 to P1 .1 E4), which is substantially complementary to the nucleic acid to be amplified or to the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present as a double strand;

Binding of a controller oligonucleotide (C1 .2) to the first primer extension product (P1.1 -Ext), wherein the controller oligonucleotide (C1.2) comprises the following ranges:

A first region (C1 .2.1) which can bind to the second region (overhang) of the first primer extension product (P1.1 E6),

A second region (C1.2.2) which is complementary to the first region of the first primer oligonucleotide (P1.1 .1), and

A third region (C1 .2.3) substantially complementary to at least a portion of the synthesized region of the first primer extension product (P1 .1 E4); and

wherein the controller oligonucleotide (C 1 .1) does not serve as a template for a primer extension of the first primer oligonucleotide (P1 .1), and the controller oligonucleotide (C 1,1) to the first primer extension product (P1.1 E6, P1.1 E5, P1.1 E4) while displacing the region (P2.1 E1, P2.1 E2) which is complementary to this region, of the nucleic acid to be amplified;

Hybridizing a second primer oligonucleotide (P1.1) to the first primer extension product, wherein the second primer oligonucleotide (P2.1) comprises a region (P2.1.1) which is sequence-specifically attached to the synthesized region of the first primer Extension product (P1.1 E1),

Extension of the second primer oligonucleotide (P.2.1) by the first polymerase to obtain a second primer extension product (P2.1-Ext) which, in addition to the second primer oligonucleotide (P2.1), has a synthesized region (P2.1 E4 to P2.1 E1), which is substantially identical to the nucleic acid or to the target sequence to be amplified, wherein the first primer extension product (P1 .1-Ext) and the second primer extension product (P2.1) form a first double-stranded amplification product; and

the steps of the first amplification are repeated until the desired amount of first amplification product has been synthesized. b) a second amplification with the steps:

Hybridizing a third primer oligonucleotide (P3.2) to the second primer extension product (P1.1-Ext.), Wherein the third primer oligonucleotide (P3.2) comprises a first region (P3.1.1) which is sequence-specific can bind a region of the second primer extension product (P2.1 E1),

Extension of the third primer oligonucleotide (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext) which, in addition to the third primer oligonucleotide (P3.2), has a synthesized region (P3.1 E5 to P3.1 E2 or P3.1 E5 to P3.1 E1), which is substantially complementary to the second primer extension product (P2.1 -Ext) or to the target sequence, wherein the second primer extension product (P2.1 ) and the third primer extension product (P3.1) are present as a double strand;

Hybridizing a fourth primer oligonucleotide (P4.2) to the first primer extension product (P1 .1-Ext) and / or to the third primer extension product (P3.1-Ext) wherein the fourth primer oligonucleotide (P4.2 ) comprises a first region (P4.1.1) which can sequence-specifically bind to the synthesized region of the first primer extension product (P1.1 E1) and the third primer extension product (P3.1 E2),

Extension of the fourth primer oligonucleotide (P4.2) by the second polymerase to obtain a fourth primer extension product (P4.2-Ext) which has a synthesized region (P4.1 E5 to P4.1 E2 or P4.1 E5 to P4.1 E1), which is substantially complementary to the first primer extension product (P1.1 -Ext) or identical to the target sequence, wherein the first primer extension product (P1 .1-Ext) and the fourth primer extension product (P4.1 -Ext) present as a double strand;

Separation of the double strand from the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer extension product (P2.1-Ext) and the third primer Extension product (P3.1-Ext) and the double strand from the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1-Ext);

Hybridizing the third primer oligonucleotide (P3.2) to the fourth primer extension product (P4.2-Ext) and extension of the third primer oligonucleotide (P3.2) by the second polymerase; and

Hybridizing the fourth primer oligonucleotide to the third primer extension product (P3.2-Ext) and extending the fourth primer oligonucleotide (P4.2) by the second polymerase.

Furthermore, the invention comprises the following aspects: A method according to aspect 1, wherein the nucleic acid fragment comprising a target sequence is provided in single-stranded form.

The method of aspect 1, wherein the nucleic acid fragment comprising a target sequence in double stranded form (comprising a nucleic acid fragment including a first target sequence, the start nucleic acid chain, and a complementary nucleic acid fragment) and this double stranded nucleic acid fragment is converted to single stranded form prior to the first amplification.

The method of aspect 1, wherein the second amplification using the third and the fourth primer proceeds as a polymerase chain reaction (PCR).

Method according to aspect 1, in which the separation of the synthesized strands during the first amplification takes place predominantly sequence-specifically with the assistance of the controller oligonucleotide.

Process according to aspect 1, wherein the separation of the synthesized strands during the second amplification is effected under the action of a temperature which can cause the separation of the synthesized strands. For example, such a temperature includes ranges of 80 ° C to 105 ° C.

A method according to aspect 1, wherein the hybridization and primer extension during the second amplification is carried out at temperatures which allow a predominantly complementary binding of primers to complementary sequence segments of the synthesized strands and a primer extension by the second polymerase. For example, such temperature includes ranges from 20 ° C to about 80 ° C.

The method of aspect 1, wherein prior to the second amplification, separation of first and second primer extension products synthesized during the first amplification occurs so that both primer extension products are single-stranded.

The method of aspect 1, wherein the first primer oligonucleotide comprises in its first region a sequence segment which is capable of complementary binding to the first target sequence in its 3 ^' segment.

The method of aspect 1, wherein the second primer oligonucleotide comprises in its 3 ^' region a sequence segment which is substantially identical to a portion of the first target sequence, said portion being in the 5 ^' segment of the target sequence

The method of aspect 1, wherein the controller oligonucleotide comprises in its second and third regions a sequence segment which is substantially identical to a portion of the target sequence.

The method of aspect 1, wherein the first target sequence and a strand complementary to this first target sequence are included on both sides of the primer pair comprising a first primer oligonucleotide and a second primer oligonucleotide. The method of aspect 1, wherein the third primer oligonucleotide comprises in its 3 ^' region a sequence segment which is capable of substantially complementary binding to the second primer extension product of the first amplification fragment 1.1.

The method of aspect 1, wherein the third primer oligonucleotide comprises in its 3 ^' region a sequence segment which is capable of substantially complementary binding to the second primer extension product of the first amplification fragment 1.1, and further includes that 3 ^' region first segment complementary segment.

The method of aspect 1, wherein the fourth primer oligonucleotide comprises in its 3 ^' region a sequence segment which is capable of substantially complementary binding to the first primer extension product of the first amplification fragment 1.1.

The method of aspect 1, wherein the fourth primer oligonucleotide comprises in its 3 ^' region a sequence segment which is capable of substantially complementary binding to the first primer extension product of the first amplification fragment 1.1 and further comprising a segment of that 3 ^' region which is substantially identical to a portion of the first target sequence, this portion being in the 5 ^' region of the target sequence

The method of aspect 1, wherein the first target sequence and a strand complementary to this target sequence are partially or completely encompassed on both sides by a primer pair formed by a third primer oligonucleotide and a fourth primer oligonucleotide.

The method of aspect 1, wherein the first primer oligonucleotide and the third primer oligonucleotide are identical.

The method of aspect 1, wherein the first primer oligonucleotide and the third primer oligonucleotide are identical, resulting during the second amplification

Primer extension products (P4.1 -Ext part 1) and (P4.1 -Ext) are identical.

The method of aspect 1, wherein the first primer oligonucleotide and the third primer oligonucleotide are identical but the second and fourth primer oligonucleotides are different.

Primer extension products (P4.1-Ext Part 1) and (P4.1 -Ext) are identical, but differ the primer extension product of the second and fourth primer oligonucleotide.

The method of aspect 1, wherein the second primer oligonucleotide and the fourth primer oligonucleotide are identical.

The method of aspect 1, wherein the second primer oligonucleotide and the fourth primer oligonucleotide are identical, resulting during the second amplification

Primer extension products (P3.1 -Ext part 1) and (P3.1 -Ext) are identical.

The method of aspect 1, wherein the second primer oligonucleotide and the fourth primer oligonucleotide are identical but the first and third primer oligonucleotides are different. The method of aspect 1, wherein the second primer oligonucleotide and the fourth primer oligonucleotide are identical, wherein primer extension products resulting from the second amplification (P3.1-Ext Part 1) and (P3.1-Ext) are identical but are distinguish the primer extension product of the first and third primer oligonucleotide.

The method of aspect 1, wherein the first primer oligonucleotide and the third primer oligonucleotide, and the second and the fourth primer oligonucleotide are identical.

The method of aspect 1, wherein the first primer oligonucleotide and the third primer oligonucleotide, and the second and the fourth primer oligonucleotide are identical, wherein during the second amplification resulting primer extension products (P4.1 -Ext part 1) and (P4 .1-Ext) are identical and resulting primer extension products (P3.1-Ext part 1) and (P3.1-Ext) are identical.

The method of aspect 1, wherein the second region of the first primer oligonucleotide comprises a polynucleotide tail that does not bind to the first target sequence.

The embodiments mentioned above in relation to aspect 1 can be combined with one another.

The nucleic acid to be amplified in the first amplification comprises a first target sequence. Before the start of the first amplification, at least one start nucleic acid chain 1.1 is added to the reaction which comprises a target sequence and can serve as template for the synthesis of the first amplification fragment.

The synthesized primer extension products of the first amplification (the first amplification fragment 1 .1) comprise the target sequence. This first amplification fragment 1 .1 can serve as start nucleic acid chain 2.1 with a template function for the second amplification.

The primer extension products synthesized in the second amplification (P3.1-Ext and P4.1-Ext) (the second amplification fragment 2.1) comprise at least portions of the first target sequence.

The term "substantially complementary" in the context of the present disclosure means that two nucleic acids, in particular their mutually complementary regions, have not more than 5, 4, 3, 2, or 1 mismatches to one another.

In certain embodiments of the method according to the invention, it is provided that the steps of the first amplification are repeated until the first amplification fragment (1.1) is present in a copy number in the range from 10 to 1 E12, in particular from 100 to 10E9, in particular from 1000 to 10E9 (10E9 = 1 million,000,000).

In certain embodiments of the method according to the invention, it is provided that the steps of the first amplification are repeated at least twice.

In certain embodiments of the method according to the invention, it is provided that the second amplification is based on a copy number of the first amplification fragment (1.1). is started, which is present in the range of 10 to 1 E12, in particular from 100 to 1 E10, in particular from 10E3 to 10E9.

In certain embodiments of the method according to the invention, it is provided that the steps of the second amplification are repeated until the amplification fragment (2.1) is present in a copy number in the range from 10E5 to 1E16, in particular from 10E5 to 1E14, in particular 10E6 to 1 E14.

In certain embodiments of the method according to the invention, it is provided that the steps of the second amplification are repeated at least twice.

In a further embodiment, the detection system comprises at least one

Oligonucleotide probe labeled with a fluorescent reporter.

In a further embodiment, the detection system comprises at least one

Oligonucleotide probe labeled with a fluorescent reporter and a fluorescence quencher.

In a further embodiment, the detection system comprises at least one

An oligonucleotide probe labeled with a donor fluorophore capable of forming a FRET pair with the fluorescent reporter.

In a further embodiment, an oligonucleotide probe comprises a sequence segment which is substantially complementary to at least one of the primer extension products formed (P1 .1-Ext, P2.1-Ext, P3.1-Ext, P4.1-Ext) and which is at least hybridize to one of the formed primer extension products under suitable conditions (hybridization conditions).

In a further embodiment, this sequence segment is complementary to the first and / or the third primer extension product.

In another embodiment, this sequence segment is complementary to the first and / or the third primer extension product, wherein the oligonucleotide probe can bind complementary in the 3 ^' segment of the respective primer extension product which is not complementarily bound by the controller oligonucleotide.

In a further embodiment, this sequence segment is complementary to the second and / or the fourth primer extension product.

In a further embodiment, this sequence segment of the oligonucleotide probe comprises a length which is in the range between 10 nucleotides and 50, in particular between 15 and 40, in particular between 15 and 30 nucleotides.

In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially complementary to the controller oligonucleotide. In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially complementary to the controller oligonucleotide, the length of this segment being less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides.

In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially complementary to one of the primer oligonucleotides.

In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially complementary to one of the primer oligonucleotides, the length of this segment being less than 20 nucleotides, in particular comprising less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides.

In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially identical to the sequence of the third region of the controller oligonucleotide.

In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially identical to the sequence of the third region of the controller oligonucleotide, the length of this segment being less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides.

In one embodiment, the controller oligonucleotide comprises one of the following components (a fluorescence reporter and / or a fluorescence quencher and / or a donor fluorophore), wherein at least one of these components is located in the third region of the controller oligonucleotide.

In one embodiment, the oligonucleotide probe is at least partially cleavable by a 5 ^' -3 ^' nuclease.

In a further embodiment, an oligonucleotide probe comprises a sequence segment which is substantially complementary to the target sequence or its portion encompassed by one of the amplification products, the length of this segment being in the range of between 5 and 50 nucleotides, in particular between 10 and 40, in particular between 15 and 30 nucleotides.

In another embodiment, an oligonucleotide probe does not comprise a sequence segment substantially complementary to the target sequence or its complementary strand.

In another embodiment, an oligonucleotide probe comprises a sequence segment not substantially complementary to the target sequence or its complementary strand. The binding of the oligonucleotide probe to the respective complementary segment of the primer extension product formed under suitable hybridization conditions leads to formation of a double strand. The hybridization conditions are present during the process.

At appropriate times during the process, the reaction is illuminated with light of a suitable wavelength for the generation of a fluorescence signal and the detection of the fluorescence signal from the fluorescence reporter, whereby the intensity of the fluorescence signal is measured.

The detection of the fluorescence signal is carried out with suitable optical / physical means, in which either the increase of the fluorescence signal or the decrease of the fluorescence signal is measured. By means of suitable sensors, the intensity of the fluorescence signal can be converted into measured values which, after appropriate calibration, make it possible to determine whether a desired target sequence is present in the reaction mixture or not.

An essential aspect of the fluorescence detection system is the reporter-quencher pair. When the quencher is in close proximity to the reporter, no signal is emitted upon exposure to the excitation light. When reporter and quencher molecules are held in close proximity due to a complementary star sequence, no fluorescence signal appears even under illumination. However, if the fluorescence system is altered such that the nucleotide sequence located between reporter and quencher can hybridize to a target sequence, then reporters and quenchers are placed in a spatial distance that causes the quencher to be so far from the reporter molecule that the reporter molecule will emits fluorescence radiation when the reaction mixture is irradiated with an excitation light source. The distance between reporter and quencher depends on the molecules used. Usually, the emission of light after irradiation of the fluorescence reporter is then reduced or almost completely reduced when the quencher and reporter are at a distance of less than 25 nucleotides from each other. This removal can be effected either by the nucleotide sequence or by special spacing molecules, such as linkers or spacers.

In another embodiment, the fluorescent reporter can form a specific reporter-donor (FRET) pair with a donor fluorophore capable of transmitting the absorbed energy to fluorescent reporters by fluorescence resonance energy transfer (FRET) ,

A reporter-donor pair comprising a fluorescent reporter and a matching donor fluorophore and forming a fluorescence resonance energy transfer pair may be designed so that only one of the partners of such a FRET pair is coupled to the oligonucleotide probe and the other partner is coupled to the controller oligonucleotide. Both fluorescent reporter and donor fluorophore are derived from the respective oligonucleotide coupled that in the non-hybridized state of the oligonucleotide probe, the donor fluorophore is unable to transfer the absorbed energy to the fluorescent reporter.

In one embodiment, the controller oligonucleotide is a component of the detection system and comprises a fluorescent reporter and / or a fluorescence quencher and / or a donor fluorophore. By simultaneous hybridization of the controller oligonucleotide to the synthesized first or third primer extension product and the oligonucleotide probe to the 3 ^' segment of the same first and / or third primer extension product, binding is made to adjacent sequence positions of the first and / or third primer Extension product, resulting in spatial proximity of the donor fluorophore and the fluorescence reporter. This reduces the distance between the fluorescent reporter and donor fluorophore so much that FRET can take place from donor fluorophore to fluorescent reporter. This leads to the generation of a fluorescence signal of the fluorescence reporter and results in a detectable increase in the fluorescence signal of the fluorescence reporter.

The distance between the donor fluorophore and the fluorescent reporter after hybridization should be less than 25, in particular less than 15 and in particular less than 5 nucleotides. The wavelength of the light upon excitation is absorbed by the donor fluorophore and transferred to the reporter, thereby emitting light that can be detected. As regards the arrangement of the detection system in the amplification product, the following embodiments are preferred, wherein either the fluorescence reporter or the fluorescence quencher or the donor fluorophore are coupled either to the controller oligonucleotide, in particular in the third region of the controller oligonucleotide:

The coupling to the controller oligonucleotide preferably takes place in the third region of the controller oligonucleotide,

The coupling to the controller oligonucleotide preferably takes place at the 5 ^' end or the third region or in its vicinity, for example 2 to about 10 nucleotides from the 5 ^' end of the third region

Coupling to the oligonucleotide probe is preferably carried out in the middle region of the oligonucleotide probe,

- Coupling to the oligonucleotide probe is preferably carried out in the 3 ^' segment of the oligonucleotide probe.

In the practice of the present invention, the following embodiments have proven particularly advantageous:

The distance between both elements of a hybridized FRET pair of oligonucleotides hybridized to the first primer extension product is less than about 30 nucleotides. The oligonucleotide probe comprising a complementary 3 ^' segment to one of the primer extension products is so modified that the polymerase is unable to extend that 3 ^' end.

The oligonucleotide probe comprising a complementary 3 ^' segment to one of the primer extension products so that the polymerase is able to extend that 3 ^' end, the oligonucleotide probe serving as a PCR primer.

- A method for detecting amplification, wherein two or more nucleic acid chains are amplified in which a specific detection system is used for each nucleic acid chain to be amplified.

Method for detecting amplification, wherein two or more nucleic acid chains to be amplified are amplified, in which the detection of the amplification of at least two nucleic acid chains to be amplified is effected by a uniform detection system.

The amplification comprises an asymmetric amplification of one of the primer extension products.

The excitation of the fluorescence reporter and the measurement of the fluorescence signal of the fluorescence reporter takes place during the amplification.

The excitation of the donor fluorophore and the measurement of the fluorescence signal of the fluorescence reporter takes place during the amplification.

The excitation of the fluorescence reporter and the measurement of the fluorescence signal of the fluorescence reporter takes place after the amplification.

- The excitation of the donor fluorophore and the measurement of the fluorescence signal of the fluorescent reporter takes place after amplification.

The oligonucleotide probe is a DNA oligonucleotide.

The oligonucleotide probe is a DNA oligonucleotide and the 3 ^' end is blocked so that the polymerase can not extend it.

The oligonucleotide probe comprises a complementary sequence segment to the first and / or the third primer extension product, this sequence segment comprising a length of 8 to about 60 nucleotides.

An oligonucleotide probe comprises a complementary sequence segment to the 3 ^' segment of the first and / or third primer extension product which is not bound by the controller oligonucleotide, this segment being from 8 to about 40 nucleotides in length. An oligonucleotide probe comprising at least one further Modifkation selected from the following group: linker (such as HEG, C3, C6), phosphate-sugar backbone modifications (such as PTO, 2 ^'-0-Me, RNA, PNA, LNA modifications) ,

In certain embodiments of the method according to the invention it is provided that the third primer oligonucleotide and / or the fourth primer oligonucleotide have a second region which adjoins the 5 'end of the first region or is linked via a linker, the second Area can not bind complementary to the first primer extension product or to the second primer extension product.

In certain embodiments of the method according to the invention, it is provided that the second region of the third and / or fourth primer oligonucleotide lies in the 5 ^' direction from the first region of the third and / or fourth primer oligonucleotide.

In certain embodiments of the method according to the invention it is provided that the third primer oligonucleotide and / or the fourth primer oligonucleotide comprises a barcode sequence.

In certain embodiments of the method according to the invention it is provided that the separation of the double strand from the first primer extension product and the fourth primer extension product and the double strand from the second primer extension product and the third primer extension product is carried out by thermal denaturation, in particular in a Temperature in the range of 85 ° C to 105 ° C.

In certain embodiments of the method of the invention, it is contemplated that the first polymerase is capable of strand displacement during synthesis.

In certain embodiments of the method according to the invention, it is provided that the second polymerase is a thermostable polymerase.

In certain embodiments of the method according to the invention it is provided that the first polymerase and the second polymerase are identical.

In certain embodiments of the method according to the invention, it is provided that the first primer oligonucleotide and the third primer oligonucleotide are substantially identical.

In certain embodiments of the method according to the invention, it is provided that the second primer oligonucleotide (P2.1) and the third primer oligonucleotide (P4.2) are substantially identical.

The term "substantially identical" in the context of the invention means in particular that two nucleic acid sequences with not more than 5, 4, 3, 2, or 1 Mismatches to each other.

In certain embodiments of the method according to the invention, it is provided that the reaction conditions of the first amplification are selected such that no spontaneous dissociation of the first amplification product can occur. In certain embodiments of the method according to the invention, it is provided that the second amplification is carried out at at least two temperatures, wherein at a first temperature the hybridization and extension of the third and / or fourth primer oligonucleotide to the first and / or second and / or third and third or fourth primer extension product, and at a second temperature separation of the resulting duplex.

In certain embodiments of the method according to the invention it is provided that the second amplification is carried out at at least three temperatures, wherein at a first temperature, the hybridization of the third and / or fourth primer oligonucleotide to the first and / or second and / or third and / or fourth primer extension product takes place, at a second temperature the extension of the third and / or fourth primer, and at a third temperature the separation of the resulting double strands.

In certain embodiments of the method according to the invention, it is provided that the first amplification and the second amplification are carried out in the same reaction batch.

In certain embodiments of the method according to the invention it is provided that the second polymerase, the third primer oligonucleotide and / or the fourth primer oligonucleotide are activatable, and / or the controller oligonucleotide is deactivatable.

Activatable polymerases may be, for example, reversible inactivated polymerases such as thermostable polymerase (hot-start polymerase) or polymerases which are reversibly inactivated by an antibody or a chemical modification.

Activatable primers may be reversible inactivated primer, for example oligonucleotides with a protected 3 ^'OH group, wherein the protecting group in particular by a polymerase with ^5' - exonuclease activity is removable. It would be advantageous in the first amplification to use a polymerase without 5 ^' exonuclease activity.

The controller oligonucleotide can be inactivated or cleaved, for example, by a polymerase with 5 ^' exonuclease activity. Alternatively, the controller oligonucleotide may also be cleaved and thereby removed by other enzymatic or chemical methods prior to the second amplification.

In certain embodiments of the method according to the invention, it is provided that the first polymerase is inactivated before carrying out the second amplification. This can be achieved, for example, by thermal denaturation, when the first polymerase is a non-thermostable polymerase.

In certain embodiments of the method according to the invention, it is provided that the first amplification is carried out in a first reaction batch and the second amplification in a second reaction batch. In certain embodiments of the method according to the invention, it is provided that an aliquot of the first reaction mixture is added to the second reaction mixture.

In certain embodiments of the process according to the invention, it is provided that the complete first reaction batch is introduced into the second reaction mixture.

In certain embodiments of the method of the invention, it is contemplated that the third portion of the controller oligonucleotide is substantially complementary to the portion of the synthesized portion of the first primer extension product that immediately adjoins the primer oligonucleotide portion of the first primer extension product. Advantageously, this improves the sequence-specific displacement of the nucleic acid to be amplified.

In certain embodiments of the method of the invention, it is contemplated that the controller oligonucleotide comprises a fourth region capable of substantially sequence-specific binding to the 3 ^' region of the third primer oligonucleotide. The fourth region can lie within the second region and / or the third region of the controller oligonucleotide or include sequence segments of the second and / or third region, wherein the fourth region in particular has a length of 9 to 30 nucleotides, in particular 10 to 20 Nucleotides, or 12 to 16 nucleotides.

The term "substantially sequence-specific" in the context of the present disclosure means that the mutually complementary regions of the primer oligonucleotide and the nucleic acid to be amplified have not more than 5, 4, 3, 2, or 1 mismatches.

In certain embodiments of the invention, it is contemplated that the controller oligonucleotide comprises one or more nucleotide modifications designed to prevent the extension of a primer bound to the controller oligonucleotide. For example, several 2 ^'-0-alkyl modification can block or prevent such an extension. In particular, there are several nucleotide modifications in the second and / or third region of the controller oligonucleotide. In particular, the controller oligonucleotide comprises at least 5 such modifications, more preferably at least 10 modifications.

In a particular embodiment, the controller oligonucleotide consists entirely of nucleotide modifications.

In certain embodiments of the method of the invention, the portion of the polymerase-synthesized portion of the first primer extension product that is substantially complementary to the third portion of the controller nucleotide has a length in the range of 5 nucleotides to 70 nucleotides.

In certain embodiments, the third single-stranded region of the controller oligonucleotide is fully complementary to the 5 ^' segment of the first primer extension product, the length of this complementary sequence segment being of at least 3 to 70 nucleotides, or of at least 5 to 50 nucleotides , in particular embodiments of 5 to 40 nucleotides, of 5 to 30 nucleotides, in particular of 5 to 20 nucleotides.

In certain embodiments of the method according to the invention, it is provided that the first amplification is carried out essentially isothermally.

In certain embodiments of the method according to the invention it is provided that the second amplification is carried out at three temperatures, wherein at the first temperature the hybridization of the third or fourth primer oligonucleotide and optionally the initial extension of the primer is performed, and at a second temperature the complete Extension of the primers and at a third temperature the separation of formed primer extension products from their respective template strands. In particular, the first temperature is in the range of 25 ° C to 65 ° C, the second temperature in the range of 65 ° C to 80 ° C and the third temperature in the range of 85 ° C to 105 ° C.

In certain embodiments of the method according to the invention, it is provided that the nucleic acid to be amplified has a length in the range from 20 nucleotides to 300 nucleotides.

In certain embodiments of the method according to the invention it is provided that the first primer oligonucleotide has a length in the range of 15 nucleotides to 100 nucleotides.

In certain embodiments of the method according to the invention it is provided that the second primer oligonucleotide has a length in the range of 15 nucleotides to 100 nucleotides.

In certain embodiments of the method according to the invention, it is provided that the controller oligonucleotide has a length in the range from 20 nucleotides to 100 nucleotides.

In certain embodiments of the method according to the invention it is provided that the third primer oligonucleotide has a length in the range of 15 nucleotides to 60 nucleotides.

In certain embodiments of the method according to the invention it is provided that the fourth primer oligonucleotide has a length in the range of 15 nucleotides to 60 nucleotides.

In certain embodiments of the inventive method is provided that the third primer oligonucleotide has at least one nuclease-resistant nucleotide modification, for example, a PTO (phosphorothioate) or 2 ^'-0-alkyl modification.

In certain embodiments of the inventive method is provided that the fourth primer oligonucleotide has at least one nuclease-resistant nucleotide modification, for example, a PTO or 2 ^'-0-alkyl modification.

In certain embodiments of the method according to the invention, it is provided that the first primer oligonucleotide in the second region is a modification or several modifications in particular immediately after the first region of the first primer oligonucleotide which stops / prevents the polymerase used from copying the second region. Advantageously, only the first region of the first primer oligonucleotide is thereby copied.

This can be achieved in certain embodiments by using nucleotide modifications which, while capable of complementary binding to the first primer extension product, are not accepted by the polymerase as a template. Examples of such nucleotide modifications set nucleotide compounds with modified phosphate-sugar backbone moieties, for example, 2 ^{'-0-alkyl-RNA} modifications (for example, 2 - OMe), LNA modifications or morpholino Modifkationen is generally prevents the. Presence of such modifications in one strand of a DNA-dependent polymerase upon reading such a strand. The number of such modifications may be different, usually few modifications (between 1 and 20) may be sufficient to prevent a polymerase from reading such a strand. Such nucleotide modifications can be used, for example, at or about the binding site of the first primer oligonucleotide to the controller oligonucleotide and / or as constituents of the second region of the first primer oligonucleotide.

Thanks to the use of such modifications, there is a local inhibition of the polymerase function, so that certain segments of the structures used can not be copied by the polymerase and remain predominantly single-stranded. In this single-stranded form they can bind further reaction components and thus perform their function.

As far as individual features of the method according to the invention have been discussed above as being present in certain embodiments, it will be apparent to those skilled in the art that these features can each be combined to form more specific embodiments. This applies to all features discussed in the present description, as long as it is not apparent that their combination is meaningless, e.g. with excluding parameter overlaps.

According to another aspect of the invention, there is provided a kit for carrying out the method according to the invention according to the aspects described above or their specific embodiments or alternatives. The kit according to the invention comprises:

a first primer oligonucleotide having the following ranges:

A first region which can bind sequence-specifically to a region of the nucleic acid to be amplified,

A second region connected to the 5 'end of the first region or linked via a linker, wherein the second region can be bound by a first controller oligonucleotide and one for the Amplification used polymerase remains essentially unkopiert under the selected reaction conditions;

Wherein the first primer oligonucleotide can be extended by a polymerase to a first primer extension product comprising a synthesized region in addition to the first primer oligonucleotide;

a second primer oligonucleotide, wherein the second primer oligonucleotide comprises a region capable of sequence-specific binding to the synthesized region of the first primer extension product and can be extended from a polymerase to a second primer extension product which is adjacent to the second primer Oligonucleotide comprises a synthesized region,

a controller oligonucleotide comprising the following ranges:

A first region that can bind to the second region of the first primer extension product,

A second region which is substantially complementary or complete to the first region of the first primer oligonucleotide, and

A third region that is substantially complementary or fully complementary to at least a portion of the synthesized region of the first primer extension product;

wherein the controller oligonucleotide does not serve as a template for a primer extension of the first primer oligonucleotide, and the controller oligonucleotide is attached to the primer

Extension product can bind under displacement of the complementary region of the second primer extension product,

a third primer oligonucleotide, wherein the third primer oligonucleotide comprises a first region capable of sequence-specific binding to a segment of the second primer extension product and can be extended from a polymerase to a third primer extension product (P3.1-Ext) which comprises a synthesized region adjacent to the third primer oligonucleotide; and

a fourth primer oligonucleotide, wherein the fourth primer oligonucleotide comprises a first region capable of sequence-specific binding to the synthesized region of the first primer extension product, and extendable from a polymerase to a fourth primer extension product which is adjacent to the fourth primer - Oligonucleotide comprises a synthesized region.

In certain embodiments of the kit of the invention, the kit further comprises at least one polymerase.

In certain embodiments of the kit of the invention, the kit comprises a first polymerase designed to extend the first and second primer oligonucleotides, and a second polymerase designed to extend the third and fourth primer oligonucleotides. In certain embodiments of the kit of the invention, the first polymerase has no 5 ^' exonuclease activity and the second polymerase has no 5 ^' exonuclease activity. In particular, the second polymerase may be a thermostable polymerase.

In certain embodiments of the kit according to the invention it is provided that the second polymerase, the third primer oligonucleotide and / or the fourth primer oligonucleotide is activatable, and / or the controller oligonucleotide is deactivatable.

According to a further aspect of the invention, the use of a kit according to the above aspect for carrying out the method according to the invention according to the above-described aspects or their specific embodiments or alternatives is provided.

Further details and advantages of the invention will be explained in a non-restrictive manner by the figures and a detailed description of selected embodiments.

The combination according to the invention comprises two amplification processes to be carried out in succession. During the first partial amplification (the first amplification procedure), nucleic acid chains comprising a target sequence are amplified. This results in amplified nucleic acid chains, which are then used as templates in the second partial amplification (the second amplification method). This second partial amplification will in many cases be a conventional PCR. During the second rapid amplification, the amplification proceeds from the target nucleic acids or nucleic acids comprising the target nucleic acids which were amplified in the first partial amplification. In this case, PCR fragments are amplified. In particular, these PCR fragments comprise target sequences or portions of target sequences. Furthermore, during the second amplification process, specific changes can be made to amplifiable nucleic acid chains. In this case, for example, target sequences can be flanked by using barcoding primers or detection-specific primers. Also, detection can be detected using PCR probes (e.g., so-called Taqman probes). Furthermore, immobilization of target sequences to the solid phase using immobilized primers can be used during the PCR phase so that the PCR proceeds as solid-phase PCR.

The first amplification method according to the invention is intended to be able to synthesize or amplify nucleic acid chains having a defined sequence composition, it being possible for generated products to serve as starting nucleic acid chains with template function for subsequent PCR, and the PCR amplification being carried out using at least one own PCR primer ,

An object of the invention is further achieved by providing a first amplification method (a first partial amplification) and corresponding means for carrying it out. The implementation of this first amplification method has already been described in PCT application PCT / EP2017 / 07101 1 and European application 16185624.0 described. For details of the execution of the amplification, the skilled person is referred to this application.

The second amplification method (the second partial amplification) can be carried out in particular as PCR, wherein at least one of the primers used has a different composition and / or structure than the primers used in the first amplification method. This results in an increase of at least one nucleic acid chain comprising the specific target sequence or its parts.

As such, PCR amplification per se is normally capable of generating well-characterized amplification products from the initial template, more specifically in real-time mode, starting from an amount greater than about 1000 copies, more preferably greater than about 100,000 copies Generate signals. When reducing the number of copies to less than 1000 (e.g., 100 or 10 copies), the PCR must include more cycles of synthesis, which can increasingly lead to defective amplification products or signals. This is especially the case if the PCR has to amplify a sequence variant (eg a mutation or allelic variant of a sequence) which is present in small amounts in the batch and the PCR amplification in the presence of a large amount of another sequence variant (eg. Sequence or allelic variant). While many methods have been developed to improve the specificity of PCR, amplification-dependent detection methods can benefit from further enhancement of the specificity of amplification techniques, e.g. in the field of liquid biopsy. Especially in clinical diagnostics there is a need to improve the specificity of measurement methods.

Due to the widespread use of PCR technology, there are numerous modifications of this technology or extensions of the PCR base process, which find application in many fields of molecular biology. By pre-connecting another, first amplification method, for example, signal specificity or PCR product specificity can be improved in these applications.

In the present invention, the combination of a preceding highly specific amplification method with downstream PCR will be described. The combination makes it possible to increase the initial copy number of nucleic acid chains to be amplified under highly selective amplification conditions of a first amplification method up to the desired amounts, which are then subsequently further amplified under less specific conditions of a PCR amplification. The first amplification method (first partial amplification) thus has a function of the first amplifier with high specificity. For example, the amount of synthesized copies in the first amplification process will range from about 10 copies to about 1 E 1 1 copies, more preferably from about 100 copies to about 1 .0E 10 copies, preferably from about 1000 to about 10E8 copies. In this case, the amount of a target sequence is increased by the first amplification. This increase (based on the starting amount of the target sequence in the batch) is, for example, in the following ranges from about 2 times to about 1 E10. more preferably from about 10 times to about 10E9 times, more preferably from about 10 times to about 10E8 times, preferably from about 10 times to about 10E7 times, more preferably from about 100 times to 10E6 times , In this case, based on the volume of the reaction, the following concentration ranges are achieved: from about 10 amol / l to about 10 nmol / l, more preferably from about 1 fmol / l to about 1 nmol / l, even better from about 10 fmol / l to about 0.1 nmol / l, in particular from about 10 fmol / l to about 10 pmol / l.

The second amplification method (the second partial amplification, which is used as a PCR method or modification thereof) plays the role of a second amplifier and allows existing PCR-based methods such as probe insertion or bar coding or sequence coding in NGS-library-preparation or solid phase PCR in combination with specific products of the first amplification.

The advantages of the combination are, on the one hand, the reduction in the number of PCR cycles which are necessary for carrying out the amplification up to the desired amount of the end product. This reduces the likelihood or extent of synthesis of products by PCR. The synthesis result can thus have higher specificity than the PCR amplification alone.

In a particular embodiment, first the first amplification with required components of the first amplification system takes place in the absence of at least one of the essential components of the second amplification system in the same reaction mixture during the first amplification reaction. For example, PCR primers or a thermostable polymerase are added only prior to PCR amplification.

After completion of the first amplification reaction, the reaction mixture is brought into contact with the components of the second amplification system and PCR amplification is carried out.

In certain embodiments, the reaction components of a respective amplification system are present in separate reaction mixtures and / or in separate reaction vessels prior to the start of amplification.

For example, the first amplification reaction is carried out in one reaction vessel, and then the synthesis result of this reaction is transferred (completely or partially) to the second reaction vessel, and then the second amplification is carried out.

In further embodiments, the reaction components are added sequentially so that first the components of the first amplification system are added and the first amplification reaction is carried out. Subsequently, the components of the second amplification system are supplied, so that the second amplification can take place. In further embodiments, the addition of the components of the second amplification system to the first amplification approach, so that the reaction is substantially the same Reaction vessel is performed. The sequence of both amplification methods is thus predetermined by the time sequence of the addition of individual components.

In order to reduce the likelihood of contamination, both reactions can be carried out in particular in a closed system. Such a system may comprise, for example, at least two separate reaction vessels. The transfer of the batch from one reaction vessel to the other also takes place in certain embodiments by means of a closed system. Such separation of the two reactions in a closed reaction vessel system is known, e.g. as separate reaction vessels, which are combined to form a cartridge system or array system or microfluidic system.

In certain embodiments, the first amplification batch comprising the amplified nucleic acids of the first amplification is used for the second amplification without partitioning of the first batch. The first approach is thus essentially completely fed to the second amplification reaction. An amount of synthesized copies from the first amplification process is supplied thereto to the second amplification system and includes, for example, a range from about 10 copies to about 1 E1 1 copies, more preferably from about 100 copies to about 1 E10 copies, preferably from about 1000 to about 10E9 copies , In this case, the amount of a target sequence is increased by the first amplification. This increase (based on the starting amount of the target sequence in the batch) is for example in the following ranges from about 2 times to about 1 E1 1-fold, better from about 10 times to about 1 000 000 000 times, even better of about 10-fold to about 1,00,000,000-fold, preferably from about 10-fold to about 10,000,000-fold, more preferably from about 100-fold to 1,000,000-fold. Based on the volume of the reaction, the following concentration ranges can be achieved: from about 10 amol / l to about 10 nmol / l, more preferably from about 1 fmol / l to about 1 nmol / l, even better from about 10 fmol / l to about 0 , 1 nmol / l, preferably from about 10 fmol / l to about 10 pmol / l.

In a further particular embodiment, it is preferred to use only a part of the first amplification mixture (an aliquot or a subset) in the second amplification reaction. Due to an amplification by means of the first amplification system, an increase in the amount of nucleic acid chains comprising at least one target sequence takes place. In the second amplification reaction, a portion of this amount may be used as the starting material. This fraction can be added or added to the second reaction mixture, for example. The proportion may for example be relatively low and depends essentially on the requirements of the desired application. Due to the proliferating effect of the PCR, the second amplification can in particular start from more than about 1000 copies of the nucleic acid chains which were amplified sequence-specifically in the first amplification method.

The PCR amplification can thus be started when a sufficient amount of the amplified nucleic acid chains has been synthesized in the first amplification process. there For example, this amount of synthesized nucleic acid chains may range from, for example, a range of about 10,000 copies to about 1 E11 copies, more preferably from about 10,000 copies to about 1 E10 copies, more preferably from about 10,000 to about 1 E9 copies. In this case, the amount of a target sequence is increased as desired by this first amplification. This increase (based on the starting amount of the target sequence in the batch) can be measured as N times the starting amount and is for example in the following ranges from about 2 times to about 1 E1 1-fold, more preferably from about 10 times to about 1 E10-fold, more preferably from about 10 times to about 1 E9-fold, especially from about 10-fold to about 1 E8-fold, especially from about 100-fold to 1 E6-fold. In this case, based on the volume of the reaction, the following concentration ranges are achieved: from about 10 amol / l to about 10 nmol / l, more preferably from about 1 fmol / l to about 1 nmol / l, even better from about 10 fmol / l to about 0.1 nmol / l, in particular from about 10 fmol / l to about 10 pmol / l.

Since more than 1000 copies of specific nucleic acid chains comprising the target sequence can be produced in the first amplification reaction, a fraction (or aliquot) of this amount can be used for the second amplification reaction.

For example, the PCR may start from an amount which includes the following ranges, for example, a range of about 100 copies to about 1 E 1 1 copies, more preferably from about 1,000 copies to about 1 E 10 copies, more preferably from about 1, 000 to about 1 E9 copies. This amount can be considered as a subset of the synthesized nucleic acid sequence containing the target sequence, augmented by the first amplification.

Providing amplified synthesis products of the first amplification based on the volume of the reaction, the concentration ranges include: from about 10 amol / l to about 100 nmol / l, more preferably from about 1 fmol / l to about 10 nmol / l, more preferably from about 10 fmol / l to about 1 nmol / l, more preferably from about 10 fmol / l to about 10 pmol / l. In this case, a PCR amplification can be started starting from these concentrations of the synthesis products of the first amplification. In the course of PCR amplification then a further proliferation of products, wherein the final concentration of PCR fragments concentration ranges from 0.01 nmol / l up to 5 pmol / l, more preferably from 1 nmol / l to 1 pmol / l comprises ,

It is also possible to use only a fraction of the nucleic acid chains specifically synthesized in the first amplification method in the second amplification method. Thus, in certain embodiments, the first amplification provides an amount of copies which represents a relative excess relative to the necessary amount of copies required or desired as a starting material for the PCR.

From this first amplification reaction, a portion is transferred to the second amplification reaction, and the synthesized nucleic acid chains contained therein serve as templates for starting the PCR reaction. A portion of the first reaction mixture can be made, for example, by dilution of the first reaction mixture and transfer of a certain volume fraction which contains synthesized nucleic acid chains in the second reaction. The proportion of the amount of specifically synthesized nucleic acid chains transferred thereby, which can serve as a template for generating PCR fragments, may include the following ranges (calculated on the total amount of synthesized products in the first amplification step): from about 1 E-7% from about 1 E-6% to about 90%, more preferably from about 0.0001% to about 50%, more preferably from about 0.001% to about 50%, or from about 0.01% to about 50% %, in particular 0.1% to about 20%.

This results in not only a dilution of the synthesized nucleic acid chains containing the target sequence but also of the components of the first amplification system, e.g. Primers and controller oligonucleotides. Also possibly formed by-products are diluted. The resulting reduction in the concentration of the components of the first amplification system is accepted and may even have a positive effect on the execution of the PCR. For example, dilution of primers and controller oligonucleotides may result in the oligonucleotide primers or oligonucleotide probes used during the PCR reaction being present in higher concentrations than the transferred oligonucleotide primers of the first amplification system. This may favor the PCR reaction and minimize interference with the amplification process.

Furthermore, dilution of a controller oligonucleotide may also have a positive effect on the PCR reaction by having this controller oligonucleotide initially present during the second amplification reaction, but its concentration during the second amplification is reduced so that its binding is sufficiently slowed down to the synthesis products or reaction components or the interaction with complementary sequence segments is reduced or occurs insufficiently and thus its effect on the overall reaction process is reduced by this dilution effect.

Thus, when providing nucleic acid chains for the second amplification, dilution of the reaction components of the first amplification system may also be performed, generally in parallel with dilution of the specific nucleic acid chain provided. The relative amount of components of the first amplification system which are transferred to the second amplification reaction can be represented as a proportion. This proportion refers to the amount of the components used in the first amplification reaction (100%). The transferred proportion of the components of the first amplification system in the second amplification reaction comprises, for example, the following ranges: from about 1 E-7% to about 50%, more preferably from about 1 E-6% to about 30%, even better from about 0.0001% to about 20%, especially from about 0.001% to about 10%, more preferably from about 0.1% to about 10%. Thus, the concentrations of the components of the first amplification system are reduced so significantly that their effect in the second amplification step is reduced or negligible. The transferred portion of the first reaction mixture may, for example, relate to the concentrations used or to the volume fractions. For example, the transfer of a microliter (1 pl) of the batch comprising the first amplification system (after completion of amplification) to 49 pl of a batch comprising the second amplification system in a 2% (v / v) dilution or dilution of 1:50 result. Higher dilution levels can be prepared accordingly by means of a dilution series.

For example, the concentration of the controller oligonucleotide in the first amplification system can be reduced from about 10 pmol / l at a dilution of 1: 1000 to about 10 nmol / l. The transferred share is thus only 0.01%. At such a dilution, at the same time, the same proportion of the synthesized nucleic acid chain comprising a target sequence can be transferred. For example, in the first amplification reaction, an amount of about 10,000,000 copies was amplified, and then the amount of products transferred to the PCR reaction at a dilution of 1: 1000 would yield a subset of about 10,000 copies. This initial amount of copies is usually sufficient for the PCR to perform a stable and sufficiently specific amplification reaction.

Also advantageous is the dilution of potentially interfering nucleic acid chains, e.g. of wild-type molecules or allelic variants. During the sequence-specific first amplification, the specific amplification of target molecules takes place predominantly. Other nucleic acid chains are not or not significantly amplified.

When diluted, the dilution effect also acts on these potentially interfering with the PCR reaction sequences. For example, this reduces the amount of wild-type sequences from 100,000 to about 100. This can have a positive effect on the specificity of the PCR reaction.

In particular embodiments, in particular, both methods are performed in one approach (as a "homogeneous assay"). For this purpose, the components of both amplification systems must already be present in one batch at the beginning of the first amplification. The required components for both amplification systems are thus supplied to the reaction mixture before the beginning of the first amplification.

In a particular embodiment, first the first amplification with required components of the first amplification system takes place in the presence of at least one of the essential components of the second amplification system in the same reaction mixture during the first amplification reaction.

The combination of both amplification systems in a reaction mixture may require adaptation of individual components or concentrations and reaction conditions.

The presence of the components of the second amplification system should not prevent the first amplification reaction. In certain embodiments, the length of the 3 ^' segment of the third primer, which may be complementary to the controller oligonucleotide, is chosen so that this segment does not prevent strand displacement by the controller oligonucleotide. This is essentially achieved by the stability of the double-stranded complex consisting of a controller oligonucleotide and a 3 ^' segment of the third primer being sufficiently low under reaction conditions of strand displacement by the controller oligonucleotide (eg 65 ° C. step during the first amplification) in that the binding of the third primer to the controller oligonucleotide is only temporary and does not prevent strand displacement. This may be affected, for example, by the length of the 3 ^' segment of the third primer, which would be able to enter such a complex with the controller oligonucleotide. For example, the length of this complex is between 8 and 20 nucleotides. Furthermore, the 3 ^' segment of the third primer may have one or more mismatches to the sequence composition of the controller oligonucleotide in the corresponding segment, resulting in destabilization of that complex. In particular, one to three mismatches are positioned in position from -10 to -20 with respect to the 3 ^' -terminal nucleotide of the third primer. This does not significantly affect the primer function of the third primer while reducing the stability of the complex with the controller oligonucleotide.

Furthermore, the controller oligonucleotide of both primers and the polymerase of the second amplification system should not be used as a template. This is particularly important for the third oligonucleotide primer, since it comprises a sequence segment which can bind complementarily to the controller oligonucleotide. The structure of the controller oligonucleotides in the segment of its possible complementary binding to the third oligonucleotide primer can therefore be designed to be comparable to that of the first primer of the first set. In certain embodiments, primer extension of the third oligonucleotide primer is prevented by the controller oligonucleotide, by using nucleotide modifications, preventing the polymerase from extending a third primer bound to the controller oligonucleotide. For example, several 2 ^'-0-alkyl modifications can convey such a blocking effect.

In order to avoid unwanted interferences between the two amplification systems, it may furthermore be advantageous for the components of the second amplification system to be completely or partially in an "inert" or "non-active" or "reversibly inactivated" or "non-reactive" state during the first partial amplification. Only for carrying out the second amplification should such components be converted into an active, i. functional state are transferred.

In certain embodiments, at least one of these PCR components is in a reversibly inactivated form during the first amplification so that this component does not participate in the first amplification reaction or its participation is insignificant. After graduation The first amplification then takes place first an activation of these reversibly inactivated components, so that the inactivation is canceled and the components are now in active form in the second amplification reaction and thus can perform their role in the amplification.

For example, reversibly inactivated PCR primers or a reversibly inactivated thermostable polymerase (so-called hot-start polymerase) are used. For example, in the conversion step from the first amplification to the second reaction conditions are used which enable activation of this inactive form of the component. In other embodiments, the activation of components occurs continuously under PCR conditions.

Some examples of reversibly inactivated primers are known to the person skilled in the art (for example termolabile primers so-called CleanAmp Primers Trilink Technologies). Such primers can be activated by heating so that the polymerases can start synthesis from this primer. Other examples of reversibly inactivated primers include primers having a 3 ^'-terminal nucleotide which comprises a modified sugar radical, for example a blocked ^3' -OH group (for example, by a C3-linker at the 3 ^'position or primers having terminal dideoxy Nucleotides, Sambrook et al NAR 1998 p.3073).

In certain embodiments, such primers have a 3 ^' -terminal mismatch to template. When using such primers, in particular a polymerase is used for the first amplification, which has no 3 ^' -5 ^' exonuclease activity (eg Bst polymerase or its modifications). As a result, such primers remain in the non-activated state during the first phase. When using such primers in the PCR phase, it is thus necessary to activate them. The activation is usually carried out by enzymatic cleavage of the 3 ^' -terminal nucleotide together with the modified sugar residue. For this reason, it is advantageous to use such primers in combination with a thermostable polymerase comprising 3 ^' - 5 ^' exonuclease activity (so-called proofreading polymerases). In certain embodiments involving primers with a 3 ^' terminal mismatch, such a terminal mismatch facilitates the function of the polymerase 3 ^' -5 ^' exonuclease. Upon initiation of PCR amplification, such "inactive" primers bind to their complementary positions on templates. After binding to the template, terminal nucleotides including a blocking group can be removed by exonuclease activity (which is associated with polymerase). This results in a complementary to the template bound primer oligonucleotide and free 3 ^' -OH groups, which can be extended by the polymerase. Such "activated" primers can now be extended by the polymerase so that complementary strands are synthesized to the respective matrices. Polymerases which are capable of being a template-specific activation of such primers under PCR conditions, for example Vent Polymerase, Deep Venf Polymerase, Pfu Polymerase or Phusion Polymerase. By design of PCR primers with a 3 ^' -terminal mismatch to the respective template (or for example, in position -1 or -2 relative to the 3 ^' -terminal nucleotide), the activation of such primers can generally be accelerated (eg for Pfu polymerase or Phusion polymerase). Other thermostable polymerases may also be modified also cleave terminal nucleotides with a blocked 3 ^'-OH group, if this to the template are complementary (for example, Vent or Deep Vent polymerases). To limit the degrading action of a polymerase on the PCR primers such primers can comprise a 3 ^{^'-5'} nuclease non-cleavable bond, such as one or more phosphorothioate modifications (PTO modifications), for example, in positions "minus 2" or " minus 3 "or from" minus 2 "to" minus 7 ". This prevents excessive degradation of primers.

The reversibly activated polymerases include, for example, those which are reversibly inactivated by means of an antibody or which are reversibly inactivated by means of a chemical modification (AmpliT aq polymerase). Several commercial suppliers have developed such "hot-start" polymerases for PCR (Qiagen, Thermofisher, Roche). In particular, Taq polymerase and its modifications in various reversibly inactivated states were offered as so-called hot-start Taq polymerase. Particularly preferred are hot-start polymerases, which are converted into an active form, for example by initial heating of the batch at 95 ° C for 1 min to 10 min. Since antibodies can screen different epitopes in polymerases, different activities of polymerases can be reversibly inactivated to different degrees (Scalice et al J. Immunol.Methods, 1994, p.147-, Lyamichev et al PNAS, 1999, p.6143).

In certain embodiments of the amplification in homogeneous format, the polymerase which has carried out the exponential amplification of the nucleic acid chain to be amplified in the first amplification reaction is inactivated by heating prior to the start of the second amplification. This inactivation can be achieved, for example, by heating the batch to above 80 ° C., better to above 90 ° C., in particular to 95 ° C., for 1 to 10 min. Thus, for example, mesophilic polymerases (such as Bst polymerase or Bsm polymerase, or Gst polymerase) can be inactivated. Such inactivation favors conversion of the process from the first amplification reaction to the second amplification reaction. Thus, at such a temperature step, an inactivation of the polymerase of the first amplification reaction can take place simultaneously and an activation of the polymerase for the second amplification reaction.

Due to such thermal inactivation of the first polymerase, it can no longer bind to the primer or template to the same extent. During the second amplification reaction, therefore, the primer-template complexes are used in particular by the polymerase, which is to carry out the synthesis in the second amplification step.

By such a change from one polymerase to the other, the other polymerase-associated activities, such as strand displacement by Bst Polymerase, "turn off", or "turn on" 5 ^' -3 ^' -Exonuklease activity of the Taq polymerase.

In certain embodiments, during the second amplification reaction, the 5 ^' segment of the controller oligonucleotide hybridized to the first primer extension product can be cleaved by the 5 ^' -3 nuclease of the polymerase (eg, 5 ^' -3 ^' nuclease of a Taq polymerase). This process is well known and is often used for probe degradation and real-time monitoring of a PCR reaction (US Pat 5,210,015). In this case, the polymerase can complementarily extend the fourth PCR primer using the third primer extension product under suitable reaction conditions by incorporation of nucleotides and at the same time enzymatically cleave the controller oligonucleotide in its 5 ^' segment of the third region hybridized to the third primer extension product. The polymerase-extended strand forms, in particular, an overlap with the controller oligonucleotide by at least one 3 ^' -terminal nucleotide during the synthesis, thereby forming a structure recognizable for 5 ^' -3 ^' -nuclease activity of the Taq polymerase under used reaction conditions, and this structure can be split. 5 ^' -3 ^' exonuclease activity cleaves the phosphodiester bonds between nucleotides of the third region of the controller oligonucleotide. The 5 ^' -3 ^' -exonuclease-related cleavage takes place in particular on the DNA strand, and some sugar-phosphate backbone modifications, such as 2 ^' -OMe ribonucleotides or PTO modifications or PNA, can slow down or even prevent this cleavage. For this reason, in particular a combination comprising a 5 ^{^'-3'} exonuclease activity of a polymerase (eg Taq polymerase), and a controller oligonucleotide is used in this embodiment, the controller oligonucleotide in its 5 ^'segment of the third Area, predominantly by nuclease cleavable nucleotides or their analogs includes (eg DNA). The length of this 5 ^' segment of the controller oligonucleotides comprises, for example, 5 to 50, in particular 10 to 30 nucleotides.

By degrading the controller oligonucleotide bound to the first primer extension product, a polymerase can also extend the second primer without strand displacement properties and thus synthesize the second primer extension product.

In certain embodiments, the presence of components of the second amplification system during the first amplification is considered as follows:

On the one hand, the effect of the components of the second amplification system can be reduced by their reversible inactivation prior to the first amplification. On the other hand, individual sequence elements should not occur as nonspecific templates for primer extension during the first amplification. For this reason, primers of the first and second amplification systems should be checked for the existence of self-complementary structures in order to avoid primer-dimer formation.

The third PCR primer typically comprises a sequence segment in its 3 ^' segment which comprises regions complementary to the controller oligonucleotide. This allows the third PCR Primer to the controller oligonucleotide complementary bind. To perform the first amplification, the third PCR primer must not prevent strand displacement by the controller oligonucleotide during the first amplification. For this purpose, the sequence length or sequence composition of the 3 ^' segment of the third PCR primer is adjusted so that it does not bind significantly to the controller oligonucleotide under reaction conditions of the strand displacement step (eg 65 ° C). This can be achieved, for example, by the melting temperature of the complex of a controller oligonucleotide and the 3 ^' segment of the third primer being substantially below the reaction temperature of the strand displacement step, for example between 45 ° and 60 ° C. Such a third PCR primer may further bind with its 3 ^' segment to its template and initiate a primer extension reaction. This may be achieved, for example, by the 3 ^' segment of the third PCR primer, which may be complementary to the controller oligonucleotide, comprising in its length regions of between 9 and 30 nucleotides, more preferably between 12 and 20 nucleotides , in particular between 12 and 16 nucleotides. This 3 ^' segment of the third PCR primer may comprise one or more mismatches to corresponding positions of the controller oligonucleotide such that the binding strength continues to decrease.

The sequence segment of the controller oligonucleotide which can substantially complementarily bind the third PCR primer is referred to as the fourth region of the controller oligonucleotide. This fourth region of the controller oligonucleotide may include sequence segments of the second region and / or the third region.

The fourth region of the controller oligonucleotide comprises in its length regions which are between 9 and 30 nucleotides, more preferably between 12 and 20 nucleotides, in particular between 12 and 16 nucleotides. The fourth region of the controller oligonucleotide may include one or more mismatches to the 3 ^' segment of the third PCR primer. In particular, this fourth region comprises nucleotide modifications that prevent the third PCR primer from being extended by a polymerase of the first and / or second amplification system using the controller oligonucleotide as a template. Such modifications have already been described for the combination of the first primer and the controller oligonucleotide. For example, they comprise sequence segments 2 ^'-0-alkyl modifications, the length of this segment may be 6 to 30 modifications and the complementary nucleotide of the oligonucleotide to the controller ^3' -terminal nucleotide of the third PCR primer particular even such modification and further flanked on both sides by at least three nucleotides with such modifications. This ensures that the controller oligonucleotide from the third and fourth primer and the polymerase of the second amplification system is not used as a template.

The creation of the first and second primer extension product of a defined length plays a role in the separation of these two products by means of a controller Oligonucleotide. For this reason, it is advantageous to prevent any premature extension of 3 ^' ends (each of the first and second primer extension products) using a third or fourth primer of the second amplification system as a template during the first amplification reaction.

A reduction or prevention of any undesired excess extension of the 3 ^' end of the first primer extension product using the fourth PCR primer as a template can be achieved in various ways: In certain embodiments, this is achieved by the fourth PCR primers, when attached to the 3 ^' segment of the first primer extension product, can not undergo perfect match complementary binding with the 3 ^' terminal nucleotide of this synthesized first primer extension product. This is intended to prevent or at least reduce excess extension of the 3 ^' - terminal nucleotides of the first primer extension product.

In certain embodiments, this is achieved by virtue of the fourth PCR primer, when bound to the 3 ^' segment of the first primer extension product, not undergoing perfect match complementary binding with the at least one of the terminal nucleotides of this synthesized first primer extension product can. The resulting at least one mismatch position is in particular in the position of -1 to -5 relative to the terminal nucleotide of the first primer extension product.

A reduction or prevention of a possibly unwanted excess extension of the 3 ^' end of the second primer extension product using the third PCR primer as a template can be achieved in various ways: In certain embodiments, this is achieved by the third PCR primer, when bound to the 3 ^' segment of the second primer extension product, can not undergo perfect match complementary binding with the 3 ^' terminal nucleotide of this synthesized first primer extension product. This should an excessive extension of the 3 ^'- be prevented or at least reduced terminal nucleotides of the second primer extension product.

In certain embodiments, this is accomplished by the third PCR primer, when bound to the 3 ^' segment of the second primer extension product, not undergoing perfect match complementary binding with the at least one of the terminal nucleotides of this synthesized second primer extension product can. The resulting at least one mismatch position is in particular in the position -1 to - 5 relative to the terminal nucleotide of the second primer extension product.

The presence of components of the first amplification system during the second amplification is considered as follows: On the one hand, the effect of the components of the first amplification system can be reduced by their dilution prior to the second amplification. On the other hand, individual elements should not occur as nonspecific templates for primer extension during the second amplification. For this reason, the primers of the first and second amplification systems should be checked for the presence of self-complementary structures in order to avoid primer-dimer formation.

In a particular embodiment, the second amplification is carried out in the presence of the controller oligonucleotide of the first amplification system. For this reason, the design of the controller oligonucleotide, the primer of the second set, and the reaction conditions must be adjusted so that the second amplification reaction is not significantly disturbed by the presence of the controller oligonucleotide.

First, the controller oligonucleotide from both primers and the polymerase from the second amplification system should not be used as a template. This is particularly important for the third oligonucleotide primer, since it comprises a sequence segment which can bind in a complementary manner to the controller oligonucleotide in the fourth region. In particular, the structure of the controller oligonucleotides in the fourth region comprises a modification which prevents a potential primer extension. For example, provide such a synthesis blocking effect of various 2 ^'-0-alkyl modifications.

The controller oligonucleotide may form on the third primer extension product during the second amplification and thus on a complementary strand with the third primer extension product. Such a double-stranded fragment may possibly prevent a polymerase from starting to synthesize the complementary strand to the full extent starting from the fourth PCR primer, up to and including the 5 ^' segment of the third primer extension product. Therefore, the choice of polymerase and reaction conditions should be such that binding of the controller oligonucleotides does not prevent synthesis of the fourth primer extension product.

The length of the segment of the third primer extension product which can make a complementary bond with the controller oligonucleotide is co-determined, for example, by the positioning of the third primer. In particular, the third primer is arranged so that the length of the resulting fully complementary portion of an expected third primer extension product to the controller oligonucleotide is in particular in the following ranges: from about 15 nucleotides to about 60 nucleotides, or from about 20 nucleotides to about 40 nucleotides , especially from about 20 nucleotides to about 30 nucleotides.

In particular embodiments, in particular, a thermostable polymerase is selected in the second amplification reaction which comprises strand displacement activity, for example, a thermostable polymerase such as Vent Exo minus polymerase or pyrophage polymerase can be used. This allows the controller oligonucleotide during of the second amplification can be separated from the third primer extension product, and the fourth primer extension product can be synthesized in full length.

In particular embodiments, in particular, a polymerase is selected in the second amplification reaction which is capable of cleaving the controller oligonucleotide by 5 ^' -3 ^' exonuclease activity of the polymerase, with simultaneous primer extension (see above). In this case, a controller oligonucleotide is used, which can be cleaved by a 5 ^' -3 ^' exonuclease, at least in its 5 ^' segment. The degradation progressively leads to a shortening of the hybridized to the third primer extension product controller oligonucleotide, which under appropriate reaction conditions (eg, temperature of about 65 ° C to 75 ° C) to destabilize this bond and finally to a separation of the bond to the third primer extension product leads. This allows the fourth full-length primer extension product to be synthesized.

In certain embodiments, the concentration of the controller oligonucleotide and the concentration of the fourth primer of the second primer set are selected such that primer binding and primer extension are faster under the chosen reaction conditions than binding of the controller oligonucleotides to the third primer extension product. For example, concentrations of the controller oligonucleotide in the range of 0.01 pmol / l to 0.3 pmol / l are used. Concurrently, concentrations of the fourth primer ranging from about 0.5 pmol / L to 2 pmol / L are used. In particular, polymerases are used in the second amplification reaction, which have high processivity (for example, Phusion Polymerase). The binding of the primer and its extension are generally faster than the binding of the controller oligonucleotides, so that the primer extension reaction is kinetically advantageous.

In certain embodiments, the primer extension reaction in the second amplification reaction is carried out at at least two temperatures. At the first, generally lower temperature, eg in the range of 45 ° C to 65 ° C, the complementary binding of the fourth primer to its complementary segment occurs in the 3 ^' segment of the third primer extension product, as well as an initial extension by the polymerase , Here, a partially extended primer extension product is generated, which has sufficient stability with the third primer extension product, so that after increasing the temperature of the second region, for example to values of about 70 ° C to about 80 ° C, this partially extended fourth Primer extension product can be extended by the polymerase. At this temperature, the controller oligonucleotide can spontaneously dissociate from its binding with the third primer extension product so that the polymerase can continue the synthesis of the fourth primer extension product, up to and including the 5 ^' segment of the third primer extension product from the polymerase becomes. In particular, polymerases are used in the second amplification reaction, which have a high processivity (eg, Phusion Polymerase). Processes which work with the composition of the reaction mixture in the "homogeneous format" are particularly suitable, for example, if a division of the first reaction batch is not meaningful or technically very complicated, for example in the case of a "micro- or nanotrottle reaction" (also known as called digital PCR).

Likewise, further elements can be supplied to an amplification, for example a solid phase comprising oligonucleotides which are suitable for a specific binding of products formed and / or also occur as immobilized primers, so that a solid phase PCR can be carried out, wherein the primer extension products immobilized on the solid phase. The establishment of contact with a solid phase comprising specific oligonucleotides may occur before, during, or only after the first amplification.

The reaction mixture can be divided into a plurality of reaction volumes (partitioning) before the start of the first amplification reaction, so that an amplification of a reaction mixture is simultaneously divided into about 100 or 1000 or more equal volume fractions. This division can take place in the form of droplets (for example as an emulsion). The execution of amplification may be carried out in parallel in this plurality of droplets (e.g., as Digital PCR).

The sequence of the amplification reactions (first a sequence-specific amplification and only then a PCR) plays an essential role: the sequence-specific amplification (first amplification) using a controller oligonucleotide takes place in particular before a PCR amplification. In order to avoid PCR-based distortions in the target sequences and side reactions before a first amplification. Therefore, the PCR-based amplification takes place only as a second step.

In a particular embodiment, therefore, no DNA fragments generated by a PCR or another amplification method are used as starting nucleic acid chains for the first amplification reaction.

The first amplification method (first partial amplification) and the required components of the first amplification system will first be described schematically, then the second amplification method (second partial amplification) and the components of the second amplification system will be described. Subsequently, the combination of the first and the second amplification method, as well as advantageous embodiments are shown. The second amplification method (also referred to below as PCR) takes place after the first amplification.

In particular, the first amplification occurs as an exponential amplification in which newly synthesized products of both primers (primer extension products) occur as templates for further synthetic steps. In this case, the primer sequences are at least partially copied, so that complementary primer binding sites arise, which immediately after their synthesis are present as sequence segments of a double strand. In the first amplification process, synthesis steps of both strands and double-strand opening steps of the newly synthesized sequence segments take place alternately. Sufficient double-strand separation after synthesis is an important prerequisite for further synthesis. Overall, such a change from synthesis and double-strand separation steps can lead to exponential amplification.

In the first amplification method, according to the invention, the double-stranded opening of the main products of the amplification (amplification of nucleic acid chains comprising target sequence) takes place inter alia by means of an oligonucleotide, which is referred to herein as a controller oligonucleotide. The controller oligonucleotide in particular comprises sequence segments which correspond to the target sequence.

In detail, the strand separation according to the invention is achieved by using a controller oligonucleotide, each having a predefined sequence, which in particular separates a newly synthesized double strand consisting of two specific primer extension products by means of a sequence-dependent nucleic acid-mediated strand displacement. The resulting single-stranded segments of the primer extension products comprise the target sequence as well as corresponding primer binding sites, which can serve as binding sites for further primer oligonucleotides, so that an exponential amplification of nucleic acid chains to be amplified is achieved. The primer extension reactions and strand displacement reactions take place simultaneously in the approach. The amplification occurs in particular under reaction conditions which do not allow a spontaneous separation of both specific synthesized primer extension products.

A specific exponential first amplification of a nucleic acid sequence comprising a target sequence comprises a repetition of synthesis steps and double-strand opening steps (activation steps for primer binding sites) as a mandatory prerequisite for the amplification of the nucleic acid chain.

The opening of synthesized duplexes is implemented as a reaction step which is to be sequence-specifically influenced by the controller oligonucleotide. This opening can be complete, even to dissociation of both complementary primer extension products, or even partial.

According to the invention, the controller oligonucleotide comprises sequence segments which can interact with the target sequence and further sequence segments which bring about this interaction or facilitate or favor it. In the context of the interaction with the controller oligonucleotide, double-stranded sections of the synthesized primer extension products are converted into a single-stranded form via sequence-specific strand displacement. This process is sequence-dependent: only when the sequence of the synthesized double strand has a certain degree of complementarity with the corresponding sequence of the controller oligonucleotide does a sufficient double strand opening occur the sequence sections essential for the continuation of the synthesis, such as primer binding sites, are converted into single-stranded form, which corresponds to an "active state". The controller oligonucleotide thus "specifically" activates the newly synthesized primer extension products comprising the target sequence for further synthetic steps.

In contrast, sequence segments which do not comprise a target sequence are not converted into a single-stranded state and remain as a double strand, which corresponds to an "inactive" state. The potential primer binding sites in such a duplex are less favored or completely hindered from interacting with new primers, so that further synthetic steps on such "non-activated" strands generally do not occur. This lack of or decreased activation (i.e., single stranded state) of synthesized nucleic acid strands following a synthesis step results in the successful conclusion that only a reduced amount of primers can successfully participate in a primer extension reaction in the subsequent synthesis step.

Due to a desirable exponential first amplification of major products (a nucleic acid sequence to be amplified comprising target sequences) several synthesis steps and activation steps (double-stranded opening steps) are combined to an amplification process and carried out as many times or repeated until the desired Amount of the specific nucleic acid chain is provided.

The reaction conditions (e.g., temperature) are designed in the course of the first amplification process so that spontaneous separation of complementary primer extension products in the absence of a controller oligonucleotide is unlikely or significantly slowed.

Thus, increasing the specificity of amplification results from the sequence dependence of the separation of complementary primer extension products comprising a target sequence: the controller oligonucleotide facilitates this double-stranded separation as a result of matching its sequence segments to given sequence segments of the primer extension products. This match is checked after each synthesis cycle by the controller oligonucleotide. The exponential amplification results from successful repeats of syntheses and sequence-specific strand displacements caused by controller oligonucleotide, i. "Activations" (double-stranded openings / double-stranded separations / strand displacement processes resulting in single-stranded form of corresponding primer binding sites) of newly synthesized primer extension products.

The use of a pre-defined controller oligonucleotide thus allows a sequence-dependent review of the contents of the primer extension products between the individual synthetic steps during the exponential amplification and inducing a selection of sequences for subsequent synthetic steps. It is possible to distinguish between "active", single-stranded states of newly synthesized specific primers. Extension products can be distinguished as a result of successful interaction with a controller oligonucleotide, and "inactive" double-stranded states of newly synthesized nonspecific primer extension products as a result of deficient, insufficient, decreased and / or slowed interaction with a controller oligonucleotide.

For exponential amplification the following effects result:

Under non-denaturing conditions, the separation of specifically synthesized strands takes place with the assistance of the controller oligonucleotide.

The exponential amplification of nucleic acid chains comprising a target sequence is carried out in a sequence-controlled manner (main reaction). This sequence control occurs after each step in the synthesis and includes sequence segments which are between the primers and comprise the target sequence. The successful verification of the result of the synthesis after each synthesis step results in the separation of the two specific primer extension products, which is the prerequisite for further specific synthesis steps.

During the first amplification, an initial development of unspecific primer extension products can not be ruled out in principle (by-products). Such non-specific primer extension products are usually present in double-stranded form immediately after their synthesis. However, the interaction with the controller oligonucleotide either remains completely or is restricted so that strand separation does not occur or strand separation is slower than the main reaction. The transmission of erroneous sequence information from one synthesis cycle to the next does not take place.

By choosing the reaction conditions and the design of the controller oligonucleotide, it is thus possible to exert a targeted influence on the efficiency of the regeneration of correct nucleic acid chain templates between individual synthesis steps in the context of an amplification process. In general, the higher the degree of correspondence of the synthesized sequence to the given sequence of the controller oligonucleotide, the more successful the separation of the synthesized products and the regeneration of correct templates from one synthesis step to the next. Conversely, sequence variation in by-products results in insufficient regeneration of template strands and thus slowing of the synthesis initiation or reduction of yield in each subsequent cycle. All exponential amplification of by-products either proceeds more slowly or does not occur at all and / or remains at an undetectable level.

The method thus makes it possible to check the synthesized sequences in real time, ie without reaction interruption, and thus provides means for the development of homogeneous assays in which all components of the assay are already present in the reaction mixture at the beginning of a reaction. As a result of the first partial amplification, a sufficient amount of highly specific amplification fragments is provided, which can serve as template in the second partial amplification (PCR).

After a sufficient reaction time or cycle number, the first amplification process is then terminated or the reaction conditions are changed so that the second amplification process (PCR) can be started. In the second amplification method, the amplification of the target sequences is carried out using nucleic acid chains prepared in the first amplification method and at least one further, PCR-specific component (for example an oligonucleotide primer and / or a PCR polymerase). Since the number of specific nucleic acid chains is sufficiently high already at the beginning of the second amplification, the PCR process requires fewer cycles until the desired total amount of products is reached. This PCR products are generated, which have fewer errors overall.

By sequential switching of a highly specific first amplification method at the beginning of the amplification and the PCR only after that, the overall specificity of the generated PCR products can thus be improved in comparison with conventional PCR methods which operate from the beginning under PCR conditions.

In particular, components for both amplification methods are already present at the beginning of the amplification.

In certain embodiments, the components of the first amplification system are different from the components of the second amplification system (PCR).

In certain embodiments, the components of the first amplification system are different from the components of the second amplification system, and the PCR components (of the second amplification system) are at least partially in non-active form (eg, hot) under reaction conditions of the first amplification process. Starting polymerases). Switching from the first amplification to the second amplification thus requires an additional activation step of the PCR components (e.g., polymerase).

In certain embodiments, the polymerase of the first amplification system is inactivated after completion of the first amplification, so that a different polymerase is used for the second amplification (PCR).

In certain embodiments, the components of the first amplification system are also partially utilized by the second amplification system using at least one additional PCR-specific component (e.g., another primer oligonucleotide or polymerase) that is not part of the first amplification system.

The present invention describes some embodiments of both methods, arrays of oligonucleotide primers, which are advantageous for performing both amplification methods. By suitable arrangement of individual elements of the first and the second Amplification system on a nucleic acid chain comprising a target sequence, homogeneous assays can be assembled with higher overall specificity.

terms and definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Standard techniques are used for molecular biology or biochemistry (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.).

Insofar as the sequences shown in the description and in the sequence listing deviate from one another, the sequence shown in the description applies in case of doubt.

In the context of the present invention, the terms used have the following meanings:

The term "oligonucleotide" as used herein with reference to primer, controller oligonucleotide, probes, nucleic acid chain to be amplified refers to a molecule having two or more, in particular more than three deoxyribonucleotides and / or ribonucleotides and / or nucleotide modifications and / or or non-nucleotide modifications. Its length includes, for example, ranges between 3 to 300 nucleotide units or its analogs, more preferably between 5 to 200 nucleotide units or its analogs. Its exact size depends on many factors, which in turn depend on the ultimate function or use of the oligonucleotides.

As used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring e.g. B. occurs in a purified restriction cleavage or was produced synthetically. A primer is capable of acting as the initiation point of the synthesis when used under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid strand, ie in the presence of nucleotides and an inducing agent such as DNA polymerase a suitable temperature and a suitable pH. The primer is particularly single-stranded for maximum efficiency in amplification. The primer must be long enough to initiate synthesis of the extension product in the presence of the inducing agent. The exact length of the primer will depend on many factors, including the reaction temperature and primer source, and the application of the method. For example, depending on the complexity of the target sequence, the length of the oligonucleotide primer in diagnostic applications is between 5 to 100 nucleotides, in particular 6 to 40 and particularly preferably 7 to 30 nucleotides. Short primer molecules generally require lower reaction temperatures to perform their primer function to form sufficiently stable complexes with the template, or higher concentrations of other reaction components, such as DNA. Polymerases, so that a sufficient extension of formed primer-template complexes can take place.

The primers used herein are selected to be "substantially" complementary to the different strands of each specific sequence to be amplified. That is, the primers must be sufficiently complementary to hybridize with their respective strands and initiate a primer extension reaction. Thus, for example, the primer sequence does not need to reflect the exact sequence of the target sequence. For example, a non-complementary nucleotide fragment may be attached to the 5 'end of the primer, with the remainder of the primer sequence being complementary to the strand. In another embodiment, single non-complementary bases or longer non-complementary sequences may be inserted in a primer, provided that the primer sequence has sufficient complementarity with the strand sequence to be amplified to hybridize therewith and thus form a primer template. Complex able to produce the synthesis of the extension product.

As part of the enzymatic synthesis of a template-complementary strand, a primer extension product is generated which is completely complementary to the template strand.

Tm melting temperature

The melting temperature of a complementary or partially complementary double strand is generally understood to mean a measured value of a reaction temperature at which approximately half of the strands are in the form of a double strand and the other half is in the form of a single strand. The system (association and dissociation of strands) is in equilibrium.

Due to a large number of factors which can influence the Tm of a double strand (eg sequence length, CG content of the sequence, buffer conditions, concentration of divalent metal cations etc.), the determination of the Tm of a nucleic acid to be amplified should take place under the same conditions, like the intended amplification reaction.

Because of the dependence of the measurable melting temperature on multiple reaction parameters, e.g. of respective buffer conditions and respective concentrations of the reactants, the melting temperature is understood to mean a value which was measured in the same reaction buffer as the exponential amplification, at concentrations of both complementary components of a double strand of from about 0.1 pmol / l to about 10 pmol / l, in particular in a concentration of about 0.3 pmol / to about 3 pmol / l, in particular about 1 pmol / l. The respective value of the melting temperature is a guideline, which correlates with the stability of a respective double strand.

Deoxyribonucleoside triphosphates

The deoxyribonucleoside triphosphates (dNTPs) dATP, dCTP, dGTP and TTP (or dUTP, or dUTP / TTP mixture) are added in adequate amounts to the synthesis mixture. In In certain embodiments, in addition to dNTPs, at least one other type of dNTP analogue may be added to the synthesis mixture. For example, in certain embodiments, these dNTP analogs include a characteristic label (eg, biotin or fluorescent dye) that can be incorporated into the nucleic acid strand. In another embodiment, this dNTP analogs include at least one modification of the sugar phosphate moiety of the nucleotide, for example, alpha-phosphorothioate-2 ^{'-Desoxyribonukleosid-} triphosphates (or other modifications which impart a nucleic acid strand, a nuclease resistance), ^2', 3 ^{'dideoxy-ribonucleoside} triphosphates, Azyklo nucleoside triphosphates (or other leading to the termination of a synthetic modifications). In certain embodiments, these dNTP analogs include at least one modification of nucleobase, eg, iso-cytosines, iso-guanosines (or other modifications of extended-genetic alphabet nucleobases), 2-amino-adenosines, 2-thiouridines, inosines, 7-deazy adenosines, 7-deaza-guanosines, 5-Me-cytosines, 5-propyl-uridines, 5-propyl-cytosines (or other modifications of nucleobases which can be incorporated into natural nucleobases by a polymerase and alter the strand Lead stability). In certain embodiments, a dNTP analog comprises both a modification of the nucleobase and a modification of the sugar-phosphate moiety. In certain embodiments, at least one other type of dNTP analogue is added to the synthesis mixture rather than at least one natural dNTP substrate.

The nucleic acid synthesis-inducing agent may be an enzyme or a system that functions to cause synthesis of the primer extension products.

Suitable enzymes for the first amplification for this purpose include, but are not limited to, DNA polymerases, e.g. Bst polymerase and its modifications, Vent polymerase and others - particularly heat-stable DNA polymerases which allow the incorporation of the nucleotides in the correct manner, thereby forming the primer extension products that are complementary to any nucleic acid strand synthesized. Generally, the synthesis is initiated at the 3 'end of each primer and then proceeds in the 5' direction along the template strand until the synthesis is complete or interrupted.

In particular, template-dependent strand-displaceable DNA polymerases are used in the first amplification. These include, for example, the large fragment of Bst polymerase or its modifications (eg Bst 2.0 DNA polymerase), the Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, the large fragment of Bsu DNA polymerase, and the large fragment of Bsm DNA polymerase.

In certain embodiments, in particular polymerases are used which have no 5 ^' -3 ^' -Exonuklease activity, or have no 5 ^' -3 ^' -FFEN activity.

In particular thermostable matrix-dependent DNA polymerases are used for the second amplification. For example, Taq polymerase or its modifications (eg Ampli-Taq), or polymerases with proofreading function: Pfu and its modifications or Vent Polymerase and its modifications. It is possible to use polymerases which have been fused with another protein in order to increase their processivity, for example Phusion Polymerase. A variety of polymerases are commercially available.

Combinations of polymerases may also be used, e.g. OneTaq polymerase (NEB) is a combination of a Taq polymerase and Vent polymerase. Such combinations of polymerases can contribute to higher synthesis accuracy in the second amplification.

In certain embodiments, at least two different polymerases are used, for example, polymerases capable of strand displacement and those having 3 ^' -5 ^' reproducing activity.

In particular embodiments, polymerases are used with a hot-start function, which can only develop their function when a certain temperature is reached.

The first amplification system comprises the components necessary to perform a specific first amplification: the first primer oligonucleotide, the second primer oligonucleotide, the controller oligonucleotide and the first polymerase.

In addition, nucleotide mixtures and buffer systems may be included to the extent necessary to perform a specific first amplification (e.g., specific buffer systems for the first polymerase).

The first amplification system supports the synthesis of the first amplification fragment

1.1 (or of the first amplification product 1.1, also referred to as the nucleic acid sequence of the first amplification to be amplified) during the first amplification (also called the first partial amplification).

The second amplification system comprises the components necessary to carry out the specific second amplification: the third primer oligonucleotide, the fourth primer oligonucleotide and the second polymerase.

Further, this may include nucleotide mixtures and buffer systems as necessary to perform a specific second amplification (e.g., special buffer systems for the second polymerase).

The second amplification system supports synthesis of the second amplification fragment

2.1 (or second amplification product 2.1) during the second amplification (also called second partial amplification).

First primer oligonucleotide: (component of the first amplification system)

The first primer oligonucleotide (Figures 12 to 16) comprises a first primer region and a second region. The first primer region is capable of binding to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified, and a Initiate primer extension reaction. The second region comprises a polynucleotide tail which is capable of binding a controller oligonucleotide and thereby effecting spatial proximity between the controller oligonucleotide and the other portions of the first primer extension product sufficient to induce strand displacement through the controller oligonucleotide. The second region of the first primer oligonucleotide further comprises at least one modification (a nucleotide modification or a non-nucleotide modification) which prevents the polymerase from copying the polynucleotide tail by inhibiting the continuation of the polymerase dependent synthesis. This modification is located, for example, at the junction between the first and second regions of the first primer oligonucleotide. The first primer region of the first primer oligonucleotide is thus replicable by a polymerase so that a complementary sequence to this region can be generated during the synthesis of the second primer extension product (discussed in detail below) from the polymerase. In particular, the polynucleotide tail of the second region of the first primer oligonucleotide is not copied by the polymerase. In certain embodiments, this is achieved by the modification in the second region, which stops the polymerase from the polynucleotide tail. In certain embodiments, this is achieved by nucleotide modifications in the second region, where the entire polynucleotide tail consists essentially of such nucleotide modifications and thus is uncopatible to the polymerase.

In certain embodiments, each first primer oligonucleotide is specific for each nucleic acid to be amplified.

In certain embodiments, each first primer oligonucleotide is specific for at least two of the nucleic acids to be amplified, each comprising substantially different sequences.

In certain embodiments, the first primer oligonucleotide is labeled with a characteristic marker, e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.

A first primer oligonucleotide is used in particular in the first amplification as a primer.

In certain embodiments, it may be used as a primer in both the first and second amplifications.

Second primer oligonucleotide: (component of the first amplification system)

An oligonucleotide capable of binding with its 3 ^' segment to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified and initiating a specific second primer extension reaction. This second Thus, primer oligonucleotide is capable of binding to the 3 ^' segment of a first specific primer extension product of the first primer oligonucleotide and initiating polymerase-dependent synthesis of a second primer extension product.

The length of the second primer oligonucleotide can be between 15 and 100 nucleotides, in particular between 20 and 60 nucleotides, in particular between 30 and 50 nucleotides.

In certain embodiments, every second primer oligonucleotide is specific for each nucleic acid to be amplified.

In certain embodiments, every other primer oligonucleotide is specific for at least two of the nucleic acids to be amplified, each comprising different sequences.

In certain embodiments, the second primer oligonucleotide is labeled with a characteristic marker, e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.

A second primer oligonucleotide is used in particular in the first amplification as a primer. In certain embodiments, it may be used as a primer in both the first and second amplifications.

Primer extension product

A primer extension product (also called a primer extension product) results from enzymatic (polymerase-dependent) extension of a primer oligonucleotide as a result of template-dependent synthesis catalyzed by a polymerase.

A primer extension product comprises the sequence of the primer oligonucleotide in its 5 ^' segment and the sequence of the extension product (also called extension product) which has been synthesized by a polymerase in a template-dependent form. The extension product synthesized by the polymerase is complementary to the template strand on which it was synthesized.

A specific primer extension product (eg P1 .1-Ext and P2.1-Tex) of the first amplification (main product) comprises sequences of the nucleic acid chain to be amplified. It is the result of a specific synthesis or a correct execution of an intended primer extension reaction in which the nucleic acid chain to be specifically amplified serves as a template. In a particular embodiment, the sequence of the synthesized primer extension products coincides completely with the expected sequence of a nucleic acid to be amplified. In another embodiment, deviations in the sequence obtained may be tolerated by the theoretically expected sequence. In certain embodiments, the degree of agreement of the sequence obtained is due to a Amplification with the sequence of the theoretically expected to be amplified nucleic acid, for example, between 90% and 100%, in particular, the match is over 95%, ideally, the agreement is greater than 98% (measured by the proportion of synthesized bases).

The length of the extension product of a specific primer extension product can be between 10 and 300 nucleotides, in particular between 10 and 180 nucleotides, in particular between 20 and 120 nucleotides, in particular between 30 and 80 nucleotides.

For example, in the second amplification, products of a specific template-dependent primer extension reaction of the third and fourth primers represent the major products or intermediates: the partial third primer extension product (P3.1-Ext Part 1, Figs. 15-18). or the complete primer extension product (P3.1-Ext, FIGS. 15-18), the partial fourth primer extension product (P4.1-Ext Part 1, FIGS. 15-18), or the complete primer Extension product (P4.1 -Ext, Figs. 15-18). These products, in certain embodiments, comprise a target sequence or its equivalents. In another embodiment, the second primer extension product comprises a target sequence and the first primer extension product comprises equivalents of the target sequence, namely the complementary strand. In certain embodiments, the fourth primer extension product comprises a target sequence and the third primer extension product comprises equivalents of the target sequence, the complementary strand. In certain embodiments, the fourth primer extension product comprises portions of a target sequence and the third primer extension product comprises equivalents of these portions of the target sequence, namely the complementary strand.

The first primer extension product (P1 .1-Ext) and the second primer extension product (P2.1-Ext) together represent the first amplification fragment 1 .1 (also referred to as amplification product 1.1) of the first amplification (Fig . 1 ).

The third primer extension product (P3.1 -Ext) and the fourth primer extension product (P4.1-Ext) together constitute the second amplification fragment 2.1 (also referred to as the second amplification product 2.1) of the second amplification (Fig . 1 ).

The third primer extension product (P3.1 Ext) may also be referred to as a complete third primer extension product. This product is made using the fourth primer extension product (P4.1-Ext) as template. The fourth primer extension product (P4.1-Ext) may also be referred to as a complete fourth primer extension product. This product is formed using the third primer extension product (P3.1-Ext) as template (Figures 15-18).

In contrast, there is a partial third primer extension product (P3.1 Ext part 1) which is generated as an intermediate template using the second Primr extension product (P2.1-Tex). The partial fourth primer extension product (P4.1 Ext 1) is generated as an intermediate template using the first primer extension product (P1 .1-Ext) (Figures 15-18).

For example, a non-specific primer extension product (by-product) includes sequences that have resulted as a result of a nonspecific or improper primer extension reaction. These include, for example, primer extension products that have arisen as a result of a false initiation event (false priming) or as a result of other side reactions, including polymerase-dependent sequence changes such as base substitution, deletion, etc. The level of sequence aberrations of nonspecific primer extension products generally exceeds the ability of controller oligonucleotides to successfully displace such double-stranded by-products from their templates so that amplification of such by-products is slower or completely absent. The extent of acceptance or the tolerance limit for deviations depend, for example, on the reaction temperature and the manner of sequencing deviation. Examples of nonspecific primer extension products are primer dimers or sequence variants which do not correspond to the nucleic acid to be amplified, e.g. Sequences which do not comprise a target sequence.

The assessment of a sufficient specificity of the amplification is often related to the task. In many amplification methods, some degree of unspecificity of the amplification reaction can be tolerated as long as the desired result can be achieved. In a particular embodiment, the proportion of nucleic acid chains to be amplified in the overall result of the reaction is more than 1%, in particular more than 10%, in particular more than 30%, based on the total amount of newly synthesized strands.

The nucleic acid to be amplified (expected result of the first amplification)

The nucleic acid to be amplified represents a nucleic acid chain which is to be amplified sequence-specifically or at least predominantly sequence-specifically by means of the first amplification using primers and controller oligonucleotide by the polymerase. The nucleic acid to be amplified comprises both strands of the first amplification fragment 1 .1 (also referred to as first amplification product 1.1) (FIG. 1). It can be used as starting nucleic acid chain 2.1, wherein at least one of its strands can be used to initiate the second amplification.

The length of the nucleic acid to be amplified may be between 20 and 300 nucleotides, in particular between 30 and 200 nucleotides, in particular between 40 and 150 nucleotides, in particular between 50 and 100 nucleotides.

The nucleic acid sequence to be amplified may comprise one or more target sequences or their equivalents. Furthermore, a nucleic acid to be amplified may comprise the sequences substantially complementary to a target sequence, which are propagated with similar efficiency as a target sequence in an amplification reaction and the target sequence or its Sections include. In addition to a target sequence, the nucleic acid to be amplified may include additional sequence segments, for example, primer sequences, sequences with primer binding sites and / or sequence segments for binding of detection probes, and / or sequence segments for sequence encoding of strands by barcode sequences and / or sequence segments for binding to a solid phase. The primer sequences or their sequence portions, as well as primer binding sites or their sequence portions, may for example belong to sequence sections of a target sequence.

In certain embodiments, the nucleic acid to be amplified corresponds to the target sequence.

In another embodiment, the target sequence forms part of the sequence of the nucleic acid sequence of the first amplification to be amplified. Such a target sequence may be flanked by 3 ^' side and / or 5 ^' side of further sequences. These further sequences may include, for example, binding sites for primers or their moieties, and / or comprising primer sequences or their moieties, and / or binding sites for detection probes, and / or adapter sequences for complementary binding to a solid phase (eg, Im Frame of microarrays, or bead-based analyzes) and / or include barcoding sequences for a digital signature of sequences.

In order for the amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain. This start nucleic acid chain predetermines the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.

In a particular embodiment, the initial template (starting nucleic acid chain), which is supplied to an amplification reaction at the beginning, or which is added to the reaction mixture, corresponds to the sequence composition of the nucleic acid chain to be amplified.

In initial stages of the amplification reaction and in its further course, the respective primers bind to the corresponding binding sites in the starting nucleic acid chain and initiate the synthesis of specific primer extension products. Such specific primer extension products accumulate exponentially in the course of amplification and increasingly assume the role of templates for the synthesis of complementary primer extension products in exponential amplification.

As a result of the repeated template-dependent synthesis processes in the context of an exponential amplification, the nucleic acid chain to be amplified is thus formed.

Towards the end of an amplification reaction, the major product of the reaction (the nucleic acid to be amplified) may be predominantly single-stranded or predominantly a complementary duplex. This can be done, for example, by the relative Concentrations of both primers and corresponding reaction conditions can be determined.

Equivalents of the nucleic acid to be amplified include nucleic acids having substantially identical information content. For example, complementary strands of a nucleic acid to be amplified have identical information content and can be said to be equivalent.

target sequence

In certain embodiments, a target sequence is a segment of a nucleic acid chain to be amplified which can serve as a characteristic sequence of the nucleic acid to be amplified. This target sequence can serve as a marker for the presence or absence of another nucleic acid. This other nucleic acid thus serves as the source of the target sequence and can be for example a genomic DNA or RNA or parts of the genomic DNA or RNA (eg mRNA), or equivalents of the genomic DNA or RNA of an organism (eg cDNA, modified RNA such as rRNA, tRNA, microRNA, etc.), or defined changes in the genomic DNA or RNA of an organism, for example mutations (eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability), splice variants, rearrangement variants (eg, T cell receptor variants), etc. The individual target sequences may represent a phenotypic trait, such as antibiotic resistance or prognostic information, and thus be of interest for diagnostic assays / assays. As a source / origin of a target sequence, such a nucleic acid may comprise, for example, the target sequence as a sequence element of its strand. A target sequence can thus serve as a characteristic marker for a particular sequence content of another nucleic acid.

The target sequence can be single-stranded or double-stranded. It may be substantially identical to the nucleic acid of the first amplification to be amplified or may be only part of the nucleic acid to be amplified.

Equivalents of the target sequence include nucleic acids with substantially identical information content. For example, complementary strands of a target sequence have identical informational content and can be said to be equivalent; RNA and DNA variants of a sequence are also examples of equivalent informational content.

As part of the material preparation prior to amplification reaction, such a target sequence can be isolated from its original sequence environment and prepared for the amplification reaction.

In a particular embodiment, a nucleic acid to be amplified comprises a target sequence. In certain embodiments, the target sequence corresponds to the nucleic acid to be amplified. In another particular embodiment, a startup Nucleic acid chain 1 .1 a target sequence. In certain embodiments, the target sequence corresponds to a starting nucleic acid chain 1 .1

The target sequence may be fully or partially included during the first amplification as part of the first amplification fragment 1 .1. In this case, for example, the second primer extension product comprises the target sequence or its portions and the second primer extension product thus comprises the strand complementary to this target sequence. This strand has an equivalent information content.

The target sequence may be wholly or partially included during the second amplification as part of the second amplification fragment 2.1. For example, the fourth primer extension product comprises the target sequence or its portions, and the third primer extension product thus comprises the strand complementary to this target sequence. This strand has an equivalent information content.

Start Nukleinsäurekete

In order for the first amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified (FIG. 1). This nucleic acid chain is referred to as the starting nucleic acid chain of the first amplification (starting nucleic acid chain 1.1). This start nucleic acid chain predetermines the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.

Such a starting nucleic acid chain can be present in single-stranded or double-stranded form at the beginning of the reaction. When the complementary strands of the starting nucleic acid chain are separated, regardless of whether the nucleic acid was originally double- or single-stranded, the strands can serve as a template for the synthesis of specific complementary primer extension products.

The starting nucleic acid chain 1 .1 comprises, in certain embodiments, a target sequence.

A start nucleic acid chain furthermore comprises at least one predominantly single-stranded sequence segment, to which at least one of the primers of the amplification system can bind predominantly complementarily with its 3 ^' segment, so that the polymerase used contains such a primer, when hybridized to the starting nucleic acid chain, may extend template-specific incorporation of dNTPs.

The start-up nucleic acid chain may also comprise segments which are not the target sequence but which can bind primers.

In order for the second amplification to start, at the beginning of the second amplification reaction, a nucleic acid chain must be present in the reaction mixture or be added thereto, which occurs as an initial template for the synthesis of the second amplification fragment (FIG. 1). This nucleic acid chain is referred to as the starting nucleic acid chain of the second amplification (starting nucleic acid chain 2.1). This start nucleic acid chain 2.1 specifies the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.

Here, the first amplification fragment 1.1 generated during the first amplification (also referred to as the nucleic acid chain to be amplified) serves as starting nucleic acid chain 2.1 for the second amplification. This start nucleic acid chain 2.1 thus comprises or consists of the first primer extension product produced in the first amplification. The starting nucleic acid chain 2.1 comprises in certain embodiments a target sequence.

PCR amplification (also called second amplification)

PCR is a polymerase chain reaction which generally serves to amplify DNA fragments. Many variants of a PCR reaction are known in the art. Among other things, allel-specific PCR, genotyping PCR, assymetric PCR, solid-phase PCR, digital PCR (partitioning / microdroplet PCR), multiplex PCR, real-time PCR using probes or intercalating dyes (eg Molecular beacons or 5 ^' -3 ^' exonuclease or two oligonucleotide probes with FRET pairs), clamp PCR using blocking probes, quantitative PCR, nested PCR, etc. One skilled in the art will be referred to the numerous reviews which describe individual PCR procedures.

Generally, during PCR, an increase in nucleic acid fragments defined by the primer position occurs. In general, at least two temperature ranges are used: a low temperature temperature range for binding of primers to their predominantly specific sequence segments and extension to form a complementary strand and at least one temperature range involving predominantly sequence-unselective separation of Strands are made so that freshly synthesized primer extension products separate from their templates.

Many techniques have been developed to influence the course of the PCR, eg, hot-start polymerases, hot-start oligonucleotides, activatable primers (eg, by means of a 3 ^' -5 ^' -Proofreading activity of polymerases).

PCR can be performed in liquid phase using PCR tubes / microtiter plates or on a solid phase or in microfluidic systems or in situ.

PCR primer pair (the third and the fourth primer oligonucleotide)

(Components of the second amplification)

Typically, includes two oligonucleotides capable of supporting amplification of a nucleic acid fragment by a PCR method. In general, a PCR primer pair comprises a third and a fourth primer oligonucleotide. Such primers are known in the art.

For clarity, PCR primers are generally referred to herein as P3 and P4 (as opposed to a controller Abhangige Amplification P1 and P2).

Many variants of PCR primers are known to a person skilled in the art. Typically, they are oligonucleotides of about 15 to about 60 nucleotides in length, which comprise at least in their 3 ^' segment sequences capable of binding to complementary segments of a target sequence and using this target sequence as a template to initiate template-dependent synthesis by means of a polymerase.

Many other functionalities, such as dye labeling (e.g., with FAM, TAMRA, Cy5), or quenching (e.g., BHQ1), affinity labeling (e.g., biotin, digoxigenin), or additional sequences, e.g. for sequence barcoding (use of specific tag sequences) or use of sequences for library construction are known to a person skilled in the art. PCR primers may be used in solution or also coupled to a solid phase (e.g., beads, micrititer plates). These variants are also well known to a person skilled in the art.

Controller oligonucleotide:

The controller oligonucleotide (Figure 1, C1. 1) is a single-stranded nucleic acid chain which includes a predefined substantially complementary sequence in a portion of the first primer extension product which is specifically generated in the amplification of the nucleic acid to be amplified (first amplification ). This allows the controller oligonucleotide to bind substantially complementary to the first primer oligonucleotide and at least to the 5 ^' segment of the specific extension product of the first primer oligonucleotide. The controller oligonucleotide in its inner sequence segment, in certain embodiments, comprises nucleotide modifications that prevent the polymerase from synthesizing a complementary strand using the controller oligonucleotide as a template when the first and / or third primer oligonucleotide is attached to the controller Oligonucleotide is bound complementarily. In certain embodiments, it is advantageous if the controller oligonucleotide consists entirely of modified nucleotides that block its template function. In certain embodiments, it is advantageous if the controller oligonucleotide consists only in part of modified nucleotides that block its template function. The controller oligonucleotide is further capable of completely or partially displacing the second specific primer extension product from binding with the first specific primer extension product under strand reaction under the chosen reaction conditions. In this case, the controller oligonucleotide with its complementary regions attaches itself to the first specific primer extension product. Upon successful binding between the controller oligonucleotide and the first specific primer extension product, this leads to recovery of a single-stranded state of the 3 ^' segment of the second specific primer extension product suitable for binding the first primer oligonucleotide so that a new primer extension reaction can take place. During synthesis of the second primer extension product, the controller oligonucleotide may be separated from binding with the first primer extension product by strand displacement, for example, by polymerase and / or by the second primer oligonucleotide.

Detection system:

A detection system comprises at least one oligonucleotide probe and at least one fluorescent reporter (a fluorophore). The detection system should be capable of carrying out the synthesis of the first and / or the second and / or the third and / or the fourth primer extension product (P1 1-Ext, P2.1-Ext, P3.1-Ext, P4. 1-text). This is done by using oligonucleotide probes, which are able to bind to the respective primer extension product and thereby generate a specific signal, or bring about a change in the signal. This change may be an increase or decrease in fluorescence intensity. A detection system may further comprise additional components. Such components include in particular fluorescence quencher and / or donor fluorophore. Furthermore, the detection system may also include the controller oligonucleotide. The array of fluorescent reporter, fluorescence quencher, donor fluorophore on the oligonucleotide probe or on the pair comprising oligonucleotide probe and controller oligonucleotide makes it possible to detect the binding events to the first primer extension product.

Fluorescent reporter

A fluorophore is a chemical compound or molecule which, when excited by electromagnetic radiation, is capable of emitting electromagnetic radiation (light) (emission). This radiation emitted by the fluorophore (emission) can be detected as a fluorescence signal by suitable technical means. Such a reporter can be covalently bound to an oligonucleotide. Many fluorophores are known which can be coupled to oligonucleotides (e.g., FAM, TAMRA, HEX, ROX, Cy dyes, Alexa dyes).

Fluorescence-quencher

A quencher is a chemical compound / molecule capable of reducing the emission of a fluorophore by direct contact (contact quenching) or by energy transfer (eg, FRET). Typically, a quencher must be placed in close proximity to the fluorophore for significant signal attenuation. Advantageous for a significant signal reduction of a fluorescence reporter by a quencher are distances between the reporter and quencher of less than 25 nucleotides, in particular of less than 15 nucleotides, in particular of less than 5 nucleotides.

To overcome a signal reduction of a fluorescent reporter by a quencher, the distance between these components must be increased accordingly, it is advantageous if the distance between the reporter and quencher of more than 15 nucleotides, in particular more than 20 nucleotides, in particular more than 40 nucleotides is increased. In this case, the distance caused by the nucleotide sequence must be due to an extended nucleotide sequence. For example, if hairpin structures form, spatial distance may no longer exist.

Especially with FRET-based quenchers, a sufficient spectral overlap between the emission spectrum of a fluorophore and the absorption spectrum of a quencher is advantageous. Therefore, fluorophore-quencher pairs are preferred which have more than 25% spectral overlap. (e.g., FAM / TAMRA).

Donor fluorophores

Donor fluorophores are chemical compounds / molecules that are capable of absorbing electromagnetic radiation and transferring it to another fluorophore (acceptor) through energy transfer (eg, as FRET) to excite this fluorophore, and as a result, itself Light emission generated. Upon emission, a fluorescence signal is generated. As a rule, the donor and the acceptor form a fluorescence resonance energy transfer pair (a FRET pair). In general, a donor must be placed in close proximity to the acceptor (fluorophore) for this signal generation to occur to any significant extent.

Advantageous for signal generation of a fluorescent reporter as a result of a FRET from a donor fluorophore are distances between the reporter and donor of less than 25 nucleotides, in particular less than 15 nucleotides, in particular less than 5 nucleotides.

The removal of the FRET effect from donor to acceptor is usually achieved by increasing the distance between both partners of a FRET pair. It is advantageous if the distance between the reporter and donor is increased to more than 15 nucleotides, in particular to more than 20 nucleotides, in particular to more than 40 nucleotides.

Furthermore, a sufficient spectral overlap between the emission spectrum of a donor and the absorption spectrum of an acceptor is generally advantageous. Therefore, preference is given to FRET pairs which have more than 25% in spectral overlap (eg FAM / Cy3). According to the invention, the spatial distance between the individual components is brought about, in particular, by connecting two components via a nucleotide sequence which can hybridize with a specific part of the target sequence.

Strand displacement (Strand Displacement):

This is a process which, by the action of a suitable agent, leads to a complete or partial separation of a first double strand (consisting for example of A1 and B1 strand) and for the simultaneous / parallel formation of a new second double strand, wherein at least one of the strands ( A1 or B1) is involved in the formation of this new second strand. One can distinguish here two forms of strand displacement.

In a first form of strand displacement, the formation of a new second duplex may be accomplished using an already existing complementary strand which is generally in single-stranded form at the beginning of the reaction. In this case, the means of strand displacement (for example, a preformed single-stranded strand C1, which has a complementary sequence to the strand A1, acts on the first already formed double strand (A1 and B1) and enters into a complementary bond with the strand A1, whereby the strand B1 aus If the displacement of B1 is completed, the result of the C1 action is a new duplex (A1: C1) and a single strand B1. If the displacement of B1 is incomplete, it depends For example, a complex of partially double-stranded A1: B1 and A1: C1 may be present as an intermediate.

In a second form of strand displacement, the formation of a new second duplex may occur under concurrent enzymatic synthesis of the complementary strand, with one strand of the first preformed duplex appearing as a template for synthesis by the polymerase. In this case, the means of strand displacement (for example, polymerase with a strand displacement ability) acts on the first already preformed duplex (A1 and B1) and synthesizes a complementary to strand A1 complementary strand D 1, wherein at the same time the strand B1 from the bond with the strand A1 is displaced.

By the term "nucleic acid mediated strand displacement" is meant a sum / series of intermediate steps which can be in equilibrium with one another and, as a result, the temporary or permanent opening of a first preformed duplex (consisting of complementary strands A1 and B1) and formation of a new one second duplex (consisting of complementary strands A1 and C1), wherein A1 and C1 are complementary to each other.

It is known that an essential structural prerequisite for the initiation of strand displacement is the creation of a spatial proximity between a duplex end (preformed first duplex of A1 and B1) and a single-stranded strand (C1) which initiates strand displacement (where A1 and C1 can form a complementary strand). Such spatial proximity can be brought about in particular by means of a single-stranded overhang (in the literature examples are known with short overhangs, referred to in English as "Toehold", see above), which binds the single-stranded strand (C1) temporarily or permanently complementary, and thus brings complementary Segqmente the strand C1 and A1 sufficiently close, so that a successful strand displacement of the strand B1 can be initiated. The efficiency of initiation of nucleic acid-mediated strand displacement is generally greater the closer the complementary segments of strand A1 and C1 are positioned to each other.

Another essential structural prerequisite for efficiently continuing nucleic acid-mediated strand displacement in internal segments is high complementarity between strands (e.g., between A1 and C1) which must form a new duplex. For example, single nucleotide mutations (in C1) can lead to the disruption of strand displacement (described, for example, for branch migration).

The present invention makes use of the ability of complementary nucleic acids to sequence-dependent nucleic acid-mediated strand displacement.

Particular embodiments of the invention are explained in more detail in the figures and examples.

Individual embodiments

Reaction conditions for first amplification

Reaction conditions include, but are not limited to, buffer conditions, temperature conditions, duration of reaction, and concentrations of respective reaction components.

In the course of the reaction, the amount of specific produced nucleic acids to be amplified accumulates in an exponential manner. The reaction comprising the synthesis of the extension products can be carried out for as long as necessary to produce the desired amount of the specific nucleic acid sequence. The inventive method is carried out in particular continuously. In a preferred embodiment, the amplification reaction proceeds at the same reaction temperature, wherein the temperature is in particular between 50 ° C and 70 ° C. In another embodiment, the reaction temperature can also be controlled variably, so that individual steps of the amplification run at respectively different temperatures.

The reagents required for the exponential amplification are in particular already present at the beginning of a reaction in the same batch. In another embodiment, reagents may also be added at later stages of the process. In particular, no helicases or recombinases are used in the reaction mixture to separate the newly synthesized duplexes of the nucleic acid to be amplified.

In a particular embodiment, the reaction mixture does not include biochemical energy-donating compounds such as ATP.

The amount of nucleic acid to be amplified at the beginning of the reaction can be between a few copies and several billion copies in one run. For diagnostic applications, the amount of nucleic acid chain to be amplified may be unknown.

The reaction may also contain other nucleic acids which are not to be amplified. These nucleic acids may be derived from natural DNA or RNA or their equivalents. In certain embodiments, control sequences are in the same approach, which should also be amplified in parallel to the nucleic acid to be amplified.

In particular, a molar excess of about 10 ³ : 1 to about 10 ¹⁵ : 1 (primer: template ratio) of the primers used and the controller oligonucleotide is added to the reaction mixture, which comprises template strands for the synthesis of the nucleic acid sequence to be amplified.

The amount of target nucleic acids may not be known if the method of the invention is used in diagnostic applications, so that the relative amount of the primer and the controller oligonucleotide relative to the complementary strand can not be determined with certainty. The amount of primer added will generally be present in molar excess relative to the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.

The concentrations of primer 1, primer 2 and controller oligonucleotides used are, for example, in the range between 0.01 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 100 pmol / l, in particular between 0, 1 pmol / l and 50 pmol / l, in particular between 0.1 pmol / l and 20 pmol / l. The high concentration of components can increase the rate of amplification. The respective concentrations of individual components can be varied independently of one another in order to achieve the desired reaction result.

The concentration of polymerase ranges between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 20 pmol / l, in particular between 0.1 pmol / l and 10 pmol / l.

The concentration of individual dNTP substrates is in the range between 10 pmol / l and 10 mmol / l, in particular between 50 pmol / l and 2 mmol / l, in particular between 100 pmol / l and 1 mmol / l. The concentration of dNTP can affect the concentration of divalent metal cations. If necessary, this will be adjusted accordingly. As divalent metal cations, Mg2 +, for example, are used. As a corresponding anion, for example, CI, acetate, sulfate, glutamate, etc. can be used.

The concentration of divalent metal cations is adapted, for example, to the optimum range for the particular polymerase and comprises ranges between 0.1 mmol / l and 50 mmol / l, more preferably between 0.5 mmol / l and 20 mmol / l, more preferably between 1 mmol / l and 15 mmol / l.

The enzymatic synthesis is generally carried out in a buffered aqueous solution. As buffer solutions, dissolved conventional buffer substances, such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, sodium glutamate in conventional concentrations can be used. The pH of these solutions is usually between 7 and 9.5, in particular about 8 to 8.5. The buffer conditions can be adapted, for example, according to the recommendation of the manufacturer of the polymerase used.

Other substances, such as so-called Tm depressants (e.g., DMSO, betaines, TPAC), etc., can be added to the buffer. Such substances reduce the melting temperature ("Tm depressors") of double strands and can thus have a positive influence on the opening of double strands. Polymerase stabilizing components such as Tween 20 or T riton 100 can also be added in conventional amounts to the buffer. EDTA or EGTA can be added to complex heavy metals in conventional amounts. Polymerase stabilizing substances such as trehalose or PEG 6000 may also be added to the reaction mixture.

In particular, the reaction mixture contains no inhibitors of the strand displacement reaction and no inhibitors of polymerase-dependent primer extension.

In certain embodiments, the reaction mixture contains DNA-binding dyes, especially intercalating dyes, such as e.g. EvaGreen or SybrGreen. Such dyes may possibly enable the detection of the formation of new nucleic acid chains.

The reaction mixture can furthermore contain proteins or other substances which, for example, originate from an original material and which do not influence the amplification.

Particular embodiments of reaction conditions

The temperature has a significant influence on the stability of the double strands.

In a particular embodiment, no temperature conditions are used during the amplification reaction, which essentially result in the separation of double strands of the nucleic acid to be amplified in the absence of controller oligonucleotide. This is to ensure that the double-stranded separation of nucleic acid chains to be amplified is dependent on the presence of the controller oligonucleotide throughout the course of the amplification. At a temperature approximately equal to the measured melting temperature (Tm) of the nucleic acid to be amplified, a spontaneous separation of both strands of the nucleic acid to be amplified occurs, such that the influence of the controller oligonucleotide on the separation of synthesized strands and thus on the sequence specificity of the nucleic acid Amplification is minimal to limited.

For example, in an exponential amplification which is less sequence specific (i.e., less controller oligonucleotide dependent), the reaction temperature may be around the melting temperature (i.e., Tm plus / minus 3 ° to 5 ° C) of the nucleic acid to be amplified. At such a temperature, sequence differences between the controller oligonucleotide and the synthesized primer extension product can generally be well tolerated in a strand displacement reaction.

Even in the temperature range from about (Tm minus 3 ° C) to about (Tm minus 10 ° C), there may still be a spontaneous strand separation of synthesized primer extension products, albeit with lower efficiency. The influence of controller oligonucleotide on the sequence specificity of the nucleic acid to be amplified is higher than at temperature conditions around the melting temperature (Tm) of the nucleic acid chain to be amplified.

Although the strand separation with decreasing reaction temperature takes place mainly due to interaction of the newly synthesized double strand with controller oligonucleotide. However, primer duplexes may spontaneously decay at the extension temperature under the conditions mentioned; without sequence-dependent strand displacement by controller oligonucleotide. For example, the reaction temperature with a reduced sequence-specific amplification in ranges between about (Tm minus 3 ° C) and about (Tm minus 10 ° C), in particular between about (Tm minus 5 ° C) and about (Tm minus 10 ° C). At such temperature, sequence differences between controller oligonucleotide and the synthesized primer extension product are less tolerated in a strand displacement reaction.

A high sequence specificity of the amplification of the method is achieved, in particular, when the newly synthesized strands of the nucleic acid to be amplified can not spontaneously dissociate into single strands under reaction conditions. In such a case, the sequence-specific strand displacement by controller oligonucleotide plays a crucial role in sequence-specific strand separation and is significantly responsible for the sequence specificity of the amplification reaction. This can generally be achieved if the reaction temperature is well below the melting temperature of both strands of the nucleic acid to be amplified and no further components are used for strand separation, for example no helicases or recombinases. For example, the reaction temperature in a sequence-specific amplification in ranges between about (Tm minus 10 ° C) and about (Tm minus 50 ° C), in particular between about (Tm minus 15 ° C) and about (Tm minus 40 ° C), in particular between about (Tm minus 15 ° C) and about (Tm minus 30 ° C). In a particular embodiment of the amplification, the maximum reaction temperature in the course of the entire amplification reaction is not increased above the melting temperature of the nucleic acid chain to be amplified.

In certain embodiments of the amplification, the reaction temperature may be raised at least once above the melting temperature of the nucleic acid chains to be amplified. The increase in temperature can be carried out, for example, at the beginning of the amplification reaction and lead to the denaturation of double strands of a genomic DNA. It should be noted that during such a step, the dependence of the double strand separation on the effect of the controller oligonucleotide is canceled or at least significantly reduced.

The reaction temperatures of the individual steps of the amplification reaction can be in the range of about 15 ° C to about 85 ° C, more preferably in the range of about 15 ° C to about 75 ° C, in particular in the range of about 25 ° C to about 70 ° C.

In the examples 2 and 3 described below, a reaction temperature of the amplification reaction of 65 ° C was used, wherein the Tm of the nucleic acids to be amplified between about 75 ° C and about 80 ° C. Thus, the duplex of the nucleic acid to be amplified was stable under reaction conditions and the amplification reaction sequence-specific.

In general, the reaction temperature can be optimally adjusted for each individual reaction step, so that such a temperature is brought about for each reaction step. The amplification reaction thus comprises a repetitive change of temperatures, which are repeated cyclically. In an advantageous embodiment of the method, reaction conditions are standardized for a plurality of reaction steps, so that the number of temperature steps is less than the number of reaction steps. In such a particular embodiment of the invention, at least one of the steps of the amplification takes place at a reaction temperature which differs from the reaction temperature of other steps of the amplification. The reaction is thus not isothermal, but the reaction temperature is changed cyclically.

For example, during amplification at least two temperature ranges are used, which are brought about alternately (cyclic change of temperatures between individual temperature ranges). In certain embodiments, the lower temperature range includes, for example, temperatures between 25 ° C and 60 ° C, in particular between 35 ° C and 60 ° C, in particular between 50 ° C and 60 ° C and the upper temperature range includes, for example, temperatures between 60 ° C and 75 ° C, especially between 60 ° C and 70 ° C.

In certain embodiments, the lower temperature range includes, for example, temperatures between 15 ° C and 50 ° C, in particular between 25 ° C and 50 ° C, in particular between 30 ° C and 50 ° C and the upper temperature range includes, for example, temperatures between 50 ° C and 75 ° C, in particular between 50 ° C and 65 ° C.

In certain embodiments, the lower temperature range includes, for example, temperatures between 15 ° C and 40 ° C, in particular between 25 ° C and 40 ° C, in particular between 30 ° C and 40 ° C and the upper temperature range includes, for example, temperatures between 40 ° C and 75 ° C, especially between 40 ° C and 65 ° C.

The temperature can be kept constant in the respective range or can be changed as a temperature gradient (decreasing or rising).

Further explanations on temperature settings are detailed in the following sections of embodiments.

Any induced temperature can be maintained for a period of time, resulting in an incubation step. The reaction mixture may thus be incubated for a period of time during amplification at a selected temperature. This time may be different for the particular incubation step and may be responsive to the progress of the particular reaction at a given temperature (e.g., primer extension or strand displacement, etc.). The time of an incubation step may comprise the following ranges: between 0.1 sec and 10,000 sec, in particular between 0.1 sec and 1000 sec, in particular between 1 sec and 300 sec, in particular between 1 sec and 100 sec.

By means of such a temperature change, individual reaction steps can be carried out, in particular at a selected temperature. As a result, yields of a particular reaction step can be improved. Within a synthesis cycle, temperature changes or temperature changes between individual temperature ranges may be required several times. A synthesis cycle may thus comprise at least one temperature change. Such a temperature change can be performed routinely, for example, in a PCR device / thermocycler as a time program.

In certain embodiments, an amplification method is preferred in which at least one of the steps comprising strand displacement and at least one of the steps comprising primer extension reactions take place simultaneously and in parallel and under the same reaction conditions. In such an embodiment, for example, a primer extension reaction of at least one primer oligonucleotide (e.g., of the first primer oligonucleotide) may be accomplished, especially at lower temperature temperature conditions. On the other hand, the strand displacement is carried out with the aid of controller oligonucleotide and the one further primer extension reaction (for example, by the second primer oligonucleotide), in particular in the reaction step in the upper temperature range.

In certain embodiments, an amplification method is preferred in which at least one of the steps comprising strand displacement by the controller oligonucleotide and at least one of the steps comprising primer extension reaction is included performed different temperatures. In such an embodiment, for example, primer extension reactions of at least one primer oligonucleotide (eg, of the first primer oligonucleotide and / or of the second primer oligonucleotide) may be carried out in particular at temperature conditions in the lower temperature range. By contrast, the strand displacement takes place with the assistance of controller oligonucleotide, in particular in the reaction step in the upper temperature range.

In a further particular embodiment, the steps of an amplification reaction proceed under identical reaction conditions.

In such an embodiment, the amplification process may be carried out under isothermal conditions, i. that no temperature changes are required to carry out the process. In such a particular embodiment of the invention, the entire amplification reaction is carried out under constant temperature, i. the reaction is isothermal. The time of such a reaction comprises, for example, the following ranges: between 100 sec and 30,000 sec, in particular between 100 sec and 10,000 sec, in particular between 100 sec and 1000 sec.

In the "Examples" section it is shown that it is possible to coordinate structures of individual reaction components and corresponding reaction steps to one another in such a way that an isothermal reaction is possible.

The sum of all process steps, which leads to a doubling of the amount of a nucleic acid chain to be amplified, can be referred to as a synthesis cycle. Such a cycle can be correspondingly isothermal or else characterized by changes in the temperature in its course. The temperature changes can be repeated from cycle to cycle and made identical.

Particularly advantageous are amplification methods in which the maximum achievable temperature essentially only permits a strand separation with the aid of controller oligonucleotide if more than 5 nucleotides of the third region of the controller oligonucleotide can form a complementary bond with the first primer extension product especially if more than 10, especially if more than 20 nucleotides of the controller oligonucleotide bind with the first primer extension product. In general, the longer the required binding between the controller oligonucleotide and the complementary strand of the first primer extension product before the synthesized strands dissociate under reaction conditions, the more specific is the amplification reaction. Specifically, by extending or shortening the third portion of the controller oligonucleotide, the desired level of specificity can be determined.

A process step can be carried out at its constant temperature repetition over the entire duration of the process or at different temperatures. Individual process steps can each be carried out in succession by adding individual components. In a particular embodiment, all reaction components necessary for the execution of an amplification are present at the beginning of an amplification in a reaction mixture.

The start of an amplification reaction can be carried out by adding a component, e.g. by adding a nucleic acid chain comprising a target sequence (e.g., a starting nucleic acid chain), or a polymerase or divalent metal ions, or also by providing reaction conditions necessary for amplification, e.g. Setting a required reaction temperature for one or more process steps.

The amplification can be carried out until the desired amount of nucleic acid to be amplified is reached. In another embodiment, the amplification reaction is carried out for a time which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount. In another embodiment, the amplification reaction is carried out over a sufficient number of synthesis cycles (doubling times) which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.

The reaction can be stopped by various interventions. For example, by changing the temperature (e.g., cooling or heating, whereby, for example, polymerase is impaired in its function) or by adding a substance which stops a polymerase reaction, e.g. EDTA or formamide.

Following amplification, the amplified nucleic acid chain can be used for further analysis. In this case, synthesized nucleic acid chains can be analyzed by various detection methods. For example, fluorescence-labeled oligonucleotide probes can be used or sequencing methods (Sanger sequencing or Next-Generation sequencing), solid-phase analyzes such as microarray or bead-array analyzes, etc. The synthesized nucleic acid chain can be used as a substrate / template in further primer extension reactions become.

In a particular embodiment, the progress of the synthesis reaction is monitored during the reaction. This can be done, for example, by using intercalating dyes, e.g. Sybrgreen or Evagreen, or using labeled primers (e.g., Lux primer or Scorpion primer) or using fluorescently labeled oligonucleotide probes.

The detection of the change in fluorescence during amplification is implemented in a detection step of the method. The temperature and the duration of this step can be adapted to the respective requirements of the oligonucleotide probe. The temperatures of the detection step include, for example, ranges between 20 ° C and 75 ° C, in particular between 40 and 70 ° C, in particular between 55 and 70 ° C. During the detection step, the reaction is illuminated with light of a wavelength which is capable of excitation into a used fluorophore of the detection system (a donor or a fluorescent reporter). The signal detection is usually parallel to excitation, whereby the specific fluorescence signal is detected and its intensity is quantified.

The amplification method can be used to verify the presence of a target nucleic acid chain in a biological material or diagnostic material as part of a diagnostic procedure.

Particular embodiments for reaction conditions of the second amplification

The reaction conditions of a PCR are well known to a person skilled in the art.

Here, therefore, some particular embodiments are to be exemplified.

In certain embodiments, the temperatures shown in FIGS. 3-11 include the following ranges:

T1 = 55 ° C (+/- 5 ° C)

T2 = 65 ° C (+/- 5 ° C)

T3 = 95 ° C (+/- 5 ° C)

T4 = 45 ° C (+/- 5 ° C)

T5 = 70 ° C (+/- 5 ° C)

T1 = 55 ° C (+/- 10 ° C)

T2 = 65 ° C (+/- 10 ° C)

T3 = 95 ° C (+/- 10 ° C)

T4 = 45 ° C (+/- 10 ° C)

T5 = 70 ° C (+/- 10 ° C)

T1 = 55 ° C (+/- 15 ° C)

T2 = 65 ° C (+/- 10 ° C)

T3 = 95 ° C (+/- 10 ° C)

T4 = 45 ° C (+/- 20 ° C)

T5 = 70 ° C (+/- 10 ° C) In certain embodiments, the temperatures shown in FIGS. 3-11 include the following ranges:

T1 = 55 ° C (+/- 5 ° C)

T2 = 65 ° C (+/- 3 ° C)

T3 = 95 ° C (+/- 10 ° C)

T4 = 45 ° C (+/- 5 ° C)

T5 = 70 ° C (+/- 3 ° C)

The time of incubation during individual temperature steps may, in some embodiments, be between 0.1 sec and 60 min, in particular between 1 sec and 10 min, in particular between 1 sec and 5 min.

The cyclic temperature changes are often referred to as PCR cycles. For example, a PCR cycle involves a complete change in temperature from T1, T2 to T3.

The temperature ranges used are primarily intended to support the following steps of the second amplification:

T1, T2, T4 and T5 Temperatures: Hybridization of the third and fourth primers to their complementary segments in the respective template strands and extension of a third and fourth primer extension product.

T3 temperature is used to separate double strands comprising at least one of the primer extension products. All double-stranded nucleic acid chains (eg double-stranded target sequences, first amplification fragments 1 .1, second amplification fragments 2. 1) and intermediates comprising P1 .1-ext and P4.1-Ext-part 1 or P2 and P3.1 -Ext part 1) converted by the action of temperature in the single-stranded form.

Furthermore, T3 temperature may serve to activate hot-start forms of the second polymerases (e.g., templates inactivated by an antibody) or to inactivate a first polymerase. Furthermore, thermolabile controller oligonucleotides can be cleaved by this temperature (T3). Furthermore, thermoactivatable primers three and four can be activated.

Thus, various temperatures can be used for the reaction control.

Furthermore, the choice of reaction temperatures in combination with respective PCR primers (the third and the fourth primer of the second amplification) can influence the production of products / formation of intermediates during the second amplification.

The amount of yields of individual products and intermediates depends on several factors. For example, higher concentrations of individual primers generally favor the yields of products / intermediates. Furthermore, the formation of products / intermediates can be influenced by the reaction temperature and the binding / affinity of individual reactants to each other (affinity of the binding of individual For example, longer oligonucleotides generally bind better than shorter oligonucleotides at higher temperatures, and CG content may also play a role in complementary sequence segments: CG-richer sequences also bind more strongly than AT-rich at higher temperatures sequences. Furthermore, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength of primers to their respective complementary segments, which also results in preferential binding of primers at higher temperatures.

For example, longer primers are used for the PCR (e.g., between 25 and 60 nucleotides, with a CG content of over 40%) having a relatively higher Tm with their complementary regions (e.g., 60-70 ° C). This allows hybridization steps and primer extension steps of the second amplification to be performed at higher temperatures (e.g., T2 or T5). Thus, in combination with relatively short first and second primers (from the first amplification), the reaction can be controlled to preferentially form primer extension products P4.1-Ext and P3.1-Ext and co-amplify primer extension products starting from P1 .1 and P2.1 during the PCR amplification can be largely suppressed.

For example, using third and fourth primers, including, for example, only a short 3 ^' segment capable of binding to the target sequence or its equivalents (eg, this segment is between 6 and 15 nucleotides in length), it may be advantageous to first do a few cycles at a low temperature (FIGS. 10A and B, A2.1 phase). A similar situation also applies to PCR primers, which comprise, for example, mismatches to only essentially complementary first amplification fragment 1 .1.

During this relatively low temperature phase (T1 and T4), primer binding of the third and / or fourth primer to their complementary segments of the first amplification fragment occurs such that, despite a small length of the complementary segment and / or mismatch, the polymerase starting from these primers hybridized to individual strands of the first amplification fragment can perform a template-dependent primer extension and primer extension products comprising a third and fourth primer oligonucleotide can be synthesized.

These PCR cycles are repeated at least twice so that complementary strands can be synthesized. When repeating the cycles, the third and fourth primers themselves are thus also copied as templates, which leads to the formation of complete primer binding sites for the third and / or fourth primer oligonucleotide.

Subsequently, an increase in the temperature can then take place (A2.2 phase), so that the third and fourth primers can bind to fully formed primer binding sites at higher temperature. Use of higher temperatures (T2 and T5) is advantageous, for example, in homogeneous assays (when both amplification systems are present in the same reaction mixture). Thus, for example, the influence of the binding of the controller oligonucleotide to complementary regions of the target sequence of the third primer extension product (P3.1 -Ext or P3.1 -Ext part) can be reduced.

The enzymatic synthesis also takes place in the second amplification generally in a buffered aqueous solution. As buffer solutions, dissolved conventional buffer substances, such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, sodium glutamate in conventional concentrations can be used. The pH of these solutions is usually between 7 and 9.5, in particular about 8 to 8.5. The buffer conditions can be adapted, for example, according to the recommendation of the manufacturer of the polymerase used.

Particular embodiments of a starting nucleic acid ketone: for the first amplification

The nucleic acid chain used or to be used at the beginning of an amplification reaction can be referred to as a starting nucleic acid chain (FIG. 1).

Their function can be seen as representing the initial template that allows for correct positioning of primers, the synthesis sections between both primers, and the initiation of binding and extension procedures. In a particular embodiment, a starting nucleic acid chain comprises a target sequence.

By binding primers to their corresponding primer binding sites (PBS 1 and PBS 2) and initiating appropriate primer extension reactions, this is done by generating first primer extension products. These are synthesized as specific copies of the nucleic acid chain present at the beginning of the reaction.

In certain embodiments, this nucleic acid chain (starting nucleic acid chain) to be used in the reaction mixture prior to the beginning of the amplification reaction may be identical to the nucleic acid chain to be amplified. The amplification reaction only increases the amount of such a nucleic acid chain.

In certain embodiments, the nucleic acid to be amplified and the starting nucleic acid chain differ in that the starting nucleic acid chain differs from the arrangement individual sequence elements of the nucleic acid sequence to be amplified, but the sequence composition of the starting nucleic acid chain may differ from the sequence of the nucleic acid chain to be amplified. For example, in the context of primer binding and extension during amplification, new sequence contents (based on starting nucleic acid chain) can be integrated into the nucleic acid chain to be amplified. Furthermore, sequence elements of a nucleic acid chain to be amplified may differ from such sequence elements of a starting nucleic acid chain in their sequence composition (eg primer binding sites or primer sequences). The starting nucleic acid serves only as an initial template for the specific synthesis of the nucleic acid chain to be amplified. This initial template may remain in the reaction mixture until the end of the amplification. Due to the exponential nature of the amplification, however, the amount of nucleic acid chain to be amplified at the end of an amplification reaction is greater than the amount of starting nucleic acid chain added to the reaction.

In certain embodiments, the startup nucleic acid chain may comprise at least one sequence segment which is not amplified. Such a start nucleic acid chain is thus not identical to the sequence to be amplified. Such sections which are not to be amplified may represent, for example as a consequence of sequence preparation steps or as a consequence of previous sequence manipulation steps, a sequence section of a starting nucleic acid chain.

In a particular embodiment, the starting nucleic acid sequence to be inserted into the reaction mixture prior to initiation of the reaction includes at least one target sequence.

In certain embodiments, such a starting nucleic acid chain includes at least one target sequence and still other non-target sequence sequences. During amplification, sequence segments comprising the target sequence are multiplied exponentially and other sequence segments are either not or only partially exponentially propagated.

Construction of a starting nucleic acid ketone (for the first amplification)

An example of such a start nucleic acid chain is a nucleic acid sequence which includes a target sequence and which comprises a Sequence Fragment-A and comprises a Sequence Fragment-B.

Sequence fragment-A of the starting nucleic acid chain comprises a sequence which has significant homology with the sequence of one of the two primers used in the amplification or is substantially identical to the copiable portion of the 3 ^' segment of the one primer. Upon synthesis of a complementary strand to this segment, a complementary sequence is generated which represents a corresponding primer binding site.

The sequence fragment B of the starting nucleic acid chain comprises a sequence which is complementary to the binding of a corresponding further primer or its 3 ^' segment is suitable for forming an extension-capable primer-template complex, wherein sequence fragment A and sequence fragment B are predominantly non-complementary in relation to each other.

In a particular embodiment, the reaction mixture of an amplification process is given a starting nucleic acid chain which has the following properties:

In particular, sequence fragment-A is located in the 5 ^' segment of the starting nucleic acid chain. In particular, this sequence fragment-A forms a restriction of the nucleic acid chain strand in the 5 ^' direction.

In particular, sequence fragment-B lies in the 3 'direction, relative to the binding site of the first primer and relative to the polarity of the first primer ("downstream"), from sequence fragment-A.

In a particular embodiment, this sequence fragment-B forms a restriction of the nucleic acid chain strand in the 3 ^' direction. In certain embodiments, this sequence fragment-B does not represent a 3 ^' -chain boundary of the nucleic acid chain strand, but is flanked by further sequences from the 3 ^' side. In particular, these sequences are not targeting sequences and do not participate in exponential amplification.

In certain embodiments, the target sequence comprises at least one of either Sequence Fragment A or Sequence Fragment B. In certain embodiments, the target sequence is between sequence fragment A and sequence fragment B.

In one embodiment (Figure 50), such a starting nucleic acid chain can serve as a template for the synthesis of a first primer extension product. The starting nucleic acid chain can be provided, for example, in the context of a primer extension reaction using the second primer oligonucleotide as a sequence segment of a longer starting nucleic acid chain during a preparatory step before the exponential amplification and converted into a single-stranded form. The starting nucleic acid chain may be, for example, a genomic DNA or RNA and serves as a source of the target sequence. The start nucleic acid chain comprises in the 5 ^' segment of the nucleic acid chain a segment 1 comprising sequence sections of the second primer oligonucleotide and limiting in the 5 ^' direction, a segment 2 comprising a target sequence or its parts, a segment 3, which comprises a primer binding site for the first primer oligonucleotide and a segment 4 which locates a non-target sequence in the 3 ^' segment of the starting nucleic acid chain and thus flanks segment 3 on the 3 ^' side.

In the context of the initiation of the amplification, the first primer can bind to such a starting nucleic acid chain in segment 3 at least with the 3 ^' segment of its first region and can be correspondingly extended in the presence of a polymerase and nucleotides. This results in a first primer extension product which is complementary to the template strand of the starting nucleic acid chain and is limited in its length. In the context of the amplification reaction, a such primer extension product via the oligonucleotide controller are separated from its template strand sequence-specific, so that corresponding sequence sections in the 3 ^' segment of the now synthesized first primer extension product are available as a binding site for the second primer oligonucleotide.

In a particular embodiment, a starting nucleic acid chain thus comprises the following sequence fragments (FIG. 50):

Sequence segment-1 (labeled segment 1) which comprises a sequence which has significant homology with the sequence of the second primer or is substantially identical to the copiable portion of the 3 ^' segment of the second primer. This sequence segment-1 is located in the 5 ^' segment of the starting nucleic acid chain, in particular this sequence segment-1 forms a boundary of the nucleic acid chain strand in the 5 ^' direction.

The sequence segment-3 (labeled segment 3), which comprises a sequence which is suitable for complementary binding of the first region of the first primer or its 3 ^' segment to form an extension-capable primer-template complex. In particular, the sequence segment-3 is in the 3 'direction, ("upstream") of the sequence segment-1.

Target sequence which lies partially or completely between segment 1 and segment 3 (this portion of the target sequence is referred to as segment 2). In a particular embodiment, the target sequence comprises segment 2, as well as at least one of segment 1 and / or segment 3.

Optionally, the start nucleic acid chain in the 3 ^' segment comprises flanking sequence segments (termed segment 4) which are not amplified.

In another embodiment (Figure 51), a starting nucleic acid chain may serve as a template for the synthesis of a second primer extension product.

The starting nucleic acid chain can be provided, for example, in the context of a primer extension reaction using the first primer oligonucleotide as a sequence segment of a longer starting nucleic acid chain during a preparatory step before the exponential amplification and converted into a single-stranded form. The starting nucleic acid chain may be, for example, a genomic DNA or RNA and serves as the source of the target sequence (shown schematically as a double strand). The start nucleic acid chain comprises in the 5 ^' segment of the nucleic acid chain a segment 5 comprising sequence segments of the first primer oligonucleotide and limiting in the 5 ^' direction, a segment 6 comprising a target sequence or its moieties, a segment 7, what comprises a primer binding site for the second primer oligonucleotide and a segment 8 which locates a non-target sequence in the 3 ^' segment of the starting nucleic acid chain and thus flanks segment 7 on the 3 ^' side. In the context of the initiation of the amplification, the second primer can bind at least to the 3 ^' segment of its first region to such a starting nucleic acid chain in segment 7 and in the presence of a polymerase and nucleotides correspondingly up to the stop segment of the first primer oligonucleotide be extended. This results in a second primer extension product which is complementary to the template strand of the starting nucleic acid chain and is limited in its length. In the context of the amplification reaction, such a primer extension product can be detached from its template strand sequence-specific via the controller oligonucleotide so that corresponding sequence segments in the 3 ^' segment of the now synthesized second primer extension product are available as a binding site for the first primer oligonucleotide.

In this particular embodiment, a start nucleic acid chain comprises the following sequence fragments (Figure 51):

Sequence segment-5 (called segment 5) comprising a sequence having significant homology with the sequence of the first region of the first primer or being substantially identical to the copiable portion of the first region of the first primer. This segment-5 lies in the 5 ^' segment of the starting nucleic acid chain and is flanked by a non-copyable oligonucleotide tail (analogous to the first primer oligonucleotide), in particular this segment forms a boundary of the copiable nucleic acid chain strand in 5 ^' . Direction.

The sequence fragment-7 (called segment 7), which comprises a sequence which is suitable for the complementary binding of a second primer or its 3 ^' segment to form an extension-capable primer-template complex.

In particular, the segment 7 lies in the 3 'direction ("upstream") of the segment 5.

Target sequence which lies partially or completely between segment 5 and segment 7 (this portion of the target sequence is referred to as segment 6). In a particular embodiment, the target sequence comprises segment 6 and at least one of segment 5 and / or segment 7.

Optionally, the starting nucleic acid chain includes flanking 3 ^' segments

Sequence sections (designated segment 8) which are not amplified.

Function of the starting nucleic acid chain for the first amplification reaction

At the beginning of the amplification reaction, the starting nucleic acid chain serves as a template for the initial generation of respective primer extension products. It thus represents the starting template for the nucleic acid chain to be amplified. The starting nucleic acid chain does not necessarily have to be identical to the nucleic acid chain to be amplified. By binding and elongation of both primers during the amplification reaction determine in Essentially, the two primers, which sequences are generated at both terminal segments of the nucleic acid chain to be amplified in the context of the amplification.

In a particular embodiment of the process, non-denaturing reaction conditions are maintained for a duplex during the exponential amplification process. Therefore, it is advantageous if the starting nucleic acid chain has a restriction in its polymerase-extendable 5 ^' sequence segment, resulting in a stop in the enzymatic extension of a corresponding primer. This limits the length of the primer extension fragments generated under reaction conditions. This can have an advantageous effect on the strand displacement by the controller oligonucleotide and lead to a dissociation of the respective strand, so that primer binding sites are converted into the single-stranded state and thus become accessible for a recapture of primers.

Particular Embodiments of the First Primer Oligonucleotide (Primer-1)

The first primer oligonucleotide (primer-1) is a nucleic acid chain which includes at least the following regions (Figures 12-14):

A first primer region in the 3 ^' segment of the first primer oligonucleotide capable of substantially sequence-specific binding to a strand of nucleic acid chain to be amplified

A second region, coupled directly or via a linker, to the 5 ^' end of the first primer region of the first primer oligonucleotide comprising a polynucleotide tail capable of binding a controller oligonucleotide and promoting strand displacement (step c). by controller oligonucleotide, wherein the polynucleotide tail remains substantially single-stranded under reaction conditions, ie does not form a stable hairpin structure or ds-structures, and in particular is not copied by the polymerase.

The total length of the first primer oligonucleotide is between 10 and 80, more preferably between 15 and 50, more preferably between 20 and 30 nucleotides or their equivalents (e.g., nucleotide modifications). The structure of the first primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions. Furthermore, the structure of the first primer oligonucleotide is adapted to its primer function. Furthermore, the structure is adapted so that a strand displacement can be performed by means of controller oligonucleotide. Overall, structures of the first and second regions are matched to each other so that exponential amplification can be performed.

In an advantageous embodiment of the invention, the first and the second region of the primer are coupled in a conventional 5 ^' -3 ^' arrangement. In certain embodiments According to the invention, the coupling of both sections takes place via a 5 ^' -5 ^' bond, so that the second region has a reverse direction than the first region.

The coupling of areas between each other / each other is particularly covalent. In certain embodiments, the coupling between the first and second regions is a conventional DNA for ^{5'-3 ^{'-Phosphodiester}} coupling. In certain embodiments, it is a 5 ^{^'-5'} -Phosphodiester coupling. In certain embodiments, it is a 5 ^{^'-3'} - phosphodiester linkage, wherein between adjacent terminal nucleotides or nucleotide modifications of the two regions at least one linker (eg, a C3, C6, C12 or HEG linker or abasic modification) is positioned.

Individual regions may include different nucleotide modifications. In this case, individual elements of nucleotides can be modified: nucleobase and backbone (sugar content and / or phosphate content). Furthermore, modifications may be used which lack or are modified at least one component of the standard nucleotide building blocks, e.g. PNA.

In certain embodiments, a second portion of the first primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are located in particular at the 5 ^' end of the polynucleotide tail.

In certain embodiments, a first primer oligonucleotide may include characteristic label. Examples of such a label are dyes (e.g., FAM, TAMRA, Cy3, Alexa 488, etc.) or biotin or other groups which can be specifically bound, e.g. Digoxigenin.

The first primer region of the first primer oligonucleotide

The sequence length is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides, the sequence being predominantly complementary to the 3 ^' segment of a strand of the nucleic acid chain to be amplified. In particular, this primer region must be able to specifically bind to the complementary 3 ^' segment of a second primer extension product. This first area should be copied in reverse synthesis and also serves as a template for 2nd strand. The nucleotide building blocks are in particular linked to each other via conventional 5 ^'to ^3' Phosphodieser bond or Phosphothioester bond.

The first primer region preferably includes nucleotide monomers which do not or only insignificantly affect the function of the polymerase, for example:

• natural nucleotides (dA, dT, dC, dG etc.) or their modifications without altered base pairing

• Modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with deviant base pairing. In a particular embodiment, the 3 ^'OH end of this range in particular free of modifications and has a functional ^3' -OH group, that can be recognized by the polymerase. The first primer region serves as the initiator of the synthesis of the first primer extension product in the amplification. In a further particular embodiment, the first region comprises at least one phosphorothioate compound, so that no degradation of the 3 ^' end of the primer by 3 ^' exonuclease activity of polymerases can take place.

The sequence of the first region of the first primer oligonucleotide and the sequence of the second region of the controller oligonucleotide are in particular complementary to one another.

In certain embodiments, the first primer region or its 3 ^' segment can bind to sequence segments of a target sequence.

The second region of the first primer oligonucleotide

In particular, the second region of the first primer oligonucleotide is a nucleic acid sequence comprising at least one polynucleotide tail, which in particular remains uncoupled from the polymerase during the synthesis reaction and which is capable of binding to the first region of the controller oligonucleotide. The segment of the second region, which predominantly undergoes this binding with the controller oligonucleotide, may be referred to as the polynucleotide tail.

Furthermore, the second region of the first primer oligonucleotide must not only specifically bind the controller oligonucleotide under reaction conditions, but also participate in the process of strand displacement by means of controller oligonucleotide. The structure of the second region must therefore be suitable for bringing about spatial proximity between the controller oligonucleotide and the corresponding duplex end (in particular, the 3 ^' end of the second primer extension product).

The design of the structure of the second region of the first primer oligonucleotide is shown in more detail in several embodiments. In this case, the arrangement of the oligonucleotide segments and used modifications are taken into account, which lead to a stop in the polymerase-catalyzed synthesis.

The length of the second region is between 3 and 60, in particular between 5 and 40, in particular between 6 and 15 nucleotides or their equivalents.

The sequence of the second area may be chosen arbitrarily. In particular, it is not complementary with the nucleic acid to be amplified and / or with the second primer oligonucleotide and / or with the first region of the first primer oligonucleotide. Furthermore, it contains in particular no self-complementary segments, such as hairpins or Stemmloops.

The sequence of the second region is particularly matched to the sequence of the first region of the controller oligonucleotide, so that both sequences can bind under reaction conditions. In a particular embodiment, this bond is under Reaction conditions reversible: there is thus a balance between components bound together and unbound components.

The sequence of the second region of the first primer oligonucleotide is chosen in particular such that the number of complementary bases which can bind to the first region of the controller oligonucleotide is between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies.

The function of the second area is, inter alia, the binding of the controller oligonucleotide. In certain embodiments, this binding is particularly specific so that a second region of a first primer oligonucleotide can bind a specific controller oligonucleotide. In another embodiment, a second region may bind more than one controller oligonucleotide under reaction conditions.

There is generally no need for a perfect match in sequence between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide. The degree of complementarity between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%. The respective complementary regions may be positioned immediately adjacent to each other or may comprise non-complementary sequence segments therebetween.

The second region of the first primer oligonucleotide may, in certain embodiments, include at least one Tm modifying modification. By introducing such modifications, the stability of the binding between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide can be modified. For example, Tm enhancing modifications (nucleotide modifications or non-nucleotide modifications) may be used, such as LNA nucleotides, 2-amino adenosines, or MGB modifications. On the other hand, Tm-lowering modifications may also be used, such as inosine nucleotide. In the structure of the second region, linkers (e.g., C3, C6, HEG linkers) may also be integrated.

For strand displacement, the controller oligonucleotide must be placed in close proximity to the double-stranded end of the nucleic acid to be amplified. This double-stranded end consists of segments of the first primer region of the first primer extension product and a correspondingly complementary thereto 3 ^' segment of the second primer extension product.

The polynucleotide tail predominantly complements the controller oligonucleotide under reaction conditions, thereby causing a transient approach of the second region of the controller oligonucleotide and the first region of an extended primer. Extension product, so that a complementary bond between these elements can be initiated as part of a strand displacement process.

In certain embodiments, binding of the controller oligonucleotide to the polynucleotide tail of the first primer oligonucleotide immediately results in such contact. This means that the polynucleotide tail and the first primer region of the first primer oligonucleotide must be directly coupled to each other. Thanks to such an arrangement, after a binding of a controller oligonucleotide in its first region, contact can be made directly between complementary bases of the second region of the controller oligonucleotide and corresponding bases of the first primer region, so that strand displacement can be initiated.

In certain embodiments, structures of the second region of the first primer oligonucleotide are located between structures of the polynucleotide tail and the first primer region. After binding of a controller oligonucleotide to the polynucleotide tail, it is thus not positioned directly at the first primer region, but at a certain distance from it. The structures between the uncopiable polynucleotide tail and the copiable first primer region of the primer oligonucleotide can generate such a spacing. This distance has a value which is between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm.

Such structures are, for example, linkers (e.g., C3 or C6 or HEG linkers) or non-controller oligonucleotide complementary segments (e.g., in the form of non-complementary, non-copyable nucleotide modifications). The length of these structures can generally be measured in chain atoms. This length is between 1 and 200 atoms, in particular between 1 and 50 chain atoms, preferably between 1 and 10 chain atoms.

In order for the polynucleotide tail of polymerase to remain uncopyable under amplification conditions, the second region of the first primer oligonucleotide generally comprises sequence structures which cause the polymerase to stop in the synthesis of the second primer extension product after the polymerase releases the polymerase first primer area has been successfully copied. These structures are said to prevent copying of the polynucleotide tail of the second region. The polynucleotide tail thus remains uncoated, in particular, by the polymerase.

In certain embodiments, such structures are between the first primer region and the polynucleotide tail.

In certain embodiments, the sequence of the polynucleotide tail may include nucleotide modifications that result in the termination of the polymerase. Thus, a sequence segment of the second region of the first primer oligonucleotide may comprise both functions: it is both a polynucleotide tail and a polymerase-terminating sequence of nucleotide modifications. Modifications in the second region of the first primer oligonucleotide which result in a synthetic stop and thus leave the polynucleotide tail uncopyable are summarized in this application by the term "first blocking moiety or a stop region".

In the following, further embodiments of structures are given, which can lead to a stop in the synthesis of the second strand.

Several building blocks in oligonucleotide synthesis are known which prevent the polymerase from reading the template and lead to the termination of polymerase synthesis. For example, non-copyable nucleotide modifications or non-nucleotide modifications are known. There are also synthetic types / arrangements of nucleotide monomers within an oligonucleotide which result in the termination of the polymerase (eg, 5 ^'to 5 ^' or 3 ^'to 3 ^' ). Primer oligonucleotides with a non-copyable polynucleotide tail are also known in the art (eg Scorpion primer structures or primers for binding to the solid phase). Both primer variants describe primer oligonucleotide structures which are able to initiate the synthesis of a strand on the one hand so that a primer extension reaction can take place. The result is a first strand, which also integrates the primer structure with tail in the primer extension product. In the synthesis of a complementary strand to the first primer extension product, eg as part of a PCR reaction, the second strand is extended to the "blocking moiety / stop structure" of the primer structure. Both described primer structures are designed in such a way that the 5 ^' portion of the primer oligonucleotide remains single-stranded and is not copied by the polymerase.

In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail that has a conventional 5 ^' to 3 ^' array in its entire length and includes non-copyable nucleotide modifications. Such non-copyable nucleotide modifications include, for example, 2 ^{'-0-alkyl-RNA} modifications, PNA, morpholino. These modifications may be distributed differently in the second primer region.

The proportion of non-copyable nucleotide modifications may be between 20% and 100% in the polynucleotide tail, in particular more than 50% of the nucleotide building blocks. In particular, these nucleotide modifications are in the 3 ^' segment of the second region and thus adjacent to the first region of the first primer oligonucleotide.

In certain embodiments, the sequence of non-copyable nucleotide modifications is at least partially complementary to the sequence in the template strand such that primer binding to the template occurs involving at least a portion of these nucleotide modifications. In certain embodiments, the sequence of non-copyable nucleotide modifications is non-complementary to the sequence in the template strand.

The non-copyable nucleotide modifications are in particular covalently coupled to each other and thus represent a sequence segment in the second region. The length of this Segment comprises between 1 and 40, in particular between 1 and 20 nucleotide modifications, in particular between 3 and 10 nucleotide modifications.

In certain embodiments, the second region of the first primer oligonucleotide comprising a polynucleotide tail, which 'has and non-copyable nucleotide modifications include (for example ^2' in its entire length, a conventional arrangement of 5'-3 -0-alkyl modifications ) and at least one non-nucleotide linker (eg, C3, C6, HEG linker). A non-nucleotide linker has the function of covalently linking adjacent nucleotides or nucleotide modifications while at the same time site-specifically disrupting the synthesis function of the polymerase.

Such a non-nucleotide linker should not remove the structures of the polynucleotide tail and the first primer region too far apart. Rather, the polynucleotide tail should be in close proximity to the first primer region. A non-nucleotide linker is taken to mean modifications which do not have a length of more than 200 chain atoms, in particular not more than 50 chain atoms, in particular not more than 10 chain atoms. The minimum length of such a linker can be one atom. An example of such non-nucleotide linkers are straight or branched alkyl linkers with an alkyl chain which include at least one carbon atom, more preferably at least 2 to 30, especially 4 to 18. Such linkers are in oligonucleotide chemistry are well known (eg, C3, C6, or C12 linkers) and can be introduced during solid phase synthesis of oligonucleotides between the sequence of the polynucleotide tail and the sequence of the first region of the first primer oligonucleotide. Another example of such non-nucleotide linkers is linear or branched polyethylene glycol derivatives. A well-known example in oligonucleotide chemistry is hexaethylene glycol (HEG). Another example of such non-nucleotide linkers are abasic modifications (eg THF modification, as analog of d ribose).

If one or more such modifications are integrated into a second region, they can effectively interfere with a polymerase in its copying function during its synthesis of the second primer extension product, such that segments located in the 3 'direction remain uncopied after such modification. The number of such modifications in the second range can be between 1 and 100, in particular between 1 and 10, in particular between 1 and 3.

The position of such a non-nucleotide linker may be at the 3 ^' end of the second region, thus representing the transition to the first region and the second region of the primer oligonucleotide.

The location of the non-nucleotide linker in the middle segment of the second region may also be used. This divides a polynucleotide tail into at least two segments. In this embodiment, the 3 ^' segment of the polynucleotide tail includes at least one, in particular several, eg between 2 and 20, in particular between 2 and 10 non-limiting copyable nucleotide modifications. These non-copyable nucleotide modifications are in particular at the transition between the first and the second region of the primer oligonucleotide.

In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail having in its entire length an array of 5 ^'to 3 ^' - and at least one nucleotide monomer in a "reverse" array of 3 ^'to 5 ^'- includes and which are positioned at the transition between the first and the second region of the first primer oligonucleotide.

In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail, such polynucleotide tail consisting entirely of nucleotides which are directly adjacent to the first region of the first primer oligonucleotide in reverse order such that the coupling of the first and second nucleotides of the second area through 5 ^' - 5 ^' position. An advantage of such an arrangement is that after copying the first region, the polymerase encounters a "reverse" arrangement of nucleotides, which typically results in termination of the synthesis at that site.

In a "reverse" array of nucleotides in the total length of the polynucleotide tail, in particular, the 3 ^' -terminal nucleotide of the polynucleotide tail should be blocked at its 3 ^' OH end to prevent side reactions. Alternatively, a terminal nucleotide can be used which has no 3 ^' -OH group, for example a dideoxy nucleotide.

In such an embodiment, of course, the corresponding nucleotide arrangement is to be adapted in the controller oligonucleotide. In such a case, the first and the second portion of the controller oligonucleotide in 3 ^'to ^3' arrangement have to be linked.

In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail having a conventional 5 ^' to 3 ^' configuration in its entire length and including at least one nucleotide modification which is not a complementary nucleobase for the polymerase, when the synthesis is performed with all natural dNTP (dATP, dCTP, dGTP, dTTP or dUTP).

For example, iso-dG or iso-dC nucleotide modifications can be integrated as single, but in particular more (at least 2 to 20) nucleotide modifications in the second region of the first primer oligonucleotide. Further examples of nucleobase modifications are various modifications of the extended genetic alphabet. In particular, such nucleotide modifications do not support complementary base pairing with natural nucleotides such that a polymerase (at least theoretically) does not contain a nucleotide from the series (dATP, dCTP, dGTP, dTTP or dUTP). In reality, rudimentary incorporation may still occur, especially at higher concentrations of dNTP substrates and prolonged incubation times (eg, 60 minutes or longer). Therefore, preferably several such Nucleotide modifications positioned at adjacent sites are used. The stop of polymerase synthesis is effected by the lack of suitable complementary substrates for these modifications. Oligonucleotides with iso-dC or iso-dG can be synthesized by standard methods and are available from several commercial suppliers (eg Trilink Technologies, Eurogentec, Biomers GmbH). Optionally, the sequence of the first region of the controller oligonucleotide can also be adapted to the sequence of such a second primer region. In this case, complementary nucleobases of the extended genetic alphabet can be integrated into the first region of the controller oligonucleotide accordingly during the chemical synthesis. For example, iso-dG may be integrated in the second region of the first primer nucleotide, its complementary nucleotide (iso-dC-5-Me) may be placed at the appropriate location in the first region of the controller oligonucleotide.

In summary, the termination of the synthesis of polymerase in the second region can be achieved in various ways. However, this blockade preferably takes place only when the polymerase has copied the first region of the first primer oligonucleotide. This ensures that a second primer extension product has an appropriate primer binding site in its 3 ^' segment. This primer binding site is exposed as part of the strand displacement and is thus available for a new binding of another first primer oligonucleotide.

In the synthesis of the complementary strand to the first primer extension product, the primer extension reaction remains in front of the polynucleotide tail. Because this polynucleotide tail remains single stranded for interaction with the controller oligonucleotide and thus is available for binding, it promotes the initiation of the strand displacement reaction by the controller oligonucleotide by placing it in the immediate vicinity of the corresponding complementary segments of the controller oligonucleotide Near the matching duplex-end brings. The distance between the complementary part of the controller oligonucleotide (second region) and the complementary part of the extended primer oligonucleotide (first region) is thereby reduced to a minimum. Such spatial proximity facilitates the initiation of strand displacement.

In the context of a schematic representation of a nucleic acid-mediated strand displacement reaction, a complementary sequence of controller oligonucleotide is now in the immediate vicinity of the appropriate duplex end. This results in competition for binding to the first region of the first primer oligonucleotide between the strand of the controller oligonucleotide and the template strand complementary to the primer. By repetitive closure and formation of base pairing between the primer region and the complementary segment of the controller oligonucleotide (second region of the controller nucleotide) or the complementary segment of the template strand, the initiation of the nucleic acid-mediated strand displacement process occurs. Generally, the closer the corresponding complementary sequence portion of the controller oligonucleotide to the complementary segment of the primer region is, the higher the yield of initiation of rod displacement. By increasing this distance, however, the yield of the initiation of the strand displacement decreases.

In the context of the present invention, it is not absolutely necessary for the initiation of the strand displacement to work with maximum yield. Thus, distances between the 5 ^' segment of the first primer region of the first primer oligonucleotide, which binds to a complementary strand of the template and forms a complementary duplex, and a correspondingly complementary sequence segment in the controller oligonucleotide, when bound to polynucleotide Tail of the second region of the first primer oligonucleotide in the following ranges are: between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm. In this particular case, this distance is less than 1 nm. In other units, this distance corresponds to a distance of less than 200 atoms, in particular less than 50 atoms, in particular less than 10 atoms. In the special case, this distance is an atom. The distance information is for guidance only and illustrates that shorter distances between these structures are preferred. The measurement of this distance is in many cases only possible by analyzing the exact structures of oligonucleotides and measuring the measurement of sequence distances or of linker lengths.

The first primer may also include additional sequence segments that are not required to interact with the controller oligonucleotide or template strand. Such sequence segments may, for example, bind further oligonucleotides which are used as detection probes or immobilization partners when bound to the solid phase.

Primer function of the first primer oligonucleotide

The first primer oligonucleotide can be used in several partial steps. First and foremost, it performs a primer function in the amplification. The primer extension reaction is carried out using the second primer extension product as a template. In certain embodiments, the first primer oligonucleotide may use the starting nucleic acid chain as a template at the beginning of the amplification reaction. In certain embodiments, the first primer oligonucleotide may be used in the preparation / provision of a starting nucleic acid chain. In the context of amplification, the first primer serves as the initiator of the synthesis of the first primer extension product using the second primer extension product as a template. The 3 ^' segment of the first primer comprises a sequence which can bind predominantly complementary to the second primer extension product. Enzymatic extension of the first primer oligonucleotide using the second primer extension product as template results in formation of the first primer extension product. Such a first primer extension product comprises the target sequence or its sequence parts. In the course of the synthesis of the second primer Extension product, the sequence of the copyable portion of the first primer oligonucleotide is recognized by the polymerase as a template and a corresponding complementary sequence is synthesized, so that a corresponding primer binding site for the first primer oligonucleotide results. The synthesis of the first primer extension product occurs up to and including the 5 ^' segment of the second primer oligonucleotide. Immediately after the synthesis of the first primer extension product, this product is bound to the second primer extension product to form a double-stranded complex. The second primer extension product is displaced sequence-specifically from this complex by the controller oligonucleotide. The controller oligonucleotide binds to the first primer extension product. Again, following successful strand displacement by the controller oligonucleotide, the second primer extension product may itself serve as a template for the synthesis of the first primer extension product. The now vacated 3 ^' segment of the first primer extension product can bind another second primer oligonucleotide so that a new synthesis of the second primer extension product can be initiated.

Furthermore, the first primer oligonucleotide can serve as the initiator of the synthesis of the first primer extension product starting from the starting nucleic acid chain at the beginning of the amplification. In certain embodiments, the sequence of the first primer is completely complementary to the corresponding sequence segment of a starting nucleic acid chain. In certain embodiments, the sequence of the first primer oligonucleotide is only partially complementary to the corresponding sequence segment of a starting nucleic acid chain. However, this divergent complementarity is not intended to prevent the first primer oligonucleotide from starting a predominantly sequence-specific primer extension reaction. The respective differences in complementarity of the first primer oligonucleotide to the respective position in the starting nucleic acid chain are in particular in the 5 ^' segment of the first region of the first primer oligonucleotide, so that in the 3 ^' segment predominantly complementary base pairing and initiation of the synthesis is possible , For the initiation of the synthesis, for example, especially the first 4-10 positions in the 3 ^' segment should be fully complementary to the template (starting nucleic acid chain). The remaining nucleotide positions may differ from a perfect complementarity. Thus, the extent of perfect complementarity in the remaining 5 ^' segment of the first region of the first primer oligonucleotide can range between 50% to 100%, more preferably between 80% and 100%, of the base composition. Depending on the length of the first region of the first primer oligonucleotide, comprising the sequence deviations from 1 to a maximum of 15 positions, in particular 1 to a maximum of 5 positions. The first primer oligonucleotide may thus initiate synthesis of a starting nucleic acid chain. In a subsequent synthesis of the second primer extension product, replicable sequence segments of the first primer oligonucleotide are copied from the polymerase such that, in subsequent synthesis cycles, a fully complementary primer binding site within the second primer extension product for binding of the first Primer oligonucleotide is formed and is available in subsequent synthesis cycles.

In certain embodiments, the first primer oligonucleotide may be used in the preparation of a starting nucleic acid chain. In this case, such a first primer oligonucleotide can bind to a nucleic acid (for example a single-stranded genomic DNA or RNA or its equivalents comprising a target sequence) predominantly sequence-specific and initiate a template-dependent primer extension reaction in the presence of a polymerase. The binding position is chosen such that the primer extension product comprises a desired target sequence. The extension of the first primer oligonucleotide results in a nucleic acid strand which has a sequence complementary to the template. Such a strand can be detached from the template (eg by heat or alkali) and thus converted into a single-stranded form. Such a single-stranded nucleic acid chain can serve as a starting nucleic acid chain at the beginning of the amplification. Such a start nucleic acid chain comprises in its 5 ^' segment the sequence portions of the first primer oligonucleotide, furthermore it comprises a target sequence or its equivalents and a primer binding site for the second primer oligonucleotide. Further steps are explained in the section "Starting nucleic acid chain".

The synthesis of the first primer extension product is a primer extension reaction and forms a partial step in the amplification. The reaction conditions during this step are adjusted accordingly. The reaction temperature and the reaction time are chosen so that the reaction can take place successfully. The particular preferred temperature in this step depends on the polymerase used and the binding strength of the respective first primer oligonucleotide to its primer binding site and includes, for example, ranges from 15 ° C to 75 ° C, especially from 20 to 65 ° C, in particular from 25 ° C to 65 ° C. The concentration of the first primer oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.

In certain embodiments, all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / by-products. Such conditions include, for example, higher temperatures, in particular above 50 ° C.

If more than one specific nucleic acid chain has to be amplified in one batch, in certain embodiments, sequence-specific primer oligonucleotides are preferably used in each case for the amplification of corresponding respective target sequences.

In particular, sequences of the first, second primer oligonucleotide and the controller oligonucleotide are matched to one another such that side reactions, eg primer-dimer formation, are minimized. For this purpose, for example, the sequence of the first and second primer oligonucleotides are adapted to one another such that both primer oligonucleotides are incapable of undergoing an amplification reaction in the absence of one suitable template and / or a target sequence and / or a start nucleic acid chain to start or support. This can be achieved, for example, in that the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide. Furthermore, it should be avoided that the primer sequences comprise extended self-complementary structures (self-complement).

In certain embodiments, the synthesis of the first and second primer extension products proceeds at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products proceeds at different temperatures. In certain embodiments, synthesis of the first primer extension product and strand displacement by controller oligonucleotide proceeds at the same temperature. In certain embodiments, synthesis of the first primer extension product and strand displacement by controller oligonucleotide proceeds at different temperatures.

Particular embodiments of the controller oligonucleotide

A controller oligonucleotide (Figures 19-26) comprises:

A first single-stranded region which can bind to the polynucleotide tail of the second region of the first primer oligonucleotide,

A second single-stranded region which can bind to the first region of the first primer oligonucleotide essentially complementary,

A third single-stranded region which is substantially complementary to at least one segment of the extension product of the first primer extension product,

and the controller oligonucleotide does not serve as a template for primer extension of the first or second primer oligonucleotide.

In general, the sequence of the third region of the controller oligonucleotide is adapted to the sequence of the nucleic acid to be amplified, since this is a template for the order of the nucleotides in the extension product of a first primer. The sequence of the second region of the controller oligonucleotide is adapted to the sequence of the first primer region. The structure of the first region of the controller oligonucleotide is adapted to the sequence of the second region of the first primer oligonucleotide, especially the nature of the polynucleotide tail.

A controller oligonucleotide may also include other sequence segments that do not belong to the first, second or third region. For example, these sequences can be attached as flanking sequences at the 3 ^' and 5 ^' ends. In particular, these sequence segments do not interfere with the function of the controller oligonucleotide. The structure of the controller oligonucleotide has in particular the following properties:

The individual areas are covalently bonded to each other. The binding can be done for example via conventional 5 ^' -3 ^' bond. For example, a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.

A controller oligonucleotide may bind by its first region to the polynucleotide tail of the first primer oligonucleotide, which binding is mediated primarily by hybridization of complementary bases. The length of this first region is 3 to 80 nucleotides, in particular 4 to 40 nucleotides, in particular 6 to 20 nucleotides. The degree of sequence match between the sequence of the first region of the controller oligonucleotide and the sequence of the second region of the first primer oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%. In particular, binding of the first region of the controller oligonucleotide should be specific to the second region of the first primer oligonucleotide under reaction conditions.

The sequence of the first region of the controller oligonucleotide is chosen in particular such that the number of complementary bases that can bind to the second region of the first primer oligonucleotide complementary between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies.

Since the controller oligonucleotide is not a template for the polymerase, it may include nucleotide modifications that do not support polymerase function, which may be both base modifications and / or sugar-phosphate backbone modifications. The controller oligonucleotide may include, for example, in its first region, nucleotides and / or nucleotide modifications selected from the following list: DNA, RNA, LNA ("locked nucleic acids" analogues having 2 ^' -4 ^' bridge linkage in the sugar moiety), UNA ( "unlocked Nucleic acids" without binding between 2 ^{^'-3'} -atoms of the sugar moiety), PNA ( "peptide nucleic acids" analogs), PTO (phosphorothioate), morpholino analogs, 2 ^{'-0-alkyl-RNA} modifications ( such as 2 ^'-OMe, ^2' -0 propargyl, 2 ^'-0- (2-methoxyethyl), ^2' -0-propyl-amine), 2 - halogen-RNA, 2 ^'-amino-RNA, etc. These nucleotides or Nucleotide modifications are linked together, for example, by conventional 5 ^' -3 ^' bonding or 5 ^' -2 ^' bonding. For example, a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.

The controller oligonucleotide may include nucleotides and / or nucleotide modifications in its first region, the nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and its analogues, iso-guanines and its analogues. The controller oligonucleotide may include in its first region non-nucleotide compounds selected from the following list: Intercalators that may affect the binding strength between the controller oligonucleotide and the first primer oligonucleotide, eg, MGB, naphthalene, etc. Like elements can also be used in the second region of the first primer.

The controller oligonucleotide may include in its first region non-nucleotide compounds, e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.

The controller oligonucleotide may bind by means of its second region to the first primer region of the first primer oligonucleotide, the binding being mediated essentially by hybridization of complementary bases.

The length of the second region of the controller oligonucleotide is matched to the length of the first region of the first primer oligonucleotide and is consistent with this in particular. It is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides. The sequence of the second region of controller oligonucleotide is in particular complementary to the first region of the first primer oligonucleotide. The degree of agreement in complementarity is between 80% and 100%, in particular between 95% and 100%, in particular at 100%. The second portion of controller oligonucleotide specifically includes nucleotide modifications of one, which hinder the polymerase in extension of the first primer oligonucleotide, but do not block the formation of complementary double strands, or not substantially prevent, for example, 2 ^'-0-alkyl RNA analogs ( for example, 2 ^'-0- Me, ^2' -0- (2-methoxyethyl), 2 ^'-0-propyl, ^2' -0-propargyl nucleotide modifications), LNA, PNA or morpholino nucleotide modifications. In particular, individual nucleotide monomers are linked via 5 ^' -3 ^' linkage, but the alternative 5 ^' -2 ^' linkage between nucleotide monomers can also be used.

The sequence length and nature of the first and second regions of the controller oligonucleotide are particularly chosen such that the binding of these regions to the first primer oligonucleotide is reversible under reaction conditions, at least in one reaction step of the process. This means that although the controller oligonucleotide and the first primer oligonucleotide can specifically bind to one another, this bond should not lead to the formation of a complex of both elements that is permanently stable under reaction conditions.

Rather, an equilibrium between a bound complex form of controller oligonucleotide and the first primer oligonucleotide and a free form of individual components under reaction conditions should be sought or made possible at least in one reaction step. This ensures that at least a portion of the first primer oligonucleotides can be in free form under reaction conditions and can interact with the template to initiate a primer extension reaction. On the other hand, it will ensure that corresponding sequence regions of the controller oligonucleotide are available for binding with an extended primer oligonucleotide.

By choosing the temperature during the reaction, the proportion of free, single-stranded and thus reactive components can be influenced: by lowering the temperature, first primer oligonucleotides bind to the controller oligonucleotides, so that both participants bind a complementary double-stranded complex. Thus, the concentration of single-stranded forms of individual components can be lowered. An increase in temperature can lead to the dissociation of both components into the single-stranded form. In the region of the melting temperature of the complex (controller oligonucleotide / first primer oligonucleotide), about 50% of the components are present in single-stranded form and about 50% as a double-stranded complex. By using appropriate temperatures, the concentration of single-stranded forms in the reaction mixture can thus be influenced.

In embodiments of the amplification process comprising temperature changes between individual reaction steps, desired reaction conditions can be brought about during corresponding reaction steps. For example, by using temperature ranges approximately at the level of melting temperature of complexes of controller oligonucleotide / first primer oligonucleotide shares of each free forms of individual components can be influenced. In this case, the temperature used destabilizes complexes comprising controller oligonucleotide / first primer oligonucleotide, so that during this reaction step individual complex components are at least temporarily single-stranded and thus able to interact with other reactants. For example, a first sequence region of the controller oligonucleotide may be released from the double-stranded complex with a non-extended first primer, and thus may interact with the second sequence region of an extended first primer oligonucleotide, thereby initiating strand displacement. On the other hand, release of a first, non-extended primer oligonucleotide from a complex comprising controller oligonucleotide / first primer oligonucleotide results in the first primer region becoming single-stranded and thus capable of interacting with the template such that primer extension by a polymerase can be initiated.

The temperature used does not have to correspond exactly to the melting temperature of the complex of controller oligonucleotide / first primer oligonucleotide. It is sufficient if the temperature is used in a reaction step, for example in the range of the melting temperature. For example, the temperature in one of the reaction steps comprises ranges of Tm +/- 10 ° C, in particular Tm +/- 5 ° C, in particular Tm +/- 3 ° C of the complex of controller oligonucleotide / first primer oligonucleotide.

Such a temperature can be set, for example, in the context of the reaction step, which comprises a sequence-specific strand displacement by the controller oligonucleotide. In embodiments of the amplification process which do not involve temperature cycling between individual reaction steps and where the amplification proceeds under isothermal conditions, reaction conditions are maintained over the entire duration of the amplification reaction in which there is equilibrium between a complex of controller oligonucleotide and the first Primer oligonucleotide and a free form of individual components is possible.

The ratio between a complex form of controller oligonucleotide and the first primer oligonucleotide and free forms of individual components can be influenced both by reaction conditions (eg temperature and Mg ²⁺ concentration) and by structures and concentrations of individual components.

The sequence length and nature of the first and second regions of the controller oligonucleotide are, in certain embodiments, chosen such that the ratio between a proportion of a free controller oligonucleotide is given under given reaction conditions (eg in the step of strand displacement by the controller oligonucleotide) and a portion of a controller oligonucleotide complexed with a first primer oligonucleotide comprises the following ranges: from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, more preferably from 1:10 to 10: 1. The ratio between a proportion of a free first primer oligonucleotide and a proportion of a first primer oligonucleotide in complex with a controller oligonucleotide comprises ranges from 1: 100 to 100: 1, in particular from 1: 30 to 30: 1, in particular from 1 : 10 to 10: 1.

In certain embodiments, the concentration of the first primer oligonucleotide is higher than the concentration of the controller oligonucleotide. As a result, there is an excess of the first primer in the reaction and the controller oligonucleotide must be released for its effect of binding with the first primer by choosing a corresponding reaction temperature. In general, this is done by raising the temperature to sufficient levels of free forms of the controller oligonucleotide.

In certain embodiments, the concentration of the first primer oligonucleotide is lower than the concentration of the controller oligonucleotide. As a result, there is an excess of the controller oligonucleotide and the first primer oligonucleotide must be released for its effect of binding to the controller oligonucleotide by choosing an appropriate reaction temperature. In general, this is achieved by an increase in temperature, to sufficient concentrations of free forms of the first primer oligonucleotide.

In isothermal conditions, there is an equilibrium: certain portions of the first primer oligonucleotide and the controller oligonucleotide are bound together, while others are present as a single-stranded form in the reaction. The controller oligonucleotide may bind by means of its third region to at least one segment of the specifically synthesized extension product of the first primer oligonucleotide (Figures 13 to 35). Binding is preferably by hybridization of complementary bases between the controller oligonucleotide and the extension product synthesized by the polymerase.

To support the strand displacement reaction, the sequence of the third region should in particular have a high complementarity to the extension product. In certain embodiments, the sequence of the third region is 100% complementary to the extension product.

The binding of the third region takes place in particular on the segment of the extension product which directly adjoins the first region of the first primer oligonucleotide. Thus, in particular, the segment of the extension product lies in the 5 ^' segment of the entire extension product of the first primer oligonucleotide.

In particular, the binding of the third region of the controller oligonucleotide does not occur over the entire length of the extension product of the first primer oligonucleotide. In particular, a segment remains unbound at the 3 ^' end of the extension product. This 3 ^' -terminal segment is necessary for the binding of the second primer oligonucleotide.

The length of the third region is adjusted to such an extent that the third region firstly binds to the 5 ^' -terminal segment of the extension product, but on the other hand does not bind the 3 ^' continuous segment of the extension product.

The total length of the third region of the controller oligonucleotide is from 2 to 100, in particular from 6 to 60, in particular from 10 to 40 nucleotides or their equivalents. The controller oligonucleotide may enter into a complementary bond with the segment of the extension product over that length, thereby displacing this 5 ^' segment of the extension product from binding with its complementary template strand.

The length of the 3 ^' -terminal segment of the extension product which is not bound by the controller oligonucleotide comprises, for example, ranges between 5 and 100 nucleotides, in particular 5 and 60 nucleotides, in particular between 10 and 40, in particular between 15 and 30 nucleotides.

This 3 ^' segment of the extension product is not displaced from the controller oligonucleotide from binding with the template strand. Even with the third region of the controller oligonucleotide fully bound to its complementary segment of the extension product, the first primer extension product may remain bound to the template strand via its 3 ^' -terminal segment. The bond strength of this complex is chosen in particular such that it can dissociate spontaneously under reaction conditions (step e), for example. This can be achieved, for example, by the melting temperature of this complex being selected from the 3 ^' -terminal segment of the extension product of the first primer. Oligonucleotide and its template strand is approximately in the range of the reaction temperature or below the reaction temperature in a corresponding reaction step (reaction step e). With little stability of this complex in the 3 ^' segment of the extension product, complete binding of the third region of the controller oligonucleotide to the 5 ^' segment of the extension product results in rapid dissociation of the first primer extension product from its template strand.

The controller oligonucleotide as a whole has a suitable structure to perform its function: under appropriate reaction conditions, it is capable of sequence-specific displacement of the extended first primer oligonucleotide from binding with the template strand, thereby converting the template strand into single-stranded form, and thus for further binding with a novel first primer oligonucleotide and its target sequence-specific extension by the polymerase.

To fulfill the function of strand displacement, regions one, two and three of the controller oligonucleotide should be predominantly in single-stranded form under reaction conditions. Therefore, double-stranded self-complementary structures (e.g., hairpins) in these regions should be avoided as much as possible since they may degrade the functionality of the controller oligonucleotide.

The controller oligonucleotide should not appear as a template in the method of the invention, therefore the first primer oligonucleotide, when attached to the controller oligonucleotide under reaction conditions, should not be extended by the polymerase.

This is achieved in particular by using nucleotide modifications which prevent the polymerase from copying the strand. In particular, the 3 ^' end of the first primer oligonucleotide does not remain elongated when the first primer oligonucleotide binds to the controller oligonucleotide under reaction conditions.

The degree of blockage / inhibition / slowing / aggravation of the reaction may be between complete expression of this property (e.g., 100% blockage under given reaction conditions) and a partial expression of this property (e.g., 30-90% blockade under given reaction conditions). Preference is given to nucleotide modifications which individually or in a series coupled to each other (eg as a sequence fragment consisting of modified nucleotides) more than 70%, in particular more than 90%, in particular more than 95%, and in particular to 100% the extension of a first primer can prevent.

The nucleotide modifications may include base modifications and / or sugar-phosphate-residue modifications. The sugar-phosphate modifications are preferred because any complementary sequence of a controller oligonucleotide can be assembled by combining with conventional nucleobases. The nucleotides with modifications in the sugar-phosphate residue, which can lead to hindrance or blockage of the synthesis of the polymerase include, for example: 2 ^'-0-alkyl modifications (eg, ^2' -0-methyl, 2 ^'-0- (2- Methoxyethyl), 2 ^'-0-propyl, ^2' -0-propargyl nucleotide modifications), 2 ^{^'-amino-2'} -Deoxy- nucleotide modifications, 2 ^{^{'amino-alkyl-2'}} -deoxy-nucleotide modifications , PNA, morpholino modifications, etc.

The blockade can be accomplished by either a single nucleotide modification or only by coupling multiple nucleotide modifications in series (e.g., as a sequence fragment consisting of modified nucleotides). For example, at least 2, in particular at least 5, in particular at least 10, of such nucleotide modifications can be coupled side by side in the controller oligonucleotide.

A controller oligonucleotide may comprise a uniform type of nucleotide modifications or may comprise at least two different types of nucleotide modification.

In particular, the location of such nucleotide modifications in the controller oligonucleotide is intended to prevent the polymerase from extending the 3 ^' end of a first primer oligonucleotide bound to the controller oligonucleotide.

In certain embodiments, such nucleotide modifications are located in the second region of the controller oligonucleotide. In certain embodiments, such nucleotide modifications are located in the third region of the controller oligonucleotide. In certain embodiments, such nucleotide modifications are located in the second and third regions of the controller oligonucleotide.

For example, the second region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%.

For example, the third region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%, in particular at least 90%. In certain embodiments, the entire third region comprises nucleotide modifications that prevent a polymerase from extending a primer bound to such a region using the controller oligonucleotide as a template. In certain embodiments, the entire third and second regions include such nucleotide modifications. In certain embodiments, the entire first, second, and third regions include such nucleotide modifications. Thus, the controller oligonucleotide may consist entirely of such nucleotide modifications. Such modified controller oligonucleotides can be used, for example, in multiplex analyzes in which further primers are used. This is to prevent inadvertent primer extension reactions on one or more controller oligonucleotides.

The sequence of nucleobases from these nucleotide modifications is adapted to the requirements of the sequence in each area.

For example, the remaining portion can be made up of natural nucleotides, or nucleotide modifications which do not or only insignificantly prevent the polymerase function, for example DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides. In this case, further modifications, for example base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or non-nucleotide modifications such as dyes, or MGB modifications, etc. can be used, for example, to match binding strengths of individual regions of the controller oligonucleotides. The individual nucleotide monomers can be coupled to each other via conventional 5 ^' -3 ^' bond or else via 5 ^' -2 ^' bond.

A segment of the oligonucleotide controller nucleotide modification which prevents extension of the 3 ^' end of a first primer oligonucleotide bound to the controller oligonucleotide by the polymerase is termed a "second blocking moiety". The length of this segment may include between 1 to 50 nuclide modifications, especially between 4 and 30. For example, this segment may be located in the controller oligonucleotide such that the 3 ^' end of the bound first primer oligonucleotide is in this segment. Thus, this segment can span regions two and three.

In particular embodiments, in particular, no linker structures or spacer structures such as C3, C6, HEG linkers are used to prevent the extension of the 3 ^' end of a first primer oligonucleotide bound to the controller oligonucleotide.

In certain embodiments, a controller oligonucleotide in its third region comprises at least one component of the detection system (eg, fluorescent reporter or fluorescent quencher or a donor fluorophore). The position of this component is in certain embodiments at the 5 ^' end of the controller oligonucleotide. In another embodiment, this component is in the inner sequence segment of the third region. The distance up to the 5 ^' end of the controller oligonucleotide may be between 2 to 50 nucleotides, in particular between 2 and 20, in particular between 2 and 10 nucleotides. With a simultaneous binding of the oligonucleotide probe and the controller oligonucleotide on the same first primer extension product, there is a spatial proximity of the two components of the detection system (eg between a fluorescent reporter on the oligonucleotide probe and a donor fluorophore on the controller oligonucleotide).

The controller oligonucleotide may comprise, in addition to regions one, two and three, further sequence segments which, for example, flank the abovementioned regions in the 5 ^' segment or 3 ^' segment of the controller oligonucleotide. Such sequence elements can be used, for example, for other functions, such as, for example, interaction with probes, binding to solid phase, etc. In particular, such regions do not disturb the function of regions one to three. The length of these flanking sequences may be, for example, between 1 to 50 nucleotides. Furthermore, a controller oligonucleotide may comprise at least one element for immobilization on a solid phase, eg a biotin residue. Farther For example, a controller oligonucleotide may include at least one element for detection, eg, a fluorine dye.

In the presence of a controller oligonucleotide, newly synthesized sequences are checked for their sequence contents by interaction with the controller oligonucleotide.

• If the sequence oligonucleotide is correctly matched to the sequence oligonucleotide, strand displacement occurs, with the template strands being replaced by newly synthesized strands. Here, primer binding sites are transformed into the single-stranded state and are available for a new interaction with primers and thus for further synthesis. Thus, the system of both primer extension products is placed in an active state. The controller oligonucleotide thus has an activating effect on the system.

• If there is no match with given sequence contents of the controller oligonucleotide, strand displacement of the template strands is affected by newly synthesized strands. The strand displacement and / or separation is either slowed down quantitatively or completely eliminated. It is thus not at all or less often the transfer of primer binding sites in the single-stranded state. Thus, there are no or only few primer binding sites available for a new interaction with primers. Thus, the system of both primer extension products is rarely put into an active state or an active state is not reached.

The efficiency of the double-stranded opening of the newly synthesized primer extension products after each individual synthesis step affects the potentially achievable yields in subsequent cycles: the fewer free / single-stranded primer binding sites of a nucleic acid chain to be amplified at the beginning of a synthesis step The lower the number of newly synthesized strands of the nucleic acid chain to be amplified in this step. In other words, the yield of a synthesis cycle is proportional to the amount of primer binding sites available for interaction with corresponding complementary primers. Overall, this can be realized a control circuit.

This control circuit corresponds to a real-time / on-line control of synthesized fragments: Sequence control takes place in the reaction mixture while the amplification takes place. This sequence control follows a predetermined pattern and the oligonucleotide system (by the strand-opening action of the controller oligonucleotide) can distinguish between "correct" and "non-correct" states without external interference. In the correct state, the synthesis of sequences is continued; in the incorrect state, the synthesis is either slowed down or completely prevented. The resulting differences in yields of "correct" and "incorrect" sequences after each step affect the entire amplification comprising a variety of such steps. In exponential amplification, this dependence is exponential so that even slight differences in efficiency in a single synthesis cycle due to the sequence differences may signify a significant time delay in total amplification, or cause the complete absence of detectable amplification in a given time frame.

This effect of real-time control of the newly synthesized nucleic acid chains is associated with the use of the controller oligonucleotide and the effect of the controller oligonucleotide in the context of an amplification is thus significantly beyond the length of the primer oligonucleotides spanning area.

Reaction conditions in strand displacement reaction

The displacement of the second primer extension product from binding with the first primer extension product by means of a sequence-dependent strand displacement by the controller oligonucleotide forms a partial step in the amplification. The reaction conditions during this step are adjusted accordingly. The reaction temperature and the reaction time are chosen so that the reaction can take place successfully.

In a particular embodiment, strand displacement by the controller oligonucleotide proceeds until binding / dissociation of the second primer extension product from binding with the first primer extension product. Such dissociation of the 3 ^' segment of the first primer extension product from complementary portions of the second primer extension product may occur spontaneously as part of a temperature-dependent / temperature-related separation of both primer extension products. Such dissociation has a favorable effect on the kinetics of the amplification reaction and can be influenced by the choice of reaction conditions, for example by means of temperature conditions. The temperature conditions are therefore chosen such that successful strand displacement by complementary binding of the controller oligonucleotide favors dissociation of the second primer extension product from the 3 ^' segment of the first primer extension product.

This embodiment is not a "classical" PCR, but the thermally induced dissociation of the 3 'segment runs in temperature ranges well below the typical strand separation inducing reactions of> 90 ° C of classical PCR.

In a further particular embodiment, the strand displacement by the controller oligonucleotide proceeds until the detachment / dissociation of a 3 ^' segment of the second primer extension product (P2.1 -Ext) from the complementary binding with the first primer extension product (P1 .1- Ext), wherein this 3 ^' segment of the second primer extension product (P2.1 -Ext) comprises at least a complementary region to the first primer and a complementary segment to the first primer extension product (P1 .1-Ext), which is only in the enzymatic synthesis originated. It comes to training of a complex (C 1 .1 / P1.1-Ext / P2.1.-Ext) (Figure 2B) containing both the first primer extension product (P1.1-Ext), the second primer extension product (P2. 1-Ext) and the controller oligonucleotide (C1.1). In such a complex, the 3 ^' segment of the second primer extension product is at least transiently single-stranded since it can be displaced from the controller oligonucleotide from its binding with the first primer extension product. Schematically, there is a balance between binding and detachment of the P2.1-Ext to the P1.1-Ext. The 3 ^' segment of the first primer extension product (P1 .1-Ext) is complementary to such a complex hybridized to the second primer extension product (P2.1-Ext) (Figure 2B).

Due to a partially open primer binding site for the first primer oligonucleotide (3 ^' segment of the second primer extension product), a new primer oligonucleotide can be linked to its primer binding site of this single stranded sequence segment of the complexed (P2.1 -ext) bind under reaction conditions and thus initiate a synthesis of a new first primer extension product (P1.2-Ext) by a polymerase. As a rule, this reaction proceeds at a reduced rate, since the 3 ^' segment of the P2.1 -Ext is not permanently single-stranded, but is in competitive behavior with the controller oligonucleotide and thus alternately single-stranded and double-stranded states by binding to the P1 1 - Ext.

Continuation of this newly started synthesis of P1 2-Ext using the second primer extension product as template (P2.1 -Ext) can also be induced by polymerase-induced strand displacement to dissociate the complex (C1.1 / P1 1-Ext / P2.1. -Ext) lead. In this case, act controller oligonucleotide, temperature-dependent double strand destabilization and strand displacement by the polymerase synergistic and complementary. This results in a dissociation of the 3 ^' segment of the first primer extension product (P1.1 -Ext) from complementary portions of the second primer extension product (P2.1-Ext).

Such dissociation has a favorable effect on the kinetics of the amplification reaction and may be influenced by the choice of reaction conditions, e.g. by means of temperature conditions. The involvement of the polymerase-mediated synthesis-dependent strand displacement in the dissociation of P1.1 -Ext and P2.1 -Ext has a favorable effect on strand separation.

The temperature in this step includes, for example, ranges from 15 ° C to 75 ° C, especially from 30 ° C to 70 ° C, especially from 50 ° C to 70 ° C.

Given the length of the first region of the controller oligonucleotide and the second region of the first primer oligonucleotide (including, for example, ranges of from 3 to 25 nucleotide monomers, more preferably from 5 to 15 nucleotide monomers), a strand displacement reaction can generally be successfully initiated. With complete complementarity of the controller oligonucleotide to corresponding portions of the first primer extension product, the controller oligonucleotide may be attached to the first primer. Extend extension product to the 3 ^' segment of the first primer extension product and displace the second primer extension product. The second primer extension product thus remains in association with the 3 ^' segment of the first primer extension product. This strength of this compound can be influenced by temperature. Upon reaching a critical temperature, this compound can decay and dissociate both primer extension products. The shorter the sequence of the 3 ^' segment, the more unstable this compound and the lower the temperature which causes spontaneous dissociation.

A spontaneous Dissozialtion can be achieved for example in the temperature range, which is approximately at the melting temperature. In certain embodiments, the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 3 ° C) of the complex comprising the 3 ^' segment of the first primer extension product that is not bound by controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.

In certain embodiments, the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 5 ° C) of the complex comprising the 3 ^' segment of the first primer extension product that is not bound by the controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.

In certain embodiments, the temperature of the steps of strand displacement by the controller oligonucleotide is above the melting temperature of the complex comprising the 3 ^' segment of the first primer extension product that is not bound by the controller oligonucleotide and the second primer oligonucleotide second primer extension product. Such a temperature includes temperature ranges from about Tm + 5 ° C to Tm + 20 ° C, especially from Tm + 5 ° C to Tm + 10 ° C. By using a higher temperature, the equilibrium in this reaction step can be shifted towards dissociation. As a result, the kinetics of the reaction can be favorably influenced. Use of too low temperatures in the strand displacement step by controller oligonucleotide can result in a significant slowing of the amplification.

In certain embodiments, a first primer extension product comprises a 3 ^' segment which is not bound by the controller oligonucleotide, and which

Sequence lengths of 4 to 6, preferably 7 to 8, in particular from 9 to about 18 nucleotides.

In this embodiment, a spontaneous dissociation is usually already achieved at temperature ranges between 40 ° C and 65 ° C. Higher temperatures also lead to dissociation.

Sequence lengths from 15 to about 25 nucleotides. In this embodiment, a spontaneous dissociation usually already be achieved at temperature ranges between 50 ° C and 70 ° C. Higher temperatures also lead to dissociation.

In certain embodiments, a first primer extension product comprises a 3 ^' segment that is not bound by the controller oligonucleotide and that has sequence lengths of from 20 to about 40 nucleotides. In this embodiment, a spontaneous dissociation usually already at temperature ranges between 50 ° C and 75 ° C can be achieved. Higher temperatures also lead to dissociation.

The composition of the 3 ^' segment of the first primer extension product and optionally an introduction of melting temperature-influencing oligonucleotide modifications (eg MGB) or reaction conditions (eg TPAC, betaine)) can influence the choice of temperature. An appropriate adaptation can therefore be made.

In certain embodiments, all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / by-products. Such conditions include, for example, higher temperatures, for example above 50 ° C.

In certain embodiments, the single steps of strand displacement by controller oligonucleotides proceed at the same temperature as the synthesis of the first and second primer extension products. In certain embodiments, the individual steps of strand displacement by controller oligonucleotides occur at temperature that differs from the temperature of the respective synthesis of the first and second primer extension products. In certain embodiments, synthesis of the first primer extension product and strand displacement by controller oligonucleotide proceeds at the same temperature. In certain embodiments, synthesis of the second primer extension product and strand displacement by controller oligonucleotide proceeds at the same temperature.

The concentration of the controller oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.

Particular Embodiments of the Second Primer Oligonucleotide (Primer-2):

An oligonucleotide capable of binding with its 3 ^' segment to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified and initiating a specific second primer extension reaction (Figs. 14, 27 to 29, 55, 68 to 71). This second primer oligonucleotide is thus capable of binding to the 3 ^' segment of a first specific primer extension product of the first primer oligonucleotide and initiating polymerase-dependent synthesis of a second primer extension product. In certain embodiments, every second primer oligonucleotide is specific for each nucleic acid to be amplified. The second primer oligonucleotide should be able to be copied in the reverse synthesis and also serves as a template for the synthesis of the first primer extension product.

The length of the second primer oligonucleotide can be between 15 and 100 nucleotides, in particular between 20 and 60 nucleotides, in particular between 30 and 50 nucleotides. The nucleotide building blocks are in particular linked to each other via conventional ^{5'-3 ^'bond} or Phosphodieser- Phosphothioester bond. Such a primer oligonucleotide can be chemically synthesized in the desired form.

In certain embodiments, the second primer oligonucleotide may include nucleotide monomers that do not or only slightly affect the function of the polymerase, including, for example:

Modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with aberrant base pairing (e.g., universal base pairs such as inosine 5-nitroindole).

In a particular embodiment, the 3 ^'OH end of this range in particular free of modifications and has a functional ^3' -OH group, that can be recognized by the polymerase, and matrizenabhänig extended. In a further particular embodiment, the 3 ^' segment of the second primer comprises at least one phosphorothioate compound such that no degradation from the 3 ^' end of the primer by the 3 ^' exonuclease activity of polymerases can occur.

The second primer oligonucleotide can be used in several partial steps. First and foremost, it performs a primer function in the amplification. The primer extension reaction is carried out using the first primer extension product as a template. In certain embodiments, the second primer oligonucleotide may use the starting nucleic acid chain as a template at the beginning of the amplification reaction. In certain embodiments, the second primer oligonucleotide may be used in the preparation / provision of a starting nucleic acid chain.

In the context of amplification, the second primer serves as the initiator of the synthesis of the second primer extension product using the first primer extension product as template. The 3 ^' segment of the second primer comprises a sequence which can bind predominantly complementary to the first primer extension product. Enzymatic extension of the second primer oligonucleotide using the first primer extension product as template results in the formation of the second primer extension product. Such synthesis typically occurs in parallel with displacement of the controller oligonucleotide from its binding with the first primer extension product. This displacement is predominantly due to the polymerase and may be partially due to the second Primer oligonucleotide take place. Such a second extension product comprises the target sequence or its segments. In the course of the synthesis of the second primer extension product, the sequence of the copiable portion of the first primer oligonucleotide is recognized by the polymerase as a template and a corresponding complementary sequence is synthesized. This sequence is located in the 3 ^' segment of the second primer extension product and comprises the primer binding site for the first primer oligonucleotide. The synthesis of the second primer extension product occurs until the stop position in the first primer oligonucleotide. Immediately after the synthesis of the second primer extension product, this product is bound to the first primer extension product to form a double-stranded complex. The second primer extension product is sequence-specifically displaced from this complex by the controller oligonucleotide. Again, after successful strand displacement by the controller oligonucleotide, the second primer extension product can itself serve as a template for the synthesis of the first primer extension product.

Furthermore, the second primer oligonucleotide can serve as the initiator of the synthesis of the second primer extension product starting from the starting nucleic acid chain at the beginning of the amplification. In certain embodiments, the sequence of the second primer is completely complementary to the corresponding sequence segment of a starting nucleic acid chain. In certain embodiments, the sequence of the second primer oligonucleotide is only partially complementary to the corresponding sequence segment of a starting nucleic acid chain. However, this aberrant complementarity is not intended to prevent the second primer oligonucleotide from starting a predominantly sequence-specific primer extension reaction. The respective differences in complementarity of the second primer oligonucleotide to the respective position in the starting nucleic acid chain are in particular in the 5 ^' segment of the second primer oligonucleotide, so that in the 3 ^' segment a predominantly complementary base pairing and initiation of the synthesis is possible. For the initiation of the synthesis, for example, especially the first 4-10 positions in the 3 ^' segment should be fully complementary to the template (starting nucleic acid chain). The remaining nucleotide positions may differ from a perfect complementarity. Thus, the extent of perfect complementarity in the 5 ^' segment can range between 10% to 100%, especially between 30% and 100% of the base composition. Depending on the length of the second primer oligonucleotide, this deviation encompasses a complete complementarity in the 5 ^' segment of 1 to 40, in particular 1 to 20 nucleotide positions. In certain embodiments, the second primer oligonucleotide binds only to its 3 ^' segment to the starting nucleic acid chain, but not to its 5 ^' segment. The length of such a 3 ^' - segment of the second primer oligonucleotide fully complementary to the starting nucleic acid chain comprises regions between 6 and 40 nucleotides, in particular between 6 and 30 nucleotides, in particular between 6 and 20. The length of a corresponding, not complementary to the starting nucleic acid chain 5 ^' segment of the second primer oligonucleotide comprises regions between 5 and 60, in particular between 10 and 40 Nucleotides. The second primer oligonucleotide can thus initiate synthesis of a starting nucleic acid. In a subsequent synthesis of the first primer extension product, sequence sections of the second primer oligonucleotide are copied from the polymerase so that again in subsequent synthesis cycles, a fully complementary primer binding site is formed within the first primer extension product for binding of the second primer oligonucleotide and is available in subsequent synthesis cycles.

In certain embodiments, the second primer oligonucleotide may be used in the preparation of a starting nucleic acid chain. In this case, such a second primer oligonucleotide can bind to a nucleic acid (for example a single-stranded genomic DNA or RNA or its equivalents comprising a target sequence) predominantly / preferably sequence-specifically and initiate a template-dependent primer extension reaction in the presence of a polymerase. The binding position is chosen such that the primer extension product comprises a desired target sequence. The extension of the second primer oligonucleotide results in a strand which has a sequence complementary to the template. Such a strand can be detached from the template (eg by heat or alkali) and thus converted into a single-stranded form. Such a single-stranded nucleic acid chain can serve as a starting nucleic acid chain at the beginning of the amplification. Such a start nucleic acid chain comprises in its 5 ^' segment the sequence parts of the second primer oligonucleotide, furthermore it comprises a target sequence or its equivalents and a primer binding site for the first primer oligonucleotide. Further steps are explained in the section "Starting nucleic acid chain".

In a particular embodiment, at least in its 3 ^' segment, the second primer oligonucleotide comprises sequence portions which can bind complementarily and sequence specifically to a sequence segment of a target sequence and initiate / support a successful primer extension reaction by the polymerase. The length of such a sequence segment comprises regions of 6 and 40 nucleotides, in particular of 8 to 30 nucleotides, in particular of 10 to 25 nucleotides.

In certain embodiments, the second primer oligonucleotide comprises copyable sequence segments in its 3 ^' and 5 ^' segments which are copied from the polymerase upon synthesis of the first primer extension product. Thus, all sequence sections of the second primer are copied from the polymerase. This results in the formation of a primer binding site in the 3 ^' segment of the first primer extension product.

In certain embodiments, the second primer oligonucleotide, with its copatible portions, corresponds in length to the 3 ^' segment of the first primer extension product that is not bound by the controller oligonucleotide. In the complex comprising the second primer oligonucleotide and the first primer extension product, the 3 ^' end of such a second primer oligonucleotide is adjacent to the controller oligonucleotide which is adjacent to the first oligonucleotide Primer extension product is bound. Extension of such a primer is done using the first primer extension product as a template. Upon extension of such a primer, the displacement of the controller oligonucleotide from binding with the first primer extension product occurs via polymerase-dependent strand displacement.

In certain embodiments, the second primer oligonucleotide with its copiable sequence portions is shorter than the 3 ^' segment of the first primer extension product that is not bound by the controller oligonucleotide. Thus, in the complex comprising the second primer oligonucleotide and the first primer extension product, there is a single-stranded portion of the first primer extension product between the 3 ^' end of such primer and the controller oligonucleotide bound to the first primer extension product. Extension of such a primer is done using the first primer extension product as a template. Upon extension of such a primer, the displacement of the controller oligonucleotide from binding with the first primer extension product occurs via polymerase-dependent strand displacement.

In certain embodiments, the second primer oligonucleotide with its copatible portions is longer than the 3 ^' segment of the first primer extension product that is not bound by the controller oligonucleotide. In the complex of the second primer oligonucleotide and the first primer extension product, the 3 ^' segment of the second primer and the 5 ^' segment of the controller oligonucleotide compete for binding to the first primer extension product. The binding of the 3 ^' segment of the second primer to the first primer extension product required for initiation of the synthesis takes place with simultaneous partial displacement of the 5 ^' segment of the controller oligonucleotide.

Upon initiation of the synthesis by the polymerase, the extension of such a primer is performed using the first primer extension product as a template. Upon extension of such a primer, the displacement of the controller oligonucleotide from binding with the first primer extension product occurs via polymerase-dependent strand displacement. The sequence length of the 3 ^' segment of the second primer oligonucleotide which displaces the 5 ^' segment of the controller oligonucleotide may comprise the following ranges: 1 to 50 nucleotides, in particular 3 to 30 nucleotides, in particular 5 to 20 nucleotides. For example, the use of second primer oligonucleotides of greater length, which exceeds the length of the 3 ^' segment of the first primer extension product, is advantageous in some embodiments. Such embodiments include, for example, a first primer extension product having a 3 ^' segment that is not bound by the controller oligonucleotide, having a length of 5 to 40 nucleotides, more preferably 10 to 30 nucleotides. Especially for shorter 3 ^' segments, a longer second primer oligonucleotide provides improved sequence specificity upon initiation of the synthesis. The binding strength of the second primer oligonucleotide to its primer binding site depends on the length of the primer. In general, longer second primer oligonucleotides can be used at higher reaction temperatures.

In particular, sequences of the first, second primer oligonucleotide and the controller oligonucleotide are matched to one another such that side reactions, e.g. Primer-dimer formation, minimized. For this purpose, for example, the sequence of the first and second primer oligonucleotides are adapted to each other such that both primer oligonucleotides are incapable of undergoing an amplification reaction in the absence of an appropriate template and / or target sequence and / or starting sequence. Start nucleic acid chain. This can be achieved, for example, in that the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide. Furthermore, it should be avoided that the primer sequences comprise extended self-complementary structures (self-complement).

The synthesis of the second primer extension product is a primer extension reaction and forms a substep in the first amplification. The reaction conditions during this step are adjusted accordingly. The reaction temperature and the reaction time are chosen so that the reaction can take place successfully. The particular preferred temperature in this step depends on the polymerase used and the binding strength of the respective second primer oligonucleotide to its primer binding site and includes, for example, ranges from 15 ° C to 75 ° C, especially from 20 to 65 ° C, in particular from 25 ° C to 65 ° C. The concentration of the second primer oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.

In certain embodiments, the synthesis of the first and second primer extension products proceeds at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products proceeds at different temperatures. In certain embodiments, synthesis of the second primer extension product and strand displacement by controller oligonucleotide proceeds at the same temperature. In certain embodiments, synthesis of the second primer extension product and strand displacement by controller oligonucleotide proceeds at different temperatures. Polymerases:

Preferably, template-dependent polymerases are used which are capable of strand displacement.

For example, in particular embodiments, a large fragment of the Bst polymerase or its modifications (e.g., Bst 2.0 DNA polymerase) can be used. Furthermore, Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, large fragment of Bsu DNA polymerase, large fragment of Bsm DNA polymerase can be used. Vent exo minus polymerase, Deepvent exo minus DNA (from NEB) and PyroPhage polymerase from Lucigen are thermostable enzymes with strand displacement activity.

In one embodiment, polymerases are used which exhibit no activity at room temperature, so-called hot-start polymerases or warm-start polymerases. An example of this is provided by Bst 2.0 Polymerase Warm Start (from NEB).

Particular embodiments of the third primer oligonucleotide

(Component of the second amplification system)

In one embodiment, the third primer oligonucleotide is identical to the first primer oligonucleotide of the first amplification system.

In certain embodiments, the third primer oligonucleotide is not identical to the first primer oligonucleotide of the first amplification system.

The length of the third primer oligonucleotide may be between 15 and 100 nucleotides, in particular between 20 and 60 nucleotides, in particular between 30 and 50 nucleotides. The CG content is for example between 20% and 80%, in particular between 30 and 79%. The nucleotide building blocks are in particular linked to each other via conventional ^{5'-3 ^'bond} or Phosphodieser- Phosphothioester bond. Such a primer oligonucleotide can be chemically synthesized in the desired form.

In certain embodiments, the third primer oligonucleotide may include nucleotide monomers that do not or only insignificantly affect the function of the polymerase, including, for example:

Modified nucleotides, nuclease-resistant phosphorothioate compounds (PTO) modifications, LNA modifications, 2-amino-dA, 2-thio-dT or other nucleotide modifications with different base pairing (eg universal base pairs, such as inosine 5 -Nitroindol).

In a particular embodiment, the 3 ^'OH end of the third oligonucleotide primer in particular free of modifications and a functional ^3' has -OH group of the Polymerase detected and can be extended depending on the template. In a further particular embodiment, the 3 ^' segment of the third primer comprises at least one phosphorothioate compound, so that no degradation of the 3 ^' end of the primer by 3 ^' exonuclease activity of polymerases can take place.

In certain embodiments, the 3 ^' end of the third primer is blocked. For example, with a 3 ^' phosphate group or with a C3 linker. The activation of the 3 ^' segment of the third primer oligonucleotide in these embodiments takes place only in the second amplification, for example using 3 ^' -5 ^' -exonuclease activity of the second polymerase.

In particular, the third primer oligonucleotide does not comprise any sequence segments which are capable of complementary binding to the first region of the controller oligonucleotide.

The third primer oligonucleotide (Figures 15-31) can be positioned in various arrangements relative to the first amplification fragment 1.1 (the first amplification product 1.1 comprising a target sequence).

In order for the second amplification reaction to start using a first amplification fragment 1 .1 as template (starting nucleic acid chain 2.1), the third and fourth primers must bind within sequences predetermined by the first amplification fragment and be extended by the polymerase become.

In a particular embodiment, the third primer oligonucleotide can bind to a strand of the first amplification fragment 1 .1. In particular, the third primer oligonucleotide binds to the second primer extension product and can thereby initiate primer extension using a suitable polymerase and reaction conditions.

This binding of the third primer oligonucleotide is in certain embodiments preferably in the 3 ^' segment of the second primer extension product.

The third primer oligonucleotide preferably comprises a sequence segment in its 3 ^' region which can bind complementarily or predominantly complementarily to the second primer extension product under used reaction conditions such that the polymerase is capable of facilitating the synthesis of the third primer extension product initiate.

The length of this segment comprises in particular ranges between 6 and 30 nucleotides, in particular between 8 and 25 nucleotides, in particular between 10 and 20 nucleotides, in particular between 10 and 15 nucleotides. In certain embodiments, this segment is fully complementary to the corresponding segment of the second primer extension product. In certain embodiments, this segment comprises at least one mismatch to the primer extension product. In particular, the position of this mismatch is no closer than -4 position with respect to the 3 ^' end of the third primer, in particular no closer than -5, in particular no closer than -6, in particular no closer than position -8 relative to the 3 ^' end of the third primer oligonucleotide. Since the third primer oligonucleotide can also bind to the controller oligonucleotide with this 3 ^' segment, such is Mismatch weakened the binding of this segment to the controller oligonucleotide. Thus, when choosing the length and number of mismatches, it is contemplated that while the 3 ^' segment is to bind to the second primer extension product and initiate a primer extension reaction, it is also noted that this segment is functional at the reaction conditions used does not irreversibly bind to the controller oligonucleotide and thus inactivate it.

Thus, in the choice of position and length, interactions between the third primer oligonucleotide and the controller as well as the second primer extension product are taken into account.

The position of attachment of this segment to the second primer extension product can be chosen differently (Figures 27-31, 57).

For example, the third primer oligonucleotide may bind predominantly complementary to the same sequence segment as the first primer oligonucleotide. The position of the 3 ^' end of the third primer oligonucleotide matches the position of the 3 ^' end of the first primer oligonucleotide. Thus, the third primer oligonucleotide may at least partially (with its 3 ^' segment) bind complementary to a portion of the target sequence. The 3 ^' end of the third primer is thus within the second blocking unit of the controller oligonucleotide and can not be extended through the polymerase using the controller as a template (Figure 20).

In certain embodiments, the third primer oligonucleotide binds predominantly complementary to the second primer extension product with its 3 ^' end shifted relative to the 3 ^' end of the first primer oligonucleotide. In certain embodiments, the 3 ^' end of the third primer oligonucleotide is shifted by at least one nucleotide in the 3 ^' direction of the second primer extension product. Thus, the segment of the second primer extension product to which the third primer oligonucleotide is capable of predominantly complementary binding is shifted in the 3 ^' direction (Figure 19).

In certain embodiments, the 3 ^' end of the third primer oligonucleotide is shifted by at least one nucleotide in the 5 ^' direction of the second primer extension product. Thus, the segment of the second primer extension product, to which the third primer oligonucleotide can bind predominantly complementarily, is shifted in the 5 ^' direction (FIG. 21).

In certain embodiments, the binding position of the third primer oligonucleotide is shifted in the 5 ^' direction of the second primer extension product so that the third primer oligonucleotide does not overlap the binding position of the first primer oligonucleotide of the first amplification system. Thus, the segment of the second primer extension product to which the third primer oligonucleotide is capable of predominantly complementary binding is shifted in the 5 ^' direction relative to the binding site of the first primer oligonucleotide (Figure 22). The third primer oligonucleotide thus comprises sequence segments which can bind complementarily to the controller oligonucleotide. The segment of the controller oligonucleotide which is capable of complementary binding to the third primer oligonucleotide is referred to as the fourth region of the controller oligonucleotide. To prevent unwanted primer extension of the third primer oligonucleotide on the controller, at least positions of the controller oligonucleotide located around the 3 ^' end of the third primer oligonucleotide are modified. For example, this can be done in a similar way to modifcations of the second blocking unit. The segment of the controller comprising such modifications (which prevent extension of the third primer oligonucleotide) is referred to as the fourth blocking unit (Figures 19-22). Their position depends on the potential binding position of the third primer oligonucleotide within the controller.

The third primer oligonucleotide is said to be capable of being copied upon reverse synthesis and also serves as a template for the synthesis of the fourth primer extension product.

The third primer oligonucleotide comprises, in certain embodiments, at least one sequence segment in its 3 ^' region which is capable of predominantly complementary binding to the first target sequence. This segment can bind predominantly complementarily to the second primer extension product (comprising corresponding segments of the target sequence), which polymerase can perform a primer extension reaction.

The third primer oligonucleotide, in certain embodiments, comprises at least one sequence segment in its 5 ^' region which is not complementary to the target sequence. This segment may, for example, comprise from 1 to 60 nucleotides and may serve, for example, for other purposes, for example barcoding, cloning, immobilization, probe binding, etc. The sequence composition of this 5 ^' region is adapted so as not to interfere with the second amplification.

The third primer oligonucleotide may comprise further modifications, eg fluorescent dyes (eg FAM, Cy5 etc.), fluorescence quenchers (eg BHQ1, BHQ2 etc), affinity tags (eg biotin, digoxigenin etc.). In another embodiment, the third primer oligonucleotide may comprise a linker (eg, C3 or HEG linker) such that its 5 ^' region remains uncoupled from the polymerase.

In certain embodiments, the third primer is immobilized on a solid phase prior to the second amplification reaction. The primer extension of this third primer oligonucleotide thus leads to the immobilization of the entire third primer extension product.

The concentration of the third primer oligonucleotide used may comprise, for example, ranges between 0.01 pmol / l to about 10 pmol / l, in particular between 0.1 pmol / l and about 2 pmol / l.

Particular embodiments of the fourth primer oligonucleotide (Component of the second amplification system)

In one embodiment, the fourth primer oligonucleotide is identical to the second primer oligonucleotide of the first amplification system.

In certain embodiments, the fourth primer oligonucleotide is not identical to the second primer oligonucleotide of the first amplification system.

The length of the fourth primer oligonucleotide can be between 15 and 100 nucleotides, in particular between 20 and 60 nucleotides, in particular between 30 and 50 nucleotides. The CG content is for example between 20% and 80%, in particular between 30 and 79%. The nucleotide building blocks are in particular linked to each other via conventional ^{5'-3 ^{'phosphodiester}} bond or Phosphothioester bond. Such a primer oligonucleotide can be chemically synthesized in the desired form.

In certain embodiments, the fourth primer oligonucleotide may include nucleotide monomers that do not or only insignificantly affect the function of the polymerase, including, for example:

In a particular embodiment, the 3 ^'OH end of the fourth oligonucleotide primer in particular free of modifications and has a functional ^3' -OH group, that can be recognized by the polymerase, and template-extended. In a further particular embodiment, the 3 ^' segment of the fourth primer comprises at least one phosphorothioate compound such that no degradation from the 3 ^' end of the primer by the 3 ^' exonuclease activity of polymerases can occur.

In certain embodiments, the 3 ^' end of the fourth primer is blocked. For example, with a 3 ^' phosphate group or with a C3 linker. The activation of the 3 ^' segment of the fourth primer oligonucleotide in these embodiments takes place only in the second amplification, for example using 3 ^' -5 ^' -exonuclease activity of the second polymerase.

In particular, the fourth primer oligonucleotide does not comprise any sequence segments which are capable of complementary binding to the first region of the controller oligonucleotide.

The fourth primer oligonucleotide (Figures 15-31) can be positioned in various arrangements relative to the first amplification fragment 1.1 (the first amplification product 1.1 comprising a target sequence). In order for the second amplification reaction to start using a first amplification fragment 1 .1 as template (starting nucleic acid chain 2.1), the third and fourth primers must bind within sequences predetermined by the first amplification fragment and be extended by the polymerase become.

In a particular embodiment, the fourth primer oligonucleotide can bind to a strand of the first amplification fragment 1.1. Preferably, the fourth primer oligonucleotide binds to the first primer extension product and can thereby initiate primer extension using a suitable polymerase and reaction conditions.

This binding of the fourth primer oligonucleotide is in certain embodiments preferably in the 3 ^' segment of the first primer extension product.

The fourth primer oligonucleotide preferably comprises a sequence segment in its 3 ^' region which can bind complementary or predominantly complementary to the first primer extension product under reaction conditions used so that the polymerase is capable of facilitating the synthesis of the fourth primer extension product to initiate.

The length of this segment comprises in particular ranges between 6 and 40 nucleotides, in particular between 8 and 30 nucleotides, in particular between 10 and 25 nucleotides, in particular between 10 and 20 nucleotides. In certain embodiments, this segment is fully complementary to the corresponding segment of the first primer extension product. In certain embodiments, this segment comprises at least one mismatch to the first primer extension product. In particular, the position of this mismatch is no closer than -4 position with respect to the 3 ^' end of the fourth primer, in particular not closer than -5, in particular not closer than -6, in particular not closer than position -8 relative to the 3 ^' . End of the fourth primer oligonucleotide.

The position of the binding of this segment to the first primer extension product may be chosen differently (Figs. 23-31, 57).

For example, the fourth primer oligonucleotide may bind predominantly complementary to the same sequence segment as the second primer oligonucleotide. The position of the 3 ^' end of the fourth primer oligonucleotide matches the position of the 3 ^' end of the second primer oligonucleotide. Thus, the fourth primer oligonucleotide comprises at least in part (with its 3 ^' segment) a portion of the target sequence.

In certain embodiments, the fourth primer oligonucleotide binds predominantly complementary to the first primer extension product, with its 3 ^' end being shifted with respect to the 3 ^' end of the second primer oligonucleotide. In certain embodiments, the 3 ^' end of the fourth primer oligonucleotide is shifted by at least one nucleotide in the 3 ^' direction of the first primer extension product. Thus, the segment of the first primer extension product to which the fourth primer oligonucleotide is capable of predominantly complementary binding is displaced in the 3 ^' direction (Figure 1). In certain embodiments, the 3 ^' end of the fourth primer oligonucleotide is shifted by at least one nucleotide in the 5 ^' direction of the first primer extension product. Thus, the segment of the first primer extension product to which the fourth primer oligonucleotide is capable of predominantly complementary binding is shifted in the 5 ^' direction.

In particular, the fourth primer oligonucleotide does not comprise any sequence segments which can bind complementarily to the controller oligonucleotide.

The fourth primer oligonucleotide should be able to be copied in reverse synthesis and also serves as a template for in the context of the synthesis of the third primer extension product.

The fourth primer oligonucleotide, in certain embodiments, comprises at least one sequence segment in its 3 ^' region which comprises portions of the first target sequence and thus can bind to a strand which is complementary to the target sequence. This segment can be predominantly complementary to the first primer extension product (comprising corresponding complementary segments to the target sequence), which polymerase can perform a primer extension reaction.

The fourth primer oligonucleotide, in certain embodiments, comprises at least one sequence segment in its 5 ^' region which does not comprise sequence segments of the first target sequence. This segment may, for example, comprise from 1 to 60 nucleotides and may for example serve other purposes, for example "barcoding", cloning, immobilization, probe binding, etc. The sequence composition of this 5 ^' region is adapted so as not to interfere with the second amplification ,

The fourth primer oligonucleotide may comprise further modifications, eg fluorescent dyes (eg FAM, Cy5 etc.), fluorescence quenchers (eg BHQ1, BHQ2 etc), affinity tags (eg biotin, digoxigenin etc.) Primer oligonucleotide include a linker (eg C3 or HEG linker) so that its 5 ^' region remains uncoupled from the polymerase.

In certain embodiments, the fourth primer is immobilized on a solid phase prior to the second amplification reaction. The primer extension of such a fourth primer oligonucleotide thus leads to immobilization of the entire fourth primer extension product.

The concentration of the fourth primer oligonucleotide used may comprise, for example, ranges between 0.01 pmol / l to about 10 pmol / l, in particular between 0.1 pmol / l and about 2 pmol / l.

Polymerases of the second amplification system:

Many polymerases are known for carrying out a PCR. In certain embodiments, thermostable template-dependent DNA polymerases are used, which have a ^{5'-3 ^'exonuclease} activity.

In certain embodiments, Taq polymerase and / or its formulations and / or their modifications (e.g., Ampli-Taq) are used to carry out the second amplification.

In certain embodiments, thermostable template-dependent DNA polymerases having strand-displacement activity are used. For example, Vent Exo minus (from NEB), PyroPhage Polymerase (from Lucigene), SD Polymerase (from Bioron).

In certain embodiments, thermostable template-dependent DNA polymerases are used which have a 3 ^' -5 ^' proof reading activity. For example, Vent exo plus, Deep Vent exo plus (from NEB), Pfu Polymerase (Jena Biosciences), Phusion Polymerase (NEB).

In certain embodiments, thermostable template-dependent DNA polymerases are used which are conjugated to another protein, for example to increase the polymerase's processivity. For example, Phusion Polymerase (NEB).

Primer oligonucleotides comprising additional sequence segments:

The above-mentioned structures of the first primer and the second primer can be considered as so-called "base structure of the primer" or "minimal structure of the primer".

Such basic structures of oligonucleotides with primer function (eg, first primer oligonucleotide, second primer oligonucleotide, optionally third primer oligonucleotide, optionally fourth primer oligonucleotide, etc.) comprise sequence segments which are essential for the execution of the amplification reaction. Method are advantageous, for example, the first and second region of the first primer.

Such a basic structure of the primer can be extended by additional, additional sequence segments. Such additional sequence segments include structures which, while not necessary for the performance of the amplification process, may nevertheless be useful for other tasks.

Such additional sequence segments may optionally be introduced into a primer and used for further functions or reactions. This allows the polymerase synthesized primer extension products (starting from, for example, the first and / or the second primer) to be linked to such sequences segments. This achieves integration of such additional sequence segments and primer extension products into a molecular structure. Such integration may be advantageous in certain embodiments. A variety of applications for primer sequences with additional sequence segments are known to one skilled in the art.

Several functions are known to a person skilled in the art, which are supported by additional sequence segments of the primer. The introduction of additional structures can be used, for example, as a means of imparting intermolecular or intramolecular bonding. A person skilled in the art is aware of several examples of such structures. For example, probes can be designed according to such a principle of intra-molecular binding, for example in the context of Scorpion primers. For example, sequence segments can further serve to bind additional oligonucleotides. In this case, a sequence-specific intermolecular binding can be achieved using stringent conditions. Such interactions can be used, for example, for the binding of amplification products to a solid phase by complementary binding to immobilized oligonucleotides.

Another example is introduction of so-called adapter sequences and / or use of further sequence segments for the unique coding or sequence-specific labeling of primers and primer extension products emanating therefrom (so-called primer barcoding). This is used, for example, for NGS library preparation (Stählber et al Nucleic Acids Res. 2016 Jun 20; 44 (11): e105). In the sequence analysis of primer extension products, such a label can be used to assign sequences later.

Yet another example is the use of further sequence segments to introduce specific sequences with binding of certain proteins, e.g. Restriction endonucleases etc.

Yet another example is the use of further sequence segments to introduce spacer sequences which are not intended to bind a specific interaction partner, but serve primarily to increase the distance between adjacent sequences.

Such additional sequences may either be positioned on the copiable portion of the primer or added to the non-clippable portion of the primer. Several factors play a role in judging whether a sequence segment is copied or not. For example, positioning of the sequence segment in the respective oligonucleotide, nucleotide modifications used (eg C3, HEG, 2 ^' -Ome etc.) can decide whether or not a sequence segment is used as template during a process step.

In one embodiment, an additional sequence segment is introduced into the copyable region of the primer, eg, at the 5 ^' segment of the copiable portion of the second primer, so that, for example, in reading the primer sequence during a synthesis of a target sequence, additional sequence Segments are also read from the polymerase. The length of such additional sequence segment includes ranges of 3 to 50 nucleotides. The composition of these sequence segments in this embodiment allows the synthesis by a polymerase, this sequence segment thus serves as a template for polymerase-dependent synthesis. In such a segment, for example, natural nucleotides are used, eg dA, dG, dC, dT. In another embodiment, additional sequence segments may be positioned, for example, at the 5 ^' terminus of the primer, which should not be copied in the synthesis of specific amplification fragments comprising a target sequence. This can be achieved, for example, by positioning one or more modifications or chemical groups which prevents polymerase from the synthesis of a complementary strand (eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 ^' om modifications, etc.). Such modification may for example be positioned at the 5 ^'terminus of the copyable portion of the second primer and obstruct the continuation of the synthesis. For example, an HEG group may be introduced at the 5 ^' end of the copatible segment of the second primer, followed by an additional sequence segment.

Furthermore, an additional sequence segment may be positioned at the 5 ^' terminus of the second region of the first primer. Such localization of additional sequence segments prevents synthesis of a complementary strand during regular synthesis of specific amplification products comprising a target sequence.

The length of such additional sequence segment includes ranges of 3 to 50 nucleotides. The base composition may comprise, for example, natural nucleobases (A, G, C, T, U, inosine) or modifications at different positions of nucleotides (eg at the bases such as 2-amino-adenine, iso-guanine, iso-cytosines, 5-propargyl uridines, 5-propargyl cytosines or on the sugar-phosphate backbone, such as LNA, 2 ^' -Ome, 2 ^' -halogen, etc.). In a certain embodiment, a first primer and additional sequence segments are combined to form an oligonucleotide. In a certain further embodiment, a second primer and additional sequence segments are combined to form an oligonucleotide.

Such additional sequence segments are designed in an oligonucleotide such that they do not prevent amplification of target sequences. This is achieved, for example, by avoiding or reducing inhibiting interactions with the structures of the primers or controllers which are essential for the method. In certain embodiments, additional structures may form double-stranded segments complementary to other primer regions under the selected reaction conditions. In particular, however, such double-stranded segments do not prevent specific amplification of a target sequence. In certain embodiments, such additional sequence segments do not interact with the first or second primer region of the first primer. In certain embodiments, such additional sequence segments do not interact with the controller oligonucleotide. In certain embodiments, such additional sequence segments do not interact with other primers in the reaction. In certain embodiments, such additional sequence segments do not interact with P1 1 -Ext or P2.1 -Ext or other amplification fragments comprising a target sequence. In certain embodiments, such additional sequence segments do not form stable under reaction conditions Double-stranded portions with the first or second region of the first primer, which completely prevent the function of the first or the second region.

In certain embodiments, such additional sequence segments do not interact with the second primer. In particular, in certain embodiments, such additional sequence segments do not interact with the 3 ^' segment of the second primer.

In certain embodiments, the first primer comprises at its 5 ^' terminus of the second region an additional sequence segment of the first primer (variant sequence variant P1). This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers). Furthermore, this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copiable first region of the first primer. The additional sequence variant P1 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.

In certain embodiments, the second primer comprises at its 5 ^' terminus an additional sequence segment of the second primer (variant sequence variant P2). This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers). Furthermore, this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copyable region of the second primer. The additional sequence variant P2 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.

It has been observed that such oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2 are less susceptible to side reactions than oligonucleotides comprising only a first primer, or oligonucleotides comprising only a second primer , For example, in certain embodiments, the generation and / or amplification of nonspecific primer-dimer structures may be delayed. Thus, in such a side reaction, optionally, the formation of by-products comprising no target sequence can be reduced or retarded. As a result, for example, the premature consumption of primers can be reduced or delayed. For example, the use of such oligonucleotides is advantageous if primer dimers comprising first primers (PD P1) or primer dimers comprising second primers (PD P2) are produced by secondary reactions and lead to premature consumption of primers in the reaction. Use of primers having such additional structures (first primer with additional sequence variant P1 and / or second primer with additional sequence variant P2) is advantageous in certain embodiments if nonspecific reactions are observed in an amplification reaction. Such side reactions may be favored by several factors, including but not limited to:

• longer reaction times (eg in ranges between 1 hr and 100 hr) • higher concentrations of primers are used (eg in ranges between 1 mitioI / I and 1 mmol / l)

Higher concentrations of polymerase are used (e.g., in ranges above 10 unit / 10mI)

Multiplexing reactions (e.g., amplification of more than 10 different target sequences in a reaction approach).

High concentrations of complex nucleic acid chains in the reaction mixture (e.g.

Concentrations above 1 μg hgDNA in 50 ml)

Individual factors alone or in combination with other factors may promote side reactions.

In general, it is possible to counteract side reactions (eg nonspecific primer-dimer formation) by optimizing reaction components and / or reaction conditions, for example by reducing concentrations of individual components, shorter reaction times, sequence design of primer sequences , Choice of more stringent reaction conditions. The additional sequence segments cited in an advantageous embodiment (oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2) represent a further possibility for delaying certain side reactions.

In embodiments, primer oligonucleotides with additional sequence segments are shown. In these embodiments, additional sequence segments are used which do not participate in the specific amplification of a target sequence and contribute to the delay of side reactions. Thus, oligonucleotides comprising a first primer and additional sequence variant P1 and oligonucleotides comprising a second primer and additional sequence variant P2 are used.

One skilled in the art will recognize that an oligonucleotide, in addition to a primer structure that is advantageous for the specific amplification of a target sequence (this structure may also be referred to as a "base structure" or "minimal structure"), also includes additional, additional sequence sequences. Segments may include (eg additional sequence variant P1 or additional sequence variant P2). Such additional sequence segments may provide a variety of different other beneficial properties.

Certain embodiments of the detection system

The detection system comprises at least one fluorescent reporter and at least one oligonucleotide probe which is capable of hybridizing to at least one of the primer extension products formed during the amplification. Furthermore, a detection system may comprise a fluorescent quencher matching the fluorescent reporter (called a quencher), so that this quencher is capable of detecting the fluorescence signals of the fluorescence quencher Under certain circumstances, reducing the fluorescence reporter or reducing the signal intensity. Furthermore, a detection system may comprise a fluorescent reporter-matched donor fluorophore, such that this donor fluorophore is capable of enabling the fluorescence signals of the fluorescent reporter in certain circumstances by energy transfer. Furthermore, the detection system may comprise the controller oligonucleotide, wherein such a controller oligonucleotide comprises either a fluorescent reporter or a donor fluorophore or a fluorescence quencher.

The arrangement of individual elements (fluorescence reporter, fluorescence quencher, donor fluorophore) on the oligonucleotide probe and / or on the controller oligonucleotide to lead in the presence of a primer extension product to form each complementary complexes to change the fluorescence signal from the fluorescent reporter.

A person skilled in the art knows a large number of reporter systems which have been developed in the realm of real-time PCR in the last 20 years. These include, for example, probes with self-complementary segments, eg: so-called "molecular beacons", exonuclease-degradation-based probes (so-called "Taqman" probes which are specifically cleaved using Taq polymerase 5 ^' - 3 ^' nuclease activity), probe Systems with two oligonucleotides which are labeled with FRET pair and can be arranged in a strand so that a signal is generated, primer-based probes (eg LUX primer, which change the intensity of the signal when self-complementary structures unfold during reverse synthesis) , "Scorpion primer" (with segments complementary to the strand synthesized with the primer), etc. Some probes can be used as end point measurement in signal acquisition (eg, molecular beacons). Some probes are used to detect the kinetics of PCR, eg 5 ^' -3 ^' nuclease probes. Many different arrangements of probes and fluorescent reporters, fluorescence quenchers and donor fluorophores are known in the literature. Also, many fluorescent reporter quenchers as well as fluorescent reporter donor fluorophores (also called donor-acceptor pairs or FRET pairs) are known ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed Didenko, 2006, for example, Chapter 1 and 2, Product Description "Flurescent Molecular Probes", published by Gene Link Inc.). Most of the probes were developed for PCR-based methods, using both the specific arrangement of primers, probes and polymerases used, eg with 3 ^' exonuclease (FEN).

In general, such probes may bind more or less specifically to the DNA fragments generated during amplification, the signal being altered as a result of such binding alone or in combination with other events (eg, nuclease degradation or attachment of another oligonucleotide to adjacent segments) , This change can be detected and quantified.

Because of the use of the PCR in the second amplification, therefore, also such known techniques and probes can be used. The sequences of Oligonucleotide probes adapted to the resulting during the reaction amplification products.

The choice of a probe also depends on whether, for example, a particular variant of the target sequence has to be detected by means of a target sequence-specific probe or should, for example, only the consumption of primers (as a sign of amplification) be registered. Different probe formats can thus be selected, depending on the task.

In the following, therefore, the special features of such an adaptation for some embodiments will be discussed in the first place.

Heterogeneous format

In this case, components of both amplification systems are separated at the beginning of the first amplification, so that no influence of oligonucleotide probes or PCR primers on the first amplification can take place. Conversely, upon completion of the first amplification, an aliquot is transferred from the first amplification to the second amplification. The resulting dilution of reaction components of the first amplification system favors the use of known for a PCR reaction probe constructions. For example, in the presence of the controller oligonucleotide in concentrations of less than 100 nmol / l, in particular less than 10 nmol / l, in particular less than 1 nmol / l, in particular less than 0.01 nmol / l, the probe binding to complementary segments of the primer extension fragments formed under As the PCR conditions are hardly affected, probe-based detection methods known to a person skilled in the art can be used.

The oligonucleotide probes may bind to one of the formed primer extension products (eg to the third and fourth primer extension product) and this binding event may be detected by various techniques (eg, using Taqman probes and a Taq polymerase or by binding from "Molecular Beacons" to complementary segments of corresponding primer extension products).

Homogeneous format

In a homogeneous format, the components of both amplification systems at the beginning of the first amplification are in the same approach and therefore can interact with other components and intervene in certain processes. In particular, the presence of effective concentrations of controller oligonucleotide (eg between 0.01 pmol / l and 10 pmol / l) and oligonucleotide probes (eg between 0.01 pmol / l and 10 pmol / l) can lead to interactions between these components may have an effect on sub-steps or results of these steps. For this reason, the following aspects, among others, have to be taken into account:

Presence of controller oligonucleotides can affect the binding of oligonucleotide probes to the primer extension products formed. This is the case, for example, when a probe and a controller are significant Overlaps in segments that are complementary to primer extension products (eg, third region of the controller and oligonucleotide probe may partially hybridize to the same segment of the first and / or third primer extension product). For this reason, it is advantageous to limit the extent of such overlaps. For example, the length of segments in the case of the controller and probe can be adjusted to such an extent that they have the least possible overlap. Preferably, the sequence segments do not overlap upon complementary binding to the formed primer extension products.

• Oligonucleotide probes may bind to the controller oligonucleotide and affect it upon strand displacement. This can be done, for example, when the controller oligonucleotide and the oligonucleotide probe each comprise a segment which results in the formation of a double-stranded complement between the controller and the probe. For this reason, it is advantageous to limit the extent of such complementary segments. For example, the length of segments in the case of the controller and probe can be adjusted to such an extent that they have as little complementarity as possible. Preferably, the controller and probe do not include complementary sequence segments.

For such reasons, for example, in a homogeneous format, it is advantageous to make the oligonucleotide probe hybridize preferentially to the 3 ^' segment of the first or third primer extension product. These segments are not hybridized by the controller oligonucleotide.

Another essential aspect of this invention is a possible polymerase change upon switching from the first to the second amplification: the first polymerase can be inactivated and the second polymerase can be activated. This makes it possible, for example, to use 5 ^' -3 ^' nuclease-sensitive probes ("Taqman probes") during the second amplification: in the first amplification, for example, Bst polymerase Large Fragment is preferably used. This fragment can not cleave the Taqman probes. At the beginning of the second amplification, the Bst polymerase Large Fragment is inactivated and the Taq polymerase (eg used as a hot-start polymerase) is activated. As a result, the 5 ^' -3 ^' nuclease-sensitive probes can now be used.

Depending on the chosen constellation between a fluorescent reporter and / or a donor fluorophore and / or a fluorescence quencher, this change can lead to an increase or decrease in the signal intensity of the fluprescent repeater. This change can be detected by known suitable means (eg in a real-time PCR apparatus, such as StepOne PCR or Lightcycler or rotor genes, see information from manufacturers) during or after an expired reaction. The detection of the changes in the signal can allow conclusions to be drawn about the course of the reaction: eg amplitude of the signal, kinetics, time or concentration dependence of the signal appearance. When using multiple target Sequences can be coded according to multiplex spectral analyzes by different spectral properties, so that several reactions can be observed parallel to each other.

The present invention describes some embodiments of oligonucleotide probes which are particularly advantageous for detecting the progress of the reaction.

The oligonucleotide probe is an oligonucleotide, which is preferably constructed from DNA nucleotides. In another embodiment, this oligonucleotide can be composed of other nucleotide monomers, for example, of RNA or of nucleotide modifications, for example, with sugar-phosphate backbone modifications such as PTO or LNA or 2 ^'-0-Me. In another embodiment, this oligonucleotide sample is a mixed polymer comprising both DNA and non-DNA elements (eg RNA, PTO LNA). This oligonucleotide probe may comprise further oligonucleotide modifications, eg linkers or spacers (eg C3, HEG, abasic monomers, eg THF modification).

The base composition of the oligonucleotide probe preferably comprises bases which can undergo complementary binding with natural nucleobases (A, C, T, G) under hybridization conditions. In another embodiment, the probe also includes modifications including, for example, universal bases (e.g., inosine, 5-nitro-indole). The probe may include other modifications that affect the binding behavior of oligonucleotides, e.g. MGB modifications.

The length of the oligonucleotide probe is preferably between 8 and 80 nucleotides, in particular between 12 and 80 nucleotides, in particular between 12 and 50, in particular between 12 and 35 nucleotides. The oligonucleotide probe typically comprises a segment which can complementarily bind complementarily to at least one of the formed products. In one embodiment, the oligonucleotide probe comprises at least one further segment which can not bind to one of the formed primer extension products in a complementary manner.

The probe may be arranged differently in relation to other components of the amplification systems. Certain embodiments are preferred:

In one embodiment, an oligonucleotide probe comprises at least one of the formed primer extension products (P1 .1-Ext, P2.1-Ext, P3.1-Ext, P4.1-Ext) in

Substantially complementary sequence segment which can hybridize to at least one of the primer extension products formed under suitable conditions (hybridization conditions). In another embodiment, this sequence segment is complementary to the first and / or the third primer extension product. In another embodiment, this sequence segment is complementary to the first and / or the third primer extension product, wherein the oligonucleotide probe can bind complementary in the 3 ^' segment of the respective primer extension product which is not complementarily bound by the controller oligonucleotide. In a further embodiment is this sequence segment to the second and / or the fourth primer extension product complementary. In a further embodiment, this sequence segment of the oligonucleotide probe has a length which is in the range between 10 nucleotides and 50, in particular between 15 and 40, in particular between 15 and 30 nucleotides. In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially complementary to the controller oligonucleotide. In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially complementary to the controller oligonucleotide, the length of this segment being less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides.

In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially complementary to one of the primer oligonucleotides. In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially complementary to one of the primer oligonucleotides, the length of this segment being less than 20 nucleotides, in particular comprising less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides.

In another embodiment, this sequence segment of the oligonucleotide probe does not comprise a sequence region that is substantially identical to the sequence of the third region of the controller oligonucleotide. In a further embodiment, this sequence segment of the oligonucleotide probe comprises a sequence region which is substantially identical to the sequence of the third region of the controller oligonucleotide, the length of this segment being less than 20 nucleotides, in particular less than 15 nucleotides, in particular less than 10 nucleotides, in particular less than 5 nucleotides,

In one embodiment, the oligonucleotide probe is at least partially cleavable by a 5 ^' -3 ^' nuclease. In another embodiment, the controller oligonucleotide is cleavable by a 5 ^' -3 ^' nuclease, at least in its 5 ^' segment (third region of the controller).

In a further embodiment, an oligonucleotide probe comprises a sequence segment which is substantially complementary to the target sequence or its portion encompassed by one of the amplification products, the length of this segment being in the range of between 5 and 50 nucleotides, in particular between 10 and 40, in particular between 15 and 30 nucleotides. In another embodiment, an oligonucleotide probe does not comprise a sequence segment substantially complementary to the target sequence or its complementary strand. For example, it may be

In one embodiment, the 3 ^' end of the oligonucleotide probe is blocked by a modification, eg, by a fluorophore or quencher or donor, or by another modification that prevents the polymerase from using the oligonucleotide as a primer (eg, phosphate residue or C3 linker or dideoxy nucleotide modification).

In another embodiment, the 3 ^' end of the oligonucleotide probe is free and can bind complementary to the first primer extension product and initiate synthesis by the polymerase. This allows the oligonucleotide probe to be extended like a primer, resulting in the formation of a probe extension product.

In one embodiment, the sequence composition of the probe corresponds to the sequence composition of the primer.

Position of fluorescent reporter, fluorescent quencher or donor fluorophore may vary depending on the embodiment of the oligonucleotide probe. These elements can be covalently bound to either one of the respective ends of the oligonucleotide probe or in the middle region. Many such modifications are known to one skilled in the art, for example, coupling of FAM reporter to the 3 ^' end or to the 5 ^' end of a nucleotide, or use of dT-BHQ1 or dT-FAM or dT-TMR modifications for coupling of probes in middle or inner sequence segment of the probe. Such modified oligonucleotide probes can be obtained from commercial suppliers (eg, Sigma-Aldrich, Eurofins, IDT, Eurogentec, Thermofisher Scientific).

For example, the oligonucleotide probe comprises at least one sequence segment which is capable of undergoing a substantially complementary binding with the third or fourth primer extension product formed during amplification under suitable reaction conditions of a detection step. In this case, the oligonucleotide probe is bound for example to the single-stranded 3 ^' segment of the synthesized third primer extension product or to the synthesized 5 ^' segment of the fourth primer extension product complementary. In this case, such a probe does not comprise sequence segments which are identical to the controller or are complementary to the controller. This generates a complex comprising a primer extension product and an oligonucleotide probe. The binding of the oligonucleotide probe and the controller oligonucleotide to the synthesized third primer extension product is preferably sequence-specific. The length of this sequence segment complementary to the 3 ^' segment of the first primer extension product is, for example, in the range from 8 to 80 nucleotides, in particular between 12 and 80 nucleotides, in particular between 12 and 50, in particular between 12 and 35 nucleotides, in particular between 15 and 25 nucleotides. The detection system comprising at least one fluorescent reporter bound to either the oligonucleotide probe or the controller oligonucleotide is capable of generating the signal or fluorescence reporter signal intensity as a function of the binding of the oligonucleotide probe to change to complementary sequences. Depending on the embodiment of the detection system, this change may result in a generation or increase or decrease of the signal.

During amplification, the third and fourth primer extension products are separated such that the 3 ^' segment of the third primer extension product and the corresponding fragment of the fourth primer extension product are in single stranded form. An oligonucleotide probe can bind to this 3 ^' segment of the third primer extension product or 5 ^' segment of the fourth primer extension product during the reaction or only after its completion.

The binding is essentially sequence-specific, but can tolerate deviations from complete complementarity.

The binding of the oligonucleotide probe preferably does not prevent amplification. The concentration of the probe and its length are adjusted so that sufficient amount of primers can initiate the synthesis of the primer extension products.

As the reaction progresses, a sufficient amount of primer extension products are formed so that the oligonucleotide probe can also bind sufficiently to cause a detectable signal change.

A suitable detection system comprising at least one fluorescence reporter further comprises in one embodiment at least one fluorescent quencher suitable for the fluorescent reporter. The fluorescence quencher (also called a quencher) can function as a contact quencher or as a FRET quencher. Relevant examples in the literature are known ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed Didenko, 2006, for example, Chapter 1 and 2; Product Description "Florescent Molecular Probes", published by Gene Link Inc.). For example, fluorescein (FAM) can serve as the fluorescent reporter, and BHQ-1 or BHQ-2 or TAMRA can occur as a suitable fluorescence quencher. In one embodiment, guanosine nucleobases may act as quenchers (e.g., in combination with a FAM as a reporter). When the fluorescence reporter is excited with a suitable light wavelength, an emission of the fluorescence signal takes place in the absence of the quencher. However, a spatial proximity between the fluorescent reporter and a suitable quencher reduces / decreases the intensity of a fluorescent reporter. With increasing distance / separation of the fluorescent reporter and the quencher, the signal intensity increases.

Another suitable detection system comprising at least one fluorescence reporter further comprises in one embodiment at least one to the fluorescent reporter matching donor fluorophore (also called donor) to form a FRET pair. Relevant examples in the literature are known ("Fluorescent Energy Transfer Nucleic Acid Probes" Ed Didenko, 2006, for example, Chapter 1 and 2, Product Description "Fluorescent Molecular Probes", published by Gene Link Inc.). A FRET pair usually includes a donor and an acceptor (usually a reporter acts as an acceptor). For example, as a fluorescent reporter tetramethylrodamine (TAMRA) can serve, as a suitable partner of a FRET pair FAM (donor) may occur, another example is FAM (donor) and Cy3 (as acceptor or reporter). When the donor excites (eg, FAM), the donor transfers the energy to the reporter (TAMRA or Cy3) so that the reporter himself is thereby enabled to use energy as electromagnetic radiation (detectable light signal or fluorescence signal). leave. This fluorescent signal of the reporter can be detected by suitable means. With increasing spatial separation of the reporter and the donor fluorophore, the signal decreases increasingly and is usually no longer measurable detectable from a distance of over 50 nucleotides (measured as 50 nucleotides of a double strand).

By appropriate positioning of individual elements of the detection system to oligonucleotide probe and / or controller oligonucleotide, it is possible to detect binding events of these components to the first primer extension product by signal increase or decrease.

Such detection may occur either during amplification (e.g., as on-line acquisition) or at appropriate intervals or even at the end of a reaction.

Detection of the fluorescence signal takes place in a detection step. In the detection step of the method should be checked whether the oligonucleotide probe has bound to the 3 ^' segment of the first primer extension product (P1 -Ext) complementary or not. In the detection step, the reaction temperature is therefore adjusted so that the probe would be able to substantially complementarily bind to the 3 ^' segment of the first primer extension product. This temperature may either correspond to one of the temperatures during amplification or represent a step separate from amplification temperature steps.

During this step, the response from a light source can be excited with the light of a suitable wavelength. Depending on the design of the detection system, the wavelength is adapted to the absorption spectrum of the fluorescent reporter or of the donor fluorophore. If the oligonucleotide probe can bind to the 3 ^' end of a synthesized first primer extension product, a signal from the fluorescent reporter is expected. This signal has a characteristic spectrum of wavelengths and can be detected and quantified by a corresponding detection system. Current real-time PCR devices typically include both excitation light source and detection system Detection of fluorescence from reporters, as well as temperature-controlled containers for reaction vessels. An example of this are real-time PCR devices such as StepOne or LightCycler or RotorGene.

The detection can be used to quantify one or more starting nucleic acid chains present in the reaction. Furthermore, the detection can be used to detect an availability of a starting nucleic acid chain at the beginning of a reaction. Furthermore, a detection system may be used in conjunction with an internal amplification control.

In another embodiment, two or more nucleic acid chains can be specifically amplified in an amplification approach. For example, combinations of specific first primers and / or specific controller oligonucleotides and / or specific second primers may be used. For example, target sequences and an internal amplification control are amplified in one approach. It is therefore advantageous to carry out the detection of individual nucleic acid chains separately and independently of one another during their amplification.

In one embodiment, specific detection systems are used in each case, so that monitoring of the amplification of a nucleic acid chain by means of a specific detection system takes place. The specific signals of fluorescence reporters can be detected simultaneously. Preferably, the spectral properties of fluorescent reporters differ so much that they can be made by detecting respective fluorescence signals at characteristic wavelengths. For example, two or three or four fluorescent reporters can be used. The respective specific wavelengths of fluorescence signals are preferably more than 10 nm, in particular more than 20 nm, in particular more than 30 nm measured at maximum intensity (fluorescence peak) of a fluorescence spectrum. Such combinations are known. For example, combinations comprising FAM and / or Cy3 and / or Cy5 or FAM and / or HEX and / or ROX are suitable. The respective quenchers are preferably chosen specifically for each fluorescent reporter, so that signal reduction by a quencher has a high efficiency. For example, combinations of FAM / BHQ-1 and HEX / BHQ-2 or FAM / BHQ-1 and Cy5 / BHQ-2 are used.

In a further embodiment, a detection system may be used which allows monitoring of the amplification of a group of different nucleic acid chains. This group may comprise two or more nucleic acid chains to be amplified. The components of a detection system are adjusted accordingly. In one embodiment, such a group of different nucleic acid chains to be amplified comprises, for example, at least one uniform sequence segment specific for the oligonucleotide probe used for complementary binding of an oligonucleotide probe under reaction conditions of a detection step. In another embodiment, such a group comprises different nucleic acid chains to be amplified For example, at least one sequence segment for a predominantly complementary binding of an oligonucleotide probe, wherein the sequence composition of this sequence segment is different within this group. These differences may range from 1 to 10 nucleotides, preferably from 1 to 3 nucleotides.

Other aspects and embodiments are to be found in the following items which illustrate but are not limited to the invention:

1 . Object: A method for amplifying a nucleic acid, wherein

a) a sample comprising a first nucleic acid polymer comprising a first target sequence M [and the M (reverse) complementary sequence M ^' ], wherein M in the 5'-3' orientation comprises in direct sequence the sequence sections MPL, MS and MPR, b) a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors;

c) a first left oligonucleotide primer PL1 which is (substantially) identical to MPL;

d) a first right oligonucleotide primer PR1 comprising in sequence 5'-3 'directly the sequence sections PCR and PMR, wherein PMR has the [hybridizing] sequence complementary to MPR [essentially sequence-specific binding] and the sequence section PCR not can bind to M [or a sequence immediately adjacent to MPR with respect to the sequence M in 3 '], and

wherein PR1 (in particular in the section PCR) comprises modified nucleotide units, so that PCR can not serve as template for the activity of the first template-dependent nucleic acid polymerase; and

e) a controller oligonucleotide CR comprising in sequence 5 'to 3' the sequences CSR, CPR and CCR in direct sequence, where CSR is identical to a portion of MS which is 5 'of MPR [and at initiation the polymerase is read from PR first, so CSR can bind to the polymerization product of primer PR1], CPR is complementary to PMR (and identical to MPR) and CCR is complementary to PCR,

and wherein CR comprises modified nucleotide building blocks in CSR so that CSR can not serve as template for the activity of the template-dependent nucleic acid polymerase;

2. Subject: The method for amplifying a nucleic acid according to the first article, wherein a first primer extension product PR1 'is obtained, which in the 5'-3' orientation in addition to the sequence regions PCR and PMR comprises a synthesized region PSR, which substantially complementary to the target sequence M in the 5 'to MPR adjacent region, and a second primer extension product PL1 'is obtained which, in addition to the sequence region MPL, comprises a synthesized region PSL which is substantially identical to the target sequence M in the region adjacent to MPL in 3',

and where

either the reaction conditions of the first amplification step are selected, and / or

the lengths and melting temperatures of PCR and possibly MS are selected so that PRT can form a double strand with M, [PL1 ^' can form a double strand with M ^' ,] [PRI ^' can form a double strand with PL1 ^' ], and PRT with C can form a duplex and the formation of the double strand of PRT and C is preferred over the formation of the double strand of PRT with M [at least in the range of MPR].

3. Subject: The method for amplifying a nucleic acid according to the 2.

Subject, being

the lengths and melting temperatures of PCR and optionally MS and / or the positions of MPL and MPR are selected

In the absence of the controller oligonucleotide CR, the first primer extension product PRT does not separate from the second primer extension product PLT.

4. Subject: The method according to any preceding item, wherein the sample is contacted in a second amplification step with the following components:

a) a second left oligonucleotide primer PL2, which is identical to a first secondary primer binding region MPL2,

b) a second right oligonucleotide primer PR2 which is complementary to a region MPR2,

wherein MPL2 and MPR2 are included in M and the 3 'end of MPL2 [at least 20 positions] is located 5' of the 5 'end of MPR2 (in particular MPL2 is identical to MPL and / or MPR2 is to MPR).

5. Subject: The method according to the fourth subject, wherein PL2 and / or PR2 [directly] have a sequence section PCL2 or PCR2 in 5 'of the sequence section identical or complementary to MPR2, respectively.

6. Subject: The method according to any one of the preceding items 1 to 5, wherein a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors) in the second amplification step are brought into contact with the sample.

7. Subject: The method according to any one of the preceding items 1 to 7, characterized in that the modified nucleotide building blocks 2'-0-Alkylribonukleosidbausteine, in particular 2'-0-Methylribonukleosidbausteine include.

8. Subject: The method according to any one of the preceding items 1 to 7, characterized in that the first amplification step is performed substantially isothermal.

9. Subject: The method of any one of preceding items 1 to 8, characterized in that MS has a length of 20 nucleotides to 200 nucleotides.

10. Subject: The method according to any one of the preceding items 1 to 9, characterized in that PR1 has a length in the range of 15 nucleotides to 100 nucleotides.

1 1. Object: The method according to any one of the preceding items 1 to 10, characterized in that PCR has a length in the range of 5 nucleotides to 85 nucleotides, in particular that PCR has between 50% and 300% of the length of the sequence segment PMR.

12. Item: The method according to any one of the preceding items 1 to 1 1, characterized in that CR (controller oligonucleotide) has a length in the range of 20 nucleotides to 100 nucleotides.

13. Subject: as method according to one of the preceding items 1 to 12, characterized in that the first amplification and the second amplification are carried out in the same reaction mixture.

14. Subject: The method according to any one of the preceding items 1 to 13, characterized in that the second template-dependent nucleic acid polymerase is a thermostable polymerase, in particular a thermostable DNA polymerase.

15. Subject: The method according to any one of the preceding items 1 to 14, characterized in that the first template-dependent nucleic acid polymerase is thermally inactivated, in particular that the first template-dependent nucleic acid polymerase is a mesophilic polymerase.

16. Subject: The method according to one of the preceding items 1 to 15, characterized in that the second template-dependent nucleic acid polymerase, the second right oligonucleotide primer PR2 and / or the second left oligonucleotide primer PL2 are activatable, and / or the controller oligonucleotide CR deactivatable is.

17. Subject: The method according to any one of the preceding items 1 to 16, characterized in that the components of the second amplification step after contacting the first amplification step are brought into contact with the sample. 18. Object: The method according to any one of the preceding items 1 to 17, characterized in that CR in CSR and CPR comprises a sequence region which can bind sequence-specifically to the second right oligonucleotide primer PR2.

19. Subject: The method according to any one of the preceding items 1 to 18, characterized in that the selected reaction conditions, in particular of the first amplification step, a reaction temperature in the range of 25 ° C to 80 ° C, in particular 50 to 70 ° C include.

20. Subject: A kit for performing a method according to any one of items 1 to 19, comprising:

a first right oligonucleotide primer PR1 comprising in sequence 5'-3 'immediately following sequence sections PCR and PMR, PMR to a primer binding site MPR of a genomic sequence M of a eukaryotic organism or of a pathogenic bacterium, in particular of a mammal, in particular a human target sequence, where M in the 5 'to 3' orientation directly comprises the sequence segments MPL, MS and MPR, and the sequence segment PCR can not bind to a sequence located directly in 3 'of MPR, and wherein

PR1 (in particular in the section PCR) modified nucleotide units, so that PCR can not serve as a template for the activity of the first template-dependent nucleic acid polymerase; and

a first left oligonucleotide primer PL1 which is (substantially) identical to MPL;

a controller oligonucleotide CR comprising, in the 5'-3 'orientation, the sequence sequences CSR, CPR and CCR in immediate succession, CSR being identical to a portion of MS which is 5' of MPR [and upon initiation of the polymerase read from PR first, so CSR can bind to the polymerization product of primer PR1], CPR is complementary to PMR (and identical to MPR), and CCR is complementary to PCR, and

wherein CR comprises modified nucleotide building blocks in CSR so that CSR can not serve as template for the activity of the template-dependent nucleic acid polymerase;

a second left oligonucleotide primer PL2 which is identical to a first secondary primer binding region MPL2, and

a second right oligonucleotide primer PR2 which is complementary to a region MPR2,

21. Item: The kit according to the 20th article, further comprising a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the DNA polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, in particular a mesophilic matrix-dependent polymerase, in particular a mesophilic matrix-specific polymerase without 5 ^' -3 ^' exonuclease activity.

22. Subject: The kit according to any one of items 20 and 21, further comprising a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, in particular a thermophilic one matrix-dependent polymerase, in particular a thermophilic matrix-dependent polymerase with 5 ^' -3 ^' exonuclease activity.

23. Subject: A method of amplifying a nucleic acid comprising the steps of: a) a first amplification comprising the steps of:

A first region which can bind sequence-specific to a region of the nucleic acid to be amplified, wherein the region of the nucleic acid to be amplified comprises at least the 5 ^' terminus of the target sequence or is located in the 5 ^' direction of the target sequence;

A second region which connects to the 5 'end of the first region or is linked via a linker, which second region can be bound by a controller oligonucleotide and remains substantially uncoated for the polymerase used under the chosen reaction conditions;

Extension of the first primer oligonucleotide (P1.1) by a first polymerase to obtain a first primer extension product (P1 .1-Ext) which comprises, in addition to the first primer oligonucleotide (P1.1), a synthesized region substantially is complementary to the nucleic acid to be amplified or to the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present as a double strand;

Binding of a controller oligonucleotide (C1 .1) to the first primer extension product (P1.1 -Ext), wherein the controller oligonucleotide (C1.1) comprises the following ranges:

A first region which can bind to the second region (overhang) of the first primer extension product (P1 .1-Ext), A second region which is substantially complementary to the first region of the first primer oligonucleotide (P1.1), and

A third region that is substantially complementary to at least part of the synthesized region of the first primer extension product (P1 .1-Ext); and

wherein the controller oligonucleotide (C1 .1) does not serve as a template for primer extension of the first primer oligonucleotide (P1 .1) and the first controller oligonucleotide (C1.1) to the first and second regions of the first primer extension product (P1 .1 - Ext) binds with displacement of the complementary to the first and second region region of the nucleic acid to be amplified;

Hybridizing a second primer oligonucleotide (P1 .1) to the first primer extension product, wherein the second primer oligonucleotide (P2.1) comprises a region that is sequence-specifically attached to the synthesized region of the first primer extension product (P1.1 -Ext) which is at least complementary to the 5 ^' terminus of the target sequence or located in the 3 ^' direction thereof;

Extension of the second primer oligonucleotide (P.2.1) by the first polymerase to obtain a second primer extension product (P2.1-Ext) which comprises, in addition to the second primer oligonucleotide (P2.1), a synthesized region which is substantially is identical to the nucleic acid or to the target sequence to be amplified, wherein the first primer extension product (P1.1 -Ext) and the second primer extension product (P2.1) form a first double-stranded amplification product; and b) a second amplification comprising the steps of:

Hybridizing a third primer oligonucleotide (P3.2) to the second primer extension product (P1 .1-Ext.) Of the first amplification product, wherein the third primer oligonucleotide (P3.2) comprises a first region which is sequence specific to a region the second primer extension product (P1 1-Ext.) comprising at least the 5 ^' terminus of the target sequence or located in the 5 ^' direction thereof;

Extension of the third primer oligonucleotide (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext) which comprises, in addition to the third primer oligonucleotide (P3.2), a synthesized region which is substantially complementary to the second primer extension product (P2.1-Ext) or to the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) are present as a duplex;

Hybridizing a fourth primer oligonucleotide (P4.2) to the first primer extension product (P1.1 -Ext), the fourth primer oligonucleotide (P4.2) a first region capable of binding sequence-specifically to the synthesized region of the first primer extension product (P1 .1-Ext) that is complementary to or at least to the 5 ^' terminus of the target sequence, or in the 3 ^' direction thereof;

Extension of the fourth primer oligonucleotide (P4.2) by the second polymerase to obtain a fourth primer extension product (P4.2-Ext) which comprises, in addition to the fourth primer oligonucleotide, a synthesized region substantially complementary to the first primer Extension product (P1.1 -Ext) or identical to the target sequence, wherein the first primer extension product (P1 .1-Ext) and the fourth primer extension product (P4.1 -Ext) are present as a double strand;

Separation of the double strand from the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer extension product (P2.1) and the third primer extension product ( P3.1);

A method according to item 23, characterized in that the steps of the first amplification are repeated until the first amplification product is present in a copy number in the range of 10 to 100,000,000,000, in particular from 100 to 1,000,000,000, in particular from 1,000 to 100,000. 000th

Method according to item 23 or 24, characterized in that the third primer oligonucleotide and / or the fourth primer oligonucleotide have a second region which adjoins the 5 'end of the first region or is linked via a linker, wherein the second region can not bind complementarily to the first primer extension product (P1.1 -Ext) or to the second primer extension product (P2.1-Ext).

Method according to one of the preceding items 23-25, characterized in that the separation of the double strand from the first primer extension product (P1 1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer Extension product (P2.1) and the third primer extension product (P3.1) is carried out by thermal denaturation, in particular at a temperature in the range of 85 ° C to 105 ° C.

Method according to one of the preceding items 23-26, characterized in that the first polymerase and the second polymerase are identical. 28. Method according to any of the preceding items 23-27, characterized in that the first primer oligonucleotide (P1.1) and the third primer oligonucleotide (P3.2) are substantially identical; and or

the second primer oligonucleotide (P2.1) and the third primer oligonucleotide (P4.2) are substantially identical.

29. Method according to one of the preceding items 23-28, characterized in that the first amplification and the second amplification are carried out in the same reaction batch.

30. Method according to item 29, characterized in that the second polymerase, the third primer oligonucleotide (P3.1) and / or the fourth primer oligonucleotide (P4.1) are activatable, and / or the controller oligonucleotide (C1 .1) can be deactivated.

31. The method according to any one of the preceding items 23 to 28, characterized in that the first amplification in a first reaction mixture and the second amplification are carried out in a second reaction mixture.

32. The method of item 31, characterized in that an aliquot of the first reaction mixture or the complete first reaction mixture is added to the second reaction mixture.

33. Method according to one of the preceding items 23-32, characterized in that the controller oligonucleotide (C 1.1) comprises a fourth region which can bind sequence-specifically to the third primer oligonucleotide (P3.2).

34. Method according to one of the preceding items 23-33, characterized in that the first amplification is carried out essentially isothermally.

35. The method according to one of the preceding items 23-24, characterized in that the first primer oligonucleotide (P1.1) in the second region has one or more modifications, in particular immediately following the first region of the first primer oligonucleotide, which stops the first polymerase at the second area.

36. A kit for carrying out a method according to any one of items 23 to 35, comprising:

a first primer oligonucleotide (P1.1) comprising the following ranges:

A second region adjoining the 5 'end of the first region or connected via a linker, which second region can be bound by a first controller oligonucleotide and by a polymerase used for the amplification under the selected reaction conditions in Essentially remains uncopied; wherein the first primer oligonucleotide (P1.1) can be extended by a polymerase to a first primer extension product (P1.1 -Ext) comprising a synthesized region in addition to the first primer oligonucleotide (P1.1);

a second primer oligonucleotide (P2.1), wherein the second primer oligonucleotide (P2.1) comprises a region which can bind sequence-specifically to the synthesized region of the first primer extension product (P1 .1-Ext) which is at least 5 ^'terminus of the target sequence is complementary or in ^3' - is the direction thereof, and a polymerase to a second primer extension product (P2.1-Ext) can be extended, which (in addition to the second primer oligonucleotide P2.1 ) a synthesized region comprises a controller oligonucleotide (C1 .1) comprising the following regions ::

A first region which can bind to the second region of the first primer extension product (P1.1 -Ext),

A second region which is substantially complementary to the first region of the first primer oligonucleotide (P1.1), and

A third region which is substantially complementary to at least a portion of the synthesized region of the first primer extension product (P1.1 -Ext);

wherein the controller oligonucleotide (C 1 .1) does not serve as a template for primer extension of the first primer oligonucleotide (P1 .1), and the controller oligonucleotide (C1 .1) to the first and second regions of the first primer extension product (P1.1 -Ext) can bind under displacement of the complementary to the first and second region region of the nucleic acid to be amplified;

a third primer oligonucleotide (P3.2), wherein the third primer oligonucleotide (P3.2) comprises a first region capable of sequence-specific binding to a region of the second primer extension product (P1.1 -Ext) comprising at least the first primer oligonucleotide (P3.2) 5 ^' terminus of the target sequence or is in the 5 ^' direction thereof, and can be extended from a polymerase to a third primer extension product (P3.2-Ext) which is next to the third primer oligonucleotide (P3.2). comprises a synthesized region; and

a fourth primer oligonucleotide (P4.2), wherein the fourth primer oligonucleotide (P4.2) comprises a first region capable of sequence-specific binding to the synthesized region of the first primer extension product (P1.1-Tex) which is at least to the 5 ^' terminus of the target sequence or in the 3 ^' direction thereof, and can be extended from a polymerase to a fourth primer extension product (P4.2-Ext) which is next to the fourth primer oligonucleotide (P4. 2) comprises a synthesized region. 37. Use of a kit according to item 36 for carrying out a method according to any one of items 23 to 36.

38. Subject: A method of amplifying a nucleic acid comprising the steps of: a) a first amplification comprising the steps of:

Provision of a starting nucleic acid 1.1, which comprises a target sequence

Hybridizing a first primer oligonucleotide (P1 .1) to a nucleic acid to be amplified with a target sequence (either starting nucleic acid 1 .1 or P2.1-ext), the first primer oligonucleotide (P1.1) comprising the following ranges:

A first region (P1 .1.1) which can bind sequence-specific to a region of the nucleic acid to be amplified (P2.1 E1),

A second region (P1 .1.2) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide and for the polymerase used under the selected reaction conditions essentially remains uncopied;

Extension of the first primer oligonucleotide (P1.1) by a first polymerase to obtain a first primer extension product (P1 .1-Ext) which comprises a synthesized region in addition to the first primer oligonucleotide (P1.1) (P1.1 E1 to P1 .1 E4) which is substantially complementary to the nucleic acid to be amplified or to the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present as a double strand;

A first region (01 .2.1) which can bind to the second region (overhang) of the first primer extension product (P1.1 E6),

A third region (C1 .2.3) that is substantially complementary to at least a portion of the synthesized region of the first primer extension product (P1 .1 E4); and

wherein the controller oligonucleotide (C 1 .1) does not serve as a template for a primer extension of the first primer oligonucleotide (P1 .1), and the first controller oligonucleotide (C1 .1) to the first primer extension product (P1.1 E6, P1 .1 E5, P1.1 E4) while displacing the region (P2.1 E1, P2.1 E2) which is complementary to this region, of the nucleic acid to be amplified;

Hybridizing a second primer oligonucleotide (P1.1) to the first primer extension product, wherein the second primer oligonucleotide (P2.1) comprises a region (P2.1.1) that is sequence-specifically attached to the synthesized region of the first primer extension product (P1.1). P1.1 E1) can bind,

Extension of the second primer oligonucleotide (P.2.1) by the first polymerase to obtain a second primer extension product (P2.1-Ext) which, in addition to the second primer oligonucleotide (P2.1), has a synthesized region (P2.1 E4 to P2.1 E1), which is substantially identical to the nucleic acid or to the target sequence to be amplified, wherein the first primer extension product (P1.1 -Ext) and the second primer extension product (P2.1) form a first double-stranded amplification product; and

Steps of the first amplification are repeated until the desired amount of first amplification products has been synthesized.

b) a second amplification with the steps:

Hybridizing a third primer oligonucleotide (P3.2) to the second and / or the fourth primer extension product (P1 1 -Ext. Or P4.1-Ext), wherein the third primer oligonucleotide (P3.2) comprises a first region (P3.1.1) which can sequence-specifically bind to a region of the second primer extension product (P2.1 E1) and the fourth primer extension product (P4.1 E2),

Extension of the third primer oligonucleotide (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext) which, in addition to the third primer oligonucleotide (P3.2), has a synthesized region (P3.1 E5 to P3.1 E2 or P3.1 E5 to P3.1 E1) which is substantially complementary to the second primer extension product (P2.1-Ext) or to the target sequence, the second primer extension product (P2.1 ) and the third primer extension product (P3.1) are present as a double strand;

Hybridizing a fourth primer oligonucleotide (P4.2) to the first primer extension product (P1 .1-Ext) and / or to the third primer extension product (P3.1-Ext) wherein the fourth primer oligonucleotide (P4.2 ) comprises a first region (P4.1 .1) which can sequence-specifically bind to the synthesized region of the first primer extension product (P1.1 E1) and the third primer extension product (P3.1 E2),

Extension of the fourth primer oligonucleotide (P4.2) by the second polymerase to yield a fourth primer extension product (P4.2-Ext) which has a synthesized region adjacent to the fourth primer oligonucleotide (P4.1 E5 to P4.1 E2 or P4.1 E5 to P4.1 E1) which is substantially complementary to the first primer extension product (P1.1 -Ext) or identical to the target sequence, the first primer Extension product (P1.1 -Ext) and the fourth primer extension product (P4.1-Ext) are present as a double strand;

Separation of the double strand from the first primer extension product (P1.1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer extension product (P2.1-Ext) and the third primer Extension product (P3.1 -EX) and the double strand from the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1-Ext);

A method according to item 38, characterized in that the steps of the first amplification are repeated until the first amplification product is present in a copy number in the range of 10 to 100,000,000,0000, in particular from 100 to 1,000,000,000, in particular from 1,000 to 100,000. 000th

Method according to item 38 or 39, characterized in that the third primer oligonucleotide and / or the fourth primer oligonucleotide have a second region (P3.1.2 or P4.1 .2) which adjoins the 5 'end of the the second region may not bind complementarily to the first primer extension product (P1 .1-Ext) or to the second primer extension product (P2.1-Ext).

Method according to any one of the preceding items 38-40, characterized in that the separation of the double strand from the first primer extension product (P1 1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer Extension product (P2.1-Ext) and the third primer extension product (P3.1-Ext) and the double strand from the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1 -Ext ) is carried out by thermal denaturation, in particular at a temperature in the range of 85 ° C to 105 ° C.

Method according to one of the preceding items 38-40, characterized in that the first polymerase and the second polymerase are identical.

Method according to one of the preceding articles, characterized in that the first primer oligonucleotide (P1 .1) and the third primer oligonucleotide (P3.2) are substantially identical; and or

the second primer oligonucleotide (P2.1) and the fourth primer oligonucleotide (P4.2) are substantially identical.

44. Method according to one of the preceding items 38-40, characterized in that the first amplification and the second amplification are carried out in the same reaction batch.

45. Method according to item 44, characterized in that the second polymerase, the third primer oligonucleotide (P3.1) and / or the fourth primer oligonucleotide (P4.1) are activatable, and / or the controller oligonucleotide (C1 .1) can be deactivated.

46. The method according to any one of the preceding items 38-45, characterized in that a first labeled with a fluorescent dye oligonucleotide probe can bind to the third primer extension product complementary and the signal of the

Fluorescent dye is detected.

47. The method according to any one of the preceding items 38-46, characterized in that a first marked with a fluorescent dye oligonucleotide probe can bind to the fourth primer extension product complementary and the signal of the

Fluorescent dye is detected.

Examples

Material and methods:

Reagents were purchased from the following commercial suppliers:

unmodified and modified oligonucleotides (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences); Polymerases NEB (New England Biolabs); dNTP ^'s : Jena Bioscience; intercalating EvaGreen dye: Jena Bioscience; Buffer substances and other chemicals: Sigma-Aldrich; Plastic goods: Sarstedt

Solution 1 (amplification reaction solution 1):

Potassium glutamate, 50 mmol / l, pH 8.0; Magnesium acetate, 10 mmol / l; dNTP (dATP, dCTP, dTTP, dGTP), 200 pmol / l each; Polymerase (Bst 2.0 warm start, 120,000 U / ml NEB), 12 units / 10 pl; Triton X-100, 0.1% (v / v); EDTA, 0.1 mmol / l; TPAC (tetrapropylammonium chloride), 50 mmol / l, pH 8.0; EvaGreen dye (dye was used according to manufacturer's instructions in 1:50 dilution). Solution 2 (amplification reaction solution 2):

1x isothermal buffer (New England Biolabs); in simple concentration, the buffer contains: 20 mM Tris-HCl; 10mM (NH ₄ ) ₂ S0 ₄ ; 50 mM KCl; 2mM MgSO ₄ ; 0.1% Tween® 20; pH 8.8@25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;

EvaGreen dye (dye was used according to manufacturer's instructions in 1:50 dilution)

Solution 4 (amplification reaction solution 4):; 1 x Isothermal buffer (New England Biolabs), see above.

All concentrations are indications of the final concentrations in the reaction. Deviations from the standard reaction are indicated accordingly.

The melting temperature (Tm) of the components involved was determined at the concentration of 1 pmol / l of respective components in solution 1. Different parameters are indicated in each case.

General information on reactions (first amplification)

The start of the reaction was carried out by heating the reaction solutions to reaction temperature, since Bst 2.0 polymerase warm start at lower temperatures is largely inhibited in their function by a temperature-sensitive oligonucleotide (according to the manufacturer). The polymerase becomes increasingly more active from a temperature of about 45 ° C, at a temperature of 65 ° C, no differences between Polymerase Bst 2.0 and Bst 2.0 warm start were found. To prevent the extensive formation of by-products (e.g., primer dimers) during the preparation phase of a reaction, Polymerase Bst 2.0 Warmstart was used. Deviations are specified.

Reaction stop was carried out by heating the reaction solution to above 80 ° C, e.g. 10 min at 95 ° C. At this temperature, polymerase Bst 2.0 is irreversibly denatured and the result of the synthesis reaction can not be subsequently changed.

Reactions were carried out in a thermostat with a fluorescence measuring device. For this purpose, a commercial real-time PCR device was used, StepOne Plus (Applied Biosystems, Thermofischer). The reaction volume was 10 pl by default. Deviations are indicated.

Both endpoint determination and kinetic observations were made. For end point determinations, the signal was registered, for example, by dyes bound to nucleic acids, eg by TMR (tetramethyl-rhodamine, also called TAMRA) or by FAM (fluorescein). The wavelengths for excitation and measurement of the fluorescence signals of FAM and TMR are stored as factory settings in the StepOne Plus Real-Time PCR device. Also, an intercalating dye (EvaGreen) was used in end point measurements (eg when measuring a melting curve). Eva Green is an intercalating dye and is an analog of the commonly used dye Sybrgreen, but with somewhat less inhibition of polymerases. The wavelengths for excitation and measurement of the fluorescence signals of SybrGreen and EvaGreen are identical and are stored as factory settings in the StepOne Plus Real-Time PCR device. The fluorescence can be continuously detected by means of built-in detectors, ie "online" or "real-time". Since the polymerase synthesizes a double strand during its synthesis, this technique could be used for kinetic measurements (real-time monitoring) of the reaction. Due to a certain cross-talk between color channels in the StepOne Plus device, partially increased basal signal intensity was observed in measurements in which, for example, TMR-labeled primers in concentrations of more than 1 pmol / l (eg 10 pmol / l) were used , It has been observed that TMR signal in Sybr-Green channel leads to increased basal levels. These increased baseline values were taken into account in calculations.

The kinetic observations of response curves were routinely recorded by fluorescence signals from fluorescein (FAM-TAMRA Fret pair) and intercalating dyes (EvaGreen), respectively. Time-dependence of the signal course was registered (real-time signal acquisition with StepOne plus PCR device). An increase in the signal during a reaction compared to a control reaction was interpreted according to the design of the approach. For example, an increase in the signal using Evagreen dye was interpreted as an indication of an increase in the amount of double-stranded nucleic acid chains during the reaction, and thus as a result of ongoing DNA polymerase synthesis.

In some reactions, a melting curve determination was performed following the reaction. Such measurements allow conclusions about the presence of double strands, which can absorb, for example, intercalating dyes and thereby significantly enhance the signal intensity of dyes. As the temperature increases, the proportion of double strands decreases and the signal intensity also decreases. The signal is dependent on the length of nucleic acid chains and on the sequence composition. This technique is well known to a person skilled in the art.

For example, when using melting curve analysis in conjunction with reactions containing significant levels of modified nucleic acid chains (eg, controller oligonucleotides or primers), the EvaGreen dye signal was found to differ between B-form of DNA and A-form of DNA can behave modified nucleic acid chains. For example, in the B-form of the double-stranded nucleic acid chains (commonly believed for classical DNA segments), higher signal intensity has been observed than with double-stranded nucleic acid chains having the same sequence of nucleobases which may adopt an A-form-like conformation (eg, several ^' -0-Me modifications of nucleotides). This observation has been taken into account when using intercalating dyes. If necessary, the reaction was analyzed by capillary electrophoresis and the length of fragments formed was compared to a standard. In preparation for capillary electrophoresis, the reaction mixture was diluted in a buffer (Tris-HCl, 20 mmol / l, pH 8.0, and EDTA, 20 mmol / l, pH 8.0) to such an extent that the concentration of labeled nucleic acids was ca. 20 nmol / l. Capillary electrophoresis was performed by GATC-Biotech (Konstanz, Germany) as a contracted service. According to the supplier, capillary electrophoresis was performed on an ABI 3730 Cappilary Sequencer under standard conditions for Sanger sequencing using POP7 gel matrix, at about 50 ° C, and performed at a constant voltage (about 10 kV). The conditions used led to denaturation of double strands, so that the single-stranded form of nucleic acid chains was separated in capillary electrophoresis. Electrophoresis is a standard technique in genetic analysis. Automated capillary electrophoresis is now routinely used in Sanger sequencing. The fluorescence signal is recorded continuously during capillary electrophoresis (usually using virtual filters) to produce an electrophorogram in which the signal intensity correlates with the duration of the electrophoresis. For shorter fragments, eg unconsumed primers, one observes an earlier signal peak, with extended fragments there is a temporal shift of the signals proportional to the length of the extended region. Thanks to guided controls of known lengths, the length of extended fragments can be measured. This technique is known to a person skilled in the art and is also used by default in fragment length polymorphism.

Unless otherwise defined with respect to a particular sequence, both upper case and lower case letters agct and AGCT refer to the deoxyribonucleotide building blocks of the DNA, or the corresponding ribonucleotides or base analogs. In some embodiments, uracil nucleobases are used in modified sequence segments, so as the sugar 2 were - OMe modifications used (ribose 2 ^'-0-methyl modification). Other 2 ^'-0-alkyl modifications are possible. In amplification approaches with dUTP (especially first amplification reaction), amplification fragments are generated which comprise dUMP (as protection against contamination). In general, however uracil bases can be used with both 2 ^{'-deoxy-ribose} and ribose; The person skilled in the disclosure as a whole extracts from the disclosure the teaching relating to the respective sequence segments of the sequences used here for determining at which sites classical DNA backbones, RNA or base analogues can be usefully used. Example 1 (Fig. 36)

Use of human genomic DNA as a source of target sequence

In this example, the use of human genomic DNA (hgDNA) as the source of a target sequence is shown. The target sequence was a sequence segment of the Factor V Leiden gene (Homo sapiens coagulation factor V (F5), mRNA, referred to herein as the FVL gene).

Only the first amplification was performed. The example shows that a controller-dependent first amplification can be performed. In this example, no second amplification was performed.

Target sequence:

5 ^' GTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA - 3 ^' (SEQ ID NO: 001)

The binding sequence for the first primer oligonucleotide is underlined. The second primer oligonucleotide binds with its 3 ^' segment to the reverse complement of the double underlined sequence.

The first primer, the second primer, and controller oligonucleotide were designed and synthesized for the FVL mutation variant of the gene.

The first primer oligonucleotide: P1 F5-200-AE2053

5 ^' AACT CAG ACAAG ATGTG AT ttTTTT AC CTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ^' (SEQ ID NO: 2):

The segment used as the primer in the reaction is underlined.

A = 2 ^{'deoxy-adenosine;} C = 2 ^{'deoxy-cytosine;} G = 2 ^{'deoxy-guanosine;} T = 2 ^{'deoxy-thymidine} (thymidine)

This oligonucleotide comprises the following modifications:

1 = C3 linker served to terminate the synthesis of the second primer extension product.

The in square brackets segment of the primer [CUCU GAUGCUUC] comprised Me modifications 2 ^'-0- and served as the second primer region capable of binding the first portion of the controller oligonucleotide:

A = (2 ^{'-0-methyl-adenosine);} G = (2 ^{'-0-methyl-guanosine);} C = (2 ^{'-0-methyl-cytosine);} U = (2 ^{'-0-methyl-uridine)}

This primer oligonucleotide comprises the first region (positions 1 - 12 from the 3 ^' end), the second region (C3 linker, as well as positions 13 - 24 from the 3 ^' end), and a segment with an additional sequence variant P1 (positions 25 - 57 from the 3 ^' end). The first region and the second region are necessary for the execution of a specific amplification and can be summarized as "basic structure of the first primer" or "minimal structure of the first primer". The additional sequence variant P1 represents an example of additional sequence segments, which can be integrated on the first primer oligonucleotide. Positions 1-12 serve as template in synthesis of the second primer extension product. C3 modification and the second region prevent synthesis from continuing at positions 25-57 during synthesis of the second primer extension product.

Primer 2: P2G3-5270-7063

5 ^' CT ACAGAACT CAG ACAAG ATGTG AACT ACAT GTT 6

G CT CAT ACT AC AATGTC ACTT ACTGTAAG AG C AG A 3 ^' (SEQ ID NO: 3)

The segment used as the primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

6 = HEG linker

This primer oligonucleotide comprises a copyable region and a non-copyable region. The copyable region comprises (positions 1-13 of the 3 ^' end which can bind to sequence of FVL gene within hgDNA and positions 14-35 which, while not complementary to sequence of FVL gene, bind during amplification can bind the first primer extension product). The copyable region can be summarized as "base structure of the second primer" or "minimal structure of the second primer".

The uncopyable region (positions 36 to 70 from the 3 ^'end which is not complementary to bind to the sequence of FVL- gene) is separated by HEG modification of copiable area, which the continuation of the synthesis at positions 36-70 during a synthesis of the first Primer extension product prevented. The uncopiable region provides an example of an additional sequence variant P2, which can be integrated on the second primer oligonucleotide.

The following controller oligonucleotide was used: AD-F5-1001 -503

5 ^' [UAAUCUGUAA GAGCAGAUCCCUGGACAGGC AA GGAAUACJAGGTAGAAGCATC AGAG X 3 ^' (SEQ ID NO: 4)

The in square brackets 5 ^'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] included ^2' -0-Me-nucleotide modifications:

Modifications: A = (2 ^{'-0-methyl-adenosine);} G = (2 ^{'-0-methyl-guanosine);} C = (2 ^'-0-methyl cytosines); U = (2 ^{'-0-methyl-uridine)}

X = 3 ^'phosphate group for blocking a possible extension by polymerase. The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ^' end of the controller oligonucleotide is blocked with a phosphate group to prevent possible extension by the polymerase.

The first primer comprises in its first region a sequence which can specifically bind to the sequence of the Factor V Leiden gene within the genomic DNA such that synthesis by a polymerase can be started. The second region of the first primer comprises a sequence that does not specifically hybridize to the sequence of the FVL gene. Furthermore, the first primer comprises a further sequence segment, which connects to the 5 ^' end of the second region (additional sequence variant P1). This segment does not participate in the specific amplification of the factor 5 Leiden segment. The function of this segment is mainly seen in the delay of side reactions.

The second primer comprises a segment in its 3 ^' segment which can specifically bind to the genomic DNA such that synthesis by a polymerase can be started. The 5 ^' segment of the second primer comprises a sequence which does not specifically hybridize to the sequence of the FVL gene. During reverse synthesis, this sequence segment can be copied. The second primer comprises a further sequence segment which can specifically hybridize neither with the controller oligonucleotide, nor with the first primer, nor with the second primer. This segment was located at the 5 ^' end of the second primer and is separated from the 5 ^' end of the primer by a HEG linker (additional sequence variant P2). This segment does not participate in the specific amplification. The function of this segment is mainly seen in the delay of side reactions.

The controller oligonucleotide was designed so that a perfect match situation results in the sequence of the Factor V Leiden mutation of the FVL gene. The controller oligonucleotide comprises first, second and third regions.

The genomic DNA used was the WHO standard for the FVL mutation. Prior to use in the reaction, the DNA was denatured by heating (5 min at 95 ° C) and thus converted from the double-stranded state to the single-stranded state. Based on this single-stranded hgDNA, a start-up nucleic acid chain was first created by a primer extension. Subsequently, an exponential amplification was carried out starting from this starting nucleic acid chain. The specificity of the amplification was demonstrated by melting curve analysis and Sanger sequencing with a sequencing primer.

All reactions were carried out in Amplification Solution 1.

The dNTPs used included: dATP, dGTP, dCTP, dUTP (instead of dTTP).

The polymerase used was Bst 2.0 Warm-Start Polymerase from NEB.

The starting nucleic acid chain was generated as follows: Approximately 50,000 haploid genomic equivalents (HGE), 150 ng hgDNA, were in contact with the second primer (0.5 pmol / l) and Bst-2.0 Warm Start Polymerase (approximately 1 unit), as well as dNTPs (approximately 250 pmol / l ) were brought under hybridization conditions (Amplifikationslösung 1, temperature of about 60 ° C) in 50 pl reaction volume and incubated for about 10 min. During this phase, the second primer is extended, with the genomic DNA as template. The result is a primer extension product which can serve as a starting nucleic acid. After completion of this reaction, the reaction mixture was heated to 95 ° C for about 10 minutes to separate this starting nucleic acid chain. This reaction mixture was frozen and used as a source of starting nucleic acid chain as needed.

The specific amplification of the target sequence of the FVL gene was carried out using 5 .mu.l of the reaction mixture with the starting nucleic acid chain (corresponds to about 5000 HGE).

The other reaction components (first primer, second primer, controller oligonucleotide, Eva Green dye, Polymerase Bst.2.0 Warm Start, dNTPs) were added to give a final reaction volume of about 10 μl. The final concentrations of the components were: first primer: 5 pmol / l, second primer:

2 pmol / l, controller oligonucleotide: 1 pmol / l, Eva Green dye (1:50), polymerase Bst.2.0 Warm Start (about 8 units), dNTPs: about 250 pmol / l.

In the control approach no hgDNA was added.

The reaction was carried out in a Step-One Plus instrument (Thermofisher Scientific).

The reaction temperature was initially changed by cyclic changes (30 cycles) between 65 ° C (5 min, including detection step) and 55 ° C (1 min) and then held constant for 1 hr at 65 ° C (detection step every 2 min). The course of the reaction was monitored by signal detection of the EvaGreen dye. After completion of the reaction, the reaction mixture was first brought to 95 ° C for 10 minutes, and then a melting curve of the formed products was measured.

First, a preparation of a starting nucleic acid chain was carried out (schematically FIG. 50). Subsequently, an exponential amplification was carried out with extension of the first primer and the second primer and the controller oligonucleotide.

As a result of the amplification, accumulation of amplification fragments occurs. The result of the detection of the amplification can be seen in FIG. It can be seen that approximately after 2 hr of the reaction a visible increase in fluorescence occurs (36 A). The subsequent melting curve analysis showed a specific melting curve with Tm of 84 ° C. (FIG. 36 B).

Sequence check (Figure 36C):

Sequence checking was carried out by means of a sequencing primer:

SeqP1 F5-35-x03 5 ^'- AAG CTCGACAAAAGAAC TCAG AG TGTG CTCGAC AC tacctgtattcc ttgcc ^3' (SEQ ID NO: 005)

A = 2 ^{'deoxy-AdenosinC} = ^2' deoxy-cytosine; G = 2 ^{'deoxy-guanosine;} T = 2 ^{'deoxy-thymidine} (thymidine)

For sequence testing, the reaction mixture (after measuring the melting curve) was diluted with water (from about 1:10 to about 1: 100) and the respective aliquots were mixed with a sequencing primer (added in concentration of 2 pmol / l). This mixture was shipped by a commercial sequencing provider (GATC-Biotec) and sequenced by Sanger sequencing as order sequencing. The resulting electropherograms were checked for agreement with the FVL sequence gene. As a result of the reaction, sequence of the FVL gene was identified.

Example 2 (Figure 37):

Selective amplification reaction of sequence variants of a target sequence.

In this example, the influence of a sequence change in the template on the amplification was investigated. Upon extension of the first primer oligonucleotide, a complementary strand is formed which has a complementary sequence to the template and thus comprises these deviations in the sequence. In this way, it should be examined what effect such a mismatch between a resulting first primer extension product and a controller oligonucleotide has on the amplification. The position of the mismatch lies in the 3 ^' direction of the first primer and is therefore not checked by the primer but by the controller oligonucleotide.

Discrimination between individual sequence variants of the target sequence thus takes place by means of a controller oligonucleotide using a uniform first and second primer.

Only the first amplification was performed. The example shows that a controller-dependent first amplification with discrimination between two target sequence variants can be performed. In this example, no second amplification was performed.

The following matrices were used:

Template (SEQ ID NO 6) having sequence composition resulting in a first primer extension product with a perfect-match match with controller oligonucleotide:

M2SF5-M001 -200

5 ^' GCT CATA CTACAATGTCA CTTA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO: 6)

A = 2 ^{'deoxy-AdenosinC} = ^2' deoxy-cytosine; G = 2 ^{'deoxy-guanosine;} T = 2 ^{'deoxy-thymidine} (thymidine) The binding sequence for the first primer oligonucleotide is underlined. The second primer oligonucleotide binds to the reverse complement of the double underlined sequence (35 positions in 5 'terminus).

Template (SEQ ID NO 7) having sequence composition leading to a first primer extension product that mismatches with the controller oligonucleotide at a single base position (in bold):

M2SF5-WT01-200

5 ^' GCT CATA CTACAATGTCA CTTA CTGTAA GAGCAGATCC CTGGACAGGC GA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO: 7)

The binding sequence for the first primer oligonucleotide is underlined. The second primer oligonucleotide binds to the reverse complement of the double underlined sequence.

The following primers were used:

The first primer oligonucleotide:

P1 F5-200-AE2053

5 ^' AACT CAG ACAAG ATGTG AT ttTTTT AC CTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ^' (SEQ ID NO: 2)

The segment used as the primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

Segment of the primer [CUCU GAUGCUUC] included 2 ^'-0-Me modifications and served as the second primer region capable of binding the first portion of the controller oligonucleotide:

A = (2 ^{'-0-methyl-adenosine)} G = ^(2' -0-methyl-guanosine); C = (2 ^{'-0-methyl-cytosine);} U = (2 ^{'-0-methyl-uridine)}

Primer 2: P2G3-5270-7063

5 ^' CT AC AG AACT CAG ACAAG AT GT AACT AC AATGTT 6

GCT CAT ACT AC AATGTC ACTT ACTGT AAG AG C AG A 3 ^' (SEQ ID NO: 3)

The segment used as primer in the reaction is underlined.

This oligonucleotide comprises the following modifications: 6 = HEG linker

The following controller oligonucleotide was used:

AD F5-1001-503

5 ^' [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUACjAGGTAGAAGCATC AGAG X 3 ^' (SEQ ID NO: 4)

The in square brackets 5 ^'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] includes ^2' -0-Me-nucleotide modifications:

modifications:

X = 3 ^'phosphate group for blocking a possible extension by polymerase.

The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ^' end of the controller oligonucleotide is blocked with a phosphate group to prevent possible extension by the polymerase.

Four approaches have been prepared:

As a starting nucleic acid sequence, batch 1 contains the template M2SF5-M001 -200 (Perfect Match Situation) in a concentration of 300 fmol / l (corresponds to approx. 2x10 ^L 6 copies / batch).

As starting nucleic acid sequence, batch 2 contains the template M2SF5-M001-200 (Perfect Match Situation) in a concentration of 300 amol / l (corresponds to approx. 2x10 ^L 3 copies / batch).

Approach 3 does not contain a template and thus forms a control.

As starting nucleic acid sequence, batch 4 contains the template M2SF5-WT01-200 (single mismatch situation) in a concentration of 300 pmol / l (about 2x10 ^L 9 copies per batch).

Primer 1 was used at 5 pmol / L, the controller oligonucleotide at 2 pmol / L and primer 2 at 1 pmol / L.

The other reaction conditions were: Amplification solution 2.

To readjust the presence of genomic DNA in the assay, 100 ng of freshly denatured fish DNA (salmon DNA) was added per reaction.

The thermal reaction conditions were cyclic alternating temperature changes, each followed by a 5 minute time interval at 65 ° C for a 2 minute time interval at 55 ° C. The Amplification was followed for 100 cycles. Detection was carried out at 65 ° C for Eva Green fluorescence signal.

The successful amplification could be detected by an increase in the EvaGreen fluorescence signal over time.

Temperature changes and real-time monitoring were performed with the StepPne Plus Real-Time PCR device from Thermofisher.

Fig. 37 shows a typical course of the EvaGreen signal. On the Y-axis is the increase of the fluorescence signal (Delta Rn) and on the X-axis the reaction time (as cycle number) is plotted. Arrows mark individual reaction approaches. The selected positions belong to the following approaches:

Arrow 1: 300 fmol / l perfect match matrix (about 2x10 ^L 6 copies / batch)

Arrow 2: 300 amol / l perfect match die (about 2x10 ^L 3 copies / batch)

Arrow 3: no die

Arrow 4: 300 pmol / l mismatch template (about 2x 10 ^L 9 copies per batch).

The increase of the fluorescence signal is seen both in the perfect match and in the mismatch variant of the template, the signal of the mismatch variant (4) appearing later despite a 100-fold excess. It can be seen that the mismatch amplification signals are significantly delayed from the perfect match amplification signal. With the single mismatch, a delay of about 15 cycles is observed. The time delay (= number of cycles) is a direct measure of the discrimination in the amplification. Further quantification of discrimination in amplification can be achieved by comparison with a template concentration series under perfect match amplification.

Using a Perfect-Match template results in the synthesis of a complementary strand of a primer extension product. This extension product is complementary to both the Perfect Match template and the controller oligonucleotide used.

In contrast, using a mismatch sequence, the synthesis of the first primer extension product results in the generation of a complementary strand of the extension product which, while having complete complementarity to the mismatch template, is thereby complemented by the third region of the controller - Oligonucleotide deviates. This deviation occurs in the 5 ^' -store segment of the extension product, which should react with controller oligonucleotide to allow the strand displacement process to proceed. As shown in the present example, the mismatch interferes with strand displacement by the controller oligonucleotide.

The control reactions with a Perfect Match template (arrows 1 and 2) showed a concentration dependence of the amplification. With decreasing concentration needed the reaction longer time to synthesize a sufficient amount of the nucleic acid to be amplified for the signal to rise above the baseline level.

This result illustrates the importance of the base composition in the controller oligonucleotide: deviations from the complementarity between the controller oligonucleotide and the primer extension product can lead to slowing or even disruption of the amplification.

In this example it was shown that although the sequence ends of the perfect match template and the mismatch template were completely identical, and thus the potential for binding of both primer oligonucleotides was the same, both reactions proceeded completely differently: with a complete complementarity between the Controller oligonucleotide and the 5 ^' segment of the extension product of the first primer oligonucleotide proceeded according to the amplification. An interruption of strand displacement by a sequence deviation (in this case by a mismatch) led to the suppression of the amplification.

Example 3 (Figures 38-42):

Use of two amplifications: a first amplification and followed by a second amplification

In this embodiment it is demonstrated that amplification products of the first amplification (first amplification) can be used by a downstream, classical PCR (second amplification) as starting nucleic acid chains. Thus, a total of two separate amplification reactions were carried out: first a first amplification, then a second amplification.

First amplification

First, a first amplification was performed using a single-stranded nucleic acid chain (here as a single-stranded starting nucleic acid chain 1.1) comprising a target sequence using a first amplification system. The reaction conditions used (temperature of 55 ° C and 65 ° C) do not permit spontaneous separation of the double strand formed during the reaction comprising the first primer extension product and the second primer extension product in the absence of a controller oligonucleotide.

The first amplification system included the following components:

A first primer oligonucleotide,

A second primer oligonucleotide,

A controller oligonucleotide and

A polymerase, (Bst 2.0 Warm Start Polymerase), which has strand displacement properties • as well as necessary substrates for polymerase (dNTP ^'s : dATP, dCTP, dGTP, dTTP) and suitable buffer systems (The reaction was carried out in isothermal buffer 1 x (NEB)).

The progress of the reaction was detected by means of EvaGreen at 65 ° C.

At the concentration ratios of the first primer oligonucleotide (5mioI / I) and the controller oligonucleotide (2mioI / I), the first primer is in relative excess to the controller oligonucleotide. The melting temperature of the complex comprising the first primer oligonucleotide and the controller oligonucleotide was about 63 ° C. (Tm), measured in the same reaction solution.

In the first amplification reaction two temperature ranges were used:

55 ° C (2 min) and 65 ° C (2 min). At temperature step 55 ° C, the controller oligonucleotide was completely in complex with the first primer oligonucleotide. This prevented the controller oligonucleotide from binding to the first primer extension product. At the second temperature step (65 ° C), this complex was able to dissociate at least partially from the complex, so that free, single-stranded controller oligonucleotides were available in preparation. Such a free controller oligonucleotide may either form a complex with a new first primer oligonucleotide or anneal to the first primer extension product. Contact with the first primer extension product begins by complementary binding of the sequence segments of the first region of the controller oligonucleotide to the corresponding sequence segments of the second primer region, which are not copied by the polymerase.

The individual synthesis processes and strand separation processes essentially comprise the following processes:

The first primer oligonucleotide can thereby bind specifically to the 3 ^' segment of the nucleic acid chain provided (starting nucleic acid chain 1.1) and be extended by the polymerase (this reaction proceeds predominantly at 55 ° C.). The synthesis proceeds to the end of the template strand (5 ^' region of the starting nucleic acid chain). This resulted in a first primer extension product. The controller oligonucleotide can bind to this first primer extension product by displacing the template strand (here initially the starting nucleic acid chain) by complementary base pairing (this reaction proceeds predominantly at 65 ° C). The separation of the 3 ^' segment of the first primer extension product (which was not bound by the controller) from the complex with the template strand was predominantly temperature-induced at 65 ° C. (the Tm of this 3 ^' segment was below 65 ° C.) ). The 3 ^' segment of the first primer extension product thereby became single-stranded. The first primer extension product was thus in complex with the controller oligonucleotide. The second primer oligonucleotide was now able to complementarily bind to this 3 ^' segment of the synthesized first primer extension product and to initiate the synthesis of the second primer extension product by the polymerase (this step can be performed at 55 ° C as well) also at 65 ° C). The synthesis was carried out with simultaneous displacement of the controller oligonucleotide from binding to the first primer extension product. The polymerase used in the first primer extension reaction (Bst 2.0 Warm Start) has a strand displacing property. Synthesis of the second primer extension product occurred up to and including the first region of the first primer, which was hereby copied from the polymerase. The synthesis of the second primer extension product was terminated by a C3 linker in the first primer extension product so that the second portion of the first primer extension product was not copied from the polymrease. The result was the second primer extension product, which formed a double strand with the first primer extension product (Tm of this double strand = first amplification product was about 79 ° C). Repeated heating of the reaction mixture to 65 ° C re-bound the controller oligonucleotide to the first primer extension product so that now the second primer extension product was released from its binding to the first primer extension product.

As a result of the release of the second primer extension product, this product could now serve as a template: the second primer extension product comprises in its 3 ^' segment a sequence which is complementary to the first region of the first primer and thus capable of forming a new primer To bind oligonucleotide and start the synthesis by means of the polymerase.

As a result, repeated synthesis and strand separation events occurred, with both synthesized primer extension products occurring as templates in subsequent cycles.

The first amplification product could be synthesized starting from the starting nucleic acid chain (1 .1) using primers provided with the aid of the provided controller oligonucleotide until the desired amount of copies was reached (here the concentration of the first amplification product 1 .1 was about 0.8-1 pmol / L towards the end of the first amplification, which corresponds to about 1000,000,000,000 copies in a 10 μl reaction mixture). The number of copies was estimated by way of illustration from concentration.

The reaction was stopped by heating to 95 ° C for 10 min, denaturing the first polymerase. Melting-fast analysis was then performed to confirm the specific amplification. The reaction mixture was frozen and used as needed in the second amplification.

Second Amplification (PCR) After completion of the first amplification, a portion of the first reaction mixture was added to the second amplification. The first amplification fragment (1 .1) synthesized during the first amplification served as second starting nucleic acid chain (2.1) for the second amplification.

Several dilution steps of the first completed amplification run were added to the second amplification reaction which resulted in a dilution series.

It should be noted that no purification of formed first amplification fragments (1.1) occurred, but only a dilution. So that all unused components of the first amplification system - albeit in diluted form - also templates in the second amplification step.

The PCR reaction conditions used (three temperature ranges of 55 ° C (1 min) and 72 ° C (3 min) and 95 ° C (20 sec) allowed standard PCR (second amplification) to be performed.

The second amplification system each comprised the following components:

A third primer oligonucleotide,

A fourth primer oligonucleotide,

A polymerase, (Taq polymerase), which is a thermostable polymerase

• as well as necessary substrates for polymerase (dNTP ^'s : dATP, dCTP, dGTP, dTTP) and suitable buffer systems.

Concentrations of individual components typical for a PCR were used: PCR primers in final concentrations of 0.5 pmol / l each, and the Taq polymerase in concentration (1100 dilution, corresponding to approximately 1 unit / reaction) and dNTPs (A, G, C, T) in concentration of about 200 pmol / l. The reaction was carried out in isothermal buffer 1 × (NEB).

The second amplification was carried out using this first amplification fragment as starting nucleic acid chain (2.1) and using a second amplification system. The progress of the synthesis was detected by means of EvaGreen at 72 ° C. The control reaction used was NTC and starting nucleic acid chain 1 .1, which can also be used as a template in the second amplification system.

The number of cycles required in the second amplification, up to the rise of the specific signal, was measured and compared to reference values. From the comparison of the number of cycles required for the detectable amplification, the successful use of the first amplification fragment (1 .1) in the PCR was concluded.

In detail, the following was carried out:

The first amplification product of a controller oligonucleotide-based first amplification reaction was diluted and used as template (input) under typical PCR conditions amplified. The detection in the context of the downstream PCR is carried out in this example with the intercalating dye EvaGreen. By comparison with a number of different control approaches, the inventors show that a signal only arises in the downstream PCR if the controller oligonucleotide-based amplification reaction was successful. For this reason, the downstream, classical PCR can also be called a detection PCR.

The amplification product of the controller oligonucleotide-based amplification reaction was essentially prepared as described in Example 2.

The following primer oligonucleotides were used:

The first primer oligonucleotide: P1 F5-200-AE205

CACTTAC GACA22CAAGA TTTTTT TACCTGTAT [CUCU GAUGCUUC] 1 TACCTGTATTCC (SEQ ID NO 13)

The segment used as primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

1 = C3 linker served to terminate the synthesis of the second primer extension product. 2 = 2 ^{'deoxy-lnosine}

The segment of the primer [CUCU GAUGCUUC] included 2 ^'-0-Me modifications and served as the second primer region capable of binding the first portion of the controller oligonucleotide:

The second primer oligonucleotide: P2G3-5270-7063

5 ^' CT AC AG AACT AG AC AAG AT GT AACT AC AATGTT 6

G CT CAT ACT AC AATGTC ACTT ACTGT AAG AG C AG A 3 ^' (SEQ ID NO: 3)

The segment used as primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

6 = HEG linker

The following controller oligonucleotide (SEQ ID NO: 4) was used:

AD F5-1001-503 5 '[UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] AGGTAGAAGCATC AGAG x 3

X = 3 ^'phosphate group for blocking a possible extension by polymerase.

Start nucleic acid chain (1.1) with pefect-match match to the controller.

M2SF5-M001 -200

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO 006)

The starting nucleic acid chain was used at a concentration of about 1 pM.

As a result, an amplification fragment is expected, which gives the second primer extension product with the following sequence:

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA 3 ^' (SEQ ID NO 10)

(the non-duplicable sequence portions of the second primer are not shown here).

The PCR was performed with 3 different primer pairs. The primer pairs capture different sequence regions of the amplification product. For a better understanding, the primer binding sites on the template strand (= amplification product) are also labeled for each primer pair.

For the PCR were used:

PCR primer pair 1 consisting of the third primer oligonucleotide SeqP1 F5 300-35x (SEQ ID NO 8) and the fourth primer oligonucleotide P2-4401-601 TMR (SEQ ID NO 9):

The third primer oligonucleotide SeqP1 F5 300-35x

5 'ACGAAGCTCGCAAGAACTCAGAGTGTGCTCGACACTACCTGTATTCC 3' (SEQ ID NO: 8)

The fourth primer oligonucleotide P2-4401-601

TMR 5 'G CT CAT ACT AC AATGTCACTT AC 3' (SEQ ID NO 9) Respectively: A = 2 ^{'deoxy-AdenosinC} = ^2' deoxy-cytosine; G = 2 ^{'deoxy-guanosine;} T = 2 ^'-deoxy- thymidine (thymidine)

TMR = tetramethylrhodamine attached at the 5 'end of the strand (P2-4401-601 TMR)

These two primers bind to the template strand in the following manner (shown here as the second primer extension product of the first amplification):

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA

GGAATACAGGTA 3 ^' (SEQ ID NO: 010)

In the control approach, primers of this primer pair can also bind to the starting nucleic acid chain 1 .1 as follows:

M2SF5-M001-200 (SEQ ID NO: 006)

5 ^' GCT CATA CTACAATGTCA CTTA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^'

PCR primer pair 2 consisting of the third primer oligonucleotide P3F5D-600-203 (SEQ ID NO XY) and the fourth primer oligonucleotide P2-4401-601 TMR:

The third primer oligonucleotide

P3F5D-600-203

- 5 'TMR GTACCGAAGC TCGCAGGAAC TCAGAGTGTG GAGAGGACGA AAATGTCCAG GGA 3' (SEQ ID NO 1 1)

The fourth primer oligonucleotide P2-4401-601 TMR

TMR - 5 'GCT CAT ACT ACAATGTC ACTT AC 3' (SEQ ID NO 9)

Respectively: A = 2 ^{'deoxy-AdenosinC} = ^2' deoxy-cytosine; G = 2 ^{'deoxy-guanosine;} T = 2 ^'-deoxy- thymidine (thymidine)

modifications:

TMR = tetramethylrhodamine attached at the 5 'end of the strand (P3F5D-600-203) and the P2-4401-601 TMR

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA

GGAATACAGGTA 3 ^' (SEQ ID NO: 010) In the control approach, primers of this primer pair can also bind to the starting nucleic acid chain 1 .1 as follows:

M2SF5-M001 -200

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO: 006)

PCR primer pair 3 consisting of the third primer oligonucleotide SeqP1 F5-35-X02 and the fourth primer oligonucleotide P2-4401-601 TMR:

The third primer oligonucleotide SeqP1 F5-35-X02

5 'AAGCTCGACAAAAGAACTCAGAGTGTGCTCGACACTACCTGTATTCCTTG 3' (SEQ ID NO: 012)

The fourth primer oligonucleotide P2-4401-601 TMR

TMR - 5 'GCT CAT ACT ACAATGTC ACTT AC 3' (SEQ ID NO: 009)

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA 3 ^' (SEQ ID NO: 010)

M2SF5-M001-200:

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO 6)

The nucleotides and nucleotide modifications are interrelated with each other

Phosphodiester bonds linked. Taq polymerase (NEB, catalog # M0273S) was used in the PCR. Polymerase dilutions of 1: 100 were used per reaction.

The amplification product from a controller oligonucleotide-based amplification reaction (first amplification) was used in the PCR in dilutions of 1: 5,000 to 1: 500,000,000.

As a control, also reaction mixtures were investigated which contained no template for amplification (NTC = no template control = negative control).

In addition, it was tested in further control approaches, whether the controller oligonucleotide can serve as a template for PCR primer. For this, the controller oligonucleotide (SEQ ID NO 4 = referred to herein as "Controller 503"), previously used during controller oligonucleotide-based amplification, was amplified in concentrations of 1 pmol / L to 1 pmol / L the PCR offered.

In a further control, a defined amount of the template M2SF5-M001-200 was offered for amplification in the PCR (positive control). This control demonstrated the performance of the PCR primer pairs (under ideal conditions). In addition, one could also quantitate a sample after a first amplification by comparing the obtained Ct values with a standard dilution series of the positive control. Concretely, the template M2SF5-M001-200 was tested in concentrations of 1 nmol / l to 1 fmol / l.

The third and the fourth primer oligonucleotides were used in concentrations of 0.5 pmol / l each.

The further reaction conditions were:

The thermal reaction conditions were chosen as follows:

• 20 seconds 95 ° C to activate the system

• 30 cycles, each with the following temperature-time profile

o 1 min 55 ° C

o 3 min 72 ° C

o 20 seconds 95 ° C

• 10 min 72 ° C to standardize the amplification products

• melting curve analysis

The amplification was typically followed for 30 cycles, ie 30 x (1 min 55 ° C + 3 min 72 ° C + 20 s 95 ° C) = about 30 x 260 s = 130 min. The successful amplification could be detected by an increase in the EvaGreen fluorescence signal over time. Analysis of detection PCR

The following techniques were used to analyze the detection PCR and to evaluate the resulting amplification products:

Fluorescence signal of an intercalating dye (EvaGreen)

Melting curve analysis of the resulting amplification products

In the analysis of PCR, we only discuss data obtained with a 1: 100 dilution of Taq polymerase.

In the control experiments with template (M2SF5-M001-200), it was possible to verify that all three PCR primer pairs selected could generate a specific PCR product under PCR conditions. It was also possible to verify that all three primer pairs were unable to form a product starting from the controller oligonucleotide. This was an expected result since all used "third" primers bind in the modified portion of the controller oligonucleotide.

Fig. 38A shows a typical time course of the EvaGreen fluorescence signal obtained in the amplification of dilute controller oligonucleotide amplification approaches, by primer pair 1. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Arrows mark different amplification approaches. The arrows include the following approaches:

Arrow 6 marks a negative control approach that does not contain a template and therefore does not generate an amplification signal during the course of the experiment.

Depending on the selected dilution of the controller oligonucleotide amplification approach, time-shifted amplification signals are observed. For PCR primer pair 1, dilutions of 1: 5,000 to 1: 50,000,000 may be good under the conditions chosen be dissolved. A dilution of 1: 50,000,000 produces an amplification signal that is marginally different from the negative control (see arrow 5).

FIG. 38B shows the associated melting curve analysis for reactions 1 to 5 and makes it clear that specific amplification products were formed (Tm = 82.7 ° C.).

Figure 38B shows the melting curves of the amplification products of primer pair 1 of Figure 38A. The Y-axis plots the derivative of the fluorescence signal versus temperature and the temperature is plotted on the X-axis. A uniform peak was found, marked with arrow 1. The peak at position 1 with a melting point near 82.7 ° C belongs to the amplification product of primer pair 1. Melting curve analysis indicates specific amplification.

Fig. 39A shows a typical time course of the EvaGreen fluorescence signal obtained in the amplification of dilute controller oligonucleotide amplification assays by PCR primer pair 2. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Arrows mark different amplification approaches. The arrows include the following approaches:

Arrow 5 marks a negative control approach that does not contain a template and therefore does not generate an amplification signal during the course of the experiment.

Depending on the selected dilution of the controller oligonucleotide amplification approach, time-shifted amplification signals are observed. For PCR primer pair 2, dilutions of 1: 5,000 to 1: 5,000,000 can be well resolved under the conditions chosen. A dilution of 1: 5,000,000 produces an amplification signal that is just emerging from the negative control (arrow 4).

Fig. 39B shows the associated melting curve analysis for reactions 1 to 4 and makes it clear that specific amplification products were formed. Figure 39B shows the melting curves of the amplification products of PCR primer pair 2 of Figure 39A. The Y axis plots the derivative of the fluorescence signal versus temperature, and the temperature is plotted on the X axis. A uniform peak was found, marked with arrow 1. The peak at position 1, with a melting point near 81.9 ° C, belongs to the amplification product of PCR primer pair 2. The melting curve analysis indicates specific amplification.

Fig. 40A shows a typical time course of the EvaGreen fluorescence signal obtained in the amplification of dilute controller oligonucleotide amplification assays by PCR primer pair 3. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Arrows mark different amplification approaches. The arrows include the following approaches:

Position dilution of the controller oligonucleotide amplification approach in the detection PCR approach

Arrow 1 approx. 1: 5,000 arrow 2 approx. 1: 50,000 arrow 3 approx. 1: 500,000 arrow 4 approx. 1: 5,000,000 arrow 5 approx. 1: 50,000,000 arrow 6 approx. 1: 500,000,000 arrow 7 0 mol / l = negative control

Arrow 7 marks a negative control approach that does not contain a template and therefore does not generate an amplification signal during the course of the experiment.

Depending on the chosen dilution of the controller oligonucleotide amplification approach, time-shifted amplification signals are observed. For primer pair 3, dilutions of 1: 5,000 to 1: 500,000,000 can be well resolved under the conditions chosen. A dilution of 1: 500,000,000 produces an amplification signal that is just emerging from the negative control (see arrows 6 and 7).

Fig. 40B shows the associated melting curve analysis for reactions 1 to 6 and makes it clear that specific amplification products have been formed.

Fig. 40B shows the melting curves of the amplification products of PCR primer pair 3 of Fig. 40A. The Y axis plots the derivative of the fluorescence signal versus temperature, and the temperature is plotted on the X axis. A uniform peak was found, marked with arrow 1. The peak at position 1 with a melting point near 81, 2 ° C belongs to the amplification product of the PCR primer pair 3. The melting curve analysis indicates a specific amplification.

By analyzing the fluorescence signals in the course of the amplification (amplification plots) and the melting curve analysis at the end of the amplification, it was demonstrated that the PCR primer pairs 1 to 3 were each capable of dilute amplification products, which had emerged from the first amplification reaction to use as a template.

Depending on the dilution chosen, time-delayed amplification signals are produced which are typical for a dilution series. By the PCR conditions selected here 5,000,000-fold diluted amplification products can be detected. The primer pair 3 has the highest sensitivity and can even detect amplification products at 500,000,000-fold dilution.

Figure 41 shows as template control experiments (M2SF5-M001-200) used in 1 nmol / L (arrow 1) and 10 pmol / L (arrow 2) and NTC controls (arrow 3).

Fig. 41A shows results for PCR primer pair 1.

Fig. 41B shows results for PCR primer pair 2.

Figure 41C depicts PCR primer pair 3 results.

From the comparison of the time of rise of the fluorescence signal between control experiments (template) and the performed second amplification from first amplification fragments, it can be seen that the first amplification caused an amplification of amplification fragments which used as a template in the second amplification could become.

Fig. 42 shows the course of the first amplification (before PCR).

One recognizes a signal rise, which was interpreted as an enrichment of the copy number in the first amplification. Arrow 1 corresponded to an approach with a starting nucleic acid chain 1.1. Arrow 2 = NTC control.

Example 4 (Figures 43-47):

Combination of the first amplification and the second amplification in the same batch (homogeneous assay)

In this embodiment, the inventors demonstrate how the controller oligonucleotide-based amplification reaction can be combined with a downstream, classical PCR in a homogeneous assay format. Here, the inventors use the highly selective controller oligonucleotide-based amplification reaction in the early amplification phase and then switch to a classical PCR for amplification and detection of the amplification products. In contrast to embodiment 3 (= heterogeneous assay format), the combination takes place in this embodiment in a homogeneous assay format. All assay components are already available at the start of the reaction, switching between controller-oligonucleotide-based amplification and classical PCR is achieved by a change in the temperature regime during the course of the reaction.

First, the first amplification product 1 .1 was amplified from a single-stranded starting nucleic acid chain (1.1) by controller oligonucleotide-based amplification reaction for 15 to 30 cycles, followed by 30 classical PCR cycles to further amplify the pre-amplified product to detect. For detection, the intercalating dye EvaGreen is used in this example.

The first amplification system comprises the following components:

A first primer oligonucleotide,

A second primer oligonucleotide,

A controller oligonucleotide and

A polymerase, (Bst 2.0 Warm Start Polymerase), which has strand displacement properties

• as well as necessary substrates for the polymerase (dNTP ^'s : dATP, dCTP, dGTP, dTTP) and suitable buffer systems (The reaction was carried out in isothermal buffer 1 x (NEB)).

The second amplification system each comprised the following components:

A third primer oligonucleotide,

A fourth primer oligonucleotide

A polymerase, (Taq polymerase), which is a thermostable polymerase

• as well as necessary substrates for the polymerase (dNTP ^'s : dATP, dCTP, dGTP, dTTP) and suitable buffer systems.

Both amplification systems were present together before the start of the first amplification.

In this example, the second primer oligonucleotide was used for both amplifications. The fourth primer oligonucleotide is thus identical to the second primer oligonucleotide.

The third primer oligonucleotide was varied.

In this example, the inventors present 4 different primers, each used singly per batch as "the third primer oligonucleotide".

The respective third primer oligonucleotide differs from the first primer oligonucleotide. Thus, each reaction approach comprises three primers: a first primer oligonucleotide and a second primer oligonucleotide (as components of the first amplification system) and the Third primer oligonucleotide used as the specific primer of the second amplification system. The role of the fourth primer was taken over by the second primer of the first amplification system, which was also suitable for the downstream PCR reaction. For a better understanding, the primer binding sites on the template strand (= amplification product) are labeled for each primer combination.

The following starting nucleic acid chain (1.1) was used as a single-stranded template:

Template (SEQ ID NO 6) with sequence composition resulting in a first

Primer extension product with a perfect match match to the controller oligonucleotide results in:

M2SF5-M001-200:

5 ^' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGA TCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ^' (SEQ ID NO 6)

The binding sequence for the first primer oligonucleotide is underlined. The second primer oligonucleotide binds to the reverse complement of the double underlined sequence. The binding sequence for the third primer oligonucleotide (P3F5D-600-203) is shown in bold italics.

The first amplification system:

The first primer oligonucleotide: P1 F5-200-AE205

The segment used as primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

One segment of the primer [CUCU GAUGCUUC] comprised 2 ^' 0 Me modifications and served as the second primer region for binding the first region of the controller oligonucleotide:

The second primer oligonucleotide: P2G3-5270-7063

5 ^' CT AC AG AACT AG AC AAG AT GT AACT AC AATGTT 6

GCT CAT ACT AC AATGTC ACTT ACTGT AAG AG C AG A 3 ^' (SEQ ID NO: 3) The segment used as primer in the reaction is underlined.

This oligonucleotide comprises the following modifications:

6 = HEG linker

The following controller oligonucleotide was used:

AD F5-1001-503

modifications:

X = 3 ^' phosphate group to block a possible extension by the polymerase.

The second amplification system specifically comprised each a third primer oligonucleotide (P3 primer) from the following list:

The third primer oligonucleotide: P3F5D-600-201

TMR 5 ^' GTACCGAAGC TCGCAGGAAC TCAGAGTGTG GAGAGGACGA AAA CTGTCCAGGGATC 3 ^' (SEQ ID NO 14)

modifications:

TMR (= tetramethylrhodamine) in the 5 'position

The third primer oligonucleotide: P3F5D-600-202

TMR 5 ^' GTACCGAAGC TCGCAGGAAC TCAGAGTGTG GAGAGGACGAAAA CCAGGGAT 3 ^' (SEQ ID NO 15) A = 2 ^{'deoxy-AdenosinC} = ^2' deoxy-cytosine; G = 2 ^{'deoxy-guanosine;} T = 2 ^{'deoxy-thymidine} (thymidine)

modifications:

TMR (= tetramethylrhodamine) in the 5 'position

The third primer oligonucleotide P3F5D-600-203

TMR 5 ^' GTACCGAAGCTCGCAGGAACTCAGAGTGTGGAGAGGACGAAAA TGTCCAGGGA 3 ^' (SEQ ID NO 1 1):

modifications:

TMR (= tetramethylrhodamine) in the 5 'position

The third primer oligonucleotide: P3F5D-600-204

TMR 5 ^' GT ACCG AAGCTCGCAGG AACT CAG AGTGTGG AG AGG ACG AAAA CTGTCCAG 3 ^' (SEQ ID NO 16)

A = 2 ^{'deoxy-adenosine}

modifications:

TMR (= tetramethylrhodamine) in the 5 'position

The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ^' end is blocked with a phosphate group to prevent possible extension by the polymerase.

The starting nucleic acid chain 1.1 (template) was used in concentrations of 1 pmol / l. Primer 1 was used at 5 pmol / L, the controller oligonucleotide at 2 pmol / L, primer 2 at 1 pmol / L and primer 3 at 0.5 pmol / L. For amplification, 2 polymerases were in the Taq polymerase (NEB, catalog # M0273S?) In a 1-to-100 dilution and Bst 2.0 Warm Start Polymerase (NEB, catalog # M0538S?) In a 1-to-200 dilution.

In a control reaction, no P3 primer was used. In further control reactions only BST polymerase but no Taq polymerase was used.

The further reaction conditions were:

1x isothermal buffer (New England Biolabs); in simple concentration, the buffer contains: 20 mM Tris-HCl; 10mM (NH ₄ ) ₂ S0 ₄ ; 50 mM KCl; 2mM MgSO ₄ ; 0.1% Tween® 20; pH 8.8@25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each; EvaGreen dye (dye was used according to manufacturer's instructions in 1:50 dilution)

The thermal reaction conditions were chosen according to the following profile:

• 2 min 65 ° C to activate the system

15 or 30 cycles with the following temperature-time profile (controller oligonucleotide-based amplification reaction)

o 2 min 55 ° C

o 2 min 65 ° C

• 20 seconds 95 ° C to activate the system

• 30 cycles with the following temperature-time profile

(Detection PCR)

o 1 min 55 ° C

o 3 min 72 ° C

o 20 seconds 95 ° C

• 10 min 72 ° C to standardize the amplification products

• melting curve analysis

The total amplification was typically over 45-60 cycles, ie.

First amplification: (15 or 30) x (2 min 55 ° C + 2 min 65 ° C) = (15 to 30) x 4 min = 60 to 120 min

Second amplification (PCR) 30 x (1 min 55 ° C + 3 min 72 ° C + 20 s 95 ° C) = 30 x 260 s = 130 min followed. This corresponds to a total time of 190 to 250 min.

Analysis of the combination of controller oligonucleotide-based amplification reaction and detection PCR.

The following techniques were used to analyze and evaluate the resulting amplification products:

Fluorescence signal of an intercalating dye (EvaGreen)

Melting curve analysis of the resulting amplification products

The first partial amplification (15 cycles or 30 cycles) results in an accumulation of the nucleic acid chains (the first amplification fragment 1 .1) which can be used as templates in the downstream PCR. As a result, the PCR requires fewer cycles to generate detectable levels of PCR product. By choosing the number of cycles in the two amplification phases, the amplification fraction can be adjusted to the total amplification for the two amplification reactions. By comparison with a number of different control approaches, the inventors show that by using a first amplification, the cycle number of the second amplification (PCR) could be reduced until a detectable signal was generated (Ct). This reduction in the number of cycles of the PCR occurred only when the first amplification (controller oligonucleotide-based amplification reaction) was successful. The second amplification then proceeded from first amplification products to detection. For this reason, the downstream, classical PCR can also be called a detection PCR.

Furthermore, the inventors show that a combination of the first and the second amplification system in one batch is possible, so that a homogeneous assay format could be carried out.

Below is the presentation of results of individual reaction approaches.

Figure 43A shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-201. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Cycles 1-15 utilize the controller oligonucleotide-based amplification reaction. From cycle 15 to cycle 45, the classic PCR (detection PCR) is used. The switching time (end of cycle 15) is marked with arrow 1.

Arrow 2 marks an amplification approach in which the template M2SF5-M001 -200 is amplified starting from 1 pmol / l starting concentration by BST and Taq polymerase.

Arrow 3 marks a control batch containing only BST polymerase. An amplification is omitted because the heat-sensitive BST polymerase is denatured from cycle 16 by the temperature profile in the detection PCR. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

Arrow 4 marks another control approach in which the addition of the primer P3F5D-600-201 was omitted. An amplification signal is no longer observed, since without the third primer no exponential amplification in the detection PCR is possible. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

Figure 43B shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-202. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Cycles 1-15 utilize the controller oligonucleotide-based amplification reaction. From cycle 15 to cycle 45, the classic PCR (detection PCR) is used. The switching time (end of cycle 15) is marked with arrow 1. Arrow 2 marks an amplification approach in which the template M2SF5-M001 -200 is amplified starting from 1 pmol / l starting concentration by BST and Taq polymerase.

Arrow 4 marks another control approach, in which the addition of the primer P3F5D-600-

202 was waived. An amplification signal is no longer observed, since without the third primer no exponential amplification in the detection PCR is possible. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

Fig. 44A shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-203. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Cycles 1-15 utilize the controller oligonucleotide-based amplification reaction. From cycle 15 to cycle 45, the classic PCR (detection PCR) is used. The switching time (end of cycle 15) is marked with arrow 1.

203 was waived. An amplification signal is no longer observed, since without the third primer no exponential amplification in the detection PCR is possible. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

Figure 44B shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-204. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Cycles 1-15 utilize the controller oligonucleotide-based amplification reaction. From cycle 15 to cycle 45 comes the classical PCR (detection PCR) is used. The switching time (end of cycle 15) is marked with arrow 1.

Arrow 4 marks another control approach which dispenses with the addition of primer P3F5D-600-204. An amplification signal is no longer observed, since without the third primer no exponential amplification in the detection PCR is possible. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

It turns out that a combination of controller oligonucleotide-based amplification reaction and (classical) detection PCR with each of the 4 primer-3 variants (P3F5D-600-201 to P3F5D-600-204) in homogeneous assay format succeeds. The combined use of BST and Taq polymerase is important here. Equally important is the third primer, without which no amplification signals were detected. The primer-3 variants behave quite individually, which can be recognized at the different points in time at which the amplification signal begins to stand out from the baseline. The earlier an amplification signal can be detected in the detection PCR, the more efficient is the respective primer-3 variant in the detection of previously formed controller oligonucleotide-based amplification products.

Now, we show that doubling the number of cycles of the controller oligonucleotide-based amplification reaction in the early amplification phase results in qualitatively very similar results.

Figure 45A shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-201. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. In cycles 1 to 30, the controller oligonucleotide-based amplification reaction is used. From cycle 31 to cycle 60, the classic PCR (detection PCR) is used. The switching time (end of cycle 30) is marked with arrow 1.

Arrow 3 marks a control batch containing only BST polymerase. An amplification is omitted because the heat-sensitive BST polymerase from cycle 16 by the temperature profile in the detection PCR is denatured. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

Figure 45B shows a typical course of the EvaGreen fluorescence signal during the combined amplification of template M2SF5-M001-200 with primer P3F5D-600-203. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. In cycles 1 to 30, the controller oligonucleotide-based amplification reaction is used. From cycle 31 to cycle 60, the classic PCR (detection PCR) is used. The switching time (end of cycle 30) is marked with arrow 1.

Arrow 4 marks another control approach which dispenses with the addition of primer P3F5D-600-203. An amplification signal is no longer observed, since without the third primer no exponential amplification in the detection PCR is possible. Already formed amplification products from the controller oligonucleotide-based amplification reaction remain hidden below the detection threshold of EC.

FIG. 46 shows a comparison of time intervals between a combined amplification (comprising the first and the second amplification) vs. FIG. PCR alone (only the second amplification).

The first amplification was performed as shown above. In the second reaction was used as the third primer oligonucleotide (P3F5D-600-203). The batches were pipetted as described above and reactions were carried out. As shown above, in a combined approach, a controller-dependent amplification was first performed (in this case 15 cycles) and then switched to PCR (arrow 1). The time intervals 1 and 2 were compared. Arrow 2 shows the course of the combined amplification (Bst and Taq polymerase were both used). In the beginning, 1 pmol / l start nucleic acid chain (template) was before the start of the first amplification. The rise of the fluorescence signal takes place after a time interval 1.

Arrow 3 shows the course of a control approach in which the Bst was omitted so that the first amplification reaction was "silenced" (although all components of the first amplification system were in the beginning, nevertheless it lacked the right one Polymerase, in this case Bst 2.0 polymerase). In the beginning, 1 pmol / l start nucleic acid chain (template) was before the start of the first amplification. The rise of the fluorescence signal takes place after a time interval 2. Although the Taq polymerase can synthesize a product starting from the same template, the PCR alone requires more cycles for it.

Arrow 4 shows the course of a combined batch without starting nucleic acid chain 1 .1 (without template = NTC control).

Overall, it can be seen that the amplification of amplification fragments 1 .1 during the first amplification, which subsequently could serve as start nucleic acid chain 2.1 (template) in the PCR, results in the generation of PCR fragments of the reaction in mixture 2 overall faster The PCR requires fewer cycles until a detectable amount of the second amplification product (2.1) has been prepared. Time interval 1 is shorter than time interval 2.

Fig. 47 shows a comparison of time intervals between a combined amplification (comprising the first and the second amplification) vs. PCR alone (only the second amplification).

The first amplification was performed as shown above. In the second reaction, the third primer oligonucleotide (P3F5D-600-203) was used. The batches were pipetted as described above and reactions were carried out. As shown above, in a combined approach, a controller-dependent amplification was first performed (in this case 30 cycles) and then switched to PCR (arrow 1). The time intervals 3 and 4 were compared.

Arrow 2 shows the course of the combined amplification (Bst and Taq polymerase were both used). In the beginning, 1 pmol / l start nucleic acid chain (template) was before the start of the first amplification. The increase of the fluorescence signal takes place after a time interval 3.

Arrow 3 shows the course of a control approach in which the Bst was omitted so that the first amplification reaction was "silenced" (although all components of the first amplification system were in the beginning, nevertheless it lacked the right one Polymerase, in this case Bst 2.0 polymerase). In the beginning, 1 pmol / l start nucleic acid chain (template) was before the start of the first amplification. The rise of the fluorescence signal occurs after a time interval of 4. Although the Taq polymerase can synthesize a product starting from the same template, the PCR alone needs more cycles for it. Arrow 4 shows the course of a combined batch without starting nucleic acid chain 1 .1 (without template = NTC control).

Overall, it can be seen that the multiplication of amplification fragments 1 .1 during the first amplification, which subsequently could serve as start nucleic acid chain 2.1 (template) in the PCR, results in the generation of PCR fragments in the reaction 2 in total faster The PCR requires fewer cycles until a detectable amount of the second amplification product (2.1) has been prepared. Time interval 3 is shorter than time interval 4.

Example 5 (Figures 48-49, 71): Amplification of human FVL target sequence with mutation in the presence of human genomic DNA with wild-type sequence variant

The example shows the selective amplification of a target sequence comprising a polymorphic locus comprising two sequence variants (mutation or wild-type) (SNP variants of coagulation factor V Leiden gene, FVL gene).

The components of the first amplification system (first primer, second primer, controller, polymerase) and reaction conditions were chosen so that the nucleic acid to be amplified (amplification fragment 1 .1 comprising both primer extension products, P1.1 -Ext du P2. 1-text) preferably comprised the sequence variant with mutation in the FVL gene. The wild-type sequence variant (WT sequence) should not be significantly amplified during the first amplification. The first amplification started from the starting nucleic acid 1.1, which was obtained as a primer extension product using single-stranded human gDNA (template comprising a target sequence). The amplification was carried out until the desired level of amplification fragments was reached. The products generated in the first amplification (amplification fragment 1 .1) could serve as templates (starting nucleic acid 2.1) for the second amplification (PCR).

The components of the second amplification system (third primer, fourth primer, polymerase) and reaction conditions (PCR amplification) were chosen so that both variants of the target sequence could be amplified. The second amplification (PCR) was performed following the first amplification in a separate step.

A schematic topography of the first amplification system and the second amplification system is shown in FIG. 71. Primers of the second amplification system were in "nested" format with respect to primers of the first amplification system.

The obtained products of the first amplification (amplification fragment 1.1) or the second amplification (amplification fragment 2.1) were detected and analyzed by various methods. A detection method comprised real-time detection using intercalating dyes (Eva-Green fabric), another detection method comprised real-time detection using sequence-specific oligonucleotide probes (Taqman probes) (these probes allow discrimination by sequence variant: Mutation vs. wild-type variant), another analysis Method included Sanger sequencing of amplification fragments obtained in the amplification.

A demonstration of sequence-specific amplification has been achieved in several ways. First, amplification of a target sequence comprising a mutation variant could be achieved (either alone by the first amplification or by combining the first and second amplifications). On the other hand, the amplification of a target sequence comprising a mutation variant (100 or 10 copies) in the presence of about 30,000 copies of human gDNA with wild-type variant could be achieved. Furthermore, it could be shown that no measurable amplification of the target sequence with wild-type variant (5000 copies) took place under selected conditions.

Material and methods:

Target sequence:

The following variants were chosen as the target sequence with a polymorphic locus:

FVL sequence variant with mutation:

5 ^'- tgggctaata ggactacttc taatctgtaa gagcagatcc ctggacaggc aaggaataca ggtattttgt - ^3' (SEQ ID NO 17)

WildType sequence variant:

5 ^'- tgggctaata ggactacttc taatctgtaa gagcagatcc ctggacaggc gaggaataca ggtattttgt - ^3' (SEQ ID NO 18)

Both sequences were derived on the basis of information available from NCBI:

Homo sapiens chromosome 1, GRCh38.p12 Primary Assembly, Sequence ID: NC 000001 .1 1 Coagulation Factor V with SNP 1691 G> A (substitution), in codon 506.

Components in preparation for the preparation of the starting nucleic acid 1.1

Human gDNA: WHO standard 04/224 for human gDNA for FVL gene

Mutation-bearing variant of human gDNA (03/260 Factor V Leiden homozygote) (FVL mutation)

Wild-type carrying variant of human gDNA (03/254 wild type factor V) (WT sequence)

Primer oligonucleotide

P1 F5G2-2001-203 (SEQ ID NO 19)

5 ^' - CAcaaTCATCAATACTTTTTTGTcaaaatarcucu qauacucu] 1 GTcaaaatacc tgtATT

1 = C3 Underlined sequence is composed of 2 ^{'-0Me-modified} nucleotides ^(2' -0-methyl nucleotides), and corresponds to the second region of the first primer.

Bst 2.0 Warmstart DNA Polymerase (NEB 120,000 units / ml), (used in 1: 1000 dilution reaction), further referred to as "Bst Polymerase"

First amplification system

First primer oligonucleotide P1 F5G2-1001-103

5 ^' - CAcaaTCATCAATACTTTTTGTcaaaatarcucuaauqcucuU GTcaaaatacct (SEQ ID NO 20)

1 = C3

The underlined sequence consists of 2 ^{'-OMe-modified} nucleotides and corresponds to the second region of the first primer.

Block oligonucleotide: B1-P1 F5G2-3501 -304

5 ^'- rcucuaauqcucuGucaal2aatacctqAAA X (SEQ ID NO 21)

2 = HEG

X = 3 ^' -phosphate group

The underlined and in brackets sequence consists of 2 ^{'-OMe-modified} nucleotides.

Controller Oligonucleotide: CF5G2-1002-401 (SEQ ID NO 22)

5 ^' [Aggacuacuu cuaaucugua agagcagauc ccuggacagg caaggaauac agguauu] ttgACagagcat cagagag X

X = 3 ^' -phosphate group

The sequence in brackets is composed of 2 ^{'-OMe-modified} nucleotides.

Second primer oligonucleotide

P2-HAF5-081-1051 (SEQ ID NO 23)

CAcaaTCATCAATACtaataggac 6 ctctgggctaataggactacttctaatctgtaagagca

6 = HEG

Bst 2.0 Warmstart DNA Polymerase (NEB 120,000 units / ml), further referred to as "Bst Polymerase"

The following concentrations for individual components were used:

Primary primer oligonucleotide 0.3 pmol / l

Block oligonucleotide 5 pmol / l

• Controller oligonucleotide 2 pmol / l Second primer oligonucleotide 0.2% CI / I

Bst polymerase was used in a 1: 1000 dilution reaction

To obtain the first amplification, human gDNA (from Promega, "Human male") was added in single stranded form at a concentration of about 100 ng per batch (12 mI). This simulated a test system with a complex genetic background. The human gDNA comprises pooled samples (approximately 30,000 copies per batch).

Second amplification system (EvaGreen detection)

Third primer oligonucleotide: P3F5G2-1001-301

5 ^' - CTCGACACTACTTCAAGGACAAAATacctgtattcc (SEQ ID NO 24) (used in 0.5 pmol / l)

Fourth primer oligonucleotide: P4F5G2-1001-401

5 ^'- ctc tgggctaata ggactacttc taatatgtaa gagca gat (SEQ ID NO 25) (used in 0.5 pmol / l)

Taq Polymerase Hot Start (NEB 5,000 units / ml) (used in 1: 100 dilution reaction)

• Detection using EvaGreen dye (Jena Biosciences Stock 1: 50)

The third and the fourth primer were designed in "nested format" corresponding to the first and second primer.

Oligonucleotide probes for detection of FVL system in the second amplification:

Second amplification system (probe detection)

Third primer oligonucleotide: P3F5G3-1001-3303-4

5 ^' - ACTT C AAG G AC AAAAT a cctgt att (SEQ ID NO 26) (used in 0.5 pmol / l)

Fourth primer oligonucleotide: P4F5G3-1001-3404-2

5 ^'- GAT CCC ATATGTAA GAGCA (SEQ ID NO 27) (used in 0.5 pmol / l)

• Detection by means of oligonucleotide probes

Probe Oligonucleotide for FVL Mutation-Specific Detection S1 P4-FVL-1007

5 ^'- FAM - TT G AG AC GC AAG G AA ^3' -MGB-NFQ (SEQ ID NO 28) (Thermo Fisher) (used in 0.2 pmol / l)

Probe Oligonucleotide for WT Specific Detection: S1 P4-FVL-1003-1 5 ^'- NED - TTCTGGACAGGCGAGG ^3' -MGB-NFQ (SEQ ID NO 29) (Thermo Fisher) (used in 0.6 mitioI / I)

Discriminatory base is underlined.

NFQ = non fluorescent quencher (quencher of the BlackHole series)

These probes are examples of "Taqman probes" with a fluorescent reporter and a fluorescence quencher.

Buffer:

all reactions were carried out in the same buffer. 1X Buffer Components (NEB)

20 mM Tris-HCl

10 mM (NH ₄ ) ₂ S0 ₄

50 mM KCl

2mM MgSO ₄

0.1% Tween® 20

pH 8.8 @ 25 ° C

• Optional Eva-Green Dye (Jena Biosciences), (used in 1: 50 dilution reaction).

• dNTP mix for Bst polymerase: dATP, dCTP, dGTP per 200 pmol / L, dUTP 400 pmol / l

• dNTP mix for Taq polymerase: dATP, dCTP, dGTP, dTTP each 200 pmol / L

Procedure of the procedure:

Preparation of a starting nucleic acid for the first amplification

First, the starting nucleic acid 1 .1 comprising the target sequence starting from the single-stranded human genomic DNA (WHO standards for FVL and WT sequence variants) using the primer (P1 F5G2-2001 -203, used in 0.2 pmol / l) synthesized by primer extension with Bst polymerase (10 min at 50 ° C) and then detached from the template strand by heat denaturation at 95 ° C (5 min). The preparation of starting nucleic acid 1 .1 for sequence variant of the target sequence with FVL mutation and wild-type mutation was carried out in separate approaches. Approximately 100,000 copies of human gDNA were used per batch. The primer used for this purpose had a similar structure to the first primer oligonucleotide P1 F5G2-1001-103.

After primer extension, a starting nucleic acid 1.1 resulted, which comprises a primer extension product with a sequence segment complementary to the target sequence and an overhang at the 5 ^' end. In the first amplification, such a starting nucleic acid can serve as a template: a second primer can bind to such a starting nucleic acid 1.1 sequence-specific and can be extended by polymerase. At the overhang, a controller oligonucleotide can bind to its first region. Performing a first amplification and detection:

The starting nucleic acid 1.1 (with FVL mutation and / or WT sequence) was added in different dilutions to the amplification assay (100 copies, 10 copies for FVL mutation, and 5000 copies for WT sequence). The reaction was carried out under cyclic changes of temperature between 50 ° C and 65 ° C. At these temperatures, no spontaneous decay of specific amplification fragments occurred. One cycle included incubation at 50 ° C (2 min) and at 65 ° C (4 min). The batches were incubated for different times (up to about 15 hrs). The signal from the intercalating dye EvaGreen was detected during the course of the reaction. Upon completion of the reaction, melting curves were determined. Amplification resulted in an increase in levels of double-stranded DNA (amplification fragments 1.1) capable of incorporating intercalating dyes, leading to a signal increase from EvaGreen.

The amplification fragments 1.1 synthesized during this reaction could serve as templates for the second amplification or for Sanger sequence analysis.

Performing a second amplification and detection (EvaGreen):

Prior to use in the second amplification, the products of the first amplification were diluted 1: 6000. Amplification fragments present in these diluted batches served as starting nucleic acid 2.1 for the PCR reaction. The PCR reaction was performed in 40 cycles. One cycle comprised: 55 ° C for 1 min, 68 ° C for 3 min, 95 ° C for 20 sec. Detection was performed with Eva-Green Dye. By observing the signal rise (Ct value), relative amount of added matrices could be estimated at the beginning of the reaction. The amplification fragments 2.1 synthesized in the second amplification could be used for Sanger sequencing.

Carrying out a second amplification and detection (probe oligonucleotides):

Prior to use in the second amplification, the products of the first amplification were diluted 1: 6000. Amplification fragments present in these diluted batches served as starting nucleic acid 2.1 for the PCR reaction. The PCR reaction was performed in 40 cycles. One cycle included: 57 ° C 1 min, 95 ° C 20 sec. Detection was performed with sequence-specific oligonucleotide probes (Taqman probes with fluorescence reporter and MGB from Thermofisher). By observing the signal rise (Ct value), both the relative amount of added templates at the beginning of the reaction and the sequence composition in the relevant sequence section of the synthesized products could be estimated.

Results and evaluation:

In the first amplification, starting from starting nucleic acid 1 .1 (target sequence with FVL mutation sequence variant) with starting concentrations of about 100 and 10 copies per batch (FIG. 48, arrows 1 and 2, A), signal progression during Amplification, B) melting curves) Signal increase (detectable by EvaGreen dye). Starting from starting nucleic acid with target sequences of the WT variant with starting concentration of about 5000 copies per batch, no signal increase was to be detected (FIG. 48, arrow 3). The signal was at the level of batches without a starting nucleic acid. After completion of the first amplification, an aliquot was taken, diluted, and added to the second amplification.

The second amplification was carried out starting from a dilution of batches of the completed first amplification (final dilution 1: 6000). The second amplification used the third and fourth primers, which were nested to the first and second primers. The second amplification showed a specific signal uptake in all batches of the first amplification with amplification fragments starting from starting nucleic acid 1 .1 with target sequence of the FVL mutation variant (FIG. 49, arrow 2, A) shows signal progression during amplification , B) shows melting curves). The signal increase occurs early in the course of the PCR (Ct value about 5 or 8) and indicates a high concentration of amplification fragments of the first amplification. When starting from starting nucleic acid 1.1 with target sequence of the wild-type variant, a signal was observed (FIG. 49, arrow 3, Ct value about 25), which was at the level of batches without starting nucleic acid (FIG. 49, arrow 4) , Ct value approx. 25). The comparison of time points of the signal increase (Ct values) in these mixtures shows that the amount of amplification fragments with FVL mutation at the end of the first amplification was significantly larger than the amounts of amplification fragments with wild-type DNA. Taking into account the starting nucleic acids used (10 copies FVL sequence variant vs. 5000 copies of the wild-type DNA) in the first amplification, it was observed that the amplification of the FVL sequence variant was significantly favored over the wild-type variant. The composition of the amplicons (FVL sequence) of individual reactions was further confirmed by Sanger analysis and probe-based detection.

This result speaks for a specific amplification of target sequences during the first amplification. The amplification fragments synthesized in the first amplification could be used as templates in the second amplification.

The distinction between two variants of the target sequence during the first amplification was made by the action of the controller oligonucleotide, which was made complementary to the target sequence with mutation. Thus, this controller oligonucleotide comprises at a nucleotide position a mismatch to the wild-type variant of the target sequence. The controller oligonucleotide was designed so that the polymorphic locus of the target sequence lies in the third region of the controller oligonucleotide. Thus, the polymorphic locus was in the sequence segment of the target sequence, which was in the 3 ^' direction from the first primer and in the 3 ^' direction from the second primer. The primers used alone could not have distinguished individual sequence variants in the polymorphic locus of the target sequence.

During the first amplification, predominantly a selective amplification of products occurred, which sequences with perfectly complementary content to the third region of the Controllers (FVL target sequence with mutation) had. In this example, an advantageous embodiment of the reaction conditions was chosen in which on the one hand the primer concentration was lower than the concentration of controller oligonucleotide and on the other hand cyclic temperature changes (between 50 ° C and 65 ° C) were used.

For the oligonucleotides used, primer oligonucleotides form an interaction pair with the corresponding controller oligonucleotides (e.g., first primer oligonucleotide and first controller oligonucleotide). Under the reaction conditions of the amplification, this interaction pair had a melting temperature of about 63 ° C. (measured at about 1 pmol / l concentration of both components under buffer conditions of the amplification). The first region of the primer oligonucleotide formed with a complementary sequence portion of a template a complex having a melting temperature of about 50 ° C (eg first region of the first primer and the second primer extension product (P2.1 -Ext) measured at ca 1 pmol / L concentration of both components under buffer conditions of amplification).

Depending on the embodiment, primers and controller oligonucleotides can be used in different ratios.

In an advantageous embodiment, primer-controller combinations were used in which the concentration of primer was higher than the concentration of controller (e.g., first primer 5 pmol / L and controller 2 pmol / L, see Example 1 to 3). In this embodiment, there was an excess of primer such that the primer extension step occurred at a temperature of 50 ° C in good yields despite partial binding of primer oligonucleotide to the controller oligonucleotide.

In a further advantageous embodiment (Example 5), a mixture of a primer and a corresponding controller oligonucleotide was used in which the concentration of primer was lower than the concentration of the controller oligonucleotide (eg primer 0.5 pmol / l and controller 2 pmol / l). Thus, the controller oligonucleotide was in excess. In this embodiment, sending the reaction temperature to 50 ° C resulted in rapid binding of the primer oligonucleotides to the controller oligonucleotides. This reduced the yield in the primer extension step at 50 ° C and lowered the rate of amplification. In order to maintain a sufficient primer concentration even at low temperatures and thus to increase yields in the primer extension step, so-called block oligonucleotides were used. Such block oligonucleotides competed with the primer oligonucleotide for binding to the controller oligonucleotide, but were themselves unable to be extended by a polymerase.

By using block oligonucleotides, it was possible to use the combination of primer oligonucleotide and controller oligonucleotide in some concentration ranges and to combine with cyclic temperature changes. This resulted in an increase in the reaction rate. The structure of block oligonucleotides is substantially similar to the structure of primer oligonucleotides, with the following differences:

Block oligonucleotides are not extended by polymerase. This can, for example, by blocking the 3 ^'end can be achieved by a modification (for example ^3' phosphate, 3 ^'- C3, dideoxy-nucleotide), and / or by introduction of terminal mismatches in the ^3' end of the oligonucleotide block.

Block oligonucleotides may differ in their sequence composition from their corresponding primers. The number of sequence deviations can be between 1 nucleotide to 20 nucleotides.

In the design of block oligonucleotides, it is advantageous to maintain the Tm of block oligonucleotides on controller oligonucleotides in the similar range as the Tm of primer oligonucleotides and controller oligonucleotides. As a result, block oligonucleotides and primer oligonucleotides compete for binding to controller oligonucleotides to a similar extent (e.g., primer-controller complex Tm plus / minus 3 ° C). By using higher concentrations of block oligonucleotides as primer oligonucleotides, the binding ratio can be favorably influenced.

Other examples embodiments of the invention

Fig. 1 shows schematically the starting materials and products of an amplification comprising a first amplification (Fig. 1A) (first partial amplification) and then a second amplification (Fig. 1B) (second partial amplification) using components of the first amplification system and the second amplification system. The reaction starts with the starting nucleic acid 1 .1, which comprises a target sequence and is used as a template to start the first partial amplification.

In particular, components of the first amplification system are: a first oligonucleotide primer (P1.1), a second oligonucleotide primer (P2.1), a controller oligonucleotide (C1.1) and first polymerase (P1.1), dNTPs.

During the first partial amplification (A1 .1), a specific amplification of a first amplification fragment 1 .1 takes place. comprising a first primer extension product P1 .1-Ext and a second primer extension product P2.1-Ext. The primer extension product P1 .1-Ext occurs as a template-dependent extension of P1 .1 by the polymerase under reaction conditions of the first partial amplification. The primer extension product 2.1 -Ext results from template-dependent extension of P2.1 under reaction conditions of the first partial amplification. Both primers P1.1 and P2.1 include sequence segments which can complementarily bind to the target sequence (s) such that the primers are positioned at both ends of the target sequence. The amplification product 1 .1 formed during the first partial amplification can be used as starting nucleic acid 2.1 for the second partial amplification (A2.1). During the second partial amplification, a second amplification fragment 2.1 is amplified comprising a third primer extension product P3.1 -Ext and a fourth primer extension product P4.1 -Ext., Wherein the primer extension product P3.1 -Ext as template-dependent extension of P3.1, resulting from the polymerase and the primer extension product 4.1-ext from the template-dependent extension of P4.1 under reaction conditions of the second partial amplification. Both primers P3.1 and P4.1 include sequence segments which can bind complementarily to the target sequence or their complementary sequence portions. Although P1.1 and P3.1 are capable of complementary binding with their 3 ^' segments to the controller oligonucleotide, they are not extended by the polymerase used due to the modification of the controller oligonucleotide.

Fig. 2 shows schematically starting materials and products of a first partial amplification. During the first partial amplification, a specific amplification of a first amplification fragment 1.1 takes place. comprising a first primer extension product P1.1 -Ext and a second primer extension product P2.1 -Ext .. The primer extension product P1.1 -Ext is carried out as a template-dependent extension of P1.1, and the primer extension product 2.1 -Ext results from the template-dependent extension of P2.1.

The synthesis products formed during the reaction (P1 .1-Ext and P2.1-Ext) can form different complex forms with one another and with the controller oligonucleotide (depending on the concentration ratio and reaction conditions). In particular, these forms may comprise complexes of P1 1-Ext / C1 .1 and / or P1 1 -xt and / or P1 1 -ext / C1.1 / P2.1 -ext.

The P1-Ext comprises a 3 ^' segment which includes sequence portions which can substantially complementarily bind a P4.1 primer under reaction conditions of the second partial amplification. The P2-Ext comprises a 3 ^' segment which includes sequence portions which are capable of substantially complementarily binding a P3.1 primer under reaction conditions of the second partial amplification.

Fig. 3 shows schematically a temperature profile of the two partial amplifications (Fig. 3A) as well as a schematic illustration of product accumulation (as increasing the copy number in a time dependent manner) during the first and second partial amplifications (Fig. 3B).

The sequence of the first partial amplification A1 .1 takes place under temperature conditions which do not permit nonspecific, spontaneous strand separation in the absence of a specific controller oligonucleotide. In essence, the reaction between temperature T1 and T2 proceeds. At a lower temperature (T1) in particular a hybridization of at least one primer of the first amplification system and its extension by the polymerase, at the second temperature (T2) takes place in particular a separation of P1 -Ext and P2-Ext with the assistance of the controller oligonucleotide. The reaction proceeds as cyclic Changing the reaction temperatures, wherein the required number of cycles can be selected and can influence the extent of amplification. Here, an increase of approximately 10 copies to approximately 10 ⁸ copies is shown schematically (FIG. 3B). Furthermore, it is shown schematically here that after completion of the first partial amplification, a proportion of products formed (amplification product 1.1) was transferred as an aliquot into the second partial amplification and can serve as a starting nucleic acid chain for the second partial amplification. Thus, when diluting the batch after the first partial reaction, only a partial amount of the copies formed in the first reaction is transferred to the second reaction. Also, the components of the first amplification system are diluted so that their effect on the second amplification system is reduced because of resulting low concentrations.

Fig. 3A also shows schematically the course of the second partial amplification (A2.1), wherein the temperature conditions used are chosen so that the separation of the resulting amplification products at the temperature (T3) predominantly non-specific by thermal destabilization of the bonds between the two Strands of the synthesized complementary primer extension products and takes place without significant involvement of the controller oligonucleotide. Primer binding and extension occurs at T1 similar to the first partial amplification. The reaction essentially proceeds like a PCR, with the necessary number of PCR cycles being performed to generate the desired copy number. The reactions include the binding of primers to the template, their extension to the formation of corresponding primer extension products and separation of the formed strands by temperature. This results in the amplification product 2.1. The PCR starts with an initial amount of copies of the first amplification product 1.1 comprising a target sequence of about 10 ⁵ and amplifies the amplification product 2.1 comprising the target sequence up to a copy number of about 10 ¹⁰ .

The first partial amplification proceeds under conditions which cause a sequence-dependent separation of the synthesized strands with the assistance of the controller oligonucleotide. The second partial amplification proceeds as PCR, whereby the strand separation is predominantly sequence-unspecific.

4 schematically shows a temperature profile of the two partial amplifications (FIG. 4A) as well as a schematic illustration of a product accumulation (as an increase of the copy number in a time-dependent manner) during the first and the second partial amplifications (FIG. 4B). The reactions proceed as shown in FIG. 3, with the difference that the components of the second amplification system are added to the batch with the first partial amplification, so that the number of copies of the first amplification fragment 1 Starting amount of the starting nucleic acids represents 2.1 for the second partial amplification and no significant dilution of the components of the first amplification system takes place. Fig. 5 shows schematically the starting materials and products of an amplification comprising a first partial amplification (Fig. 5A) and then a second partial amplification (Fig. 5B) using the components of the first amplification system and the second amplification system. The reaction proceeds essentially as shown in Figure 1, except that during the second partial amplification primers P3.2 and P4.2 are used, which do not contain complementary sequence segments to the 3 ^' terminal segments of P1 1 - Ext or P2.1 text include. As a result, P1.1 -Ext and P2.1Ext products with their 3 ^' ends can not undergo complementary binding to the primers P3.2 or P4.2, which extends from a polymerase (eg Pol 1.1 or Pol 2.1) become. Thus, it is prevented that P1 1 -Ext and P2.1-Ext are excessively extended when using the primers P3.2 and P4.2 under reaction conditions of the first partial amplification. During the second partial amplification, the complete P3.1-Ext and P4.1-Ext products are formed during the cyclic synthesis procedures and multiplied. The use of such primer combinations (set 1 comprising P1 .1 and P2.1 and set 2 comprising P3.1 and P4.1) allows for the design of homogeneous reactions in which both sets of primers are in the same reaction approach at the beginning of amplification are provided.

Fig. 6 shows schematically a temperature profile of both partial amplifications (Fig. 6A) and a schematic illustration of product accumulation (as an increase in copy number in a time-dependent manner) during the first and second partial amplifications (Fig. 6B ).

The figure schematically shows a temperature profile in which both partial amplifications are performed immediately after each other (both primer sets are present at the beginning of the reaction). Schematically, it is shown that during the first amplification, the increase in the number of copies of the amplification product 1.1 is from about 10 to about 10 ⁴ . These products comprise a target sequence and serve as starting nucleic acid 2.1 for the second amplification. During the second amplification, a further increase in the number of amplified target sequences starting from approximately 10 ^{4 of} the amplification products 1.1 to approximately 10 ¹⁰ resulting amplification products 2.2.

Fig. 7A shows schematically a temperature profile of the two partial amplifications. The sequence of temperature changes in FIG. 7A corresponds to that described in FIG. 3: The sequence of the first partial amplification A1 .1 takes place under temperature conditions which do not permit nonspecific, spontaneous strand separation in the absence of a specific controller oligonucleotide. In essence, the reaction between temperature T1 and T2 proceeds. At a lower temperature (T1) in particular a hybridization of at least one primer of the first amplification system and its extension by the polymerase, at the second temperature (T2) takes place in particular a separation of P1 -Ext and P2-Ext with the assistance of the controller oligonucleotide. During the course of the reaction, the amplification of the first amplification product 1 .1 takes place, which can be used as starting nucleic acid 2.1 in the second partial amplification. The reaction proceeds as a cyclic change of Reaction temperatures, where the required number of cycles can be selected, and can influence the extent of amplification. 7A further shows schematically the course of the second partial amplification (A2.1) which takes place immediately after the first partial amplification, wherein the temperature conditions used are selected so that the separation of the resulting amplification products at the temperature (T3) is predominantly nonspecific by thermal destabilization of the bonds between both strands of the synthesized complementary primer extension products and without substantial involvement of the controller oligonucleotide. Primer binding and extension occurs at T1 similar to the first partial amplification. The reaction essentially proceeds like a PCR, with the necessary number of PCR cycles being performed to generate the desired copy number. The reactions include binding of the primers to the template, their extension to formation of corresponding primer extension products, and separation of formed strands by temperature. This results in the amplification product 2.1. The first partial amplification proceeds under conditions which induce a sequence-dependent separation of synthesized strands with the assistance of the controller oligonucleotide. The second partial amplification proceeds as PCR, whereby the strand separation is predominantly sequence-unspecific.

Fig. 7B shows a first and a second amplification as in Fig. 7A. Both reactions are separated by another temperature step, here referred to as "temperature switching step", which involves raising the temperature to about T3 for a certain time. During this step, for example, an inactivation of the polymerase of the first partial amplification can take place and / or an activation of the polymerase of the second partial amplification and / or an activation of thermolabile primers. With such a step, there is thus also a change in the activity of the individual components of the amplification systems.

Fig. 8 shows schematically a temperature profile of both partial amplifications. The process of first partial amplification corresponds to that described in FIG. 7A. The course of the second partial amplification is divided here into two phases. During the first phase (A2.1 phase 1) there is a temperature change between T1 and T3. During T1, at least one primer of the second amplification system can be bound to its corresponding complementary position in amplification product 1.1 and extended. By using lower temperatures, it is also possible to use primers with relatively short 3 ^' segments which can bind complementary (as shown in FIG. 5). Phase 1 may involve several cycles, forming the initial amplification products 2.1, which comprise complementary segments which are longer and thus capable of binding primers at higher temperatures. This allows use of higher temperatures in phase 2 for primer binding and primer extension step (shown here as cyclic extensions between T2 and T3). By increasing the temperature, for example, a generation of side reactions can be counteracted. FIG. 8B shows schematically that the temperature during the A2.1 phase 1 is lowered further to temperature T4 so that, for example, the primers of Set 2 can bind. The use of the temperature T4 in phase 1 can be caused for example by using at least one primer of set 2 comprising at least one mismatch to complementary sequence segments of the first amplification products. Low temperature (T4) is intended to support an initial generation of primer extension products starting from P3.1 and / or P4.1. After this initial generation, the temperature of the step with primer binding and primer extension can be increased (phase 2), since there are now fully complementary primer binding sites.

Fig. 9A schematically shows a temperature profile of the two partial amplifications. The sequence of the first partial amplification takes place at a uniform temperature, here at T2. All necessary steps of the first partial amplification run at this temperature. Subsequently, for example, a temperature increase (temperature switching step) can follow (as described in FIG. 7B). Subsequently, a PCR reaction is carried out as a second partial amplification.

The first partial amplification proceeds at a uniform temperature, which favors a sequence-dependent strand separation with the assistance of controller oligonucleotide.

9B schematically shows a further temperature profile during the first partial amplification, which comprises both an isothermal phase (at the beginning) and a later cyclic phase. Here, too, the first partial amplification proceeds at temperatures which favor a sequence-dependent strand separation with the assistance of the controller oligonucleotide.

10A schematically shows a temperature profile of the two partial amplifications. The second partial amplification in phase 2 involves the use of a further temperature T5, which is higher than T2. This temperature is between about 68 ° C and 82 ° C. The use of temperature T5 can weaken the binding of the controller oligonucleotide to the P3.1 -ext, and thus reduce the influence of this binding on the extension of P4.1, so that the extension of P4.1 may possibly be more efficient.

Fig. 10B schematically shows a temperature profile of both partial amplifications. During the second partial amplification, an initial generation of the second amplification products takes place in phase 1. Using primers 3.1 and 4.1, which are capable of binding to their complementary positions at elevated temperatures (T5) and being lengthened by the polymerase, the temperature in the second phase can be varied between T5 and T3. By choosing the reaction conditions, one can influence the formation of intermediates or end products. For example, using longer P3.1 and P4.1 (eg 30-40 nucleotides long) in combination with a higher temperature at the primer binding step and primer extension step in the second partial amplification (eg at T2 and / or T5), preferably P3.1-Ext and P4.1-Ext are accumulated. Fig. 1 schematically shows a temperature profile of both partial amplifications. The transition phase between both partial amplifications can be designed differently. In Fig. 1A, a continuous increase in temperature at the end of the first partial amplification is shown. In Fig. 11 B, a cyclic lowering of the temperature at the end of the first partial amplification is shown. Thus, both partial amplifications may have partial overlaps in reaction sequences.

FIGS. 12-18 show the relationships between individual components of the first amplification system (up to FIG. 14) and relations between components of the first amplification system and the second amplification system. Fig. 15A shows schematically the generation of the first amplification fragments (comprising P1 1 -Ext and P2.1-Ext) starting from a starting nucleic acid 1.1 (which is here schematically added as the nucleic acid to be amplified in the reaction). Fig. 15B shows schematically the generation of intermediates which are formed using primers P3.1 and P4.1 and P1.1 -Ext and P2.1-Ext of the first partial amplification as templates (P3.1 -Ext part 1) and P4.1 -ext part 1). These intermediates can be converted to complete P3.1-Ext and P4.1-Ext in subsequent cycles by re-primer binding and extension using P3.1-Ext TeiM and P4.1-Ext part 1 as templates. By choosing the conditions, the formation of intermediates or end products can be influenced. For example, using longer P3.1 and P4.1 (eg, 30-40 nucleotides in length) in combination with a higher temperature in the primer binding step and primer extension step in the second partial amplification (eg, at T2 and / or T5) preferably P3.1 -Ext and P4.1 -Ext accumulated.

FIGS. 19 to 26 schematically show examples of arrangements of sequence segments of a controller oligonucleotide (C1.1), the first primer (P1.1) and the third primer (P3.1) and a second primer extension product (P2. 1-text). The P2.1-Ext comprises a sequence complementary to P1.1 in the 3 ^' segment and can serve as template for the generation of P1.1 -ext in the first partial amplification. Furthermore, the P2.1 -ext comprises another complementary segment for the 3 ^' segment of P3.1, which can bind to the P2.1 -ext and be extended by the polymerase such that in the second partial amplification a P3 .1-Ext can be generated.

The figures. Figures 16 through 26 summarize examples of arrangements of segments in the controller oligonucleotide and P1.1 and P3.1. P3.1 can bind with its 3 ^' segment to the controller oligonucleotide complementary. This binding takes place in a sequence segment of the controller oligonucleotide, which is referred to here as the fourth region. Depending on how the positioning of the P3.1 is done in detail, this fourth area may have correspondingly different locations with respect to areas one, two or three. In certain embodiments, the fourth region is within the second region (FIGS. 19, 20), in another embodiment, the fourth region is at the junction between regions two and three (Figure 21), in another embodiment, the fourth region is in the third region of the controller oligonucleotide (Figure 22). In particular, the presence of the controller oligonucleotide should not lead to an unwanted formation of by-products. In particular, the primer binding to the controller oligonucleotide should not cause the polymerase to catalyze a P1.1 extension or P3.1 extension using the controller oligonucleotide. This is generally achieved by using nucleotide modifications in the controller oligonucleotide, for example by using 2 ^'to O-alkyl modifications. Such modifications are used in particular in sequence segments of the controller oligonucleotide which comprise complementary sequences at least to the 3 ^' segment of the respective primer. Furthermore, such modifications may go beyond the sequence segment complementary to a primer, for example, these sequence segments may comprise positions from about minus 10 to about plus 10 nucleotides, respectively, the position of 3 ^' end of a respective primer. The sequence segments having such nucleotide modifications are referred to herein as "second blocking moiety" comprising the complementary sequence segments to the first primer (P1 .1) (Figs. 19-22), and as "fourth blocking moiety" which are complementary sequence segments to the third Primers (P3.1) include (Figures 19-22). Such modification of controller oligonucleotides prevents the polymerases from initiating a template-dependent primer extension upon primer binding to the controller oligonucleotides. The composition of the nucleotide modifications may be the same or different in the second and fourth blocking units. The length of the respective sequence segments, which are combined into a second or fourth blocking unit, may also be the same or different for the respective blocking units. The location of the respective blocking units depends on the position of the respective potential binding sites of the primers on the controller oligonucleotide (FIGS. 19-22). A possible composition of the second blocking unit for the first primer is shown in detail. The composition of the fourth blocking unit can be designed analogously on the basis of the second blocking unit. In a particular embodiment, the third portion of the controller oligonucleotide composed entirely of 2 ^'-0-alkyl modifications of nucleotides. In another particular embodiment, the third region of the controller oligonucleotide in its 3 ^' segment (eg, nucleotide positions from 1 to 20 subsequent to the second region of the controller oligonucleotide) consists entirely of 2 ^{' to} 0 alkyl modifications of nucleotides. In another particular embodiment, the second portion of the controller oligonucleotide composed entirely of 2 ^'-0-alkyl modifications of nucleotides. In a further particular embodiment, the second region of the oligonucleotide controller and the third region of the oligonucleotide in its controller 3 is ^'segment (positions 1 to 20 and then to the second region) entirely of ^2' -0-alkyl modifications of nucleotides , Thus, it is not absolutely necessary to provide individual segments with modifications separately; complete sequence segments of the controller Oligonucleotides can be provided by complementary nucleotides, for example with 2 ^' -0-alkyl modification.

Due to a lack of modification in complementary sequence segments of the primer extension products (which are generated as a result of enzymatic activity of polymerases in a template-dependent manner), primers can be recognized and extended upon complementary binding to such sequence segments of polymerases.

FIGS. 27 to 31 schematically show examples of arrangements and potential combinations comprising primer set 1 (P1 .1 and P2.1) and primer set 2 (P3.1 and P4.1). One of the primers of primer set 1 may be identical to one of the primers of set 2 (eg P4.1 corresponds to P2.1 in FIGS. 27-28). In particular when using a dilution of the reaction mixture after the first partial amplification and an addition of the components of the second amplification system after the first partial amplification has elapsed, the primers of the second primer set may differ in their length from the primer set 1 ( Fig. 30). Preferably, primer-3 structures are used which comprise only in their 3 ^' segment a complementary sequence to the controller oligonucleotide. In particular, the composition of the 5 ^' segment of the third primer does not comprise any complementary sequence segments to the controller oligonucleotide (Figure 31).

Figures 32 to 35 show schematically the interaction of components in a first partial amplification.

FIG. 32 describes components of the structures shown in FIGS. 33-35.

Figure 33 shows schematically the strand displacement mechanism.

Figure 34 shows schematically the interaction of the structures in strand displacement.

FIG. 35 shows schematically the interaction of the structures during the first nucleic acid amplification by, on the one hand, the amplification of the first primer oligonucleotide and of the second primer oligonucleotide and furthermore the action of the controller oligonucleotide and the resulting strand displacement.

Fig. 36 shows results of Example 1; Fig. 37 shows results of Example 2; Figs. 38-40 show results of Example 3; Figures 41-47 show results from Example 4, 48-49 show results from Example 5.

FIGS. 50 to 51 schematically show a preparation of a starting nucleic acid chain 1 .1

FIGS. 52-54 schematically show certain embodiments of the amplification method.

To initiate the first amplification, a first nucleic acid polymer comprising a first target sequence M [and the M (reverse) complementary sequence M ^' ], wherein M in the 5'-3' orientation comprises in sequence the sequence sections MPL, MS and MPR, provided. In one embodiment, a first nucleic acid polymer comprises the starting nucleic acid chain. In another embodiment, a first nucleic acid polymer comprises the nucleic acid sequence of the first amplification to be amplified. In another embodiment, a first nucleic acid polymer comprises the nucleic acid sequence of the second amplification to be amplified.

In this embodiment, the target sequence M [and the M (reverse) complementary sequence M ^' ] in the 5'-3' orientation comprises in immediate sequence the sequence segments MPL, MS and MPR. In one embodiment, the first nucleic acid polymer comprises such a target sequence M. In another embodiment, the start nucleic acid chain comprises such a target sequence M. In another embodiment, the nucleic acid sequence of the first amplification to be amplified comprises such a target sequence M. In a further embodiment, the amplification Fragment 1 .1 of the first amplification, such a target sequence M. In another embodiment, the nucleic acid sequence of the second amplification to be amplified comprises such a target sequence M. In a further embodiment, the amplification fragment 2.1 of the second amplification comprises such a target sequence M.

A first left oligonucleotide primer PL1 shown here is (essentially) identical to MPL of the target sequence M. Such a PL1 is a particular embodiment of the second oligonucleotide primer (P2.1).

A first right oligonucleotide primer PR1 shown here is a particular embodiment of the first oligonucleotide primer (P1.1). PR1 comprises, in the 5'-3 'orientation, the sequence sections PCR and PMR in direct sequence, with PMR (corresponding in this embodiment to the first region of the first primer) to MPR (for example a sequence segment of the target sequence M which is to be amplified from the nucleic acid comprises [has] complementary [hybridizing] sequence [essentially sequence-specific binding] and the sequence section PCR (in this embodiment, this segment corresponds to the second region of the first primer) not to target sequence M [or with respect to the sequence M in 3 '. PR1 (in particular in the section PCR) comprises modified nucleotide units, so that PCR can not serve as a template for the activity of the first template-dependent nucleic acid polymerase

A controller oligonucleotide CR shown here comprises the sequence sections CSR, CPR and CCR in direct sequence in 5'-3 'orientation. Sequence section CSR corresponds to the third area of the controller oligonucleotide. Sequence section CPR corresponds to the second area of the controller oligonucleotide. Sequence section CCR corresponds to the first area of the controller oligonucleotide.

In one embodiment, sequence portion CSR is identical to a portion of MS of the target sequence located at 5 'of MPR [and read on initiation of polymerase from PR1 first, thus allowing CSR to bind to the polymerization product of primer PR1 (extension product of first primer) ] In one embodiment, sequence portion CPR is complementary to PMR of the first primer (and identical to MPR of the target sequence M).

In one embodiment, sequence section CCR (first section of the controller oligonucleotide) is complementary to PCR (second section) of the first primer,

In one embodiment, controller oligonucleotide (CR) in its third region (CSR) comprises modified nucleotide building blocks such that CSR can not serve as a template for the activity of the template-dependent nucleic acid polymerase

A first primer extension product (PR1 '): In addition to the sequence regions PCR and PMR (of the first primer oligonucleotide), this first primer extension product comprises, in 5'-3' orientation, a synthesized region PSR which is substantially complementary to the target sequence M in 5 'is adjacent to MPR in FIG. 5'

A second primer extension product (PL1 '): This primer extension product comprises, in addition to the sequence region MPL, a synthesized region PSL which is substantially identical to the target sequence M in the region adjacent to MPL in 3',

PR1 ^' and PL1 ^' together constitute the amplification fragment 1.1 and serve as templates (starting nucleic acid 2.1) for second amplification.

A second left oligonucleotide primer PL2: Such a PL2 is a particular embodiment of the fourth oligonucleotide primer (P4.1). This PL2 is identical in one embodiment to a first secondary primer binding region MPL2. This MPL2 in such an embodiment is encompassed by the P4.1-Ext of the second amplification fragment 2.1. In another embodiment, MPL2 may be comprised by the second primer extension product. In another embodiment, MPL2 may be comprised by target sequence M.

A second right oligonucleotide primer PR2: A PR2 is a particular embodiment of the third oligonucleotide primer (P3.1). In one embodiment, it is complementary to a region MPR2. This MPR2 may be included in one embodiment of the second primer extension product. In another embodiment, MPR2 may be transfused with the fourth primer extension product. In a further embodiment, MPR2 may be comprised by target sequence M.

The arrangement of PL2 and PR2 can be different. In one embodiment, MPL2 and MPR2 of target sequence M will be included. In another embodiment, the 3 'end of MPL2 [at least 20 positions] is located at 5' of the 5 'end of MPR2. In a further embodiment, in particular MPL2 is identical to MPL and / or MPR2 to MPR.

In a further embodiment, the third (PR2) and fourth (PL2) primer oligonucleotides may comprise further sequence segments (PCL2 or PCR2).

In the second amplification, the binding of the third (PR2) and fourth (PL2) primer oligonucleotides to corresponding complementary sites of the first amplification fragments carried out so that these primers are extended by the second polymerase in the second amplification. As a result of the second amplification, primer extension products of the third and fourth primer oligonucleotides (P3.1-Ext and P4.1-Ext) are propagated. This results in a second amplification fragment 2.1.

Fig. 55 schematically shows certain embodiments of the topography of components of the first amplification system.

The starting nucleic acid 1.1 comprises (in the 5 ^' -3 ^' direction) the following segments: M1.Y, M1.5, M1.4, M1.3, M1.2, M1.1, M1.X.

The first primer oligonucleotide comprises (in the 5 ^' -3 ^' direction) the following segments: the first region (P1.1 .1) and the second region (P1.1 .2).

The controller oligonucleotide (C1.1) comprises (in the 5 ^' -3 ^' direction) the following segments: the third region (C1 .1.3), the second region (C1 .1.2), the first region (C.1.1 .1 );

The controller oligonucleotide (C1.2) comprises (in the 5 ^' -3 ^' direction) the following segments: the third region (C1 .2.3), the second region (C1 .2.2), the first region (C.1.2.1 );

The second primer P2.1 comprises (in the 5 ^' -3 ^' direction) the following segments: P2.1.1

The second primer P2.2 comprises (in the 5 ^' -3 ^' direction) the following segments: P2.2.1

The second primer P2.3 comprises (in the 5 ^' -3 ^' direction) the following segments: P2.3.1

The first primer extension product (P1.1 -Ext) comprises (in the 5 ^' -3 ^' direction) the following segments: P1.1 E6, P1.1 E5, P1.1 E4, P1.1 E3, P1.1 E2 , P1.1 E1.

The second primer extension product (P2.1-Ext) comprises (in the 5 ^' -3 ^' direction) the following segments: P2.1 E5, P2.1 E4, P2.1 E3, P2.1 E2, P2.1 E1 ,

The preferably obtained during the first amplification primer extension products P1.1 -Ext and P2.1-Ext can form complementary double strand and together constitute the second amplification fragment 1 .1, which can serve as a starting nucleic acid 2.1 for the second amplification ,

P1.1.11 can bind predominantly complementary to M1.1 and be extended by polymerase. P2.1 .1 can bind to P1.1 E1 complementarily and be extended. P1 .1 -EXE and P2.1 -EX represent the nucleic acid to be amplified which serves as starting nucleic acid 2.1 for the second amplification. P2.1, P2.2. and P2.3 represent variants of the second primer and lead to the same amplification fragments.

FIGS. 56-57 schematically show certain embodiments of the topography of the first and second amplification systems:

The third primer oligonucleotide comprises (in the 5 ^' -3 ^' direction) the following segments: P3.1 .2, P3.1 .1, where P3.1.2 is not complementary to starting nucleic acid 1.1 or to P2.1 -Ext , P3.1.1 is essentially complementary to P2.1 E1 of the P2.1 text. The fourth primer oligonucleotide comprises (in the 5 ^' -3 ^' direction) the following segments: P4.1.2, P4.1.1, where P4.1.2 is not complementary to the complementary strand of the starting nucleic acid 1.1 or to P1 1 -Ext. P4.1 .1 is essentially complementary to P1.1 E1 of the P1 1 -xt.

The preferably obtained during the second amplification primer extension products P3.1 -Ext and P4.1-Ext can form complementary double strand and together represent the second amplification fragment 2.1.

P3.1 -Ext comprises (in the 5 ^' -3 ^' direction) the following segments: P3.1 E7, P3.1 E6, P3.1 E5, P3.1 E4, P3.1 E3, P3.1 E2, P3 .1 E1. The segments P3.1 .E5 to P3.1 E3 are identical in their sequence to P1.1 E4 to P1.1 E2.

P4.1 -Ext comprises (in the 5 ^' -3 ^' direction) the following segments: P4.1 E7, P4.1 E6, P43.1 E5, P4.1 E4, P4.1 E3, P43.1 E2, P4 .1 E1. The segments P4.1 E5 to P4.1 E3 are identical in their sequence to P2.1 E4 to P2.1 E2.

Fig. 57 shows schematically certain embodiments of the third primer (P3.1, P3.2, P3.3) and the fourth primer (P4.1, P4.2, P4.3), wherein the 3 ^' segment of the respective primer can be shifted in relation to each other.

FIGS. 58-59 schematically show certain embodiments for oligonucleotide probe localization regions:

D1 - is located at the 5 ^' end of the P4.1-Ext. Thus, for example, primers with probe function can be used, eg, Scorpion primers, Lux primers, with primers constructed in their 3 ^' segments similar to P4.1.

D4 - located at the 5 ^' end of P3.1-Ext. Thus, for example, primers with probe function can be used, eg, Scorpion primers, Lux primers, with primers constructed in their 3 ^' segments similar to P3.1.

Areas D2 and D3 are in middle segments of the P3.1 -Ext and P4.1 -Ext, respectively. Therefore, hybridization probes may here, for example (for example, molecular beacons, TaqMan probes (5 ^'to ^3' nuclease cleavable probes or oligonucleotide probes with 2-FRET pairs) are located.

D2 range is particularly well suited for potential probe localization (in P3.1-Ext or in P4.1-Ext) because this region does not overlap with controller oligonucleotide. Therefore, probes can be used especially in homogeneous assays in this area. This region comprises the 3 ^' segment of the third primer extension product. D3 probes can also be provided for both P3.1-Ext and P4.1-ext. However, in the case of relatively high concentrations of C1.2 (controller, eg 0.5 mol / l to 5 pmol / l, eg in the context of a homogeneous assay), it has to be taken into account that such probes may possibly interact with the controller or the controller can be displaced. At relatively low concentrations of controller (eg, in the range less than 1 nmol / l), this interaction may occur with Controllers are neglected (eg when diluting the first amplification before the second amplification).

FIG. 60 schematically shows certain embodiments of the localization of probe

Segments which can bind predominantly complementary to the third (and possibly the first) primer extension product (P3.1-Ext and P1 .1-Ext). Various embodiments show that there are several possibilities for potential probe localizations.

FIG. 61 schematically shows certain embodiments of the localization of probe

Segments which can bind predominantly complementary to the fourth (and possibly the second) primer extension product (P4.1-Ext and P2.1-Ext). Various embodiments show that there are several possibilities for potential probe localizations.

FIGS. 62-63 schematically show certain embodiments of probes:

Probes localized in D1: S3.1, S3.2, S3.3. The probes include a fluorescent reporter (R) / fluorescent quencher (Q) pair, which when hybridized to corresponding segments of primer extension products (reporter / quencher spatial separation) results in signal enhancement. Probe S3.1 and S3.3 can be extended as primers, resulting in primer extension products starting from primers with probe function (S3.1 -Ext) and S3.3.Ext in Fig. 63).

In Fig. 64-67 schematically specific embodiments of oligonucleotide probes frequently points shown, as is widely used: S3.4 provides a 5 ^'to ^3' nuclease cleavable probe ( "Taqman probe") represent This probe can after their Hybridiserung on. the P3.1-Ext are cleaved by a Taq polymerase, with simultaneous P4.1 extension.

Probe S3.6 provides a probe system in which 2 oligonucleotides can / must bind to the P3.1-Ext. An oligonucleotide is the probe S3.6 with fluorescence reporter (R), the other probe is the controller oligonucleotide C1.2, which comprises a donor fluorophore in its 5 ^' region. Simultaneous binding of both oligonucleotides to P3.1-Ext results in sufficient spatial proximity (below 25NT) so that FRET can occur, resulting in the signal.

Probe S3.7 schematically represents a probe with self-complementary portions ("Molecular Beacon"). In the non-bound state, the signal from the fluorescence reporter (R) is preferably quenched by fluorescence quencher (Q) under selected reaction conditions. Upon complementary binding, the structure unfolds, resulting in spatial separation of the R from Q, which usually results in signal increase.

FIGS. 68-71 schematically show certain embodiments of the localization of a target sequences 1-3 in the start nucleic acid 1 .1, an amplification fragment 1.1 (P1 .1-Ext and P2.1-ext), and the second amplification fragment 2.1 (FIG. P3.1 text and P4.1 text).

Claims

claims

1 . A method of amplifying a nucleic acid (Fig.56), wherein:

A sample containing a first nucleic acid polymer comprising a first target sequence M1 [and the M1 (reverse) complementary sequence M1 ^' ], where M in 5'-3' orientation directly follow the sequence segments M1 .5, M1 .4 , M1 .3, M1 .2 and M1 .1, in a first amplification step is brought into contact with the following components:

A first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and substrates of the matrix-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, in particular magnesium ions,

• a first (right) oligonucleotide primer P1 .1, which in sequence 5 'to 3' directly comprises the sequence segments P1 .1 .2 and P1 .1 .1, P1 .1 .1 being complementary to M1 .1 [hybridizing] sequence [can bind in a substantially sequence-specific manner] and the sequence section P1 .1 .2 can not bind to M1 [or a sequence immediately adjacent to M1 .1 with respect to the sequence M1 in the 3'-direction], and

A second (left) oligonucleotide primer P2.1, which is (substantially) identical to M1 .5 [and sequence-specifically the reverse complementary sequence of M1 .5 on the opposite strand of M1 or the extension product of P1 .1, P1 .1 - Ext, there called P1 .1 E1, can bind];

A controller oligonucleotide C1 .2 which comprises in sequence 5 'to 3' the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1, C1 .2.3 being identical to a section M1 .2 of M1 , which lies in the 5 'direction of M1 .1 [and can be read first on initiation of the polymerase of P1 .1, ie C1 .2.3 can bind to the polymerization product of the primer P1 .1-Ext], C1 .2.2 complementary to P1 .1 .1 (and identical to M1 .1) and C1 .2.1 is complementary to P1 .1 .2, and where C1 .2 in C1 .2.1 comprises modified nucleotide units such that C1 .2.1 can not serve as template for the activity of the template-dependent nucleic acid polymerase,

and wherein the sample is contacted in a second amplification step with the following components:

c) a third (right) oligonucleotide primer P3.1 which comprises at the 3 'terminus a sequence segment 3.1 .1 [or consisting essentially of 3.1 .1] that is (reverse) complementary to M1 .1 of M1 [complementary to P2 1), d) a fourth (left) oligonucleotide primer P4.1 which comprises at the 3 'terminus a sequence segment 4.1 .1 [or consists essentially of 4.1 .1 which is identical or substantially identical to M1 .5 of M1 is [can bind complementarily to P1 1 -ext],

e) a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the matrix-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors.

2. The method for amplifying a nucleic acid according to claim 1, wherein a first primer extension product P1 .1-Ext. which, in the 5'-3 'orientation, comprises, in addition to the sequence regions P1 .1 .2 and P1 .1 .1, a synthesized region which in the 5'-3' orientation contains the sequence segments P1 .1 E4, P1.1 E3, P1 .1 E2 and P1 .1 E1, where P1 .1 E4 to the sequence section M1 .2 of the target sequence M1, P1 .1 E3 to M1 .3, P1 .1 E2 to M1 .4 and P1 .1 E1 to M1 .5 is substantially complementary, and a second primer extension product P2.1 -Ext is obtained, which in addition to the sequence area P2.1 .1 a synthesized area P2.1 Ext. which is substantially identical to the target sequence M1 in the region adjacent to M1 .5 in the 3 'direction,

and where

the reaction conditions of the first amplification step are selected, and / or

the lengths and / or the melting temperatures of P1 .1 .2 and possibly M1 .4, M1 .3, M1 .2 and M1 .1 are selected such that

that P1 .1 -Ext can form a double strand with M1 or with P2.1-Ext, and P1 .1-Ext can form a double strand with C1 .2 and the formation of the double strand from P1 .1 -Ext with C1 .2 is preferred over the formation of the double strand of P1 1 -ext with P2.1-Ext.

3. The method for amplifying a nucleic acid according to claim 2, wherein

the reaction conditions of the first amplification step are selected, and / or the lengths and / or the melting temperatures of P1 .1 .2 and possibly M1 .4, M1 .3, M1 .2 and M1 .1 are selected such that

In the absence of the controller oligonucleotide C1 .2, the first primer extension product P1 .1 -EX does not separate at all or does not differ significantly from the second primer extension product P2.1-Ext.

4. The method according to any one of the preceding claims, characterized in that the modified Nukleotidbausteine 2'-0-Alkylribonukleosidbausteine, in particular 2'-0-Methylribonukleosidbausteine include.

5. The method according to any one of the preceding claims, wherein the first

Amplification step is carried out substantially isothermally, in particular at a temperature in the range between 20 ° C and 50 ° C.

6. The method according to any one of the preceding claims, wherein the first

Amplification step is carried out until P1 .1 -Ext is present in a copy number in the range of 10 to 1 e12, in particular from 100 to 1 e10, in particular from 1000 to 1 e8.

7. The method according to one of the preceding claims, wherein P3.1 and / or P4.1 have a second range P3.1 .2 or P4.1 .2, located at the 5 'end of the range P3.1 .1 or P4.1 .1, where the second region is not complementary to P1 .1-Ext or P2.1-Ext.

8. The method according to any one of the preceding claims, wherein during the second amplification step, the reaction temperature is cyclically increased and decreased, in particular between a temperature in the range between 20 ° C and 75 ° C as a low temperature, and a temperature between 85 ° C to 105 ° C is changed.

9. The method according to any one of the preceding claims, characterized in that the first polymerase and the second polymerase are identical.

10. The method according to any one of the preceding claims, characterized in that

P1 .1 and P3.1 are substantially identical; and or

P2.1 and P4.1 are essentially identical.

1 1. Method according to one of the preceding claims, characterized in that the first amplification and the second amplification are carried out in the same reaction mixture.

12. The method according to claim 7, characterized in that the second polymerase, the third primer oligonucleotide (P3.1) and / or the fourth primer oligonucleotide (P4.1) are activated, and / or the controller oligonucleotide (C1 .1) can be deactivated.

13. The method according to any one of the preceding claims 1 to 6, characterized in that the first amplification in a first reaction mixture and the second amplification are carried out in a second reaction mixture.

14. The method according to claim 9, characterized in that an aliquot of the first reaction mixture or the complete first reaction mixture is added to the second reaction mixture.

15. The method according to any one of the preceding claims, characterized in that the controller oligonucleotide (C1 .1) comprises a fourth region which can bind sequence-specifically to the third primer oligonucleotide (P3.2).

16. The method according to any one of the preceding claims, characterized in that the first primer oligonucleotide (P1 .1) in the second region has a modification or a plurality of modifications, in particular immediately after the first region of the first primer oligonucleotide, the first Polymerase stops at the second area.

The method of any one of the preceding claims, wherein the sample is further contacted with a first probe oligonucleotide which:

a. comprises a sequence section which

b. is bound to a fluorescent dye, the

i. with a second to the first probe oligonucleotide forms a donor-quencher pair or a FRET pair or

ii. with a fluorescent dye attached in sufficiently close proximity to the binding site of the first probe oligonucleotide second probe oligonucleotide forms a donor-quencher pair or a FRET pair.

18. A method for amplifying a nucleic acid, wherein:

a) a sample containing a first nucleic acid polymer comprising a first target sequence M1, M1 in 5'-3 'orientation in immediate sequence, the sequence sections M1 .5, M1 .4, M1 .3, M1 .2 and M1 .1 in a first amplification step, the following components are brought into contact: b) a first template-dependent nucleic acid polymerase, in particular a DNA polymerase, and substrates of the template-dependent nucleic acid polymerase, c) a first (right) oligonucleotide primer P1. 3 'orientation in immediate sequence comprises the sequence sections P1 .1 .2 and P1 .1 .1, P1 .1 .1 having a [hybridizing] sequence complementary to M1 .1 and the sequence section P1 .1 .2 not having M1 can bind, and wherein P1 .1 (in particular in section P1 .1 .2) comprises modified nucleotide units, so that P1 .1 .2 can not serve as template for the activity of the first template-dependent nucleic acid polymerase; and

d) a second (left) oligonucleotide primer P2.1 which is (substantially) identical to M1 .5;

e) a controller oligonucleotide C1 .2, which in the 5'-3 'orientation comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct succession, C1 .2.3 being identical to a section M1 .2 of M1 which is in the 5 'direction of M1 .1, C1 .2.2 is complementary to P1 .1 .1 (and identical to M1 .1) and C1 .2.1 is complementary to P1 .1 .2,

wherein the sample is further contacted with a first probe oligonucleotide which:

a. comprises a sequence section which

b. is bound to a fluorescent dye, the

19. The method according to claim 17 or 18, wherein the sequence section of the first probe oligonucleotide does not hybridize with P1.1, P2.1, P3.1 and P4.1 as well as with C1.2 under the reaction conditions of the second amplification step.

20. A kit for carrying out the method according to one of the preceding claims, comprising:

a) a first (right) oligonucleotide primer P1 .1, which in the 5'-3 'orientation directly comprises the sequence sections P1 .1 .2 and P1 .1 .1, P1 .1 .1 to a primer binding site M1. 1 of a genomic sequence M1 of a eukaryotic organism or of a pathogenic bacterium, in particular one Mammalian, in particular to a human target sequence, with M1 in the 5'-3 'orientation in immediate sequence comprising the sequence sections M1 .5, M1 .4, M1 .3, M1 .2 and M1 .1, and the Sequence section P1 .1 .2 can not bind to M1 [or a sequence immediately adjacent to M1, 3 with respect to the sequence M1 in Fig. 3], and

wherein P1 .1 (in particular in section P1 .1 .2) comprises modified nucleotide units, so that P1 .1 .2 can not serve as template for the activity of a first template-dependent nucleic acid polymerase; and

b) a second (left) oligonucleotide primer P2.1, which is (substantially) identical to M1 .5 [and sequence-specifically the reverse complementary sequence of M1 .5 on the opposite strand of M1 or the extension product of P1 .1, P1 .1 -Ext, there referred to as P1 .1 E1, can bind];

c) a controller oligonucleotide C1 .2, which in the 5'-3 'orientation comprises the sequence sections C1 .2.3, C1 .2.2 and C1 .2.1 in direct succession, C1 .2.3 being identical to a section M1 .2 of M1 which is located in 5 'of M1 .1 [and is read first upon initiation of the polymerase of P1 .1, ie C1 .2.3 can bind to the polymerization product of the primer P1 .1 -Ext], C1 .2.2 is complementary to P1. 1 .1 (and identical to M1 .1) and C1 .2.1 is complementary to P1 .1 .2, where C1 .2 in C1 .2.1 contains modified nucleotide building blocks such that C1 .2.1 does not serve as a template for the activity of a first can serve template-dependent nucleic acid polymerase,

such as

f) a third (right) oligonucleotide primer P3.1 which comprises at the 3 'terminus a sequence segment 3.1 .1 [or consisting essentially of 3.1 .1] that is (reverse) complementary to M1 .1 of M1 [complementary to P2 G. A fourth (left) oligonucleotide primer P4.1 which comprises at the 3 'terminus a sequence segment 4.1 .1 [or consists essentially of 4.1 .1 which is identical or substantially identical to M1 .5 of M1 is [can bind complementarily to P1 1 -ext],

and optionally further comprising a second template-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, in particular a thermophilic matrix-dependent polymerase, in particular a thermophilic matrix-specific polymerase with 5 ^' . 3 ^' exonuclease activity;

and or

comprising a first probe oligonucleotide which: a. comprises a sequence section which

and

b. is bound to a fluorescent dye, the

ii. with one in close proximity to the binding site of the first probe

Oligonucleotide-binding second probe oligonucleotide fluorescent dye connected a donor-quencher pair or a

FRET pair forms.

21. The kit of claim 20, further comprising a first template-dependent one

Nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of DNA polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, in particular a mesophilic matrix-dependent polymerase, in particular a mesophilic matritzenabhängige polymerase without 5 ^' -3 ^' -Exonukleaseaktivität.

22. The kit according to any one of claims 20 or 21, wherein the modified nucleotide building blocks

2'-O-Alkylribonukleosidbausteine, in particular 2'-0-Methylribonukleosidbausteine include.