CN111909960B - Screening method for use proportion of peptide and/or protein composition - Google Patents

Screening method for use proportion of peptide and/or protein composition Download PDF

Info

Publication number
CN111909960B
CN111909960B CN202010818161.7A CN202010818161A CN111909960B CN 111909960 B CN111909960 B CN 111909960B CN 202010818161 A CN202010818161 A CN 202010818161A CN 111909960 B CN111909960 B CN 111909960B
Authority
CN
China
Prior art keywords
protein
cells
stem cells
peptide
hair follicle
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010818161.7A
Other languages
Chinese (zh)
Other versions
CN111909960A (en
Inventor
张志乾
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Qianxiang Cosmetics Co ltd
Original Assignee
Guangzhou Qianxiang Cosmetics Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Qianxiang Cosmetics Co ltd filed Critical Guangzhou Qianxiang Cosmetics Co ltd
Priority to CN202010818161.7A priority Critical patent/CN111909960B/en
Publication of CN111909960A publication Critical patent/CN111909960A/en
Application granted granted Critical
Publication of CN111909960B publication Critical patent/CN111909960B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A61K8/645—Proteins of vegetable origin; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A61Q19/08—Anti-ageing preparations
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • G01N33/5038—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects involving detection of metabolites per se
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/10—Screening for compounds of potential therapeutic value involving cells

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Urology & Nephrology (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • Dermatology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Birds (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Plant Pathology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to the field of biotechnology, in particular to a screening method for the use proportion of peptide and/or protein compositions. The screening method disclosed by the invention is characterized in that recombinant plasmids expressing different target proteins are respectively introduced into hair follicle dermal head stem cells for overexpression, then co-culture is carried out with human epidermal cells, and when the aging genes in the human epidermal cells are obviously down-regulated, the relative expression quantity of mRNA or protein of the target genes in each group of hair follicle dermal head stem cells is detected, wherein the relative expression quantity is the mass ratio of various peptides and/or proteins in the composition. The invention relates the relative expression amount of each component in the composition in cells and the use proportion of each component in the composition for the first time, the use proportion is determined by the relative expression amount, and the screening method can obtain the optimum use proportion of each component in the composition, thereby effectively utilizing each component in the composition and not damaging skin.

Description

Screening method for use proportion of peptide and/or protein composition
Technical Field
The invention relates to the field of biotechnology, in particular to a screening method for the use proportion of peptide and/or protein compositions.
Background
At present, various small molecular peptides are used as active ingredients in cosmetics, but the concentration of the small molecular peptides is not higher, the better, the concentration and the proportion of skin cells suitable for human faces are difficult to know when various small molecular peptides are used together, so that skin cell damage is easily caused by using high-concentration small molecular peptides, and a better effect is difficult to achieve when the small molecular peptides are used at low concentration.
Disclosure of Invention
The invention provides a screening method of the use proportion of a peptide and/or protein composition, which solves the problems that skin cells are damaged or better effect is difficult to achieve due to unsuitable use proportion when a plurality of small molecule peptides are combined in cosmetics.
The specific technical scheme is as follows:
the invention provides a screening method for the use proportion of peptide and/or protein compositions, which comprises the following steps:
Step 1: transfecting recombinant plasmid expressing any one component of the peptide and/or protein composition into hair follicle dermal head stem cells to obtain hair follicle dermal head stem cells expressing target proteins, and co-culturing the hair follicle dermal head stem cells expressing the target proteins with human epidermal cells for 12-24 h, wherein the rest components in the peptide and/or protein composition repeat the steps;
Step 2: and detecting the relative expression quantity of mRNA or protein of the target gene in the cocultured hair follicle dermal papilla stem cells, namely the mass ratio of various components in the peptide and/or protein composition.
In step 1 of the present invention, the peptide and/or protein composition may comprise two or more peptides, or two or more proteins, or a mixture of proteins and peptides, preferably two or more peptides; the peptide is polypeptide or small molecule peptide; in the process of transfection of the recombinant plasmids, the transfection amount of each group of recombinant plasmids is the same;
each peptide or protein in the compositions of the invention needs to function similarly or consistently, for example: peptides or proteins which are anti-ageing and/or anti-ageing related.
In the present invention, the recombinant plasmid comprises: a vector plasmid and a reporter gene;
The carrier plasmids are carrier plasmid pLentilox 3.7.7 and packaging plasmid pRSV-REV;
The reporter gene is enhanced green fluorescent protein EGFP, enhanced blue fluorescent protein EBFP or enhanced cyan fluorescent protein ECFP, preferably EGFP.
In the invention, the human epidermal cells can better simulate normal human skin. The epidermal cells cannot differentiate and divide, belong to mature cells, and can only affect the cells at most after being introduced, so that the epidermal cells are difficult to act on other cells. After the stem cells are introduced, the expression of the stem cells has larger influence on other cells (the influence of the stem cells on other surrounding epidermis cells and dermis cells mainly adopts paracrine and differentiation modes, so that the stem cells can be introduced to better simulate the condition of the stem cells in vivo, and the effect is better.)
In the co-culture, the quantity ratio of the hair follicle dermal head stem cells to the human epidermal cells is (1:3) - (1:6), preferably 1:5, a step of;
The co-cultivation time is preferably 18 to 24 hours, more preferably 24 hours.
Co-culturing hair follicle dermal papilla stem cells and human epidermis cells, monitoring the expression condition of human epidermis cell senescence genes, and performing step 2 when the co-culture is carried out for 12-24 hours, wherein the human epidermis cell senescence genes are obviously down-regulated;
Matrix Metalloproteinases (MMPs) are a class of zinc-dependent endopeptidases. Although matrix metalloproteinase 1 (MMP-1) is capable of cleaving type I collagen, MMP-2 is capable of degrading elastin and Basement Membrane (BM) compounds including type IV and type VII collagen. MMP-1 is primarily responsible for degradation of dermal collagen during aging, and MMP-2 and MMP-9 degrade extracellular matrix (ECM) proteins that affect skin thickness and wrinkle formation. Compounds in the dermal extracellular matrix, including collagen, elastin, proteoglycans, have an important impact on the appearance of the skin because of their water binding capacity. Matrix Metalloproteinases (MMPs), a family of structurally related matrix degrading enzymes, degrade and modify various dermal extracellular matrix components. Ultraviolet radiation can enhance MMP-1 production, thereby degrading collagen molecules in human skin. Thus, the aging genes described in the present invention are MMP-1 and/or MMP-2.
Type I collagen is the major structural protein of the dermal extracellular matrix, and thus, the present invention preferably detects the protein expression level of human epidermal cell senescence gene while also detecting the protein expression level of type I collagen.
The step 2 of the invention further comprises the following steps of:
Excluding the target gene with inhibited expression, wherein the relative expression amount of mRNA or protein of the residual peptide and/or protein in the composition in the hair follicle dermal papilla stem cells is the mass ratio of the residual peptide and/or protein in the composition.
The relative expression level in the step 2 of the present invention may be any one group of relative expression levels in parallel experiments, or may be average relative expression levels.
The recombinant plasmids of all components in the composition are respectively introduced into different hair follicle dermal papilla stem cells so as to enable the hair follicle dermal papilla stem cells to express in the hair follicle dermal papilla stem cells, then the hair follicle dermal papilla stem cells are respectively co-cultured with human epidermis cells, the expression condition of senescence genes of the human epidermis cells is monitored, when the co-culture is carried out for 12-24 hours, the senescence genes are obviously regulated downwards, at the moment, the expression level of mRNA or protein of target genes of the hair follicle dermal papilla stem cells is detected, and the relative expression quantity is the optimal proportion of all the components in the composition. In the embodiment of the invention, the composition is specifically five small molecular peptides, five groups of recombinant plasmids respectively expressing the five small molecular peptides are respectively introduced into five groups of hair follicle dermal head stem cells, then the five groups of hair follicle dermal head stem cells are respectively co-cultured with five groups of human epidermal cells, when the co-culture is carried out for 24 hours, the aging genes in the human epidermal cells are obviously down-regulated, the expression level of genes and proteins of the small molecular peptides in the five groups of hair follicle dermal head stem cells is detected, and the relative expression amount of the genes or proteins of the five small molecular peptides is the mass ratio of the five small molecular peptides. The peptide composition with the proportion can be applied to the skin to effectively repair skin injury, has good whitening and anti-wrinkle effects, and does not cause other injuries to the skin.
The invention also provides a peptide composition comprising: at least two peptides, wherein the peptides in the peptide composition are small molecule peptides and/or polypeptides;
The mass ratio of each peptide in the peptide composition is obtained by screening by the screening method.
In the invention, the small molecule peptide consists of 2-10 amino acids, and the polypeptide consists of 10-100 amino acids.
In the present invention, the peptide composition preferably consists of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11.
Tetrapeptides PKEK (TETRAPEPTIDE PKEK, proline-lysine-glutamate-lysine) reduce the expression of interleukin-6, interleukin-8 and tumor necrosis factor and cyclooxygenase genes in UV-light stressed keratinocytes. PKEK has obvious inhibition effect on UVB induced up-regulation of IL-1, IL-6, IL-8, TNF and POMC and tyrosinase gene expression. After 6 weeks of PKEK combined with sodium ascorbyl phosphate, facial pigmentation was significantly resolved.
Hexapeptide-11 (Hexapeptide-11) can affect the onset of aging in both intrinsically and extrinsically aged fibroblasts, and in extrinsically aged hair papilla cells.
Copper tripeptide (Copper Tripeptide) acts as a signal and carrier peptide, promotes synthesis of collagen, elastin, proteoglycans, and glycosaminoglycans, and provides anti-inflammatory and antioxidant responses. Stimulating cell regulating molecules and regeneration, healing skin and other tissues, and inhibiting aging process.
Pentapeptide-18 (PENTAPEPTIDE-18) mimics the natural mechanism of enkephalin, inhibiting neuronal activity and catecholamine release. Its effect is similar to that of the botulinum-like; and it can effectively reduce fine lines and wrinkles, moisten skin, and improve hardness and skin color.
The soybean polypeptide (Glycine max) has various biological activities of resisting oxidation, reducing blood pressure, reducing blood fat and the like. Topical application of Glycine max data showed a significant increase in Bcl-2 protein expression in the epidermis of foreskin following UVB irradiation, and a significant decrease in cyclobutane pyrimidine dimer positive cells, sunburn cells, apoptotic cells, p53 protein expression, and Bax protein expression. The soybean polypeptide for topical application can protect human skin.
When the embodiment of the invention is co-cultured for 24 hours, the senescence genes are obviously downregulated at the moment, the relative expression quantity of the peptides in the hair follicle dermal papilla stem cells is detected, and a plurality of groups of experimental results show that the transcription of Hexapeptide-11 is inhibited when the senescence genes are obviously downregulated, namely, hexapeptide-11 has no promotion effect on the downregulation of the expression of the senescence-related genes of human epidermal cells, so that the peptide composition is removed Hexapeptide-11.
The mass ratio of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11 obtained by screening by the screening method provided by the invention is (5-5.5): 3.2-4): 6.8-8.3: (9.3-10): (0-0.3), preferably (5-5.5): (3.2-4): (6.8-8.3): (9.3-10): 0, more preferably 5:4:7:10:0.
The invention preferably adopts the genetic engineering bacteria to realize the mass production of the peptide composition, adopts the method of pure biosynthesis of the genetic engineering bacteria to produce peptides, and has higher purity of the obtained peptides and multiplied effect when being applied to cosmetics or medicines.
In the invention, the engineering bacteria are preferably escherichia coli.
The invention also provides a cosmetic which comprises the peptide composition, an antioxidant, a surfactant, a whitening agent, a humectant, a wetting agent, a lubricant and water.
In the invention, the peptide composition comprises, by weight, 0.3-0.5 part of a wetting agent, 2-3 parts of a humectant, 0.1-0.2 part of a whitening agent, 0.5-0.7 part of an antioxidant, 0.1-0.3 part of a surfactant, 0.1-0.2 part of a lubricant and 93-94 parts of water.
The antioxidant is selected from vitamin C, cysteine, superoxide dismutase or metallothionein, preferably vitamin C;
The surfactant is selected from cocamidopropyl betaine, fatty acid soap, sodium dodecyl sulfate, sodium laureth sulfate or octadecyl trimethyl ammonium chloride, preferably cocamidopropyl betaine, which is a mild surfactant and can assist in softening skin;
The whitening agent is selected from nicotinamide, arbutin, kojic acid, fruit acid or salicylic acid, preferably nicotinamide, which can prevent melanin aggregation while whitening;
The humectant is selected from allantoin, hyaluronic acid, trehalose, sodium pyrrolidone carboxylate or Armba gel, preferably allantoin, which can relieve skin irritation;
the humectant is selected from propylene glycol, glycerin or sodium lactate, preferably propylene glycol, which can promote tackiness and adsorptivity to skin;
The lubricant is selected from the group consisting of glyceryl polyether-26, citric acid or potassium hydroxide, preferably glyceryl polyether-26, and the glyceryl polyether-26 is capable of softening and lubricating the skin.
Preferably, the peptide composition comprises, by weight, 0.5 part of propylene glycol, 2 parts of allantoin, 0.15 part of nicotinamide, 0.3 part of vitamin C, 0.2 part of cocamidopropyl betaine, 0.1 part of glycerolyether-26, and 93.95 parts of water.
In the present invention, the cosmetic further comprises: ethanol. The ethanol is 2-3 parts by weight, preferably 2 parts by weight. Ethanol can help shrink pores and clean grease components.
The cosmetic provided by the invention can effectively repair skin injury, has good whitening and anti-wrinkle effects, has an anti-aging function, and has no harm to skin.
The cosmetic of the present invention comprises: skin care products and make-up, the invention is preferably a skin care product. The skin care product comprises: lotion, emulsion, seminiferous liquid, eye cream, face cream or facial mask liquid. The invention also provides a medicament comprising the peptide composition and pharmaceutically acceptable auxiliary materials.
In the present invention, the medicament may be used for treating skin-related diseases.
The dosage form of the medicament comprises: spray, ointment, lotion or film coating.
From the above technical scheme, the invention has the following advantages:
the invention provides a screening method of the use proportion of peptide and/or protein compositions, which comprises the steps of respectively introducing recombinant plasmids for expressing different target proteins into hair follicle dermal head stem cells for overexpression, then co-culturing with human epidermal cells, observing the influence of the overexpression of the target proteins on senescence genes in the human epidermal cells, and detecting the relative expression quantity of mRNA or protein of the target genes in each group of hair follicle dermal head stem cells when the co-culturing is carried out for 12-24 hours, wherein the relative expression quantity is the mass ratio of various peptides and/or proteins in the compositions. The invention relates the relative expression quantity of each component in the peptide and/or protein composition in cells and the use proportion of each component in the composition for the first time, the use proportion of each component in the composition is determined by the relative expression quantity, and the screening method can obtain the optimum use proportion of each component in the composition, thereby effectively utilizing each component in the composition, avoiding the problems of secondary injury caused by excessive use of each component to the skin and poor effect caused by excessively low use quantity. The screening method can be applied to personal care products or medicines containing peptides and/or proteins, has good skin effect and does not produce side effects.
Drawings
In order to more clearly illustrate the embodiments of the invention or the technical solutions of the prior art, the drawings which are used in the description of the embodiments or the prior art will be briefly described, it being obvious that the drawings in the description below are only some embodiments of the invention, and that other drawings can be obtained from these drawings without inventive faculty for a person skilled in the art.
FIG. 1 is a map of vector plasmid pLentilox 3.7.7 and a map of packaging plasmid pRSV-REV in the lentiviral vector system provided in example 1 of the present invention;
FIG. 2 is a fluorescence microscope image (magnification 200 times) of six recombinant plasmid transfected hair follicle dermal papilla stem cells provided in example 1 of the present invention, wherein (a) is TETRAPEPTIDE PKEK, (b) is Copper Tripeptide, (c) is PENTAPEPTIDE-18, (d) is Glycine max, and (e) is Hexapeptide-11;
FIG. 3 is a graph showing Western blot detection results of MMP-1 in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing PENTAPEPTIDE-18 according to example 1 of the present invention at different time periods;
FIG. 4 is a graph showing the results of MMP-1Western blot detection in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 5 is a graph showing the results of MMP-2Western blot detection in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 6 is a graph showing the results of ELISA detection of MMP-1 in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 7 is a graph showing the results of ELISA detection of MMP-2 in human epidermal cells after co-culturing with hair follicle dermal papilla stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 8 is a graph showing the ELISA test results of type I collagen in human epidermal cells after co-culturing with hair follicle dermal papilla stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 9 is a graph showing the results of RT-qPCR assays performed on TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycinemax and Hexapeptide-11 of stem cells of the dermal papilla of hair follicles after 24h co-culture with human epidermal cells as provided in example 1 of the present invention;
FIG. 10 is a graph showing the results of measuring the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells added with different ratios TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max provided in example 2 of the present invention;
FIG. 11 is a graph showing the results of measuring the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells with and without the addition of Hexapeptide-11 and Hexapeptide-11 provided in example 2 of the present invention;
FIG. 12 is a schematic diagram of the fermentation and purification process of genetically engineered bacteria provided in example 3 of the present invention;
FIG. 13 is a graph showing the effect of the back skin of group A mice provided in example 5 of the present invention;
FIG. 14 is a graph showing the effect of the back skin of group B mice provided in example 5 of the present invention;
FIG. 15 is a view of skin tissue sections of group A mice (scale: 100 μm);
FIG. 16 is a graph showing the effect of the back skin of the mice provided in example 5 of the present invention, wherein (a) is that the ultraviolet treatment is not performed; (b) applying the liquid cosmetic of example 4 after UV treatment; (c) applying the cosmetic of comparative example 1 after UV treatment;
FIG. 17 is a view of a section of skin tissue of the corresponding mouse of FIG. 16;
FIG. 18 is a graph showing the effect of the back skin of the ultraviolet injury model mouse according to example 5 of the present invention after the application of the cosmetics, wherein (a) the liquid cosmetics according to example 1 and (b) the cosmetics according to comparative example 2 are applied; (c) applying the cosmetic of comparative example 3; (d) applying the cosmetic of comparative example 4;
FIG. 19 is a view of a section of skin tissue of the mouse of FIG. 18;
FIG. 20 is a plate diagram of the normal flora on the faces of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
FIG. 21 is a microscopic image (magnification 1000) of the normal flora on the faces of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
FIG. 22 is a microscopic image (magnification 1000) of the normal flora on the faces of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
Fig. 23 is a microscopic image (magnification 1000) of the normal flora on the face of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group.
Detailed Description
In order to make the objects, features and advantages of the present invention more obvious and understandable, the technical solutions of the embodiments of the present invention will be clearly and completely described below, and it is apparent that the embodiments described below are only some embodiments of the present invention, not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
In the examples of the present invention, mice were purchased from the racing biotechnology company, inc.; vector plasmid pLentilox 3.7.7 and packaging plasmid pRSV-REV were purchased from Shanghai-associated biological engineering Co., ltd; TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11 were recruited by the Zhong Qiao Xin boat company as healthy donors; hair follicle dermal head stem cells and human epidermal stem cells are provided by Qiao Xin boat technologies, inc. In Shanghai; coli is offered by the company celrei (beijing) life science and technology limited; staphylococcus epidermidis, sarcina, corynebacterium JK group, propionibacterium acnes were obtained from the beijing north narrative biotechnology institute.
Other reagents and materials in the examples of the invention are all commercially available.
Example 1
Construction of recombinant plasmid in this example
Referring to FIG. 1, the vector plasmid pLentilox 3.7.7 map and the packaging plasmid pRSV-REV map of the lentiviral vector system of this example.
Construction of expression TETRAPEPTIDE recombinant plasmid, construction of expression Hexapeptide-11 recombinant plasmid, construction of expression Copper Tripeptide recombinant plasmid, construction of expression PENTAPEPTIDE-18 recombinant plasmid and construction of expression Glycine max recombinant plasmid, and the specific steps are as follows:
TETRAPEPTIDE plus proline modified Lys-Glu-Lys to stabilize peptide structure, designed as (with the sequence shown in SEQ ID NO: 1):
ggagcccagcatggccgggcgggctcgccgcgccgcgcgtcccggggggcctcggcgcttctcgctgccgcgcttctctacgccgcgctgggggacgtggtgcgctcggagcagcagataccgctctccgtgtaagtgccggctcctgcgccgcccggggaggggaccttgccgcctgcgacccactgtgcccaagtttgggcgcctgca
hexapeptide-11 sequence Phe-Val-Ala-Pro-Phe-Pro, designed as (with the sequence shown in SEQ ID NO: 2):
gtagcccgccatgatttctctccttaaagctcgcgagaagcttctctctcctctcgtcagttccactatccgaagactctcctctagcctctcct
Copper Tripeptide sequence Cu-Gly-L-His-L-Lys, the design sequence is (with the sequence shown as SEQ ID NO: 3):
ctcgtgaaggcgtcccgttcggtcggtctggagagcgtcgccgaggcgctgctcgccgggggcaccgagggtggggtcgacgcccgatga
PENTAPEPTIDE-18 sequence Tyr-D-Ala-Gly-Phe-Leu, designed as (with the sequence shown as SEQ ID NO: 4):
atgttagtttggctggccgaacatttggtcaaatattattccggctttaacgtcttttctatctgacgtttcgcgccatcgtcagcctgctgaccgcgctgttcatctcattgtggatgggcccgcgtatgattgctcatttgcaaaaactttcctttggtcaggtggtgcgtaacgacggtcctgaatcacacttcagcaagcgcggtacgccgaccatgggcgggattatgatcctgacggcgattgtgatctccgtactgctgtgggcttacccgtccaatccgtacgtctggtgcgtgttggtggtgctggtaggttacggtgttattggctttgttgatgattatcgcaaagtgtgcgtaaagacaccaaagggttgatcgctcgttggaagtatttctg gatgtcggtcatt
Glycine max is designed as (having the sequence shown in SEQ ID NO: 5):
ggagcctcgcaaagcttcccattatcgtgggtcttgatcttcttccttaccatttccttgtggggagttaaggtatcaagtgaagagcaccaccaccatggcaaatctaaagagggacctgtggtggaaagggatcaaaggaggacattacttgtcactgaatttggagagatcactgccattgacatcaaggaaggacaaaaggaactaccctaccatcttcagttcatcacattggagccaaactcgctatttctccctgtgct tctccaagcagacatggtcttttatgttcatacaggttcata
the method comprises the following specific steps:
1. shaking bacterium (for preparing competent cells)
Two 3ml test tubes containing liquid culture medium were taken, 40-100. Mu.l of strain was added to each tube, and the tubes were shaken overnight.
2. Lifting plasmid (vector plasmid pLentilox 3.7.7)
The procedure was as described in the plasmid miniprep medium kit (Tiangen Biochemical Co., ltd.).
3. Enzyme digestion (double enzyme digestion producing sticky ends)
The added EP tube was incubated at 37℃for 1-2h.
4. Electrophoresis detection
And (3) performing agarose gel electrophoresis on the enzyme digestion product, and detecting whether enzyme digestion is successful or not.
And (3) recycling glue: agarose and buffer solution are used for preparing the gel in one step, and the target product is recovered through gel cutting, so that the agarose and buffer solution have the function of purifying the target product;
detecting glue: agarose and buffer were used to prepare one-to-two gels, with the bands conforming to the expectations for detection purposes.
5. Ligation of vector with target Gene
After the electrophoresis detection enzyme is cut into pieces, the needed fragments are carefully cut off, and the colloid is recovered (according to the operation of the colloid recovery kit instruction); the recovered fragments are then ligated to the vector. Placing in a incubator at 12-16deg.C, and maintaining for 8-16 hr
6. Transformation (transformation of ligation products into competent cells)
The connection products are subjected to transformation experiments according to the specific transformation operation steps, and are plated and cultured for 12-16 hours at 37 ℃.
7. Monoclonal detection
(1) Picking up a monoclonal antibody
Firstly taking the AMP out of a refrigerator, adding 3 mu L of AMP into a 3ml test tube filled with LB liquid medium after melting, and uniformly mixing by using a gun head; taking 5 branches of 1.5ml EP (a plurality of the EP pipes can be selected according to the situation), adding 500 mu L of the culture solution into each branch pipe, then selecting a monoclonal by using an inoculating loop (or a yellow gun head), and blowing by using a gun after the selection; and then shaking the selected bacteria for 4-5 hours until the bacteria become turbid.
(2) Monoclonal detection
Taking the shaken bacterial liquid of each tube as a template, carrying out PCR by using the TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11 primers, running the PCR products to electrophoresis, observing correct bands with consistent fragment sizes in electrophoresis images, extracting 100 mu L of bacterial liquid of the tube corresponding to the correct bands, adding the bacterial liquid into 3ml (with LB liquid culture solution and AMP+) test tubes, and shaking overnight; the next day shaking again, 1ml of the shaken bacteria were taken out in a 1.5ml EP tube and sent to Shanghai Meiji biological medicine technologies Co., ltd for sequencing and seed conservation. The five groups of recombinant plasmid sequencing results are compared with the designed gene sequences, and the comparison results prove that the five groups of recombinant plasmids of the embodiment are successfully constructed.
Example 2
The present example is a screening method for the proportion of peptide compositions used
1. Expression TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycinemax and Hexapeptide-11 hair follicle dermal papilla stem cells were constructed as follows:
Plasmid purification and cell culture
1.1 Five sets of plasmids constructed in example 1 were prepared.
1.2. 18-24 Hours prior to transfection, 2.5X10 6 293T cells were placed in 10cm dishes and incubated overnight at 37 ℃. Cells should reach 65% -70% confluence within 24 hours.
Transfection of 293T cells
1.3. Transfer vector pLentilox 3.7.7 and packaging plasmid pRSV-REV were added to Opti-MEM and mixed by complete pipetting.
1.4. The transfection reagent was added to the same tube and vortexed for 10 seconds.
1.5. The mixture was incubated at room temperature for 15 minutes.
1.6. The mixture was added drop-wise to the petri dish and vortexed to disperse evenly in the petri dish. The dishes were returned to the 37℃cell incubator.
Collecting lentivirus supernatant
1.7. After 12-18 hours incubation, 10ml of 293T cell medium was changed and culture continued for 48 hours.
1.8. The cell culture supernatant was transferred to a 15mL centrifuge tube. 3000g, centrifuged for 15 min, and the supernatant filtered through a filter (0.45 μm). The virus supernatant was transferred to a new tube.
1.9. And (5) finishing the preparation of the virus particles for later use.
Lentiviral transduction
1.10. 50,000 Human hair follicle papilla stem cell cells per well were plated in 24 well plates to a 50% fusion efficiency after transduction.
1.11. The medium is removed from the wells and appropriate amounts of lentiviral particles, medium, polybrene are added. Gently vortex to mix and incubate at 37 ℃.
1.12. After 72 hours of incubation following transduction, the viral genome is integrated into the hair follicle papilla stem cell genome.
As shown in fig. 2, five small molecule peptide recombinant plasmids were successfully introduced into dermal papilla stem cells of hair follicles.
2. The hair follicle dermal head stem cells expressing TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycinemax and Hexapeptide-11 were co-cultured with human epidermal cells, respectively. The co-culture method specifically comprises the following steps:
The Transwell chamber is placed in a culture plate, an upper chamber is called in the chamber, a lower chamber is called in the culture plate, an upper layer culture solution is contained in the upper chamber, a lower layer culture solution is contained in the lower chamber, and the upper layer culture solution and the lower layer culture solution are separated by a polycarbonate membrane. The cells are planted in the upper chamber, and the components in the lower culture solution can influence the cells in the upper chamber due to the permeability of the polycarbonate membrane, so that the influence of each component in the lower culture solution on the growth, movement and the like of the cells can be studied.
The upper chamber is seeded with hair follicle dermal papilla stem cells, the lower chamber is seeded with human epidermal cells (the quantity ratio of the hair follicle dermal papilla stem cells to the human epidermal cells is 1:5), the same culture medium is used, the purchased transwell experimental hole is purchased from Chemicon company, the matrigel is provided, and a 0.4 mu m polycarbonate membrane is used, so that cell secretion can be ensured to permeate while cells cannot permeate. After 24 hours of co-culture, cells are collected, and expression of human epidermal cell related senescence genes MMP-1 and MMP-2 is detected by Western blot and ELISA.
As shown in FIG. 3, the control group of FIG. 3 was added with a blank plasmid, and the introduction group was added with PENTAPEPTIDE-18 recombinant plasmids. The expression level of MMP-1 in human epidermal cells co-cultured with hair follicle dermal nipple head stem cells introduced with PENTAPEPTIDE-18 recombinant plasmid was significantly reduced compared to the control group.
As shown in FIGS. 4 to 8, the control group in FIGS. 4 to 8 was added with a blank plasmid. Compared with the control group, the expression level of MMP-1 and MMP-2 in the human epidermal cells co-cultured with the hair follicle dermal nipple head stem cells into which the recombinant plasmids TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max are introduced is obviously reduced, but after Hexapeptide-11 are introduced, compared with the control group, the expression level of MMP-1 in the human epidermal cells is not changed, MMP-2 is obviously increased, and the expression level of the type I collagen is obviously reduced.
3. After 24h co-culture, the introduced groups of epidermal cell senescence genes MMP-1 and MMP-2 were significantly down-regulated compared to the placebo group, and the mRNA expression levels of the dermal papilla stem cells of hair follicles were detected by RT-qPCR.
As shown in FIG. 9, hexapeptide-11 was inhibited during the down-regulation of senescence genes, with various levels of up-regulation of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max. Therefore, hexapeptide-11 was excluded from the five small peptides, and the other four small peptides were retained, and the average relative expression amounts were calculated from the relative expression amounts of the four groups of small peptides in fig. 9 as follows: TETRAPEPTIDE PKEK: copper Tripeptide: PENTAPEPTIDE-18: glycine max=5: 4:7:10, namely the mass ratio is 5:4:7:10.
4. The mass ratio is 5:4:7:10 was added to human epidermal cells as an experimental group, a mass ratio of 1:1:1:1, a mass ratio of 3:9:4:6, a mass ratio of 9:7:3:4, a mass ratio of 5:8:2:9, TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max were added to human epidermal cells as a control group 1, at a mass ratio of 5:4:7:10: TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11 were added to human epidermal cells as control group 2, and human epidermal cells without any small peptides added as blank control groups, and the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells were examined at the same time.
As shown in fig. 10, compared with the control group 1 and the blank control group, the mass ratio of the four peptides obtained by screening in example 2 was added into human epidermal cells, the expression of type I collagen was significantly up-regulated, the expression of MMP-1 and MMP-2 was significantly down-regulated, which indicates that the mass ratio of the four peptides obtained by screening in example 2 has a stronger inhibitory effect on human epidermal cell senescence genes, and the mass ratio is the optimal use ratio of the four peptides.
As shown in FIG. 11, control group 2 added Hexapeptide-11 had down-regulated expression of type I collagen and up-regulated expression of MMP-1 and MMP-2 relative to the experimental group, further demonstrating that Hexapeptide-11 was unable to inhibit expression of the senescence genes.
Example 3
This example shows the preparation of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max
Referring to fig. 12, a flowchart of a method for fermenting and purifying genetically engineered bacteria includes the following specific steps:
four target genes of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max selected in example 2 were introduced into plasmids. The plasmid selected in this example and the plasmid construction and verification method were the same as in example 1.
E.coli is selected as engineering bacteria, plasmids with TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max target genes are respectively introduced into the E.coli, the plasmids contain tetracycline antibody fragments, the strains are placed on a tetracycline culture medium for culture and screening out the strains which are successfully introduced and express the tetracycline antibody, the shaking culture is carried out for 24 hours at 37 ℃, and the target protein small molecular peptide is extracted by utilizing a protein extraction technology, wherein the extraction method is as follows:
1. and (3) performing expansion culture: 4 flasks were expanded to 16 flasks, and 200. Mu.l of AMP was added to each flask of medium, followed by shaking for about 1 hour.
2. Induction: adding 40 μl of IPTG for induction, removing kraft paper from the seal after adding, and loosening the binding. Shaking culture at 25℃for 4 hours.
3. Obtaining thalli: the cells were obtained by centrifugation at 8000rpm at 4℃for 25 minutes.
4. Ultrasonic wave breaking of thallus: after centrifugation, the supernatant was removed, and a bacterial solution was obtained by adding (600 ml PB lysate, 300. Mu.l lysozyme, 3ml PMSF) to the pellet. The bacterial liquid was transferred into 2 beakers, broken with ice bath ultrasound, 400w,75 times, 6 seconds each, 2 seconds apart. The supernatant was collected by centrifugation. 600ml PB lysate: 20mM/L PB,10mM/L EDTA,5% glycerol, 1mM/L DTT, pH was adjusted to 7.4.
5. Ultrasonic crushing: firstly, the probe is cleaned by deionized water, and then a small beaker containing bacteria liquid is placed in a large beaker containing ice-water mixture, and the interface of the ice water is slightly higher than the bacteria liquid level. The probe is immersed in the bacterial liquid and cannot extend too far (note the change of the liquid level caused by melting of ice in the process of breaking the bacteria).
6. And (3) suction filtration: the supernatant was suction filtered through a double layer filter paper, the filtrate was mixed with GST gel and magnetically stirred overnight. After 24 hours, the protein-gel mixture was suction filtered, and 20. Mu.l of the filtrate was sampled and subjected to electrophoresis.
7. Washing the hybrid protein: about 400ml of 1 XPBS+PMSF (1000:1) was used, eluted several times, and the upper layer foam (zein) was blotted off with a pipette until no foam was present on the gel.
8. Eluting the target protein: adding 50ml of eluent, carrying out (15+15+15) in 3 times, intermittently stirring after each addition, naturally standing for eluting for 15 minutes, carrying out suction filtration, avoiding drying the gel, combining the eluates, sampling 20 mu l, and carrying out electrophoresis. The eluate was zeroed and OD280 was measured. (OD value is preferably 1.5), placing the eluent in a dialysis bag (the dialysis bag should be boiled in advance), placing the dialysis bag in 2L of dialysis liquid 1, adding magnetic beads, and placing on a magnetic stirrer in a refrigerator at 4 ℃ for 4 hours, and changing to dialysis liquid 2. And (3) recycling the glue: washing with 3M sodium chloride solution (1 XPBS solution), 1 XPBS (no precipitate), eluting with 20% ethanol, and bottling. Eluent: 50mM/LTRIS-HCL, 10mM/LGSH; dialysate 1:20mM/LTRIS-HCl, 1mM/L EDTA, 0.15mM/L DTT; dialysate 2:0.5mM/L EDTA, 1 XPBS. And after purification, carrying out mass spectrometry analysis on the obtained small molecular peptide to verify the result and purity.
As shown in Table 1, the mass spectrum analysis results show that the score of the real and tandem matching sequences is high, the reliability is as high as 99.9%, and the purity is high.
TABLE 1 results of verification and purity detection by Mass Spectrometry of small molecule peptides
Small molecule peptides Score of Confidence level Purity of
Tetrapeptide PKEK 68 99.98％ 99.95％
Hexapeptide-11 78 99.95％ 99.94％
Copper Tripeptide 80 99.96％ 99.96％
Pentapeptide-18 76 99.97％ 99.94％
Glycine max 77 99.93％ 99.95％
Example 4
This example is a cosmetic preparation, formulated as follows:
0.5 part of peptide composition, 2 parts of ethanol, 2 parts of propylene glycol, 0.15 part of allantoin, 0.5 part of nicotinamide, 0.3 part of vitamin C, 0.2 part of cocamidopropyl betaine, 0.1 part of glycerolyether-26 and 93.95 parts of water.
The above raw materials were mixed into a liquid cosmetic, wherein peptide compositions were selected from four peptides TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max provided in example 3 in a mass ratio of 5:4:7: 10.
Comparative example 1
The comparative example is the preparation of cosmetics
The formulation of this comparative example differs from example 4 only in that the mass ratio of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18, glycine max and Hexapeptide-11 is 5:4:7:10:5.
Comparative example 2
The comparative example is the preparation of cosmetics
The formulation of this comparative example differs from example 4 only in that the mass ratio of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max is 5:8:2:9.
Comparative example 3
The comparative example is the preparation of cosmetics
The formulation of this comparative example differs from example 4 only in that the mass ratio of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max is 9:7:3:4.
Comparative example 4
The comparative example is the preparation of cosmetics
The formulation of this comparative example differs from example 4 only in that the mass ratio of TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max is 1:1:1:1.
Example 5
This example demonstrates the effect of the cosmetics prepared in example 4 and comparative examples 1 to 4
1. Construction of ultraviolet injury model of mice
1.2 Experimental animals BALB/c 10 nude mice, 6 weeks old. The fluorescent lamp simulates natural environment feeding, conventional feeding and drinking water, no adverse factors influence, and the experiment is started after 1w of adaptive feeding is adapted to laboratory environment.
After anesthetizing 10% chloral hydrate (0.2 ml/100 g) of mice, a 5cm×3cm area marked on the back of the mice was used for ultraviolet irradiation in the later experiments, 7-week-old nude mice after adaptive feeding were fixed, the marked area was fully exposed, an ultraviolet lamp was placed vertically 6cm above the skin of the exposed marked area, the ultraviolet irradiation amount per administration of 180MJ/cm 2(180MJ/cm2 was the minimum erythema amount in the 1 st week, the energy was increased by 1/3 over the first 1w for 2 to 4 weeks, 240MJ/cm 2、360MJ/cm2 respectively, and thereafter the irradiation experiment was ended from the 5 th week to the 5 th week for 360MJ/cm 2.
2. Effect verification of cosmetics
2.1 Mice were coated with the liquid cosmetics of example 4 on the back of the ultraviolet injury model mice after the last 24 hours of irradiation, were randomly divided into two groups, six groups a, four groups B, and both groups were coated according to gradients, the gradients of group a were that 0.05ml, 0.1ml, 0.2ml, 0.3ml, 0.4ml, and 0.5ml of the liquid cosmetics were added to the total amount of liquid in which the physiological saline was 2ml, respectively, were coated on the backs of the mice, were photographed after one week, were displayed, and group B was also coated on the backs of the mice with the total amount of liquid in which the liquid cosmetics of 0ml, 0.1ml, 0.2ml, and 0.4ml were combined with the physiological saline, respectively, were photographed once a week, and were photographed after one week, and displayed.
The changes in ultraviolet ray damage of group a and B mice were observed, and as a result, as shown in fig. 13 and 14, the liquid cosmetics were applied in a gradient from left to right in fig. 13 and 14. As can be seen from fig. 13 and 14, the liquid cosmetic prepared in example 4 has excellent effects on repair of damage to the skin of mice, removal of pigmentation, and removal of wrinkles, and the effect is more remarkable as the amount of the liquid cosmetic increases.
As a result of tissue slicing of the damaged tissue of group A mice, as shown in FIG. 15, the amounts of liquid cosmetics used in the upper half of FIG. 15 were 0.05ml, 0.1ml and 0.2ml, and the amounts of liquid cosmetics used in the lower half were 0.3ml, 0.4ml and 0.5ml, respectively. As can be seen from fig. 15, the aged and injured cells of the skin injured tissue of the mouse were significantly reduced, and the effect was more remarkable as the amount of the liquid cosmetic was increased.
2.2 Mice after the last 24 hours of irradiation was completed, the cosmetics prepared in comparative examples 1 to 4 were applied to the back of ultraviolet injury model mice, with the application amounts of 0.1ml/cm 2.
The change in the ultraviolet ray damage area of the mice was observed, and tissue sections were taken from the damage area of the mice to which the cosmetics were applied, and the results are shown in fig. 16 to 19. As can be seen from fig. 16 and 17, the liquid cosmetic of example 4 has a good effect on repairing damage to the skin of mice and the damaged tissue is aged and damaged cells are significantly reduced, compared with comparative example 1, indicating that Hexapeptide-11 may inhibit the repair of skin damage; as can be seen from fig. 18 and 19, the liquid cosmetics of example 4 have excellent effects on repair of damage to mouse skin, removal of pigmentation and removal of wrinkles, and significantly reduced cells of damaged tissue aging and damage, compared with comparative examples 2 to 4, indicating that unsuitable use of concentration of small molecular peptides in cosmetics causes skin damage.
Example 6
100 Healthy volunteers were selected, the ratio of male and female was 1:1, the ages were 35-65, and the volunteers were randomly divided into ten groups, each ten groups of ten people, five groups of them were used once a day, the left half face was used with the liquid cosmetic of example 4, and the right half face was used with the placebo-independent key component; the other five groups were randomized into two groups, one using the liquid cosmetic of example 4 and the other using placebo, once daily. The use time was 30 days, the amount of each was 10ml, and the measurement was carried out by using the VISIA skin test system before and after the start of the test, and the results are shown in Table 2.
The results in Table 2 show that the liquid cosmetic of example 4 is effective in reducing and smoothing wrinkles and increasing skin smoothness.
TABLE 2 VISIA skin test System test results
Example 7
The cultured facial flora was cultured, and the experimental group was set to add the flora, and the cell state was observed. The normal flora on the face comprises staphylococcus epidermidis, sarcina, corynebacterium JK and propionibacterium acnes, which are respectively cultured on a culture medium, and after the appearance of strains can be observed, the mass ratio of the peptide composition to the experimental group is 5:4:7:10, TETRAPEPTIDE PKEK, copper Tripeptide, PENTAPEPTIDE-18 and Glycine max, and the control group was added to PBS solution for control.
As shown in fig. 20 to 23, the peptide composition had no significant effect on the normal flora of the face, and the balance of the normal flora of the face was not destroyed.
The above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit and scope of the technical solutions of the embodiments of the present invention.
Sequence listing
<110> Guangzhou City Dry phase cosmetic Co., ltd
<120> A method for screening the use ratio of a peptide and/or protein composition
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 210
<212> DNA
<213> Homo sapiens
<400> 1
ggagcccagc atggccgggc gggctcgccg cgccgcgcgt cccggggggc ctcggcgctt 60
ctcgctgccg cgcttctcta cgccgcgctg ggggacgtgg tgcgctcgga gcagcagata 120
ccgctctccg tgtaagtgcc ggctcctgcg ccgcccgggg aggggacctt gccgcctgcg 180
acccactgtg cccaagtttg ggcgcctgca 210
<210> 2
<211> 95
<212> DNA
<213> Homo sapiens
<400> 2
gtagcccgcc atgatttctc tccttaaagc tcgcgagaag cttctctctc ctctcgtcag 60
ttccactatc cgaagactct cctctagcct ctcct 95
<210> 3
<211> 90
<212> DNA
<213> Homo sapiens
<400> 3
ctcgtgaagg cgtcccgttc ggtcggtctg gagagcgtcg ccgaggcgct gctcgccggg 60
ggcaccgagg gtggggtcga cgcccgatga 90
<210> 4
<211> 418
<212> DNA
<213> Homo sapiens
<400> 4
atgttagttt ggctggccga acatttggtc aaatattatt ccggctttaa cgtcttttct 60
atctgacgtt tcgcgccatc gtcagcctgc tgaccgcgct gttcatctca ttgtggatgg 120
gcccgcgtat gattgctcat ttgcaaaaac tttcctttgg tcaggtggtg cgtaacgacg 180
gtcctgaatc acacttcagc aagcgcggta cgccgaccat gggcgggatt atgatcctga 240
cggcgattgt gatctccgta ctgctgtggg cttacccgtc caatccgtac gtctggtgcg 300
tgttggtggt gctggtaggt tacggtgtta ttggctttgt tgatgattat cgcaaagtgt 360
gcgtaaagac accaaagggt tgatcgctcg ttggaagtat ttctggatgt cggtcatt 418
<210> 5
<211> 308
<212> DNA
<213> Homo sapiens
<400> 5
ggagcctcgc aaagcttccc attatcgtgg gtcttgatct tcttccttac catttccttg 60
tggggagtta aggtatcaag tgaagagcac caccaccatg gcaaatctaa agagggacct 120
gtggtggaaa gggatcaaag gaggacatta cttgtcactg aatttggaga gatcactgcc 180
attgacatca aggaaggaca aaaggaacta ccctaccatc ttcagttcat cacattggag 240
ccaaactcgc tatttctccc tgtgcttctc caagcagaca tggtctttta tgttcataca 300
ggttcata 308

Claims (3)

1. A method for screening the proportion of peptide and/or protein compositions used, comprising the steps of:
Step 1: transfecting recombinant plasmid expressing any one component of the peptide and/or protein composition into hair follicle dermal head stem cells to obtain hair follicle dermal head stem cells expressing target proteins, and co-culturing the hair follicle dermal head stem cells expressing the target proteins with human epidermal cells for 12-24 h, wherein the rest components in the peptide and/or protein composition repeat the steps;
step 2: detecting the relative expression quantity of mRNA or protein of a target gene in the hair follicle dermal papilla stem cells after co-culture, and excluding the target gene with inhibited expression, wherein the relative expression quantity of mRNA or protein of the residual peptide and/or protein in the composition in the hair follicle dermal papilla stem cells is the mass ratio of the residual peptide and/or protein in the composition;
in the co-culture process, the protein expression level of senescence genes in human epidermal cells needs to be detected;
the senescence genes include matrix metalloproteinase 1 and matrix metalloproteinase 2;
Detecting the protein expression level of an aging gene in human epidermal cells, and detecting the protein expression level of type I collagen in the human epidermal cells;
the number ratio of the hair follicle dermal head stem cells to the human epidermal cells is (1:3) - (1:6).
2. The method according to claim 1, wherein the co-cultivation time in step 1 is 18 to 24 hours.
3. The method of claim 1, wherein the recombinant plasmid comprises: a vector plasmid and a reporter gene;
The carrier plasmids are carrier plasmid pLentilox 3.7.7 and packaging plasmid pRSV-REV;
the reporter gene is enhanced green fluorescent protein EGFP, enhanced blue fluorescent protein EBFP or enhanced cyan fluorescent protein ECFP.
CN202010818161.7A 2020-08-14 2020-08-14 Screening method for use proportion of peptide and/or protein composition Active CN111909960B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010818161.7A CN111909960B (en) 2020-08-14 2020-08-14 Screening method for use proportion of peptide and/or protein composition

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010818161.7A CN111909960B (en) 2020-08-14 2020-08-14 Screening method for use proportion of peptide and/or protein composition

Publications (2)

Publication Number Publication Date
CN111909960A CN111909960A (en) 2020-11-10
CN111909960B true CN111909960B (en) 2024-06-25

Family

ID=73284031

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010818161.7A Active CN111909960B (en) 2020-08-14 2020-08-14 Screening method for use proportion of peptide and/or protein composition

Country Status (1)

Country Link
CN (1) CN111909960B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180080494A (en) * 2017-01-04 2018-07-12 연세대학교 산학협력단 Composition for inhibiting cellular senescenece or improving skin aging

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20080014563A (en) * 2006-08-11 2008-02-14 씨지케이 주식회사 Method for screening substances showing anti-senescence effects
JP7258749B2 (en) * 2017-07-18 2023-04-17 株式会社 資生堂 Screening method for anti-aging substances
KR102066670B1 (en) * 2018-09-27 2020-01-15 (주)에스바이오메딕스 In vitro skin dermis model and method for screening drug using the same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180080494A (en) * 2017-01-04 2018-07-12 연세대학교 산학협력단 Composition for inhibiting cellular senescenece or improving skin aging

Also Published As

Publication number Publication date
CN111909960A (en) 2020-11-10

Similar Documents

Publication Publication Date Title
CN111759748B (en) Anti-aging peptide composition and application thereof
CN106456676A (en) Hair growth-promoting function of culture medium of stimulated stem cells and use thereof
US9999589B2 (en) Culture medium of adipose-derived stem cell, method for preparing the same, and composition including the same for promoting hair growth
KR101844598B1 (en) Cosmetic composition
CN109069588A (en) Composition comprising GDF11 and its purposes
WO2013028034A1 (en) Adult stem cells derived from human skin dermis
KR20100096447A (en) Cosmetic composition comprising matrials cultured adult stem cells derived from swine placenta tissue and proteins extracted therefrom
CN111909960B (en) Screening method for use proportion of peptide and/or protein composition
CN107982536A (en) A kind of composition of drug target and application
KR102178778B1 (en) Composition for anti-aging containing epidermal stem cell conditioned medium and use thereof
JP6059859B2 (en) Stimulation of synthesis and activity of LOXL (lysyl oxidase-like) isoforms to stimulate the formation of elastic fibers
KR102141095B1 (en) Use of Mimosa pudica extracts for manufacture of composition for inhibiting MMP2 gene expression and collagen degradation
CN110894476A (en) Composition for preventing or improving aging comprising Rhodococcus sphaeroides strain or culture solution thereof
WO2022071610A1 (en) Composition for improving and/or ameliorating health status of skin and method for producing the same
KR20190138640A (en) Bacterial Secretos Used to Treat Skin Lesions
JP4527451B2 (en) Stimulation of synthesis and activity of LOXL (lysyl oxidase-like) isoforms to stimulate the formation of elastic fibers
KR101893339B1 (en) Composition comprising GDF11 and uses thereof
JP6324597B1 (en) Melanin production inhibitor, whitening agent, gene expression inhibitor, cosmetic composition for inhibiting melanin production, and cosmetic composition for whitening
CN112007144A (en) Application of Elabela polypeptide in preparation of antioxidant product
CN110585247A (en) Application of snowfield algae cell lysate in preparation of medicines or cosmetics for preventing, delaying or treating skin aging
CN108602853A (en) For preventing and the peptide of radical treatment alopecia
KR102618453B1 (en) Composition for preventing or improving striae distensae comprising culture medium of cord blood stem cell
KR102257532B1 (en) Composition for skin regeneration after laser treatment comprising growth factor complex
CN111939176B (en) Skin injury repairing agent containing adipose-derived stem cells and preparation method thereof
EP4227403A1 (en) Exosome and preparation process and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant