CN111979258A - Editing method of high-throughput gene - Google Patents
Editing method of high-throughput gene Download PDFInfo
- Publication number
- CN111979258A CN111979258A CN202010772166.0A CN202010772166A CN111979258A CN 111979258 A CN111979258 A CN 111979258A CN 202010772166 A CN202010772166 A CN 202010772166A CN 111979258 A CN111979258 A CN 111979258A
- Authority
- CN
- China
- Prior art keywords
- artificial sequence
- dna
- vector
- vectors
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a high-throughput gene editing method, belonging to the technical field of genetic engineering; respectively inserting tag sequences 1-11 into T-DNA of pRGEB32 vector to obtain high-throughput gene knockout vectors p32A1-p 32A 11; inserting tRNA and ccdB genes into pRGEB32 and p32A1-p 32A11 vectors to obtain gene knockout vectors p32B 0-p 32B11 with improved cloning accuracy. When the high-throughput gene knockout vector provided by the invention is used for large-scale gene knockout in rice, a transgenic strain with specific gene editing can be quickly obtained, sequencing is not needed, the target gene of the transgenic strain can be determined only by a PCR (polymerase chain reaction) and PAGE (PAGE), the workload and the working time are greatly reduced, the efficiency of target site editing reaches 92.5%, and the biallelic gene mutation efficiency reaches 82.1%.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to a high-throughput gene editing method.
Background
With the rapid development of sequencing technology, from lower microorganisms to higher animals and plants, more and more species complete the sequencing of whole genes, and how to systematically analyze the functions of each genetic locus on the genome in different biological processes is a greater challenge for life science research.
Knocking out a target gene to disable the function is one of the most common methods for studying the function of a specific gene. In recent years, CRISPR/Cas9 genome editing technology appears, and provides powerful technical support for the research of molecular biology. The CRISPR/Cas (Clustered regulated shorten plasmid streams-CRISPR associated nucleic acid) system is an adaptive immune mechanism existing in bacteria and archaea, and can specifically recognize and degrade DNA of invaded phage and exogenous plasmid. Among them, the type II CRISPR/Cas9 system from Streptococcus pyogenes was successfully applied for genome editing in many species. The CRISPR/Cas9 genome editing system consists of a single-stranded guide RNA-sgRNA and a nuclease Cas9 protein, wherein the sgRNA guides the Cas9 protein to recognize and cut a specific site of a genome to cause double-strand break of DNA at a target site, and then when a cell endogenous DNA repair system is used for repairing DSB, the situations of insertion, deletion, replacement and the like can be generated, so that the frame shift mutation of a target gene is caused, and the purpose of gene knockout is realized.
Since the specificity of the CRISPR/Cas9 for identifying the target site depends on about 20 base sequences which are complementary and matched with the target site in the guide RNA, and only 20bp nucleotide sequences on the vector need to be replaced for editing different sites, the CRISPR system is more suitable for constructing a high-throughput large-scale mutant library. At present, some researches report that a whole-gene-scale mutant library (Shalem et al, 2014; Wang et al, 2014; Meng et al, 2017; Lu et al, 2017) is established in mammalian cells and plants such as rice by using a CRISPR/Cas9 system, and the researches mostly adopt a similar method, namely, a sgRNA oligonucleotide library is firstly synthesized and then connected into a vector to construct a CRISPR vector library, and then the CRISPR vector is transferred into a receptor cell in a mixed mode. However, there are many places where improvement is required, for example, in the construction of a pool of rice mutants, it is necessary to obtain enough plants with a particular gene knocked out to determine the phenotype of the plant due to a change in gene function, rather than off-target or insertion site of T-DNA. However, it is difficult to obtain enough plants with certain genes knocked out in a short time by using the conventional method of obtaining a large number of transgenic plants by agrobacterium-mediated genetic transformation using a mixed plasmid library. In addition, extensive sequencing is required to determine the target site information of all transgenic plants, which is time consuming and costly.
Disclosure of Invention
In view of the above, the present invention provides a method for editing a high-throughput gene, which can greatly reduce the workload and the working time when performing large-scale gene knockout.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides a high-throughput gene editing method, which comprises the following steps:
1) respectively inserting tag sequences 1-11 into T-DNA of pRGEB32 vector to obtain p32A1-p 32A11 vectors;
the nucleotide sequences of the tag sequences 1-11 are shown as SEQ ID Nos. 1-11 in sequence;
2) inserting the tRNA fragment and the ccdB fragment into the pRGEB32 vector and the p32A1-p 32A11 vector obtained in the step 1) to obtain gene knockout vectors p32B 0-p 32B 11;
the nucleotide sequence of the tRNA fragment is shown as SEQ ID No. 12;
the nucleotide sequence of the ccdB fragment is shown as SEQ ID No. 13;
the gene knockout vector p32B0 is obtained by inserting a tRNA fragment and a ccdB fragment into a pRGEB32 vector;
the gene knockout vectors p32B 1-p 32B11 are obtained by sequentially inserting tRNA fragments and ccdB fragments into p32A1-p 32A11 vectors;
3) carrying out high-throughput gene editing on gene knockout vectors p32B 0-p 32B11 of the CRISPR system obtained in the step 2).
Preferably, the method for constructing the gene knockout vector in step 2) comprises: and connecting the tRNA fragment and the ccdB fragment to obtain a connecting fragment, and inserting the connecting fragment into a pRGEB32 vector and p32A1-p 32A11 vectors to obtain a gene knockout vector.
Preferably, the system used for ligation comprises 25. mu.l of 2 XHi-Fi MIX, 50ng of tRNA fragment, 50ng of ccdB fragment, 10. mu.M of 32B-F12. mu.l, 10. mu.M of 32B-R22. mu.l and water to 50. mu.l per 50. mu.l.
Preferably, the nucleotide sequence of the 32B-F1 is shown as SEQ ID No.14, and the nucleotide sequence of the 32B-R2 is shown as SEQ ID No. 15.
Preferably, the procedure for the ligation is 98 ℃ for 2 min; 98 ℃ 10s, 60 ℃ 10s, 72 ℃ 15s/kb for 35 cycles.
The invention provides a high-throughput gene editing method, which comprises the following steps: 1) respectively inserting tag sequences 1-11 into T-DNA of pRGEB32 vector to obtain p32A1-p 32A11 vectors; the nucleotide sequences of the tag sequences 1-11 are sequentially shown as SEQ ID Nos. 1-11; 2) inserting the tRNA fragment and the ccdB fragment into the pRGEB32 vector and the p32A1-p 32A11 vector obtained in the step 1) to obtain gene knockout vectors p32B 0-p 32B 11; the nucleotide sequence of the tRNA fragment is shown as SEQ ID No. 12; the nucleotide sequence of the ccdB fragment is shown as SEQ ID No. 13; the gene knockout vector p32B0 is obtained by inserting a tRNA fragment and a ccdB fragment into a pRGEB32 vector; the gene knockout vectors p32B 1-p 32B11 are obtained by sequentially inserting tRNA fragments and ccdB fragments into p32A1-p 32A11 vectors; 3) carrying out high-throughput gene editing on gene knockout vectors p32B 0-p 32B11 of the CRISPR system obtained in the step 2). The 12 vectors are used as a vector framework, different gRNAs are inserted, so that different gRNAs correspond to tag sequences with different lengths one by one, after transgenic rice is obtained, the tag sequences on the vectors can be amplified through PCR (polymerase chain reaction), fragments with different sizes are separated by electrophoresis, target sites of different strains can be rapidly distinguished without sequencing, and the workload and the working time can be greatly reduced by carrying out large-scale gene knockout on the group of vectors.
Drawings
FIG. 1 is a high throughput genetic transformation system suitable for use in a variety of genetic manipulations;
FIG. 2 is a vector system and workflow for high throughput gene editing;
FIG. 3 shows the resolution of PCR products using 12 different vectors as templates by 12% PAGE;
FIG. 4 is a 12% PAGE analysis of PCR products using different combinations of mixed vectors as templates;
FIG. 5 is a schematic diagram of the structure before and after optimization of the vector;
FIG. 6 is a schematic diagram of a construction method of a 96-well plate-based high-throughput carrier;
FIG. 7 is a partial electrophoresis result of detecting the tag sequence of the transgenic line by PCR-PAGE;
FIGS. 8-1 and 8-2 are sequencing results of gRNAs contained in transgenic lines of 12 different target genes;
FIG. 9 shows the number distribution of different target gene plants in the first group of transgenic rice plants;
FIGS. 10-1 and 10-2 show the editing of the target sites of the transgenic line portions of 12 different target genes;
FIG. 11 is statistics of target site editing of transgenic lines.
Detailed Description
The invention provides a high-throughput gene editing method, which comprises the following steps:
1) respectively inserting tag sequences 1-11 into T-DNA of pRGEB32 vector to obtain p32A1-p 32A11 vectors;
the nucleotide sequences of the tag sequences 1-11 are shown as SEQ ID Nos. 1-11 in sequence;
2) inserting the tRNA fragment and the ccdB fragment into the pRGEB32 vector and the p32A1-p 32A11 vector obtained in the step 1) to obtain gene knockout vectors p32B 0-p 32B 11;
the nucleotide sequence of the tRNA fragment is shown as SEQ ID No. 12;
the nucleotide sequence of the ccdB fragment is shown as SEQ ID No. 13;
the gene knockout vector p32B0 is obtained by inserting a tRNA fragment and a ccdB fragment into a pRGEB32 vector;
the gene knockout vectors p32B 1-p 32B11 are obtained by sequentially inserting tRNA fragments and ccdB fragments into p32A1-p 32A11 vectors;
3) carrying out high-throughput gene editing on gene knockout vectors p32B 0-p 32B11 of the CRISPR system obtained in the step 2).
In the present invention, the pRGEB32 vector is described in Addgene (Plasmid: # 63142); the nucleotide sequences of the tag sequences 1-11 are shown as SEQ ID No. 1-11 in sequence, and are specifically shown as follows:
SEQ IDNo.1:AGCTGGATCC；
SEQ IDNo.2:agctGGATCCAACTGAGTGG；
SEQ IDNo.3:agctGGATCCAACTGAGTGGTCAAGAGGTG；
SEQ IDNo.4:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTG；
SEQ IDNo.5:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGC；
SEQ IDNo.6:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTT；
SEQ IDNo.7:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTTGCACGTTGGT；
SEQ IDNo.8:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTTGCACGTTGGTACGAACTTAG；
SEQ IDNo.9:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTTGCACGTTGGTACGAACTTAGCAACCTCGAC；
SEQ IDNo.10:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTTGCACGTTGGTACGAACTTAGCAACCTCGACACGCATGGTC；
SEQ IDNo.11:
agctGGATCCAACTGAGTGGTCAAGAGGTGACGAGTGTTGAACGCATGGCATGCGAACTTGCACGTTGGTACGAACTTAGCAACCTCGACACGCATGGTCGCTAGGCTTG。
in the invention, the construction method of the p32A1-p 32A11 vector is described by taking the p32A1 vector as an example, and the construction of the p32A 2-p 32A11 vector is the same as that of the p32A 1: tag sequence 1 was mixed with pRGEB32 vector and ligated overnight at 4 ℃ in a system comprising tag sequence 11. mu.l, 10 XT 4 DNAIgase Buffer 0.5. mu.l, pRGEB32 vector 50-100ng, T4 DNAIgase (NEB) 0.5. mu.l, and water to 5. mu.l. In the present invention, the tag sequence 1 is preferably diluted 10 times and ligated, and the pRGEB32 vector is preferably linearized and ligated, but the method of linearization of pRGEB32 vector in the present invention is not particularly limited, and a conventional method of linearization of vector may be used.
In the invention, the CRISPR system preferably comprises a CRISPR/Cas9 system, and the method for knocking out the gene of the high-throughput gene knock-out vector by using the CRISPR/Cas9 system is not particularly limited, and can be realized by adopting a conventional method according to the conventional cognition of a person skilled in the art.
In the present invention, the method for constructing the gene knockout vector preferably includes: inserting the tRNA fragment and the ccdB fragment into the pRGEB32 vector and the p32A1-p 32A11 vector in the technical scheme to obtain gene knockout vectors p32B 0-p 32B 11. In the invention, the nucleotide sequence of the tRNA fragment is shown as SEQ ID No. 12; the nucleotide sequence of the ccdB fragment is shown as SEQ ID No. 13; the gene knockout vector p32B0 is obtained by inserting a tRNA fragment and a ccdB fragment into a pRGEB32 vector; the gene knockout vectors p32B 1-p 32B11 are obtained by sequentially inserting tRNA fragments and ccdB fragments into p32A1-p 32A11 vectors.
In the invention, the nucleotide sequence of the tRNA fragment is shown as SEQ ID No.12, and specifically comprises the following steps:
gagttgtgcagatgatccgtggcaACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCAggagacc；
in the invention, the nucleotide sequence of the ccdB fragment is shown in SEQ ID No.13, specifically as follows:
CGGCTGGTGCAggagacctaggcaccccaggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccgtcgagattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataacagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacccgaagtatgtcaaaaagaggtatgctatgaagcagcgtattacagtgacagttgacagcgacagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaaccatgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagggatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacaggggctggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaatgtcaggctcccttatacacagccagtggtctcggttttagagctagaaatagcaagtt。
in the invention, the accuracy of vector cloning is improved after the tRNA fragment and the ccdB fragment are connected.
In the present invention, the method for constructing the gene knockout vector preferably includes: and connecting the tRNA fragment and the ccdB fragment to obtain a connecting fragment, and inserting the connecting fragment into a pRGEB32 vector and p32A1-p 32A11 vectors to obtain gene knockout vectors p32B 0-p 32B 11. In the present invention, the system used for ligation preferably comprises 25. mu.l of 2 XHi-FiMIX, 50ng of tRNA fragment, 50ng of ccdB fragment, 32B-F12. mu.l at a concentration of 10. mu.M, 32B-R22. mu.l at a concentration of 10. mu.M, and water to 50. mu.l per 50. mu.l.
In the invention, the nucleotide sequence of 32B-F1 is shown in SEQ ID No.14, and is specifically shown as follows:
gagttgtgcagatgatccgt；
the nucleotide sequence of the 32B-R2 is shown in SEQ ID No.15, and is specifically shown as follows:
aacttgctatttctagctctaaaaccgagaccactggctgtgtat。
in the present invention, the procedure for the ligation is preferably 98 ℃ for 2 min; 98 ℃ 10s, 60 ℃ 10s, 72 ℃ 15s/kb for 35 cycles.
In the invention, the CRISPR system preferably comprises a CRISPR/Cas9 system, and the method for knocking out the gene of the gene knock-out vector by using the CRISPR/Cas9 system is not particularly limited, and can be realized by adopting a conventional method according to the conventional cognition of a person skilled in the art.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
The primers used in the following examples are shown in tables 1 and 2.
TABLE 1 primers used for vector construction
TABLE 2 primer sequences for detecting the editing of tag sequences and target genes
Example 1
1. Construction of high-throughput gene knockout vector system
(1) The vector pRGEB32 was digested with restriction enzyme Hind III to obtain a linearized vector.
(2)Using Random Sequence Generator (a)http://molbiotools.com/ randomsequencegenerator.html) The tool randomly generates a 110bp sequence with moderate GC content, and compares the sequence in a rice genome database to ensure that no similar sequence exists and avoid influencing the subsequent detection.
(3) Using the designed 110bp sequence as reference, DNA tag sequences (SEQ ID Nos. 1-11) of 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110bp were synthesized by primer phosphorylation and annealing, respectively, and used for insertion into the linearized vector. The primers and the amount required for synthesizing each fragment are detailed in the primer sequence table 1, and the primers are firstly phosphorylated, and the specific operations are shown in table 3:
TABLE 3 detailed description of the operations
Incubate at 37 ℃ for 1 h.
(4) Annealing the phosphorylation product, and placing the phosphorylation product in a PCR instrument for 5min at the program of 95 ℃; then the temperature is reduced to 25 ℃ at the speed of 0.1 ℃/s.
(5) The DNA fragments were ligated into linearized pRGEB32 using T4DNA ligase (NEB).
TABLE 4 connection System
| Annealing products (1:10 dilution) | 1μl |
| 10×T4 DNA Ligase Buffer | 0.5μl |
| Linearized vector pRGEB32 | 50-100ng |
| T4 DNA Ligase(NEB) | 0.5μl |
| H2O | Make up to 5. mu.l |
Ligation was carried out overnight at 4 ℃.
(6) The ligation product is transformed into DH5 alpha, positive clones are identified and confirmed by sequencing, and 11 new vectors p32A1-p 32A11 are constructed.
(7) The high-throughput gene knockout vector system is composed of 12 vectors including p32A1-p 32A11 and pRGEB 32.
2. Verification of the feasibility of a Carrier System
In order to verify whether each vector can be distinguished by a PCR method, primers 32A-F1 and 32A-R1 are designed on two sides of a vector insert fragment, vectors 1-12 respectively represent pRGEB32 and p32A1-p 32A11, plasmids of 12 vectors are used as templates, the same primers are used for amplifying fragments containing tag sequences with different sizes, 12% non-deformable PAGE electrophoresis detection is used, and the result is shown in figure 3, wherein the minimum band is 51bp, the maximum band is 161bp, the difference between adjacent bands is 10bp, each band with different sizes corresponds to different vectors, and different bands are clearly distinguished by electrophoresis. In addition, a plurality of mixed vectors are used as templates to simulate the situation when a plurality of vectors are transferred into the same plant, as shown in FIG. 4, the difference between every two adjacent bands of Mix1 and Mix2 is 20bp, and the difference between every two adjacent bands of Mix3 and Mix4 is 10bp, so that the bands are clearly distinguished, thereby proving that the method for distinguishing different vectors by utilizing PCR-electrophoresis is feasible.
Example 2
Construction of a library of receptor-like kinase mutants
Since the receptor-like kinase plays an important role in the aspects of plant growth and development, external environment change sensing, signal transduction and the like, the rice receptor-like kinase is taken as a research object, and a mutant library for knocking out the rice receptor-like kinase is constructed by utilizing the CRISPR vector system established in the embodiment 1.
Through analysis, 1070 receptor-like Kinase genes (Rice Kinase Database, http:// ricephenylogenomics. uddavis. edu/Kinase/index. shtml) in Rice are determined, target sites are designed for all genes, two target sites are designed for the first 96 genes respectively, two gRNAs construct PTG fragments (polymorphic-tRNA-NA) through a Golden Gate connection method, and then the PTG fragments are inserted into the designed vector for high-throughput gene knockout. Specifically, PTGs constructed for each gene were inserted into a set of 12 high-throughput gene knockout vectors constructed before, i.e., one vector corresponded to PTGs of one gene, using 12 genes as a set (a in fig. 2). Such a set of 12-gene knockout vectors is then used for mixed transformation after agrobacterium is transformed separately to obtain transgenic plants.
In order to further improve the success rate of vector cloning and simplify the vector construction steps, pRGEB32 and 11 p32A series vectors are modified, a set of new p32B series vector system is constructed, and the vector structure is shown in FIG. 5. The 12 p32B series vectors still contain tag sequences with different lengths, tRNA and ccdB genes are increased, the construction of single gRNA is facilitated, and the influence of an empty vector on the cloning success rate is reduced. The specific construction steps are as follows:
(1) PCR amplification tRNA (SEQ ID No.12)
TABLE 5 tRNA amplification systems
| 2×Hi-Fi MIX(MCLAB) | 10μl |
| Template p32A1-PTG4 | 10ng |
| 32B-F1(10μM) | 0.5μl |
| 32B-R1(10μM) | 0.5μl |
| H2O | Make up to 20. mu.l |
(2) PCR amplification of a fragment containing ccdB (SEQ ID No.13)
TABLE 5 amplification System for ccdB fragments
| 2×Hi-Fi MIX(MCLAB) | 10μl |
| Template p1300-32 | 10ng |
| 32B-F2(10μM) | 0.5μl |
| 32B-R2(10μM) | 0.5μl |
| H2O | Make up to 20. mu.l |
PCR reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, and extension at 72 ℃ for 15s/Kb for 35 cycles, and finally extension for 2 min.
(3) The PCR product was detected by agarose gel electrophoresis and then purified using a gel recovery kit (OMEGA).
(4) Both tRNA and ccdB fragments were ligated using Overlap extension PCR. 50 μ l reaction: 25 ul 2 XHi-Fi MIX (MCLAB), 50ng each of tRNA and ccdB purified product, 2 ul each of primers 32B-F1/32B-R2(10 uM), and water make-up to 50 ul. The reaction program refers to step (2), and the annealing temperature is 60 ℃.
(5) The PCR product was separated by 1% agarose electrophoresis and the target band was recovered.
(6) pRGEB32 and p32A1-p 32A11 vectors were digested with BsaI and purified.
(7) The target fragment was cloned into a linearized vector. Reaction system: 0.5. mu.l of 5 XIn-fusion premix, 20ng of target fragment, 50ng of linearized vector, make up 2.5. mu.l with water. The reaction was carried out at 50 ℃ for 15min to convert competent DB 3.1.
(8) And detecting positive clones and sequencing to confirm that 12 vectors from p32B0 to p32B11 are successfully constructed after optimization.
Except the first 96 genes, the other receptor kinase genes are connected to a p32B series vector linearized by Bsa I through primer phosphorylation annealing in a way of one gene, one gRNA. The accuracy of vector cloning is improved from 53% of the first 96 vectors to 83.3% of the optimized vectors.
Example 3
A high-throughput vector construction method is established based on a 96-well PCR plate, and specifically, as shown in FIG. 6, PTG fragments targeting different genes or oligonucleotides of sgRNA are added into different wells of a 96-well plate after phosphorylation annealing, each column corresponds to one same vector skeleton, and a system capable of simultaneously constructing 96 vectors is established by T4DNA ligase connection. Taking the vector skeleton obtained in example 2 as the p32B series as an example, the method for constructing the high-throughput vector is as follows:
(1) gRNA was synthesized by primer phosphorylation annealing.
Forward and reverse primers for synthesis of grnas, and Mix for primer phosphorylation were added sequentially in 96-well PCR plates.
TABLE 6 systems
| Oligo-Forward(100μM) | 1μl |
| Oligo-Reverse(100μM) | 1μl |
| 10×T4 DNA Ligase Buffer | 1μl |
| T4 Polynucleotide Kinase(NEB,10U/μl) | 0.5μl |
| H2O | Make up to 10. mu.l |
Sealing the sealing film, and reacting at 37 ℃ for 1 h; the 96-well plate was then placed in a PCR instrument, annealing program: 95 ℃ for 5 min; then reduced to 25 ℃ at a rate of 0.1 ℃/s.
(2) The vector was ligated to the synthetic gRNA fragment.
BsaI cuts 12 vectors (p32B 0-p 32B11) of p32B series, and the target fragment is recovered and purified by agarose gel electrophoresis to prepare a linearized vector. The synthesized gRNA was diluted 1:100 with a multichannel pipettor and 1. mu.l each was pipetted into a new 96-well PCR plate. A linearized vector was added to each column of the PCR plate, and as shown in FIG. 6, the 12 vectors in each row consisted of 12 different vector backbones. Followed by the addition of other components for attachment.
TABLE 7 systems
The sealing film was sealed and the ligation was performed overnight at 4 ℃. Next, the ligation product was transformed into DH5 a. Firstly, 30 mul of competent cells are respectively added into a 96-hole deep-hole plate, then 2 mul of ligation products are respectively sucked by a multi-channel pipette and added into the competent cells of the corresponding deep-hole plate, and plasmids are transformed into competence by a heat shock method. The transformed competencies were plated one by one and single-clone sequenced.
The constructed vector plasmid is transferred into agrobacterium EHA105 competence through electric shock transformation, after agrobacterium monoclonal is detected to be correct through PCR, bacterial liquid of 12 vectors in each group is mixed in equal quantity, and the mixed bacterial liquid is used for infecting the callus of rice variety Kitaake to obtain a transgenic plant.
Rapid identification of target site of transgenic strain
Taking the detection of transgenic plants with a first group of 12 knocked-out genes as an example, the target site information of the genes is shown in table 3, 12 knocked-out vectors are subjected to mixed transformation, the differentiated and regenerated plants are subjected to genome DNA extraction by a CTAB method, and whether the plants are transgenic positive plants or not is further detected by PCR. The PCR system is as follows: 5 ul 2 × AidlabTaqMIX, primers Cas9-F1/Cas9-R1(10 uM) each 0.3 ul, genomic DNA template 50-100ng, water make up 10 ul; reaction procedure: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles, and finally extension for 5 min.
61 transgenic positive plants are obtained through PCR detection.
Information on 812 target genes and target sites in Table
Next, in order to quickly identify the target site information contained in each transgenic plant, the target site information contained in the transgenic plant is quickly determined by amplifying tag fragments with different lengths on the T-DNA of the transgenic plant by using primers and distinguishing the size of the PCR product. The PCR reaction system and procedure were as follows:
TABLE 9 systems
| 2×Taq MIX(Aidlab) | 5μl |
| Genomic DNA | 50-100ng |
| Indel-F(10μM) | 0.25μl |
| Indel-R(10μM) | 0.25μl |
| H2O | Make up to 10. mu.l |
Reaction procedure: pre-denaturation at 95 ℃ for 3min, denaturation at 95 ℃ for 30s, annealing at 52 ℃ for 30s, and extension at 72 ℃ for 20s for 30 cycles, and finally extension for 5 min.
The PCR products can be detected separately by polyacrylamide gel electrophoresis (PAGE). The method comprises the following specific steps:
(1) 6% polyacrylamide gel (100mL per plate)
TABLE 10 system
| 40％Acry-Bis(19:1) | |
| 5×TBE | 10mL |
| H2O | 75mL |
| APS(10％) | 1mL |
| TEMED | 100μl |
(2) Electrophoresis procedure: performing constant power 20W pre-electrophoresis for 30min, loading after finishing, and performing constant power 20W electrophoresis for 150 min.
For detection, 5' -FAM labeled primers (Indel-F/Indel-R) are designed, and PCR products can be directly scanned and imaged by using a FLA5100 fluorescence scanning analyzer after gel electrophoresis. As shown in FIG. 7, the first 36 transgenic plants were PCR amplified for fragments containing specific tags and the products were detected by 6% native PAGE. Wherein, 12 bands (M1-M12) of the Marker are PCR products amplified by respectively using 12 empty vectors (pRGEB32, p32A1-p 32A11) as templates. Each size of the fragment indicates a corresponding vector framework, and the gRNA information corresponding to each vector framework is shown in table 11, and the target gene information of each transgenic plant can be quickly found by reading the Marker corresponding to the PCR product of the plant.
TABLE 11 Marker and target Gene mapping Table
The statistics of the target site information contained in all transgenic plants by PCR and PAGE detection are shown in Table 12. To verify that the PCR-based detection method was reliable, primers OsU3-F/gRNA-R were used to amplify gRNAs in transgenic plants with 12 different target genes. 30 μ l PCR System: mu.l gold medal mix (Tsingke), OsU3-F/gRNA-R (10. mu.M) each 1. mu.l, genomic DNA (50-100 ng/. mu.l) 1. mu.l. Reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 10s, and extension at 72 ℃ for 20s for 35 cycles, and finally extension for 2 min.
The results were completely consistent with those of PCR-PAGE detection by amplifying gRNA and sequencing (see FIG. 8-1 and FIG. 8-2).
TABLE 12 Targeted Gene statistics for transgenic plants
The target gene composition of 61 transgenic plants was further analyzed, and as a result, as shown in fig. 9, the obtained transgenic plants covered all 12 target genes, and the proportion of the target genes was more average except that the number of plants with R10 as the target gene was larger and the numbers of R5 and R8 were smaller. Therefore, the transgenic plant covering all target sites can be obtained with less workload in a 12-vector mixed transformation mode, and better results can be obtained by further adjusting the proportion of each vector during agrobacterium mixing in the subsequent transformation.
Transgenic plant editing detection
After the target site information of the transgenic plant is confirmed, a sequence containing a target site part in a target gene of a part of the transgenic plant is amplified through PCR, and a PCR product is sequenced to confirm that 12 CRISPR vectors can play a genome editing role.
Transgenic plants corresponding to 12 different target genes are respectively selected, genome DNA fragments containing target sites are amplified by utilizing PCR (see Table 2 for PCR primers), and 12 target genes are mutated through sequencing analysis (partial results are shown in figure 10-1 and figure 10-2), so that the vector system can successfully realize the mutation of the target genes.
PCR system for target gene amplification: mu.l of gold medal mix (Tsingke), 1. mu.l of each primer specific for the target gene (10. mu.M), and 1. mu.l of genomic DNA (50-100 ng/. mu.l). Reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 10s, and extension at 72 ℃ (10s/Kb) for 35 cycles, and final extension for 2 min.
Further, a part of the plants randomly selected from the 6 groups of transgenic positive plants obtained by mixed transformation is subjected to target site sequencing, the editing conditions of 134 target sites are detected in total, the statistical result is shown in fig. 11, and the efficiency of target site editing reaches 92.5%. Wherein the biallelic mutation efficiency reaches 82.1%.
In conclusion, the rapid and high-throughput gene function screening system constructed based on the CRISPR/Cas9 system performs mixed transformation by taking 12 vectors carrying tag sequences with different lengths as a group, can obtain the transgenic rice of the target gene in a shorter time, does not need sequencing, and can rapidly detect the target site of the transgenic strain only by a PCR-electrophoresis method. In addition, the editing efficiency of the system is high, and for large-scale gene function primary screening, more than 90% of the editing efficiency basically does not need to screen gene-edited plants through sequencing, so that the experimental period is greatly shortened, and the workload and the cost are reduced. Finally, the high-throughput gene knockout vector provided by the invention is not only suitable for the CRISPR/Cas9 system, but also suitable for the application of other CRISPR systems in organisms of different cell types.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> method for editing high-throughput gene
<160> 116
<170> SIPOSequenceListing 1.0
<210> 1
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
agctggatcc aactgagtgg tcaagaggtg 30
<210> 4
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agctggatcc aactgagtgg tcaagaggtg acgagtgttg 40
<210> 5
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc 50
<210> 6
<211> 60
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
<210> 7
<211> 70
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
gcacgttggt 70
<210> 8
<211> 80
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
gcacgttggt acgaacttag 80
<210> 9
<211> 90
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
gcacgttggt acgaacttag caacctcgac 90
<210> 10
<211> 100
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
gcacgttggt acgaacttag caacctcgac acgcatggtc 100
<210> 11
<211> 110
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaactt 60
gcacgttggt acgaacttag caacctcgac acgcatggtc gctaggcttg 110
<210> 12
<211> 107
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gagttgtgca gatgatccgt ggcaacaaag caccagtggt ctagtggtag aatagtaccc 60
tgccacggta cagacccggg ttcgattccc ggctggtgca ggagacc 107
<210> 13
<211> 1483
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
cggctggtgc aggagaccta ggcaccccag gctttacact ttatgcttcc ggctcgtata 60
atgtgtggat tttgagttag gatccgtcga gattttcagg agctaaggaa gctaaaatgg 120
agaaaaaaat cactggatat accaccgttg atatatccca atggcatcgt aaagaacatt 180
ttgaggcatt tcagtcagtt gctcaatgta cctataacca gaccgttcag ctggatatta 240
cggccttttt aaagaccgta aagaaaaata agcacaagtt ttatccggcc tttattcaca 300
ttcttgcccg cctgatgaat gctcatccgg aattccgtat ggcaatgaaa gacggtgagc 360
tggtgatatg ggatagtgtt cacccttgtt acaccgtttt ccatgagcaa actgaaacgt 420
tttcatcgct ctggagtgaa taccacgacg atttccggca gtttctacac atatattcgc 480
aagatgtggc gtgttacggt gaaaacctgg cctatttccc taaagggttt attgagaata 540
tgtttttcgt ctcagccaat ccctgggtga gtttcaccag ttttgattta aacgtggcca 600
atatggacaa cttcttcgcc cccgttttca ccatgggcaa atattatacg caaggcgaca 660
aggtgctgat gccgctggcg attcaggttc atcatgccgt ttgtgatggc ttccatgtcg 720
gcagaatgct taatgaatta caacagtact gcgatgagtg gcagggcggg gcgtaaagat 780
ctggatccgg cttactaaaa gccagataac agtatgcgta tttgcgcgct gatttttgcg 840
gtataagaat atatactgat atgtataccc gaagtatgtc aaaaagaggt atgctatgaa 900
gcagcgtatt acagtgacag ttgacagcga cagctatcag ttgctcaagg catatatgat 960
gtcaatatct ccggtctggt aagcacaacc atgcagaatg aagcccgtcg tctgcgtgcc 1020
gaacgctgga aagcggaaaa tcaggaaggg atggctgagg tcgcccggtt tattgaaatg 1080
aacggctctt ttgctgacga gaacaggggc tggtgaaatg cagtttaagg tttacaccta 1140
taaaagagag agccgttatc gtctgtttgt ggatgtacag agtgatatta ttgacacgcc 1200
cgggcgacgg atggtgatcc ccctggccag tgcacgtctg ctgtcagata aagtctcccg 1260
tgaactttac ccggtggtgc atatcgggga tgaaagctgg cgcatgatga ccaccgatat 1320
ggccagtgtg ccggtctccg ttatcgggga agaagtggct gatctcagcc accgcgaaaa 1380
tgacatcaaa aacgccatta acctgatgtt ctggggaata taaatgtcag gctcccttat 1440
acacagccag tggtctcggt tttagagcta gaaatagcaa gtt 1483
<210> 14
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
<210> 15
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
aacttgctat ttctagctct aaaaccgaga ccactggctg tgtat 45
<210> 16
<211> 10
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
<210> 17
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
<210> 18
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
agctccactc agttggatcc 20
<210> 19
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
agctggatcc aactgagtgg tcaagaggtg 30
<210> 20
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
agctcacctc ttgaccactc agttggatcc 30
<210> 21
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
agctggatcc aactgagtgg tcaagaggtg acgagtgttg 40
<210> 22
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
agctcaacac tcgtcacctc ttgaccactc agttggatcc 40
<210> 23
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc 50
<210> 24
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
agctgccatg cgttcaacac tcgtcacctc ttgaccactc agttggatcc 50
<210> 25
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
agctggatcc aactgagtgg tcaagaggtg acgagtgttg 40
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
<210> 27
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
agctaagttc gcatgccatg cgttcaacac tcgtcacctc ttga 44
<210> 28
<211> 16
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
<210> 29
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc 50
<210> 30
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
<210> 31
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
agctaccaac gtgcaagttc gcatgccatg cgttcaacac tcgt 44
<210> 32
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
cacctcttga ccactcagtt ggatcc 26
<210> 33
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc at 52
<210> 34
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gcgaacttgc acgttggtac gaacttag 28
<210> 35
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
agctctaagt tcgtaccaac gtgcaagttc gcatgccatg cgttcaacac tc 52
<210> 36
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
gtcacctctt gaccactcag ttggatcc 28
<210> 37
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
agctggatcc aactgagtgg tcaagaggtg acgagtgttg aacgcatggc atgcgaact 59
<210> 38
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
tgcacgttgg tacgaactta gcaacctcga c 31
<210> 39
<211> 59
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
agctgtcgag gttgctaagt tcgtaccaac gtgcaagttc gcatgccatg cgttcaaca 59
<210> 40
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
ctcgtcacct cttgaccact cagttggatc c 31
<210> 41
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
agctggatcc aactgagtgg tcaagag 27
<210> 42
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
gtgacgagtg ttgaacgcat ggcatgcgaa cttgcacgtt ggtacgaact 50
<210> 43
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
tagcaacctc gacacgcatg gtc 23
<210> 44
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
agctgaccat gcgtgtcgag gttgctaagt tcgtaccaac gtgcaagttc gc 52
<210> 45
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
atgccatgcg ttcaacactc gtcacctctt gaccactcag ttggatcc 48
<210> 46
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
agctggatcc aactgagtgg tcaagaggtg acgagtgtt 39
<210> 47
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
gaacgcatgg catgcgaact tgcacgttgg tacgaactta 40
<210> 48
<211> 31
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gcaacctcga cacgcatggt cgctaggctt g 31
<210> 49
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
agctcaagcc tagcgaccat gcgtgtcgag gttgctaagt tcgtaccaac gtgca 55
<210> 50
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
agttcgcatg ccatgcgttc aacactcgtc acctcttgac cactcagttg gatcc 55
<210> 51
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
ggtctcctgc accagccggg aatc 24
<210> 52
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
cggctggtgc aggagaccta ggcaccccag gctttaca 38
<210> 53
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
<210> 54
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
ctgttcgtat gtttaaagat tcc 23
<210> 55
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
<210> 56
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
gcttcagaag aactttaagt g 21
<210> 57
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
<210> 58
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
<210> 59
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
agtaccacct cggctatcca ca 22
<210> 60
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
acgcgctaaa aacggactag c 21
<210> 61
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
<210> 62
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
cgctgtttgc ctaacaagaa c 21
<210> 63
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
<210> 64
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
<210> 65
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
<210> 66
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
<210> 67
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
accagattat ggcctgcctc 20
<210> 68
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
tccttgcttc ggtgtatgcc 20
<210> 69
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
<210> 71
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
<210> 72
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
<210> 73
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
<210> 74
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
<210> 75
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
<210> 76
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
<210> 77
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
<210> 78
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
<210> 79
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
<210> 80
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
<210> 81
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 81
<210> 82
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 82
<210> 83
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 83
<210> 84
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 84
tgtggagatc gggttgtctc 20
<210> 85
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 85
<210> 86
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 86
agtattgacc ctcactgtac c 21
<210> 87
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 87
<210> 88
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 88
<210> 89
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 89
<210> 90
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 90
tgcactcgtc gaagtttctg 20
<210> 91
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 91
ggtgaagtta gctccatctc c 21
<210> 92
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 92
<210> 93
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 93
<210> 94
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 94
<210> 95
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 95
<210> 96
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 96
<210> 97
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 97
<210> 98
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 98
atctgaatcc aatacgcctc 20
<210> 99
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 99
<210> 100
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 100
<210> 101
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 101
<210> 102
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 102
tgccatgcgg ttgtattgtc 20
<210> 103
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 103
<210> 104
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 104
<210> 105
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 105
gaagattgtc cttccagttg 20
<210> 106
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 106
<210> 107
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 107
tgaatgattc aaacgaagtt 20
<210> 108
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 108
<210> 109
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 109
<210> 110
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 110
<210> 111
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 111
<210> 112
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 112
<210> 113
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 113
<210> 114
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 114
caattagttc ttgagatcta 20
<210> 115
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 115
<210> 116
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 116
Claims (5)
1. A method for editing a high-throughput gene, comprising the steps of:
1) respectively inserting tag sequences 1-11 into T-DNA of pRGEB32 vector to obtain p32A1-p 32A11 vectors;
the nucleotide sequences of the tag sequences 1-11 are shown as SEQ ID Nos. 1-11 in sequence;
2) inserting the tRNA fragment and the ccdB fragment into the pRGEB32 vector and the p32A1-p 32A11 vector obtained in the step 1) to obtain gene knockout vectors p32B 0-p 32B 11;
the nucleotide sequence of the tRNA fragment is shown as SEQ ID No. 12;
the nucleotide sequence of the ccdB fragment is shown as SEQ ID No. 13;
the gene knockout vector p32B0 is obtained by inserting a tRNA fragment and a ccdB fragment into a pRGEB32 vector;
the gene knockout vectors p32B 1-p 32B11 are obtained by sequentially inserting tRNA fragments and ccdB fragments into p32A1-p 32A11 vectors;
3) carrying out high-throughput gene editing on gene knockout vectors p32B 0-p 32B11 of the CRISPR system obtained in the step 2).
2. The editing method of claim 1, wherein the step 2) constructing method of gene knockout vector comprises: and connecting the tRNA fragment and the ccdB fragment to obtain a connecting fragment, and inserting the connecting fragment into a pRGEB32 vector and p32A1-p 32A11 vectors to obtain a gene knockout vector.
3. The editing method of claim 2, wherein the system used for ligation comprises 25 μ l of 2 × Hi-Fi MIX, 50ng of tRNA fragment, 50ng of ccdB fragment, 32B-F12 μ l at 10 μ M concentration, 32B-R22 μ l at 10 μ M concentration, and water to make up to 50 μ l per 50 μ l.
4. The editing method of claim 3, wherein the nucleotide sequence of 32B-F1 is shown as SEQ ID No.14, and the nucleotide sequence of 32B-R2 is shown as SEQ ID No. 15.
5. Editing method according to claim 2 or 3, characterized in that the program of linking is 98 ℃ for 2 min; 98 ℃ 10s, 60 ℃ 10s, 72 ℃ 15s/kb for 35 cycles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010772166.0A CN111979258B (en) | 2020-08-04 | 2020-08-04 | High-throughput gene editing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010772166.0A CN111979258B (en) | 2020-08-04 | 2020-08-04 | High-throughput gene editing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111979258A true CN111979258A (en) | 2020-11-24 |
| CN111979258B CN111979258B (en) | 2022-04-19 |
Family
ID=73444489
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010772166.0A Active CN111979258B (en) | 2020-08-04 | 2020-08-04 | High-throughput gene editing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111979258B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105647962A (en) * | 2016-02-15 | 2016-06-08 | 浙江大学 | Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system |
| WO2016110453A1 (en) * | 2015-01-06 | 2016-07-14 | Dsm Ip Assets B.V. | A crispr-cas system for a filamentous fungal host cell |
| CN106086056A (en) * | 2016-06-13 | 2016-11-09 | 江南大学 | A kind of pseudomonas putida gene knockout and genome simplified system |
| CN107012164A (en) * | 2017-01-11 | 2017-08-04 | 电子科技大学 | CRISPR/Cpf1 Plant Genome directed modifications functional unit, the carrier comprising the functional unit and its application |
| CN107937432A (en) * | 2017-11-24 | 2018-04-20 | 华中农业大学 | It is a kind of based on the genome edit methods of CRISPR systems and its application |
| CN109517846A (en) * | 2018-11-21 | 2019-03-26 | 华中农业大学 | Method based on CRISPR/Cas9 system high flux construction cotton mutant library |
| US20200157531A1 (en) * | 2018-11-16 | 2020-05-21 | Wisconsin Alumni Research Foundation | Method to enhance screening for homologous recombination in genome edited cells using recombination-activated fluorescent donor delivery vector |
-
2020
- 2020-08-04 CN CN202010772166.0A patent/CN111979258B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016110453A1 (en) * | 2015-01-06 | 2016-07-14 | Dsm Ip Assets B.V. | A crispr-cas system for a filamentous fungal host cell |
| CN105647962A (en) * | 2016-02-15 | 2016-06-08 | 浙江大学 | Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system |
| CN106086056A (en) * | 2016-06-13 | 2016-11-09 | 江南大学 | A kind of pseudomonas putida gene knockout and genome simplified system |
| CN107012164A (en) * | 2017-01-11 | 2017-08-04 | 电子科技大学 | CRISPR/Cpf1 Plant Genome directed modifications functional unit, the carrier comprising the functional unit and its application |
| CN107937432A (en) * | 2017-11-24 | 2018-04-20 | 华中农业大学 | It is a kind of based on the genome edit methods of CRISPR systems and its application |
| US20200157531A1 (en) * | 2018-11-16 | 2020-05-21 | Wisconsin Alumni Research Foundation | Method to enhance screening for homologous recombination in genome edited cells using recombination-activated fluorescent donor delivery vector |
| CN109517846A (en) * | 2018-11-21 | 2019-03-26 | 华中农业大学 | Method based on CRISPR/Cas9 system high flux construction cotton mutant library |
Non-Patent Citations (2)
| Title |
|---|
| KAIYUAN CHEN ET AL.,: "A FLASH pipeline for arrayed CRISPR library construction and the gene function discovery of rice receptor-like kinases", 《MOLECULAR PLANT》 * |
| 李红等: "植物CRISPR基因组编辑技术的新进展", 《生物工程学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111979258B (en) | 2022-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101467969B1 (en) | Method for synthesizing nucleic acid molecules | |
| CN105238859B (en) | A kind of method for obtaining chicken full-length genome high density SNP marker site | |
| CN102165073A (en) | Methods for nucleic acid mapping and identification of fine-structural-variations in nucleic acids | |
| CN110747187B (en) | Cas12a protein for identifying TTTV and TTV double-PAM sites, plant genome directed editing vector and method | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| Zakrzewski et al. | Analysis of ac 0 t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris | |
| CN107988409B (en) | Specific CAPS marker for identifying wild type or mutant of rice salt-tolerant gene OsRR22, primer and application of primer | |
| KR102121570B1 (en) | KASP primer set based on SNP for discriminating or classifying Panax ginseng cultivar or resource and uses thereof | |
| CN113564197B (en) | Construction method and application of CRISPR/Cas9 mediated plant polygene editing vector | |
| Cai et al. | Measurement of transgene copy number in plants using droplet digital PCR | |
| CN111979258B (en) | High-throughput gene editing method | |
| CN113462748A (en) | Preparation method and kit of DNA sequencing library | |
| CN108642209B (en) | Wheat plant thousand grain weight judgment marker and application thereof | |
| Urbański et al. | High-throughput and targeted genotyping of Lotus japonicus LORE1 insertion mutants | |
| CN113373241B (en) | Microsatellite marker of fishes in loach, and amplification primer and application thereof | |
| CN114250279B (en) | Construction method of haplotype | |
| Tagu et al. | Techniques for molecular biology | |
| CN113278646A (en) | Method for constructing rice polygene editing mutant library and application | |
| CN109628447B (en) | sgRNA of specific target sheep friendly site H11, and coding DNA and application thereof | |
| US6054300A (en) | Single-site amplification (SSA): method for accelerated development of nucleic acid markers | |
| KR102538189B1 (en) | A primer set for detecting active transposon PTE-3 in Chinese cabbage transformants | |
| CN117247959A (en) | DNA cloning technology based on gene editing technology | |
| CN112852996B (en) | SCAR molecular marker for identifying marigold lingua petal lobe cracking character, detection primer and application thereof | |
| CN113215145B (en) | Short fragment cloning method independent of PCR reaction | |
| CN116926221B (en) | Primer group for constructing gene library for judging mycobacterium tuberculosis typing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |