CN111944884A - Method for typing SNP sites of sample based on KASP technology - Google Patents

Abstract

The invention provides a method for typing SNP sites of a sample based on KASP technology, which comprises the steps of completing the typing detection of the SNP sites with the sample number more than or equal to 22 by the KASP method, and determining the range of different genotypes of each SNP site in a KASP typing map; selecting representative samples of different genotypes of each SNP locus and preparing the representative samples into a standard substance; determining the genotyping of the sample to be tested according to the range of KASP typing maps of different genotype standard products. The invention complements the vacancy of not less than 22 samples detected at one time by one site of the KASP technology.

Description

Method for typing SNP sites of sample based on KASP technology

Technical Field

The invention relates to the field of biotechnology, in particular to a method for typing SNP sites of a sample based on KASP technology.

Background

KASP (Kompetitive Allle Specific PCR), competitive Allele-Specific PCR, performs biallelic determination on specified SNPs (single nucleotide polymorphisms) and InDels (Insertions and Deletions) based on Specific matching of the terminal bases of the primers. The KASP technology has low requirements on the purity and concentration of a detected sample (1-10ng of DNA can be added into the reaction), and has the characteristics of high accuracy, flexibility and low cost. Particularly, the method supports the research of low, medium and high-flux samples without synthesizing expensive specific fluorescent labeling primers or probes. The KASP technology has been widely used in agricultural fields and medicine, such as variety improvement of animals and plants, disease screening and prediction, personalized medicine administration and prognosis, and the like.

The KASP technology is suitable for detecting samples with small flux, medium flux and large flux, and can be flexibly applied to the detection of 98-well plates, 384-well plates and 1536-well plates. Meanwhile, the KASP technology is used for carrying out genotype judgment based on a terminal reading plate method, namely different genotypes are judged according to different clusters formed by scattered points in sample detection. In order to present better clustering and typing effects and more accurate genotype analysis results, no less than 22 samples are detected at one time by one SNP typing. The KASP technique has absolute advantages for the detection of large numbers of samples at fewer sites, but is not very friendly for the detection of small numbers of samples, especially less than 22 samples.

Disclosure of Invention

The invention adopts the KASP typing technology which is internationally raised in recent years, namely competitive allele specificity PCR, the method is similar to the method of a Taqman probe, and also adopts double fluorescence labeling, but the KASP technology uses a general probe and is positioned in reaction mixed liquid, and the detection can be carried out only by synthesizing a common terminal specificity base primer. KASP reads and judges based on terminal fluorescence signals, each hole reaction adopts two colors of fluorescence to detect two genotypes of one SNP locus, and different SNPs correspond to different fluorescence signals.

The KASP technology is similar to the TaqMan method, and is different from the TaqMan technology in that a specific fluorescent primer is not required to be synthesized at each SNP site, and all site detection can be amplified by using a general fluorescent primer based on a unique ARM PCR principle, so that the reagent cost of the KASP technology is reduced, the accuracy is high, the cost is reduced, and the SNP site applicability is better. The KASP technology has the characteristics of accuracy, quickness, flexibility and economy.

In order to solve the above problems, the present invention provides a method for typing a sample SNP site based on KASP technology, comprising the steps of: step 1: completing the typing detection of SNP loci with the sample quantity more than or equal to 22 by a KASP method, and determining the range of different genotypes of each SNP locus in a KASP typing map; step 2: performing Sanger sequencing verification on the KASP typing results of different genotypes in the step 1, and picking out representative samples of different genotypes of each SNP locus; and step 3: selecting representative samples of different genotypes of each SNP locus for molecular cloning of target fragments and preparing the samples into a standard substance; and

and 4, step 4: and (3) in the KASP detection of less than 22 samples, selecting the standard products of different genotypes of the SNP sites to be detected obtained in the step (3) to carry out the KASP detection together, and determining the genotype of the sample to be detected according to the ranges of KASP typing maps of the standard products of different genotypes.

In one embodiment, the method is used for typing at the SNP site of rs1801133 of MTHFR gene.

In one embodiment, the primers for KASP typing detection in step 1 comprise two forward KASP primers and one universal reverse KASP primer labeled with different fluorescent labels, the two forward KASP primers being SEQ ID No. 1: GAAGGTGACCAAGTTCATGCT AGCTGCGTGATGATGAA ATCGG, respectively; SEQ ID NO. 2: GAAGGTCGGAGTCAACGGATTAGCTGCGTGATGATGAAATCGA, respectively; and one universal reverse KASP primer is SEQ ID No. 3: GCACTTGAAGGAGAA GGTGTCT are provided.

In one embodiment, two forward KASP primers and one universal reverse KASP primer are added to the reaction system in a mass ratio of 12:12: 30.

In one embodiment, the two forward KASP primers are labeled with FAM on one side and HEX on the other side.

In one embodiment, the different genotypic standards in step 3 are the cloned plasmid from the GG type sample, the cloned plasmid from the AG type sample and the cloned plasmid from the AA type sample of rs 1801133.

The KASP technology is based on an end-point method for interpretation analysis, and the experiment requires that each pair of primer samples is not less than 22, otherwise, the grouping interpretation is influenced. The invention details how to construct a KASP detection method of a site, in particular to a KASP typing method of how to establish a standard substance to correctly detect less than 22 samples, and complements the vacancy that one site of the KASP technology can not detect less than 22 samples at one time. Meanwhile, the construction of the standard substance can also be applied to the verification of amplification systems and amplification reagents in different periods, and the internal quality control in a laboratory is guided in time.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments described in the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a KASP typing map of locus rs1801133 of 30 population samples according to the present invention;

FIG. 2 is a KASP typing map of 30 samples of the first set of KASP primers of the present invention;

FIG. 3 is a KASP typing map of 30 samples of a third set of KASP primers of the present invention;

FIG. 4 is a schematic diagram of the present invention for selecting representative samples of different genotypes;

FIG. 5 is a graph of the sequencing results for three genotype positive plasmids of the present invention, wherein FIG. 5A is the sequencing results for a GG-type sample cloning plasmid, FIG. 5B is the sequencing results for an AG-type sample cloning plasmid, and FIG. 5C is the sequencing results for an AA-type sample cloning plasmid; and

FIG. 6 is a KASP typing map of site rs1801133 of a sample to be tested.

Detailed Description

In order to make those skilled in the art better understand the technical solutions in the present application, the present invention will be further described with reference to the following examples, and it is obvious that the described examples are only a part of the examples of the present application, and not all examples. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application. The invention is further described with reference to the following figures and examples.

First, group KASP detection

Genomic DNA acquisition of 1.30 subjects

The subject's buccal swab is collected and the genomic DNA extraction is carried out using a commercially available corresponding extraction kit (e.g., buccal swab genomic DNA extraction kit (TIANGEN, DP322)), or using a self-made hand-held reagent. The quality of the extracted DNA is respectively detected through 1% agarose gel electrophoresis and Nanodrop, and the result shows that the extracted genomic DNA meets the detection requirement, namely, the agarose gel electrophoresis shows that the DNA band is single and is not obviously dispersed; nanodrop detection A260/280 is between 1.7 and 2.0. Genomic DNA was diluted to 10 ng/. mu.L for use in competitive allele-specific PCR.

2. Competitive allele-specific PCR

KASP primers are designed according to the adjacent sequence of the rs1801133 site on NCBI, and comprise two forward primers recognized by fluorescent markers and a reverse universal primer. The primer sequences are as follows:

rs1801133-F1：GAAGGTGACCAAGTTCATGCTAGCTGCGTGATGATGAAATCGG (SEQ ID NO.1)

rs1801133-F2：GAAGGTCGGAGTCAACGGATTAGCTGCGTGATGATGAAATCGA (SEQ ID NO.2)

rs1801133-R1：GCACTTGAAGGAGAAGGTGTCT(SEQ ID NO.3)

the three primers are added into a reaction system according to the proportion of 12:12:30, the reaction system also comprises 2.5 mu l of 2 xMater Mix (LGC, KBS-1016), 5-50ng of DNA to be detected is added into a 384-well plate according to the total volume of 5 mu l. The DNA to be detected has 30 samples and also has a blank control, namely double distilled water replaces the sample DNA. The specific amplification procedure is pre-denaturation at 94 ℃ for 15 minutes; amplification of 10 cycles touchdown program: denaturation at 94 ℃ for 20 seconds, renaturation at 61-55 ℃ (-0.6 ℃/cycle) and extension for 1 minute; amplification was performed in 26 cycles: denaturation at 94 ℃ for 20 seconds, renaturation at 55 ℃ and extension for 1 minute. The 7900HT Fast Real-Time PCR System was used to detect fluorescent signals and analyze typing. And if the typing is insufficient, continuing to add the cycle, changing the annealing extension temperature of the cycle to 57 ℃, and detecting the fluorescent signal after increasing 3 cycles each time until the typing is sufficient.

The typing map (Allelic hybridization Plot) results of KASP primers are shown in FIG. 1. Wherein the X-axis allele is set as FAM marker and the Y-axis allele is set as HEX marker.

According to the typing results of the KASP primers in figure 1, the range of different genotypes of the SNP of each rs1801133 locus in the KASP typing map is determined.

TABLE 1 three sets of KASP primer typing interpretation rules

The typing result is shown in fig. 1, the blank control NTC in the result typing graph is close to the origin, the sample to be tested is far from the NTC, the sample can be classified into different clusters, the scattered points in the clusters are distributed closely, the clusters are far away from each other, and the typing effect is good. Can obviously distinguish wild type GG type, heterozygous type AG type and variant homozygous type AA type.

The KASP primers can cluster all 30 samples and judge the corresponding genotypes, and the genotype proportion is 100%. In addition, the fluorescence value data of the cluster sample is analyzed for the degree of vergence by using a k-means method. The results show that the discrete degree index (totwitkins) in the cluster group is 0.333; the degree of dispersion indicator (betweens) between the clusters was 35.525. the smaller the totwitkins, the better, the tighter the scattered point distribution in the cluster, and the larger the betwenss, the better, the farther the cluster distance. From these two statistical indicators, the KASP primer can distinguish the rs1801133 genotype.

Design of KASP primer and comparative experiment

3 groups of KASP primers are designed and synthesized according to sequences adjacent to the rs1801133 locus on NCBI, wherein each group of primers comprises 2 forward primers, namely a FAM labeled primer, a HEX labeled primer and 1 universal reverse primer. The G alleles of the 3 groups of primers are all marked by FAM, the A alleles are all marked by HEX, and the specific primer sequences are as follows:

first set of KASP primers:

rs1801133-F3：GAAGGTGACCAAGTTCATGCTGCTGCGTGATGATGAAATCGG (SEQ ID NO.4)；

rs1801133-F4：GAAGGTCGGAGTCAACGGATTGCTGCGTGATGATGAAATCGA (SEQ ID NO.5)

rs1801133-R2：TTGAGGCTGACCTGAAGCACTTG(SEQ ID NO.6)

second set of KASP primers:

rs1801133-F1：GAAGGTGACCAAGTTCATGCTAGCTGCGTGATGATGAAATCGG (SEQ ID NO.1)

rs1801133-F2：GAAGGTCGGAGTCAACGGATTAGCTGCGTGATGATGAAATCGA (SEQ ID NO.2)

rs1801133-R1：GCACTTGAAGGAGAAGGTGTCT(SEQ ID NO.3)

third set of KASP primers:

rs1801133-F5：GAAGGTGACCAAGTTCATGCTAAAAGCTGCGTGATGATGAAA TCGG(SEQ ID NO.7)

rs1801133-F6： GAAGGTCGGAGTCAACGGATTGAAAAGCTGCGTGATGATGAAAT CGA(SEQ ID NO.8)

rs1801133-R3：TGACCTGAAGCACTTGAAGGAGAAGG(SEQ ID NO.9)

KASP experiments and comparative analyses of three sets of KASP primers from 4.30 samples

30 samples were genomic DNA extracted from buccal swabs and diluted to about 10 ng/. mu.l before reaction. Three groups of 3 primers are added into a reaction system according to the proportion of 12:12:30, 5-50ng of DNA to be detected and 2 XMater Mix 2.5 mul are added into a 384-well plate according to the total volume of 5 mul. The DNA to be detected has 30 samples and also has a blank control, namely double distilled water replaces the sample DNA. The specific amplification procedure is pre-denaturation at 94 ℃ for 15 minutes; amplification of 10 cycles touchdown program: denaturation at 94 ℃ for 20 seconds, renaturation at 61-55 ℃ (-0.6 ℃/cycle) and extension for 1 minute; amplification was performed in 26 cycles: denaturation at 94 ℃ for 20 seconds, renaturation at 55 ℃ and extension for 1 minute. The 7900HT Fast Real-Time PCR System was used to detect fluorescent signals and analyze typing. And if the typing is insufficient, continuing to add the cycle, changing the annealing extension temperature of the cycle to 57 ℃, and detecting the fluorescent signal after increasing 3 cycles each time until the typing is sufficient.

The results of the typing diagrams (Allelic differentiation Plot) for the first and third sets of KASP primers are shown in FIGS. 2 and 3. Wherein the X-axis allele is set as FAM marker and the Y-axis allele is set as HEX marker.

The typing results of the three groups of KASP primers are interpreted according to the rules of Table 1, the corresponding interpretation results and fluorescence values are shown in Table 2, and the cluster interpretation effects are marked in FIG. 1, FIG. 2 and FIG. 3.

TABLE 2 genotype ratio and fluorescence values determined for three sets of KASP primers

In an ideal state, the blank contrast NTC is close to the origin, the sample to be detected is far away from the NTC, the sample can be classified into different clusters, scattered points in the clusters are distributed tightly, and the clusters are far apart.

As can be seen from Table 2, the NTC's of all three sets of KASP primers are close to the origin. Only the second group of KASP primers can cluster all 30 samples and judge the corresponding genotypes, and the genotype proportion is judged to be 100%. Next is a third set of KASP primers 83.3% (25/30). Finally, the first set of KASP primers, determined at a rate of only 60% (18/30). From the perspective of the proportion of genotypic samples that were clustered, the second set of KASP primers was superior to the other two sets of primers.

In addition, the fluorescence value data of three cluster samples of three groups of KASP primers are compared and analyzed for the degree of vergence by using a k-means method. The results show that the discrete degree indicators (totwitkins) in the cluster group are arranged from small to large: the second set of KASP primers (0.333) < the first set of KASP primers (0.589) < the third set of KASP primers (1.429); considering that the first set of KASP primers only identified 2 clusters, and the other two groups had 3 clusters, the index comparison between cluster clusters excluded the first set of KASP primers. The dispersion degree indexes (betweens) among the clustering groups are arranged from large to small as follows: second set of KASP primers (35.525) > third set of KASP primers (13.194). Wherein, the smaller the totwitkins, the better, the tighter the scattered point distribution in the cluster is represented, the larger the betwenss, the better, the farther the cluster is represented. From these two statistical criteria, the second set of KASP primers is superior to the other two sets of primers.

In summary, by comparing the three sets of KASP primers, the second set of KASP primers is optimal and most closely approximates the ideal typing effect.

Sanger sequencing verification

Designing a specific common PCR primer according to a sequence adjacent to the rs1801133 site on NCBI, wherein the sequence is as follows:

rs1801133 upstream primer: GGTCAGAAGCATATCAGTCA (SEQ ID NO.10)

rs1801133 downstream primer: AAGAACTCAGCGAACTCAG (SEQ ID NO.11)

30 samples were PCR amplified with the above primers in 25. mu.l of an amplification system consisting of 2 XTakara Premix Taq 12.5. mu.l, 10. mu.M of upstream and downstream primers each 1. mu.l, DNA template 50-100 ng, and double distilled water to 25. mu.l. And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min followed by 30 cycles of reaction, each cycle comprising denaturation at 94 ℃ for 30 sec, annealing at 55 ℃ for 30 sec, extension at 72 ℃ for 30 sec, and extension at 72 ℃ for 7 min after completion of the cycle. The PCR amplification products were sent to the genome research center of Beijing Nosse, Inc. for Sanger sequencing. The Sanger sequencing results were 100% identical to the KASP analysis results for the second pair of KASP primers (as shown in table 3).

TABLE 3.30 subjects rs1801133 site KASP analysis results and Sanger sequencing results

Thirdly, selecting representative samples of 3 different genotypes

From three different genotypes, i.e. three different clusters, one representative sample is selected and labelled, located in each cluster. As shown in fig. 4, representative samples of the Y-axis allele homozygous cluster (AA homozygous) recommend selecting samples near the Y-axis in the cluster, i.e., samples with lower X-axis fluorescence and higher Y-axis fluorescence (type AA select sample No. 6); the samples close to the X axis in the X axis allele homozygous cluster (GG homozygous) are recommended to be selected from the samples in the cluster, namely, the samples with lower Y axis fluorescence value and higher X axis fluorescence value (GG type 12 sample); the representative samples of the X-axis and Y-axis allele heterozygosis cluster (AG heterozygosis type) recommend selecting samples in the middle of the X-axis allele cluster and the Y-axis allele cluster, namely taking an NTC point as an origin, respectively taking a scattered point which is connected with the X-axis cluster and is closest to the X-axis as a cluster X-axis, taking a scattered point which is connected with the Y-axis cluster and is closest to the Y-axis as a cluster Y-axis, taking the NTC as the origin, drawing a straight line by taking a half of an included angle of the X-axis and the Y-axis as an angle of about 45 degrees, recommending the samples which are close to the straight line of about 45 degrees and have larger X-axis fluorescence value and Y-axis fluorescence value as heterozygosis cluster representative samples (AG type 28 samples), and preparing a standard product.

Preparation of standard products of different genotypes

The 3 samples selected from 3, i.e., sample nos. 12 (GG type), 28 (AG type), and 6 (AA type), were subjected to PCR amplification using designed general PCR primers. Mu.l of the amplification system, 2 XTakara Premix Taq 12.5. mu.l, 10. mu.M upstream and downstream primers 1. mu.l each, 50-100 ng of DNA template, and double distilled water to 25. mu.l. And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min followed by 30 cycles of reaction, each cycle comprising denaturation at 94 ℃ for 30 sec, annealing at 55 ℃ for 30 sec, extension at 72 ℃ for 30 sec, and extension at 72 ℃ for 7 min after completion of the cycle.

The PCR product was purified by a general agarose gel DNA recovery kit (TIANGEN, DP 209). The purified amplification product is connected with a pEASY-T3 carrier, the connection product is transformed into Trans 1-T1 competent cells, after being incubated for 1 hour at 37 ℃ in an LB liquid culture medium, the ligation product is coated on an LB solid culture medium (the volume ratio of the LB solid culture medium to the 100mg/ml ampicillin is 1:1) with 100mg/ml of ampicillin, 24mg/ml of IPTG and 20mg/ml of X-gal (the volume ratio of the three is 1:1:2), and the blue-white spot screening is carried out by overnight culture at 37 ℃. The white spot colonies were randomly picked and inoculated in 4mL LB liquid medium at 180rpm/min and 37 ℃ overnight. Plasmid extraction kit e.z.n.a.^TMPlasmid Mini Kit I extracts the Plasmid of the positive clone. Simultaneous use of common PCR primer pair extractantsThe particles are subjected to specific PCR amplification, a target band is detected by agarose gel electrophoresis, and the DNA fragments are sent to the Beijing Nosse genome research center, Inc. for Sanger sequencing. The sequencing results are consistent with the results of the plasmid Sanger sequencing from the extraction of sample clone No. 12 being of GG type, the plasmid Sanger sequencing from the extraction of sample clone No. 28 being of AG type, and the plasmid Sanger sequencing from the extraction of sample clone No. 6 being of AA type. The sequencing results are shown in FIG. 5 (both reverse complementary sequences).

The concentration of the cloned plasmids of samples No. 6, No. 12 and No. 28 is measured by Nanodrop, and then diluted to 10 ng/mul, thus preparing the standard substance of 3 different genotypes of the rs1801133 locus. The clone plasmid for sample No. 12 was designated as standard 1(GG type), the clone plasmid for sample No. 28 was designated as standard 2(AG type), and the clone plasmid for sample No. 6 was designated as standard 3(AA type).

Fifth, KaSP typing experiment of rs1801133 locus of one sample

The DNA sample to be tested was subjected to KASP test with 3 standards and 1 blank according to the above method. Detecting fluorescent signals by 7900HT Fast Real-Time PCR System, and judging the genotype of the sample to be detected according to the detection result by the standard in the table 1.

The result is shown in fig. 6, the blank control NTC is located at a position close to the origin, 3 standard products are obviously grouped and consistent with the interpretation standard position, the sample to be detected and the standard product 1(GG type) are also located at the lower right corner and close to the X axis, belong to the same cluster and are homozygous for the allele of the X axis, and therefore the genotype of the rs1801133 locus of the sample to be detected is the GG type.

In the KASP experiment, besides the 384-well plate used in the Real-Time example as a reaction plate and the 7900HT Fast Real-Time PCR System for detecting the fluorescent signal, other qPCR instruments in a laboratory can be used for detecting the fluorescent signal and loading the corresponding reaction plate according to the actual conditions of the laboratory; 1536-well plates can be selected as reaction plates for large-batch experiments, and a BMGPHERAstar instrument detects fluorescent signals.

It is to be understood that the invention disclosed is not limited to the particular methodology, protocols, and materials described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Sequence listing

<110> Beijing Nosai genome research center, Inc

<120> method for typing sample SNP sites based on KASP technology

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaaggtgacc aagttcatgc tagctgcgtg atgatgaaat cgg 43

<210> 2

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gaaggtcgga gtcaacggat tagctgcgtg atgatgaaat cga 43

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gcacttgaag gagaaggtgt ct 22

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaggtgacc aagttcatgc tgctgcgtga tgatgaaatc gg 42

<210> 5

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaaggtcgga gtcaacggat tgctgcgtga tgatgaaatc ga 42

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ttgaggctga cctgaagcac ttg 23

<210> 7

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaaggtgacc aagttcatgc taaaagctgc gtgatgatga aatcgg 46

<210> 8

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaaggtcgga gtcaacggat tgaaaagctg cgtgatgatg aaatcga 47

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgacctgaag cacttgaagg agaagg 26

Claims (6)

1. A method for typing a sample SNP site based on the KASP technique, the method comprising the steps of:

step 1: completing the typing detection of SNP loci with the sample quantity more than or equal to 22 by a KASP method, and determining the range of different genotypes of each SNP locus in a KASP typing map;

step 2: performing Sanger sequencing verification on the KASP typing results of different genotypes in the step 1, and picking out representative samples of different genotypes of each SNP locus;

and step 3: selecting representative samples of different genotypes of each SNP locus for molecular cloning of target fragments and preparing the samples into standard substances; and

and 4, step 4: and (3) in the KASP detection of less than 22 samples, selecting the standard products of different genotypes of the SNP sites to be detected obtained in the step (3) to carry out the KASP detection together, and determining the genotype of the sample to be detected according to the ranges of KASP typing maps of the standard products of different genotypes.

2. The method according to claim 1, wherein the method is used for typing the SNP site of rs1801133 of MTHFR gene.

3. The method of claim 2, wherein the primers for KASP typing detection in step 1 comprise two forward KASP primers and a universal reverse KASP primer labeled with different fluorescent labels, the two forward KASP primers being SEQ ID No. 1: GAAGGTGACCAAGTTCATGCTAGCTGCGTGATGATGAA ATCGG, respectively; SEQ ID NO. 2: GAAGGTCGGAGTCAACGGATTAGCTGCGTGATGATGAAATCGA, respectively; and one universal reverse KASP primer is SEQ ID No. 3: GCACTTGAAGGAGAA GGTGTCT are provided.

4. The method of claim 3, wherein two forward KASP primers and one universal reverse KASP primer are added to the reaction system in a mass ratio of 12:12: 30.

5. The method of claim 3, wherein the two forward KASP primers are labeled with FAM on one side and HEX on the other side.

6. The method according to claim 3, wherein the different genotypic standards in step 3 are the cloned plasmid from the GG type sample, the cloned plasmid from the AG type sample and the cloned plasmid from the AA type sample of rs 1801133.

Images