CN111944841A - Arginine deiminase secreted and expressed by pichia pastoris and construction method - Google Patents
Arginine deiminase secreted and expressed by pichia pastoris and construction method Download PDFInfo
- Publication number
- CN111944841A CN111944841A CN202010627909.5A CN202010627909A CN111944841A CN 111944841 A CN111944841 A CN 111944841A CN 202010627909 A CN202010627909 A CN 202010627909A CN 111944841 A CN111944841 A CN 111944841A
- Authority
- CN
- China
- Prior art keywords
- arginine deiminase
- gene
- arginine
- deiminase
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/50—Hydrolases (3) acting on carbon-nitrogen bonds, other than peptide bonds (3.5), e.g. asparaginase
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
- C12P13/10—Citrulline; Arginine; Ornithine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y305/00—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
- C12Y305/03—Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amidines (3.5.3)
- C12Y305/03006—Arginine deiminase (3.5.3.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Public Health (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of genetic engineering, and discloses an arginine deiminase secreted and expressed by pichia pastoris and a construction method, wherein an optimized arginine deiminase gene is fused on a yeast expression vector BDM to construct a single-copy expression vector; restriction enzymes EcoRI, SPe I, BamH I and Xba I are used for enzyme digestion, according to the principle that the viscous ends of SPe I and Xba I can be complementarily matched, through repeated enzyme digestion, connection and conversion operation, a recombinant plasmid containing arginine deiminase is obtained, and after pichia pastoris is electrotransformed, arginine deiminase can be efficiently secreted and expressed under the induction of methanol. The multicopy high-efficiency expression arginine deiminase constructed by the invention can be used for improving the yield, reducing the cost, realizing the extracellular secretion expression of arginine deiminase and being suitable for the large-scale production of arginine deiminase.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an arginine deiminase secreted and expressed by pichia pastoris and a construction method.
Background
At present, Arginine Deiminase (ADI) as an Arginine degrading enzyme irreversibly catalyzes Arginine, which is an unnecessary amino acid for human, to produce citrulline and ammonia by catalyzing citrulline with Arginine-succinate synthetase (ASS) and Arginine-succinate lyase (AL) through urea cycle, but does not express (ASS) and thus cannot synthesize Arginine by itself, thereby it is possible to fundamentally eliminate or control the growth of Arginine-auxotrophic cancer cells by cutting off the supply of Arginine to tumor cells through Arginine degrading enzyme.
Today, methods for preparing arginine deiminase include chemical synthesis, microbial fermentation, and enzymatic methods. Chemical synthesis methods often cause environmental pollution, and are slowly banned under the environment-friendly and large-format situation. The enzyme liquid obtained by the microbial fermentation method often contains a large amount of miscellaneous enzymes, so that the obtaining cost of pure enzymes is high. The recombinase enzymatic synthesis is of great interest due to mild reaction conditions, high yield and simple product purification. This method involves an enzyme, arginine deiminase, which hydrolyzes arginine to citrulline and ammonia, and currently ADI is derived from Aspergillus fumigatus, Bacillus cereus, enterococcus faecium, Pseudomonas, and the like.
In summary, the problems of the prior art are as follows: (1) in the prior art, the expression content of target protein of engineering strains for preparing arginine deiminase by a fermentation method is low, and the purification cost of the arginine deiminase is high.
(2) In the prior art, arginine deiminase is prepared by a recombinant enzyme method, arginine deiminase is mainly expressed and purified in bacterial cells, an engineering strain with an arginine deiminase gene is integrated, and a thallus can convert a substrate to prepare citrulline.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a construction method of an engineering strain for expressing arginine deiminase outside pichia pastoris cells.
ADI in the present invention is derived from enterococcus faecalis, and the expression of arginine deiminase
(Arginine deiminase[Enterococcus faecalis CBRD01])
The DNA Sequence of (1) is Sequence ID:ESU74366.1(SEQ ID NO：1)。
the invention also aims to provide a construction method of engineering strains for realizing the high-efficiency extracellular secretion expression of arginine deiminase, which comprises the following steps:
step one, designing a primer F, R according to an arginine deiminase gene sequence of Escherichia coli K-12 provided by GenBank, (SEQ ID NO: 2) amplifying the arginine deiminase gene by taking an Escherichia coli genome as a template, wherein a gel electrophoresis band is about 1224bp, and the sequence is as follows: (SEQ ID NO: 1);
purifying the PCR product arginine deiminase gene, and connecting the purified PCR product arginine deiminase gene to a BDM vector to obtain a recombinant plasmid efADim3BDM, sent to sequencing after colony PCR validation; sequencing results show that the arginine deiminase gene is successfully inserted into the vector BDM.
And step three, carrying out enzyme digestion and enzyme linkage by using 4 restriction enzymes EcoRI, SPe I, BamH I and Xba I to sequentially obtain plasmids of the expression cassette structures connected in series.
Further, in step two, the recombinant plasmid efADIm3The BDM contains an initial signal element alcohol oxygen dehydrogenase strong promoter alpha-factor signal peptide gene, an arginine deiminase gene fused at the C end of the initial signal element and a termination signal.
Another objective of the present invention is to provide the above highly expressed arginine deiminase, wherein the DNA sequence for expressing arginine deiminase is SEQ ID NO: 1.
the invention also aims to provide a medicament which is prepared by the arginine deiminase with high expression and is used for eliminating or controlling the growth of arginine auxotrophic cancer cells.
In summary, the advantages and positive effects of the invention are: designing an expression gene sequence of mutated arginine deiminase according to the preference of pichia pastoris translation codon, fusing an optimized arginine deiminase gene on a yeast expression vector BDM to construct a single-copy expression vector, wherein the vector contains an arginine deiminase expression cassette consisting of an initial signal element alcohol oxygen deiminase strong promoter (AOX1), an alpha-factor signal peptide gene, an arginine deiminase gene fused at the C end of the alpha-factor signal peptide gene, a termination signal element (AOX) and the like; restriction enzymes EcoRI, SPe I, BamH I and Xba I are used for enzyme digestion, according to the principle that viscous ends of SPe I and Xba I can be complementarily matched, through repeated enzyme digestion, connection and conversion operations, recombinant plasmids containing different copy series expression cassettes of arginine deiminase are obtained, and after pichia pastoris is electrotransformed, arginine deiminase can be efficiently expressed in an extracellular secretion manner under the induction of methanol. The multi-copy high-efficiency expression arginine deiminase constructed by the invention can be used for improving the yield and reducing the cost, and is suitable for the large-scale production of the arginine deiminase.
The invention optimizes heterogenous arginine deiminase gene by codon, integrates the gene on pichia pastoris genome by using genetic engineering means, constructs a strict secretion expression vector by using methanol as an inducer through an initial signal element alcohol oxygen dehydrase strong promoter (AOX1), an alpha-factor signal peptide gene, an arginine deiminase gene fused at the C end of the initial signal element and a termination signal, and obtains a recombinant expression engineering strain with the expression of the arginine deiminase strictly controlled by electrotransformation of pichia pastoris GS115 competent cells.
The invention has the following important significance:
(1) by optimizing codons of the arginine deiminase gene and constructing an expression vector, the engineering strain (Pichia pastoris AD1-M3 GS115(His4) Pichia pastoris AD1-M3 GS115(His4) capable of effectively extracellularly secreting and expressing the arginine deiminase is obtained and stored in China center for type culture collection, the address of Wuhan, Wuhan university, the preservation number: CCTCC NO: M2019931, and the engineering strain is stored for thirty years from 11, 14 and 11 months in 2019) which can solve the problem that the engineering strain in the current market expresses the arginine deiminase intracellularly, and the product tolerance is poor to cause autolysis of the engineering strain or the enzyme activity is rapidly reduced in the later fermentation period.
(2) Experiments prove that the engineering strain can also carry out whole-cell conversion of arginine to generate citrulline and ammonia, and resting cells with enzymolysis activity can be obtained easily by high-density fermentation of the pichia pastoris, so that a novel citrulline industrial production idea is provided.
Drawings
FIG. 1 is a flow chart of a method for preparing Pichia pastoris multi-copy extracellular secretion expression arginine deiminase provided by the embodiment of the invention.
Fig. 2 is a diagram of a BDM loaded EFADIm3(MD plate) provided by an embodiment of the invention.
FIG. 3 is a graph showing the screening of recombinants using 24-well plates and the detection of expression amount by running PAGE gel, according to the present invention.
FIG. 4 is a graph of expression levels detected by 4-day induction of supernatant run on page gel as provided in the examples of the present invention.
FIG. 5 is a graph showing the reaction between 1ml of 2% arginine substrate and 700. mu.L of yeast expression supernatant provided in the examples of the present invention.
FIG. 6 is a 1C0py enzyme map provided by an embodiment of the present invention.
FIG. 7 is a 2C0py cleavage map provided by an embodiment of the present invention.
FIG. 8 is a 3C0py cleavage map provided by an embodiment of the invention.
FIG. 9 is a 4C0py cleavage map provided by an embodiment of the invention.
FIG. 10 is a 5C0py cleavage map provided by an embodiment of the invention.
FIG. 11 is a pH adaptation curve for heterologously expressed enzymes provided by examples of the present invention
FIG. 12 is a graph of the temperature adaptation of heterologously expressed enzymes provided in accordance with an embodiment of the present invention
FIG. 13 is a graph of the adaptation of heterologously expressed enzymes to metal ions as provided in an embodiment of the present invention
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In the prior art, a cassette expression structure for connecting arginine deiminase in series is not available, so that the expression quantity of the enzyme in pichia pastoris GS115 cannot be effectively improved. In the prior art, the yield is low and the cost is high in the production of arginine deiminase.
The novel engineering strain for extracellular efficient secretory expression of arginine deiminase constructed by the invention is used for large-scale industrial production of arginine deiminase, and the pichia pastoris expression strain avoids the problem that the existing escherichia coli is difficult to bear the gene for high-density fermentation.
Aiming at the problems in the prior art, the invention provides a copy expression arginine deiminase and a construction method thereof, and the invention is described in detail with reference to the attached drawings.
The construction method of the high multi-copy expression arginine deiminase provided by the embodiment of the invention comprises the following steps:
designing an expression gene sequence of mutated arginine deiminase according to the preference of pichia pastoris translation codon, fusing the optimized arginine deiminase gene on a yeast expression vector BDM to construct a single-copy expression vector, wherein the vector contains an initial signal element alcohol oxygen dehydrogenase strong promoter (AOX 1). Alpha-factor signal peptide gene and arginine deiminase expression box comprising arginine deiminase gene fused at C end, termination signal element (AOX), etc.
Restriction enzymes EcoRI, SPe I, BamH I and Xba I are used for enzyme digestion, and recombinant plasmids containing different copy tandem expression cassettes of arginine deiminase are obtained by repeated enzyme digestion, connection and conversion operations according to the principle that the viscous ends of SPe I and Xba I can be complementarily paired.
After pichia pastoris is electrotransformed, arginine deiminase can be efficiently secreted and expressed under the induction of methanol.
In the embodiment of the present invention, as shown in fig. 1, the method for constructing a multicopy expression arginine deiminase provided in the embodiment of the present invention includes:
s101, designing a primer F, R according to an arginine deiminase gene sequence of Escherichia coli K-12 provided by GenBank,
(F:5'AGCCATCCGATTAATGTGTTTAGC 3',
r:5'CAGATCCTCACGATACAGCGGCATG 3' Sequence ID: 2); the arginine deiminase gene is amplified by taking an escherichia coli genome as a template, and a gel electrophoresis band is about 1224 bp.
S102, purifying the PCR product, and connecting the PCR product to a BDM vector to obtain a recombinant plasmid efADIm3And (4) carrying out sequencing after colony PCR verification, wherein the sequencing result shows that the arginine deiminase zymogen gene is successfully inserted into the vector BDM.
S103, carrying out enzyme digestion and enzyme ligation by using 4 restriction enzymes EcoRI, SPeI, BamHI and XbaI to sequentially obtain plasmids of tandem expression cassette structures, wherein the single-copy DNA Sequence is Sequence ID:ESU74366.1i.e. multiple copies express arginine deiminase.
The invention is further described with reference to specific examples.
The efADIm provided by the embodiment of the invention3-BDM, 905M vector load expression method comprising the steps of:
1) the target gene fragment was amplified by PCR.
2) The length is detected by means of a detection glue.
3) And (3) preparing a DPnl digestion methyl template.
4) The degree of digestion was checked using a detection gel.
5) T5 transformation was performed.
6) The plate was inoculated with a single colony in a 500. mu.L EP tube.
7) Colony PCR was performed.
8) Recombinants were examined using a detection gel.
9) And (4) inoculating the bacterium liquid with the recombinant into a bacterium bottle and shaking the bacterium.
10) Extracting plasmid.
11) And (5) sequencing.
12) The plasmid was linearized.
13) And detecting the processing result by using the detection glue.
14) And (6) recovering the glue.
15) And (4) electrically converting the yeast.
In the embodiment of the invention, the preparation method of the high multi-copy expression arginine deiminase of the embodiment of the invention comprises the following steps:
(1) loading of EFADIm3(MD plate) with BDM is shown in figure 2.
(2) Recombinants were screened using 24-well plates and the expression level was checked by running PAGE gels. As shown in fig. 3.
(3) Screening 4 recombinant bacteria, performing shake flask fermentation on the 4 recombinant bacteria, inducing the supernatant for 4 days to run page gel, and detecting the expression amount, wherein the expression amount is shown in figure 4.
(4) 1ml of 2% arginine substrate and 700. mu.L yeast expression supernatant are taken for reaction, shaking table reaction is carried out at 45 ℃ for 3 hours, and a 0.5 microliter point thin-layer chromatography plate is taken, and the detection results are all active. As shown in fig. 5.
(5) Multiple copies of expression of EFADIm3, increased dose effects, including: (5.1)1C0py enzyme cleavage, as shown in FIG. 6.
(5.2)2C0py cleavage, as shown in FIG. 7.
(5.3)3C0py cleavage, as shown in FIG. 8.
(5.4)4C0py cleavage, as shown in FIG. 9.
(5.5)5C0py cleavage, as shown in FIG. 10.
The invention is further described below in connection with ADI enzymatic property analysis.
The principle of activity detection:
the ureido contained in the L-citrulline molecule and diacetyl monoxime can be condensed into a red diazole compound under the condition of strong acid. The absorbance of this complex at 490nm can be linearly related to the citrulline concentration.
Solution preparation:
H2SO4-H3PO4mixed acid: v (H)2SO4):V(H3PO4)＝1:3。
Preparing a color developing solution: 1.50g of diacetyl monoxime is accurately weighed and dissolved in 50ml of distilled water completely to obtain 30g/l diacetyl monoxime aqueous solution.
The experimental method comprises the following steps:
respectively adding required amount of L-citrulline operating solution (diluted by water to form different gradients) into a series of test tubes, metering the volume to 5mL by using distilled water, then sequentially adding 0.25mL30g/L diacetyl monoxime solution of 2mL mixed acid, shaking up, sealing, carrying out a dark boiling water bath reaction for 30 min/(or carrying out a metal bath reaction for 10min, cooling to room temperature by using tap water, measuring the light absorption value), cooling to room temperature in a dark place after the reaction is finished, taking 200 mu L of the mixture to an ELISA plate, and measuring the light absorption value at 490 nm. The above experimental procedures were all performed at room temperature, and the measurement was repeated 3 times for each sample.
When the L-citrulline is in the range of 0-0.04 mg/ml, the light absorption value has a good linear relation with the mass concentration of the citrulline.
A＝0.0705ρ-0.1926(μg/ml)r＝0.999。
The first method comprises the following steps:
effect of PH on enzyme activity:
the buffer pH is 5.566.577.58.
20% of arginine substrate and 0.0367g of ADI are mixed and subjected to shaking table reaction at 45 ℃ for 20 minutes, 50 microliters of centrifuged supernatant, 450 microliters of water dilution, 200 microliters of mixed acid and 25 microliters of diacetyl monooxime are taken and boiled in a metal bath at 100 ℃ for 10 minutes, and the 490nm absorbance is measured by a microplate reader.
As shown in table 1 and fig. 11.
TABLE 1
A second method:
0.68g of ADI cells were weighed out and suspended in 15ml of water, and 0.1mol of glycine (PH 2.5-3.5) and 0.1mol of citric acid (pH 4-5.5.). 0.1mol of sodium phosphate (PH 6-7) were added, respectively.
The reaction solution is prepared into arginine substrate with the concentration of 20 percent and the PH of 2.5 to 7 respectively.
Reaction system: 4ml of arginine substrate plus 50. mu.l of enzyme solution were taken in each of 25ml Erlenmeyer flasks, and the mixture was allowed to react for 30 minutes in a shaker at 45 ℃.
A detection system: taking 50 microliter of reaction liquid, 450 microliter of water, 200 microliter of mixed acid and 25 microliter of diacetyl monoxime, uniformly mixing, carrying out metal bath at 100 ℃ for 10min, taking 200 microliter of mixed acid, placing the mixed acid in a 96-well plate, and measuring the light absorption value at 490nm by using an enzyme-linked immunosorbent assay instrument.
As shown in table 2 and fig. 12.
TABLE 2
A20% arginine solution was prepared from a citric acid solution having a pH of 4, and the reactions were carried out at 30.35.40.45.50.55.60.65 ℃. As shown in table 3 and fig. 13.
TABLE 3
The effect of metal ions on enzyme activity;
respectively preparing 0.1m/l CaCl2、0.1m/lCoCl26H2O、0.1m/lMnCl24H2O、0.1m/lCuSo45H2O、 0.1m/lZnSO47H2O、0.1m/lMgCl26H20 solution of the compound.
2.7ml of 20% arginine substrate at pH4 + 300. mu.l of metal ion solution (final concentration of metal ion: 0.1mM/L) + 30. mu.l of enzyme solution (0.29g of bacterial cells +10ml of deionized water resuspended) were reacted in a shaker at 50 ℃ for 30min, and sampling and detecting were carried out.
A detection system:
450. mu.l of water + 50. mu.l of reaction mixture + 200. mu.l of mixed acid + 25. mu.l of diacetyl monoxime. The metal bath is heated for 10min at 100 ℃.
As a result, Cu2+Mn with a certain inhibiting effect on enzyme activity and proper concentration2+.Mg2+And CO2+Has promoting effect on enzyme activity, Zn2+Has little influence on enzyme activity.
The invention is further described with reference to specific examples.
Specific example 1: whole cell enzyme catalysis arginine preparation citrulline
In order to reduce the amount of bacterial cells used in the reaction system, the conversion reaction system containing 20% arginine substrate was adjusted to pH 6.0 by making full use of the fact that proteins in the microbial cells were expressed at high density. Then 10g/L of pichia pastoris bacterial cells heterologously expressing ADI are put into the raw material solution, stirring is carried out while adding, the full dissolution of the bacteria is ensured, the stirring speed is controlled at 60rpm, the temperature is controlled at 37 ℃, an automatic titrator device is used for controlling the pH value of the solution at 6.0, a sample is taken after reaction for 3 hours for HPLC analysis, and citrulline can be obtained by comparing with a standard product, wherein the conversion rate is 96.8%.
Specific example 2: preparation of citrulline from arginine under catalysis of immobilized cells
The conversion system contained 20% arginine substrate and the pH was adjusted to 6.0. Then 40g/L of immobilized whole cells are put into the raw material solution, stirring is carried out while adding, the stirring speed is controlled at 50rpm, the temperature is controlled at 40 ℃, an automatic titrator device is used, the pH value is controlled at 6.0, a sample is taken after 3 hours of reaction for HPLC analysis, and a citrulline product can be obtained by comparing with a standard substance, wherein the conversion rate is 97.3%.
Specific example 3: thin layer chromatography for detecting reaction degree
The conversion system contained 20% arginine substrate and the pH was adjusted to 6.0. Then 40g/L of immobilized whole cells are put into the raw material solution, stirring is carried out while adding, the stirring speed is controlled at 50rpm, the temperature is controlled at 40 ℃, an automatic titrator device is used, the pH is controlled at 6.0, a sampling point thin layer is taken after 3 hours of reaction, and by contrast with a substrate and a standard product, the product arginine disappears, and the substrate citrulline is generated (as shown in figure 5).
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
<110> university of Hubei
<120> arginine deiminase secreted and expressed by pichia pastoris and construction method
<160> 2
<210>1
<211> length of sequence
<212> DNA（SEQ ID NO：1）：atgagccatccgattaatgtgtttagcgaaatcggtaaactgaaaaccgttatgctgcatcgtccgggtaaagaactggaaaatctgatgccggattatctggaacgtctgctgtttgatgatattccgtttctggaaaaagcacaggcagaacatgatgcatttgcagaactgctgcgtagcaaagatattgaagttgtgtatctggaagatctggcagccgaagcactgattaatgaagaagttcgtcgtcagtttatcgaccagttcctggaagaagcaaatattcgtagcgaaagcgccaaagaaaaagttcgtgaactgatgctggaaatcgatgataacgaagaactgatccagaaagcaattgccggtattcagaaacaagaactgccgaaatatgaacaagaattcctgaccgatatggtggaagcagattatccgtttattatcgatccgatgccgaacctgtattttacccgtgataattttgcaacgatgggtcatggtattagcctgaaccatatgtatagcgttacccgtcagcgtgaaaccatttttggtcagtatatctttgattatcaccctcgctttgccggtaaagaagttcctcgcgtttacgatcgttcagaaagcacccgtattgaaggtggtgatgaactgattctgagcaaagaagttgttgcaattggtattagtcagcgtaccgatgcagccagcattgaaaaaattgcacgcaacatctttgaacagaaactgggctttaaaaacatcctggcctttgatattggtgagcaccgcaaatatatgcatctggataccgtttttaccatgatcgactatgacaagtttaccatccatccggaaattgaacctggtctggttgtttatagcattaccgaaaaagccgatggcgatattcagatcaccaaagagaaagataccctggataacatcctgtgcaaatacctgcacctggataatgttcagctgattcgttgtggtgccggtaatctgaccgcagcagcacgtgaacagtggaatgatggtagcaataccctggcaattgcaccgggtgaagtggttgtgtatgatcgtaataccattaccaataaagcactggaagaggcaggcgttaaactgaactatattccgggtagcgaactggttcgtggtcgtggtggtccgcgttgtatgagcatgccgctgtatcgtgaggatctg
<212> DNA
<213> Artificial Sequence (Artificial Sequence):
<400>SEQ ID NO：2：
F:5'AGCCATCCGATTAATGTGTTTAGC 3',
R: 5'CAGATCCTCACGATACAGCGGCATG 3'
<213> Artificial Sequence (Artificial Sequence)
<211> the amino acid sequence is:
<400>SEQ ID NO：3：
MSHPINVFSEIGKLKTVMLHRPGKELENLMPDYLERLLFDDIPFLEKAQAEHDAFAELLRSKDIEVVYLEDLAAEALINEEVRRQFIDQFLEEANIRSESAKEKVRELMLEIDDNEELIQKAIAGIQKQELPKYEQEFLTDMVEADYPFIIDPMPNLYFTRDNFATMGHGISLNHMYSVTRQRETIFGQYIFDYHPRFAGKEVPRVYDRSESTRIEGGDELILSKEVVAIGISQRTDAASIEKIARNIFEQKLGFKNILAFDIGEHRKYMHLDTVFTMIDYDKFTIHPEIEPGLVVYSITEKADGDIQITKEKDTLDNILCKYLHLDNVQLIRCGAGNLTAAAREQWNDGSNTLAIAPGEVVVYDRNTITNKALEEAGVKLNYIPGSELVRGRGGPRCMSMPLYREDL
Claims (6)
1. a construction method for efficiently expressing arginine deiminase is characterized in that a heterologous arginine deiminase gene is optimized through codons, the gene is integrated on a pichia pastoris genome by means of gene engineering, a strict secretion expression vector taking methanol as an inducer is constructed by an initial signal element, namely an alcohol oxygen deiminase strong promoter, an alpha-factor signal peptide gene, an arginine deiminase gene fused at the C end of the initial signal element and a termination signal, and a recombinant expression engineering strain with the expression of the arginine deiminase strictly controlled is obtained by electrotransfering a pichia pastoris GS115 competent cell.
2. The method for constructing the arginine deiminase with high expression level according to claim 1, wherein the method for constructing the arginine deiminase with high expression level comprises the following steps:
firstly, designing primers F and R according to an arginine deiminase gene sequence of Escherichia coli K-12 provided by GenBank, wherein DNA is SEQ ID NO: 2, the amino acid sequence is SEQ ID NO: 3 amplifying arginine deiminase gene by using an escherichia coli genome as a template, wherein a gel electrophoresis band is about 1224 bp;
purifying the PCR product arginine deiminase gene, and connecting the purified PCR product arginine deiminase gene to a BDM vector to obtain a recombinant plasmid efADim3BDM, sent to sequencing after colony PCR validation;
and step three, carrying out enzyme digestion and enzyme linkage by using 4 restriction enzymes EcoRI, SPe I, BamH I and Xba I to sequentially obtain plasmids of the expression cassette structures connected in series.
3. The method for constructing arginine deiminase with high efficiency according to claim 1, wherein in the second step, the recombinant plasmid efADIm3The BDM contains an initial signal element alcohol oxygen dehydrogenase strong promoter alpha-factor signal peptide gene, an arginine deiminase gene fused at the C end of the initial signal element and a termination signal.
4. The method for constructing arginine deiminase with high expression level as claimed in claim 1, wherein after the third step, arginine deiminase is secreted and expressed under the induction of methanol.
5. The arginine deiminase with high expression efficiency as claimed in claim 1, wherein the DNA sequence of the arginine deiminase is SEQ ID NO: 1.
6. a medicament for destroying or controlling the growth of arginine auxotrophic cancer cells, prepared by highly expressing arginine deiminase according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010627909.5A CN111944841A (en) | 2020-07-01 | 2020-07-01 | Arginine deiminase secreted and expressed by pichia pastoris and construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010627909.5A CN111944841A (en) | 2020-07-01 | 2020-07-01 | Arginine deiminase secreted and expressed by pichia pastoris and construction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111944841A true CN111944841A (en) | 2020-11-17 |
Family
ID=73337858
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010627909.5A Pending CN111944841A (en) | 2020-07-01 | 2020-07-01 | Arginine deiminase secreted and expressed by pichia pastoris and construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111944841A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113122565A (en) * | 2021-04-22 | 2021-07-16 | 湖北省生物农药工程研究中心 | Novel practical pichia pastoris secretory expression vector, construction method and kit |
| CN113881724A (en) * | 2021-09-30 | 2022-01-04 | 新泰市佳禾生物科技有限公司 | Extraction and purification method for arginine-citrulline |
| CN113999834A (en) * | 2021-09-30 | 2022-02-01 | 新泰市佳禾生物科技有限公司 | Arginine deiminase producing strain and construction method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102061283A (en) * | 2010-12-05 | 2011-05-18 | 江南大学 | Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof |
| CN102409003A (en) * | 2010-09-26 | 2012-04-11 | 中国农业科学院饲料研究所 | Pichia pastoris for multi-copy high-efficiency expression of recombinant plectasin |
| CN104560927A (en) * | 2015-01-09 | 2015-04-29 | 石药集团中诺药业（石家庄）有限公司） | Mutated arginine deiminase as well as preparation method and application thereof |
| CN104694523A (en) * | 2015-03-21 | 2015-06-10 | 江南大学 | Extracellular expression method of arginine deiminase and application thereof |
| CN106591271A (en) * | 2017-03-02 | 2017-04-26 | 江南大学 | Arginine deiminase mutant with improved enzyme activity and temperature stability and application of mutant |
-
2020
- 2020-07-01 CN CN202010627909.5A patent/CN111944841A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102409003A (en) * | 2010-09-26 | 2012-04-11 | 中国农业科学院饲料研究所 | Pichia pastoris for multi-copy high-efficiency expression of recombinant plectasin |
| CN102061283A (en) * | 2010-12-05 | 2011-05-18 | 江南大学 | Construction of recombinant strain capable of producing arginine deiminase and directional modification method thereof |
| CN104560927A (en) * | 2015-01-09 | 2015-04-29 | 石药集团中诺药业（石家庄）有限公司） | Mutated arginine deiminase as well as preparation method and application thereof |
| CN104694523A (en) * | 2015-03-21 | 2015-06-10 | 江南大学 | Extracellular expression method of arginine deiminase and application thereof |
| CN106591271A (en) * | 2017-03-02 | 2017-04-26 | 江南大学 | Arginine deiminase mutant with improved enzyme activity and temperature stability and application of mutant |
Non-Patent Citations (1)
| Title |
|---|
| 李娜: "精氨酸脱亚胺酶的分泌型表达研究", 《中国优秀博硕士学位论文全文数据库(硕士)》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113122565A (en) * | 2021-04-22 | 2021-07-16 | 湖北省生物农药工程研究中心 | Novel practical pichia pastoris secretory expression vector, construction method and kit |
| CN113881724A (en) * | 2021-09-30 | 2022-01-04 | 新泰市佳禾生物科技有限公司 | Extraction and purification method for arginine-citrulline |
| CN113999834A (en) * | 2021-09-30 | 2022-02-01 | 新泰市佳禾生物科技有限公司 | Arginine deiminase producing strain and construction method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111944841A (en) | Arginine deiminase secreted and expressed by pichia pastoris and construction method | |
| CN108467860B (en) | Method for high yield of gamma-aminobutyric acid | |
| CN108060114B (en) | A kind of Escherichia coli of fermenting and producing l-Alanine and its application | |
| CN111662917A (en) | High specific activity alkaline phosphatase engineering bacteria, engineering bacteria construction and alkaline phosphatase purification method | |
| CN101348794A (en) | Encoding gene of high activity glucose oxidase, preparation and use thereof | |
| CN115873836A (en) | Nerolidol synthetase and application thereof | |
| CN111019851A (en) | Recombinant pichia pastoris engineering bacterium containing high-copy-number egg white lysozyme gene and application thereof | |
| CN114672447B (en) | Bacterial strain with self-flocculation capability and preparation method and application thereof | |
| CN112175919A (en) | Lactone hydrolase mutant and application thereof | |
| CN102392047B (en) | Bicistronic mRNA (messenger ribonucleic acid) expression vector suitable for cells of mammals and application thereof | |
| CN116240187A (en) | Prolyl hydroxylase alpha 1 subunit mutant, coding gene and application thereof in catalyzing hydroxylation of proline | |
| CN115838713A (en) | Protease and application thereof in L-carnosine synthesis | |
| CN112941003A (en) | Method for synthesizing L-alanine by catalyzing maleic acid through double-enzyme coupling whole cells | |
| CN108913732B (en) | Method for heterologous production of monacolin J and application | |
| CN114107270B (en) | L-aspartic acid beta-decarboxylase mutant | |
| CN118497157B (en) | Tea tree myricetin synthetase CsMs, coding gene and application thereof | |
| CN110819609A (en) | Mutant lipase with improved thermal stability as well as preparation method and application thereof | |
| CN110904068A (en) | CK-MB type creatine kinase isozyme, preparation method and application | |
| CN116333157B (en) | Modified D-psicose3-epimerase and application thereof | |
| CN114457055B (en) | Carboxylesterase, coding gene, genetically engineered bacterium and application thereof | |
| CN113564195B (en) | Fructosamine descarbohydrase pichia pastoris expression vector, genetically engineered bacterium, construction method and protein expression method | |
| CN102719463B (en) | A kind of method producing restructuring mixing L-arabinose isomerase | |
| CN116410906A (en) | Recombinant bacterium for exogenous expression of alanine racemase and application thereof | |
| CN114836453A (en) | Gene for coding proteinase K and strain for expressing proteinase K | |
| CN116904468A (en) | Phosphate-responsive promoter and application thereof in D-lactic acid production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |