CN111759748B - Anti-aging peptide composition and application thereof - Google Patents
Anti-aging peptide composition and application thereof Download PDFInfo
- Publication number
- CN111759748B CN111759748B CN202010818202.2A CN202010818202A CN111759748B CN 111759748 B CN111759748 B CN 111759748B CN 202010818202 A CN202010818202 A CN 202010818202A CN 111759748 B CN111759748 B CN 111759748B
- Authority
- CN
- China
- Prior art keywords
- peptide composition
- parts
- weight
- pentapeptide
- tetrapeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/33—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing oxygen
- A61K8/34—Alcohols
- A61K8/345—Alcohols containing more than one hydroxy group
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/40—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing nitrogen
- A61K8/44—Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof
- A61K8/442—Aminocarboxylic acids or derivatives thereof, e.g. aminocarboxylic acids containing sulfur; Salts; Esters or N-acylated derivatives thereof substituted by amido group(s)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
- A61K8/494—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with more than one nitrogen as the only hetero atom
- A61K8/4946—Imidazoles or their condensed derivatives, e.g. benzimidazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
- A61K8/645—Proteins of vegetable origin; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/67—Vitamins
- A61K8/673—Vitamin B group
- A61K8/675—Vitamin B3 or vitamin B3 active, e.g. nicotinamide, nicotinic acid, nicotinyl aldehyde
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/67—Vitamins
- A61K8/676—Ascorbic acid, i.e. vitamin C
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/72—Cosmetics or similar toiletry preparations characterised by the composition containing organic macromolecular compounds
- A61K8/84—Cosmetics or similar toiletry preparations characterised by the composition containing organic macromolecular compounds obtained by reactions otherwise than those involving only carbon-carbon unsaturated bonds
- A61K8/86—Polyethers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/005—Preparations for sensitive skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/10—Washing or bathing preparations
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/08—Tripeptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K5/00—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof
- C07K5/04—Peptides containing up to four amino acids in a fully defined sequence; Derivatives thereof containing only normal peptide links
- C07K5/10—Tetrapeptides
- C07K5/1024—Tetrapeptides with the first amino acid being heterocyclic
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/52—Stabilizers
- A61K2800/522—Antioxidants; Radical scavengers
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/59—Mixtures
- A61K2800/592—Mixtures of compounds complementing their respective functions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/59—Mixtures
- A61K2800/592—Mixtures of compounds complementing their respective functions
- A61K2800/5922—At least two compounds being classified in the same subclass of A61K8/18
Abstract
The invention relates to the technical field of small molecular peptides, in particular to an anti-aging peptide composition and application thereof. The invention discloses a peptide composition, which consists of tetrapeptide, hexapeptide-11, copper tripeptide, pentapeptide-18 and soybean polypeptide; the mass ratio of tetrapeptide, copper tripeptide, pentapeptide-18, soybean polypeptide and hexapeptide-11 is as follows: (5-5.5): (3.2-4): (6.8-8.3): (9.3-10): (0-0.3). The components in the peptide composition are cooperatively matched according to a proper mass ratio, and when the peptide composition is applied to skin, the skin damage can be effectively repaired, the whitening and anti-wrinkle effects are good, secondary damage to the skin cannot be caused, and the anti-aging effect is remarkable compared with other proportions.
Description
Technical Field
The invention relates to the technical field of small molecular peptides, in particular to an anti-aging peptide composition and application thereof.
Background
At present, a plurality of anti-aging products in the market, in particular to peptide cosmetics, and the active peptide has multiple physiological functions of resisting oxidation, resisting aging, eliminating free radicals and the like, so the peptide is widely applied to the fields of cosmetics and the like. However, when a plurality of peptides are used together at present, skin cells are easily damaged, and a good effect is difficult to achieve.
Disclosure of Invention
The invention provides an anti-aging peptide composition and application thereof, and solves the problems that skin cells are easy to operate and a better effect is difficult to achieve when various peptides are used together at present.
The specific technical scheme is as follows:
the invention provides an anti-aging peptide composition, which consists of tetrapeptide, hexapeptide-11, copper tripeptide, pentapeptide-18 and soybean polypeptide;
the mass ratio of the tetrapeptide, the hexapeptide-11, the copper tripeptide, the pentapeptide-18 and the soybean polypeptide is as follows: (5-5.5): (3.2-4): (6.8-8.3): (9.3-10): (0-0.3).
The Tetrapeptide PKEK (proline-lysine-glutamic acid-lysine) can reduce the expression of interleukin-6, interleukin-8, tumor necrosis factor and cyclooxygenase genes in the keratinocyte under the stress of ultraviolet light. PKEK has obvious inhibition effect on UVB-induced up-regulation of IL-1, IL-6, IL-8, TNF, POMC and tyrosinase gene expression. After 6 weeks of PKEK in combination with sodium ascorbyl phosphate, facial pigmentation spots clearly resolved.
Hexapeptide-11 (Hexapeptide-11) is able to influence the onset of senescence in internally and externally aged fibroblasts, externally aged dermal papilla cells.
The Copper Tripeptide (Copper Tripeptide) acts as a signal and carrier peptide, promotes the synthesis of collagen, elastin, proteoglycans and glycosaminoglycans, and provides an anti-inflammatory and antioxidant response. Stimulating cell regulatory molecules and regeneration, healing skin and other tissues, and inhibiting aging process.
Pentapeptide-18 (Pentapeptide-18) mimics the natural mechanism of enkephalin, inhibiting neuronal activity and catecholamine release. Its action effect is similar to that of botulinus fungus; and it can effectively reduce fine lines and wrinkles, moisten skin, and improve hardness and complexion.
The soybean polypeptide (Glycine max) has multiple biological activities of resisting oxidation, lowering blood pressure, reducing blood lipid, etc. Local application of Glycine max data shows that after UVB irradiation, the expression of Bcl-2 protein in foreskin epidermis is obviously increased, and the expression of cyclobutane pyrimidine dimer positive cells, sunburn cells, apoptotic cells, p53 protein and Bax protein is obviously reduced. Topical application of soy polypeptides can protect human skin.
It should be noted that, when a plurality of anti-aging small molecule peptides are used together in the prior art, skin cells are easily caused by too high concentration of some anti-aging small molecule peptides, and the better effect is difficult to be achieved by using the anti-aging small molecule peptides with low concentration. The components in the peptide composition are cooperatively matched according to a proper mass ratio, and when the peptide composition is applied to skin, the skin injury can be effectively repaired, the whitening and anti-wrinkle effects are good, secondary injury to the skin cannot be caused, and compared with other proportions, the anti-aging effect is remarkable.
The anti-aging peptide composition provided by the invention is obtained by the following screening method according to the mass ratio of each component:
step 1: transfecting the recombinant plasmid expressing the tetrapeptide to hair follicle dermal papilla stem cells to obtain hair follicle dermal papilla stem cells expressing the tetrapeptide, co-culturing the hair follicle dermal papilla stem cells expressing the tetrapeptide and human epidermal cells for 12-24 hours, and repeating the steps by using hexapeptide-11, copper tripeptide, pentapeptide-18 and soybean polypeptide;
step 2: and detecting the relative expression quantity of mRNA or protein of the target gene in the co-cultured hair follicle dermal papilla stem cells, namely the mass ratio of the tetrapeptide, the hexapeptide-11, the copper tripeptide, the pentapeptide-18 and the soybean polypeptide in the peptide composition.
The invention firstly relates the relative expression quantity of each component in the peptide composition in cells to the use ratio of each component in the composition, determines the use ratio of each component in the composition through the relative expression quantity, and can obtain the optimum use ratio of each component in the composition by the screening method, thereby efficiently utilizing each component in the composition, causing no damage to skin, and avoiding the problems of secondary damage to skin caused by over-high use quantity of each component and poor use effect. The screening method can be applied to personal care products or medicines containing peptides and/or proteins.
In the step 1 of the invention, in the transfection process of the recombinant plasmid for expressing tetrapeptide, the recombinant plasmid for expressing hexapeptide-11, the recombinant plasmid for expressing copper tripeptide, the recombinant plasmid for expressing pentapeptide-18 and the recombinant plasmid for expressing soybean polypeptide, the transfection quantity of each group of recombinant plasmids is the same;
in the present invention, the recombinant plasmid includes: a vector plasmid and a reporter gene;
the carrier plasmid is a carrier plasmid pLentilox 3.7 and a packaging plasmid pRSV-REV;
the reporter gene is enhanced green fluorescent protein EGFP, enhanced blue fluorescent protein EBFP or enhanced cyan fluorescent protein ECFP, and is preferably EGFP.
In the invention, human epidermal cells can better simulate normal human skin. Since epidermal cells cannot differentiate and divide and belong to mature cells, the cells can only be affected at most after introduction, and the epidermal cells are difficult to act on other cells. After the stem cells are introduced, the expression of the stem cells has great influence on other cells (the influence of the stem cells on other surrounding epidermal cells and cells in a dermis layer mainly adopts two modes of paracrine and differentiation, so the introduction of the stem cells can better simulate the situation in vivo, and the effect is better)
In the co-culture, the number ratio of the hair follicle dermal papilla stem cells to the human epidermal cells is (1:3) - (1:6), and preferably 1:5;
co-culturing hair follicle dermal papilla stem cells and human epidermal cells, monitoring the expression condition of human epidermal cell senescence genes, and when the co-culture is carried out for 12-24 h, the human epidermal cell senescence genes are obviously reduced, detecting the expression level of mRNA or protein of target genes of the hair follicle dermal papilla stem cells, wherein the relative expression level is the optimal ratio of each component in the composition;
the co-cultivation is preferably carried out for 18 to 24 hours, more preferably for 24 hours.
Matrix Metalloproteinases (MMPs) are a class of zinc-dependent endopeptidases. While interstitial collagenase 1 (MMP-1) cleaves type I collagen, MMP-2 degrades elastin and Basement Membrane (BM) compounds including type IV and type VII collagens. MMP-1 is primarily responsible for degradation of dermal collagen during aging, and MMP-2 and MMP-9 degrade extracellular matrix (ECM) proteins that affect skin thickness and wrinkle formation. Compounds in the dermal extracellular matrix, including collagen, elastin, proteoglycans, have a significant impact on the appearance of the skin because of their water-binding capacity. Matrix Metalloproteinases (MMPs), a family of structurally related matrix degrading enzymes, degrade and modify various dermal extracellular matrix components. Ultraviolet radiation enhances MMP-1 production, thereby degrading collagen molecules in human skin. Thus, the senescence gene of the present invention is MMP-1 and/or MMP-2.
Type I collagen is the major structural protein of the dermal extracellular matrix, and therefore, it is preferable that the expression level of type I collagen is measured together with the expression level of human epidermal senescence gene in step 2 of the present invention.
The method for detecting the relative expression quantity of the mRNA or protein of the target gene in each group of the hair follicle dermal papilla stem cells in the step 2 further comprises the following steps:
excluding the target gene with the suppressed expression, wherein the relative expression amount of mRNA or protein of the residual peptide in the peptide composition in the hair follicle dermal papilla stem cells is the mass ratio of the residual peptide in the composition.
The relative expression level in step 2 of the present invention may be any one set of relative expression levels in parallel experiments, or may be an average relative expression level.
According to the experimental data of the embodiment of the invention, when the co-culture is carried out for 24 hours, the senescence gene is obviously reduced, the relative expression amount of the peptide in the hair follicle dermal papilla stem cells is detected, and a plurality of groups of experimental results show that the transcription of the Hexapeptide-11 is inhibited when the senescence gene is obviously reduced, namely the Hexapeptide-11 has no promotion effect on the expression reduction of the human epidermal cell senescence-related gene, so that the peptide composition removes the Hexapeptide-11. Thus, the mass ratio of the tetrapeptide, the copper tripeptide, the pentapeptide-18, the soy polypeptide, and the hexapeptide-11 is: (5-5.5): (3.2-4): (6.8-8.3): (9.3-10): 0, preferably (5-5.5): (3.2-4): 6.8-8.3): (9.3-10): 0, more preferably 5:4:7:10:0.
the invention preferably adopts the genetically engineered bacteria to realize the mass production of the peptide composition, adopts the purely biological synthesis method of the genetically engineered bacteria to produce the peptides, has higher purity of the obtained peptides, and has multiplied effect when being applied to cosmetics or health care products.
In the invention, the engineering bacteria are preferably Escherichia coli.
The invention also provides the use of the above peptide compositions in the preparation of personal care products.
In the present invention, the personal care product comprises: cosmetics and bath products.
The invention also provides an anti-aging cosmetic which comprises the anti-aging peptide composition.
Preferably, the anti-aging cosmetic further comprises: antioxidants, surfactants, whitening agents, humectants, lubricants, and water.
In the invention, the peptide composition comprises, by weight, 0.3-0.5 part of peptide composition, 2-3 parts of wetting agent, 0.1-0.2 part of humectant, 0.5-0.7 part of whitening agent, 0.1-0.3 part of antioxidant, 0.1-0.2 part of surfactant, 0.1-0.2 part of lubricant and 93-94 parts of water.
The antioxidant is selected from vitamin C, cysteine, superoxide dismutase or metallothionein, preferably vitamin C;
the surfactant is selected from cocamidopropyl betaine, fatty acid soap, lauryl sodium sulfate, lauryl polyoxyethylene ether sodium sulfate or octadecyl trimethyl ammonium chloride, preferably cocamidopropyl betaine, and the cocamidopropyl betaine is a mild surfactant and can assist in softening skin;
the whitening agent is selected from niacinamide, arbutin, kojic acid, tartaric acid or salicylic acid, preferably niacinamide, and the niacinamide can prevent melanin from aggregating while whitening;
the humectant is selected from allantoin, hyaluronic acid, trehalose, sodium pyrrolidone carboxylate or Gemba gum, preferably allantoin, which can relieve skin irritation;
the humectant is selected from propylene glycol, glycerin or sodium lactate, preferably propylene glycol, which can promote adhesion and adsorptivity with skin;
the lubricant is selected from glyceryl polyether-26, citric acid or potassium hydroxide, preferably glyceryl polyether-26, and glyceryl polyether-26 can soften and lubricate skin.
Preferably, the peptide composition comprises 0.5 part by weight, 2 parts by weight of propylene glycol, 0.15 part by weight of allantoin, 0.5 part by weight of nicotinamide, 0.3 part by weight of vitamin C, 0.2 part by weight of cocamidopropyl betaine, 0.1 part by weight of glyceryl polyether-26, and 93.95 parts by weight of water.
In the present invention, the anti-aging cosmetic further comprises: and (3) ethanol. 2-3 parts of ethanol, preferably 2 parts. The ethanol can assist in shrinking pores and cleaning oil components.
The anti-aging cosmetic provided by the invention can effectively repair skin damage, has good whitening and anti-wrinkle effects, has an anti-aging function, and is harmless to skin.
The anti-aging cosmetic comprises: skin care products and make-up products, skin care products being preferred according to the invention. The skin care product comprises: lotions, liquids for cleansing, eye creams, face creams or facial fluids.
According to the technical scheme, the invention has the following advantages:
the invention provides an anti-aging peptide composition, which consists of tetrapeptide, hexapeptide-11, copper tripeptide, pentapeptide-18 and soybean polypeptide; the mass ratio of tetrapeptide, copper tripeptide, pentapeptide-18, soybean polypeptide and hexapeptide-11 is as follows: (5-5.5): (3.2-4): (6.8-8.3): (9.3-10): (0-0.3).
The components in the anti-aging peptide composition are cooperatively matched according to a proper mass ratio, and when the anti-aging peptide composition is applied to skin, the skin injury can be effectively repaired, the whitening and anti-wrinkle effects are good, secondary injury to the skin cannot be caused, and compared with other proportions, the anti-aging effect is remarkable. The peptide composition can be used in personal care products, and has good anti-aging effect and no side effect.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without inventive exercise.
FIG. 1 is a map of the vector plasmid pLentilox 3.7 and the packaging plasmid pRSV-REV in the lentiviral vector system provided in example 1 of the present invention;
FIG. 2 is a fluorescence microscope (magnification 200X) of six sets of recombinant plasmid transfected hair follicle dermal papilla stem cells provided in example 1 of the present invention, wherein (a) is Tetrapeptide PKEK, (b) is coater Tripeptide, (c) is Pentapeptide-18, (d) is Glycine max, and (e) is Hexapeptide-11;
FIG. 3 is a graph showing the Western blot detection results of MMP-1 in human epidermal cells co-cultured with the hair follicle dermal papilla stem cells expressing Pentaptide-18, provided in example 1 of the present invention, at different time periods;
FIG. 4 is a graph showing the detection results of MMP-1Western blot in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, copper Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11, respectively, according to example 1 of the present invention;
FIG. 5 is a graph showing the detection results of MMP-2Western blot in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 6 is a graph showing the result of ELISA detection of MMP-1 in human epidermal cells co-cultured with hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, hopper Tripeptide, pentapeptide-18, glycine max, and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 7 is a graph showing the result of MMP-2ELISA assay in human epidermal cells after co-culture with hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18, glycine max, and Hexapeptide-11, respectively, provided in example 1 of the present invention;
FIG. 8 is a graph showing the results of ELISA detection of type I collagen in human epidermal cells after co-culture with hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11, respectively, as provided in example 1 of the present invention;
FIG. 9 is a diagram showing the results of RT-qPCR detection of Tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11 in dermal papilla stem cells of hair follicles after 24h of cocultivation with human epidermal cells, which is provided in example 1 of the present invention;
FIG. 10 is a graph showing the results of measuring the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells to which Tetrapeptide PKEK, hopper Tripeptide, pentaapeptide-18 and Glycine max were added at various ratios, according to example 2 of the present invention;
FIG. 11 is a graph showing the results of measuring the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells to which Hexapeptide-11 was added and to which Hexapeptide-11 was not added, according to example 2 of the present invention;
FIG. 12 is a schematic view of a fermentation and purification process of genetically engineered bacteria provided in example 3 of the present invention;
FIG. 13 is a graph showing the effects on the back skin of mice in group A provided in example 5 of the present invention;
FIG. 14 is a graph showing the effects of the dorsal skin of group B mice provided in example 5 of the present invention;
FIG. 15 is a photograph of a skin tissue section (scale: 100 μm) of a group A mouse;
FIG. 16 is a graph showing the effects of the back skin of a mouse provided in example 5 of the present invention, wherein (a) is no UV treatment; (b) applying the liquid cosmetic of example 4 after ultraviolet treatment; (c) applying the cosmetic of the comparative example 1 after ultraviolet treatment;
FIG. 17 is a photograph of a histological section of skin from a mouse corresponding to FIG. 16;
FIG. 18 is a graph showing the effects of applying the liquid cosmetic of example 1 to the back skin of a mouse model of ultraviolet damage according to example 5 of the present invention, and applying the cosmetic of comparative example 2 to the back skin of the mouse model of ultraviolet damage; (c) applying the cosmetic of comparative example 3; (d) applying the cosmetic of comparative example 4;
FIG. 19 is a photograph of a histological section of skin from a mouse corresponding to FIG. 18;
FIG. 20 is a plate diagram of normal facial flora of an experimental group and a control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
FIG. 21 is a microscopic image (magnification 1000X) of normal flora in the face of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
FIG. 22 is a microscopic image (magnification 1000X) of normal flora in the face of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group;
fig. 23 is a microscope photograph (magnification 1000 ×) of normal facial flora of the experimental group and the control group provided in example 7 of the present invention, wherein (a) is the experimental group and (b) is the control group.
Detailed Description
In order to make the objects, features and advantages of the present invention more obvious and understandable, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the embodiments described below are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
In the examples of the present invention, mice were purchased from race biotechnology limited; the vector plasmid pLentilox 3.7 and the packaging plasmid pRSV-REV were purchased from Shanghai Lingmei bioengineering, inc.; tetrapeptide PKEK, copper Tripeptide, pentapeptide-18, glycine max, and Hexapeptide-11 healthy donors were recruited by Zhong Qiao Xin boat company; hair follicle dermal papilla stem cells and human epidermal stem cells are provided by Qiao Xin boat science and technology ltd, shanghai; coli was provided by seirui cheng (beijing) life science and technology ltd; staphylococcus epidermidis, sarcina, JK group corynebacteria and Propionibacterium acnes are obtained from Beijing Beinanna institute of Biotechnology; 293T cells were purchased from Wu Hanpu Nosai Biotechnology, inc.
Other reagents and starting materials in the examples of the invention are commercially available.
Example 1
This example is the construction of recombinant plasmids
Referring to FIG. 1, the vector plasmid pLentilox 3.7 map and the packaging plasmid pRSV-REV map of the lentiviral vector system of this example are shown.
The construction of recombinant plasmid for expressing Tetrapeptide, the construction of recombinant plasmid for expressing Hexapeptide-11, the construction of recombinant plasmid for expressing Copper Tripeptide, the construction of recombinant plasmid for expressing Pentapeptide-18 and the construction of recombinant plasmid for expressing Glycine max, comprises the following steps:
tetrapeptide and proline modified Lys-Glu-Lys are added to stabilize a peptide structure, and the designed sequence is (having a sequence shown in SEQ ID NO: 1):
ggagcccagcatggccgggcgggctcgccgcgccgcgcgtcccggggggcctcggcgcttctcgctgccgcgcttctctacgccgcgctgggggacgtggtgcgctcggagcagcagataccgctctccgtgtaagtgccggctcctgcgccgcccggggaggggaccttgccgcctgcgacccactgtgcccaagtttgggcgcctgca
the Hexapeptide-11 sequence Phe-Val-Ala-Pro-Phe-Pro has the following design sequence (with the sequence shown in SEQ ID NO: 2):
gtagcccgccatgatttctctccttaaagctcgcgagaagcttctctctcctctcgtcagttccactatccgaagactctcctctagcctctcct
the sequence of the Copper Tripeptide Cu-Gly-L-His-L-Lys is designed as follows (with the sequence shown in SEQ ID NO: 3): ctcgtgaaggcgtcccgttcggtcggtctggagagcgtcgccgaggcgctgctcgccgggggcaccgagggtggggtcgacgcccgatga
The Pentapeptide-18 sequence Tyr-D-Ala-Gly-Phe-Leu has the following design sequence (having the sequence shown in SEQ ID NO: 4):
atgttagtttggctggccgaacatttggtcaaatattattccggctttaacgtcttttctatctgacgtttcgcgccatcgtcagcctgctgaccgcgctgttcatctcattgtggatgggcccgcgtatgattgctcatttgcaaaaactttcctttggtcaggtggtgcgtaacgacggtcctgaatcacacttcagcaagcgcggtacgccgaccatgggcgggattatgatcctgacggcgattgtgatctccgtactgctgtgggcttacccgtccaatccgtacgtctggtgcgtgttggtggtgctggtaggttacggtgttattggctttgttgatgattatcgcaaagtgtgcgtaaagacaccaaagggttgatcgctcgttggaagtatttctg gatgtcggtcatt
the Glycine max design sequence is (with the sequence shown in SEQ ID NO: 5):
ggagcctcgcaaagcttcccattatcgtgggtcttgatcttcttccttaccatttccttgtggggagttaaggtatcaagtgaagagcaccaccaccatggcaaatctaaagagggacctgtggtggaaagggatcaaaggaggacattacttgtcactgaatttggagagatcactgccattgacatcaaggaaggacaaaaggaactaccctaccatcttcagttcatcacattggagccaaactcgctatttctccctgtgct tctccaagcagacatggtcttttatgttcatacaggttcata
the method comprises the following specific steps:
1. shaking bacteria (preparation competent cell for standby)
Two 3ml tubes containing liquid medium were taken, 40-100. Mu.l of the inoculum was added to each tube, and shaken overnight.
2. Extracting plasmid (vector plasmid pLentilox 3.7)
The procedures were performed according to the instructions in the plasmid miniprep kit (Tiangen Biochemical technology Co., ltd.).
3. Restriction enzyme (double restriction to generate cohesive end)
The added EP tube is placed at 37 ℃ and is insulated for 1-2h.
4. Electrophoretic detection
And (4) carrying out agarose gel electrophoresis on the enzyme digestion product, and detecting whether the enzyme digestion is successful.
And (3) recovering glue: agarose and buffer solution are prepared into gel one by one, and target products are recovered through gel cutting and have the function of target product purification;
detecting glue: agarose gels were made one-to-two with buffer, and the bands were as expected for detection purposes.
5. The vector is linked to a target gene
After the enzyme digestion is successfully detected through electrophoresis, the required fragments are carefully cut off, and the colloid is recovered (according to the operation of the gel recovery kit instruction); the recovered fragments are then ligated to the vector. Placing in a warm box, keeping the temperature at 12-16 deg.C for 8-16h
6. Transformation (ligation into competent cells)
Performing competence according to the specific operation steps of transformation, performing transformation experiment on the ligation product, plating and culturing at 37 ℃ for 12-16h.
7. Monoclonal detection
(1) Picking monoclonal
Taking AMP out of a refrigerator, adding 3 mu L of AMP into a 3ml test tube filled with LB liquid culture medium after the AMP is melted, and uniformly mixing the AMP and the LB liquid culture medium by using a gun head; taking 5 EP tubes (selecting several tubes according to the situation) of 1.5ml, adding 500 microliter of the culture solution into each tube, then selecting a monoclonal by using an inoculating loop (or a yellow gun head), and blowing by using a gun after selecting; then, the selected bacteria are shaken for 4 to 5 hours until the bacteria are turbid.
(2) Monoclonal detection
Taking the well-shaken bacterial liquid in each tube as a template, carrying out PCR by using the primers of Tetrapeptide PKEK, copper Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11, running the PCR product for electrophoresis, observing correct strips with consistent fragment sizes in an electrophoresis image, extracting 100 mu L of bacterial liquid in tubes corresponding to the correct strips, adding the bacterial liquid into 3ml (LB liquid culture medium and plus AMP) test tubes, and shaking overnight; shaking again the next day, taking 1ml of the shaken bacteria, placing in a 1.5ml EP tube, sending to Shanghai Megi biological medicine science and technology Limited company for sequencing, and preserving the seeds. The sequencing results of the five groups of recombinant plasmids are compared with the designed gene sequence, and the comparison results prove that the five groups of recombinant plasmids are successfully constructed.
Example 2
This example is a screening method for the ratio of peptide compositions used
1. Construction of the hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, hopper Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11, the concrete steps are as follows:
plasmid purification and cell culture
1.1 five groups of plasmids constructed in example 1 were prepared.
1.2. 18-24 hours before transfection, 2.5X 10 6 Individual 293T cells were placed in 10cm dishes and incubated overnight at 37 ℃. Cells should achieve 65% -70% fusion within 24 hours.
Transfection of 293T cells
1.3. The transfer vector pLentilox 3.7 and the packaging plasmid pRSV-REV were added to Opti-MEM and mixed by complete pipetting.
1.4. Transfection reagents were added to the same tube and vortexed for 10 seconds.
1.5. The mixture was incubated at room temperature for 15 minutes.
1.6. The mixture was added drop wise to the petri dish and vortexed to disperse uniformly in the petri dish. The dish was returned to the cell incubator at 37 ℃.
Collecting the lentivirus supernatant
1.7 incubation for 12-18 hours, 10ml of 293T cell culture medium was replaced and the culture was continued for 48 hours.
1.8. The cell culture supernatant was transferred to a 15mL centrifuge tube. 3000g, centrifuged for 15 min and the supernatant filtered through a filter (0.45 μm). The virus supernatant was transferred to a new tube.
1.9. And completing preparation of virus particles for later use.
Lentiviral transduction
1.10 plating 50,000 individual hair follicle papilla stem cells per well in 24-well plates to a fusion efficiency of 50% after transduction.
1.11. The medium was removed from the wells and the appropriate amount of lentiviral particles, medium, polybrene was added. Vortex gently to mix.
1.12. 72 hours after transduction, the viral genome integrated into the hair follicle papilla stem cell genome.
As shown in FIG. 2, five small-molecule peptide recombinant plasmids were successfully introduced into hair follicle dermal papilla stem cells.
2. Hair follicle dermal papilla stem cells expressing Tetrapeptide PKEK, hair follicle dermal papilla stem cells expressing compressor Tripeptide, hair follicle dermal papilla stem cells expressing Pentapeptide-18, hair follicle dermal papilla stem cells expressing Glycine max, and hair follicle dermal papilla stem cells expressing Hexapeptide-11 were co-cultured with human epidermal cells, respectively. The co-culture method specifically comprises the following steps:
the Transwell chamber is placed in a culture plate, an upper chamber is weighed in the chamber, a lower chamber is weighed in the culture plate, an upper layer of culture solution is contained in the upper chamber, a lower layer of culture solution is contained in the lower chamber, and the upper layer of culture solution and the lower layer of culture solution are separated by a polycarbonate membrane. When the cells are planted in the upper chamber, the components in the lower layer culture solution can affect the cells in the upper chamber due to the permeability of the polycarbonate membrane, so that the influence of each component in the lower layer culture solution on the growth, movement and the like of the cells can be researched.
The upper chamber is seeded with hair follicle dermal papilla stem cells, the lower chamber is seeded with human epidermal cells (the number ratio of the hair follicle dermal papilla stem cells to the human epidermal cells is 1:5), the same culture medium is used, and the commercially available transwell test holes are purchased from Chemicon corporation, are provided with matrigel, and are provided with 0.4 mu m polycarbonate membrane, so that cell secretions can permeate and cells can not permeate. After 24 hours of co-culture, cells are collected, and the expression conditions of the aging genes MMP-1 and MMP-2 related to the human epidermal cells are detected by Western blot and ELISA.
As shown in FIG. 3, blank plasmid was added to the control group and Pentapeptide-18 recombinant plasmid was added to the introduction group in FIG. 3. Compared with the control group, the expression level of MMP-1 in the human epidermal cells which are cultured together with the hair follicle dermal papilla stem cells introduced with the Pentaptide-18 recombinant plasmid is obviously reduced.
As shown in FIGS. 4 to 8, blank plasmids were added to the control groups in FIGS. 4 to 8. Compared with a control group, the expression level of MMP-1 and MMP-2 in human epidermal cells co-cultured with hair follicle dermal papilla stem cells introduced with the recombinant plasmids of Tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18 and Glycine max is obviously reduced, the expression level of type I collagen is obviously increased, but after the introduction of the Hexapeptide-11, the expression level of MMP-1 in the human epidermal cells is not changed, MMP-2 is conversely increased, and the expression level of type I collagen is obviously reduced.
3. After 24h of co-culture, compared with a blank control group, the down regulation of epidermal cell senescence genes MMP-1 and MMP-2 of the introduced group is obvious, and the expression level of mRNA of the hair follicle dermal papilla stem cells is detected by adopting RT-qPCR.
As shown in FIG. 9, hexapeptide-11 was inhibited during the down-regulation of senescence genes, and Tetrapeptide PKEK, chip Tripeptide, pentapeptide-18 and Glycine max were all up-regulated to varying degrees. Therefore, the Hexapeptide-11 was excluded from the five small molecule peptides, and the other four small molecule peptides were retained, and the average relative expression amount was calculated from the relative expression amounts of the four groups of small molecule peptides in fig. 9 as follows: tetrapeptide PKEK: hopper polypeptide: pentapeptide-18: glycine max =5:4:7:10, namely the mass ratio of 5:4:7:10.
4. the mass ratio of the components is 5:4:7:10 to human epidermal cells as an experimental group, 1: 4:7:10: tetrapeptide PKEK, compressor Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11 of 5 were added to human epidermal cells as a control group 2, and human epidermal cells to which no small peptide was added were used as a blank control group to examine the expression levels of type I collagen, MMP-1 and MMP-2 in human epidermal cells at the same time.
As shown in fig. 10, the mass ratio obtained by screening in example 2 was 5:4:7:10, the expression of type I collagen is significantly up-regulated, and the expression of MMP-1 and MMP-2 is significantly down-regulated, indicating that the mass ratio obtained by screening in example 2 is 5:4:7:10 has strong inhibiting effect on human epidermal cell senescence genes, and the mass ratio is the optimal use ratio of the four peptides.
As shown in FIG. 11, in comparison with the experimental group, in the control group 2, when Hexapeptide-11 was added, the expression of type I collagen was down-regulated, and the expressions of MMP-1 and MMP-2 were up-regulated, further indicating that Hexapeptide-11 could not effectively inhibit the expression of senescence gene.
Example 3
This example illustrates the preparation of Tetrapeptide PKEK, copper Tripeptide, pentapeptide-18 and Glycine max
Referring to fig. 12, a flow chart of a fermentation and purification method of genetically engineered bacteria includes the following steps:
four target genes, namely Tetrapeptide PKEK, chip Tripeptide, pentapeptide-18 and Glycine max, screened in example 2 were introduced into a plasmid. The plasmids selected in this example and the construction and verification methods of the plasmids were the same as those in example 1.
Selecting escherichia coli as an engineering bacterium, respectively introducing plasmids with four target genes of Tetrapeptide PKEK, copper Tetrapeptide, pentapeptide-18 and Glycine max into the escherichia coli, wherein the plasmids have tetracycline antibody fragments, culturing the strains on a tetracycline culture medium to screen out strains which are successfully introduced and express the tetracycline antibody, culturing the strains on a shaking table for 24 hours at 37 ℃, and extracting target protein small molecular peptides by using a protein extraction technology, wherein the extraction method comprises the following steps:
1) And (3) amplification culture: after expanding 4 flasks to 16 flasks, 200. Mu.l AMP was added to each flask, and the medium was shake-cultured for about 1 hour.
2) Induction: adding 40 mul IPTG for induction, removing sealed kraft paper after adding, and tying loosely. Shaking-culturing at 25 deg.C for 4 hr.
3) Obtaining thalli: the cells were centrifuged at 8000rpm for 25 minutes at 4 ℃ to obtain cells.
4) And (3) ultrasonic cell disruption: after centrifugation, the supernatant was removed, and the precipitate was added (600 ml PB lysate, 300. Mu.l lysozyme, 3ml PMSF) to obtain a bacterial solution. The bacterial liquid is transferred into 2 beakers, and is subjected to ultrasonic bacteria breaking in ice bath for 75 times at 400W, 6 seconds each time and 2 seconds at intervals. The supernatant was collected by centrifugation. 600ml PB lysate: 20mM/L PB,10mM/L EDTA,5% glycerol, 1mM/L DTT, adjusted pH to 7.4.
5) Ultrasonic crushing: the probe is cleaned by deionized water, and then the small beaker containing the bacterial liquid is placed in a large beaker containing an ice-water mixture, wherein the ice-water interface is slightly higher than the bacterial liquid level. The probe is immersed in the bacteria liquid and can not extend for a long time (attention is paid to liquid level change caused by ice melting in the bacteria breaking process).
6) And (3) suction filtration: the supernatant was filtered with double-layer filter paper, the filtrate was mixed with GST gel, and stirred magnetically overnight. After 24 hours, the protein-gel mixture was filtered with suction, and 20. Mu.l of the filtrate was sampled and left for electrophoresis.
7) Washing the hybrid protein: about 400ml of 1 XPBS + PMSF (1000.
8) Eluting the target protein: adding 50ml of eluent into the solution for 3 times (15 + 15), stirring intermittently after each addition, naturally standing for elution for 15 minutes, filtering, drying the gel, combining the eluates, sampling 20 mu l, and leaving the electrophoresis. The OD280 was determined by zeroing the column with the eluent. (OD value up to 1.5 is preferred) the eluate is placed in a dialysis bag (the dialysis bag should be boiled in advance), the dialysis bag is placed in 2L of the dialysate 1, magnetic beads are added and placed on a magnetic stirrer in a refrigerator at 4 ℃, and the dialysate 2 is changed after 4 hours. And (3) recovering glue: washing with 3M sodium chloride solution (dissolved in 1 XPBS), 1 XPBS (no precipitate), eluting with 20% ethanol, and bottling. Eluent: 50mM/LTRIS-HCl, 10mM/LGSH; dialysate 1:20mM/L TRIS-HCL, 1mM/L EDTA, 0.15mM/L DTT; dialysate 2:0.5mM/L EDTA, 1 XPBS. And after purification, carrying out mass spectrometry on the obtained small molecular peptide to verify the result and purity.
As shown in Table 1, the mass spectrometry results have high score with the tandem matching sequence, the reliability is as high as 99.9%, and the purity is high.
TABLE 1 Mass spectrometric verification and purity test of small molecule peptides
Example 4
This example is the preparation of a cosmetic formulation as follows:
0.5 part of peptide composition, 2 parts of ethanol, 2 parts of propylene glycol, 0.15 part of allantoin, 0.5 part of nicotinamide, 0.3 part of vitamin C, 0.2 part of cocamidopropyl betaine, 0.1 part of glycerol polyether-26 and 93.95 parts of water.
The raw materials are mixed into a liquid cosmetic, wherein the peptide composition is prepared by mixing the Tetrapeptide PKEK, the Copper Tripeptide, the Pentapeptide-18 and the Glycine max provided by the example 3 according to the mass ratio of 5:4:7:10.
Comparative example 1
This comparative example is the preparation of a cosmetic
The formulation of this comparative example differs from example 4 only in that the mass ratio of Tetrapeptide PKEK, copper Tripeptide, pentapeptide-18, glycine max and Hexapeptide-11 is 5.
Comparative example 2
This comparative example is the preparation of a cosmetic
The formulation of this comparative example differs from example 4 only in that the mass ratio of Tetrapeptide PKEK, hopper Tripeptide, pentapeptide-18 and Glycine max is 5.
Comparative example 3
This comparative example is the preparation of a cosmetic
The formulation of this comparative example differs from example 4 only in that the mass ratio of Tetrapeptide PKEK, copper Tripeptide, pentaapeptide-18 and Glycine max is 9.
Comparative example 4
This comparative example is the preparation of a cosmetic
The formulation of the comparative example differs from example 4 only in that the mass ratio of Tetrapeptide PKEK, hopper Tripeptide, pentapeptide-18 and Glycine max is 1.
Example 5
This example demonstrates the effectiveness of the cosmetic compositions prepared in example 4 and comparative examples 1 to 4
1. Construction of mouse ultraviolet ray damage model
1.2 Experimental animals BALB/c nude mice 10, 6 weeks old. The fluorescent lamp simulates natural environment feeding, is fed with food and water regularly, has no adverse factor influence, and starts to perform experiments after being fed with 1w adaptively to adapt to the laboratory environment.
Anesthetizing 10% chloral hydrate (0.2 ml/100 g) of mouse, marking 5cm × 3cm area on back for ultraviolet irradiation in experiment, fixing 7-week-old nude mouse after adaptive breeding, fully exposing the marked area, vertically placing ultraviolet lamp 6cm above the exposed marked area skin, and giving 180MJ/cm ultraviolet irradiation amount to nude mouse every 1 week 2 (180MJ/cm 2 The minimum erythema causing amount) of the mixture, the energy is increased by 1/3 compared with the energy of the former 1w between 2 and 4 weeks, and the energy is 240MJ/cm 2 、360MJ/cm 2 And then, the measured value is maintained at 360MJ/cm from the 5 th week 2 The irradiation experiment was ended by week 8.
2. Cosmetic effect verification
2.1 after the last 24 hours of irradiation, the liquid cosmetic of example 4 was applied to the back of the mice as a model of ultraviolet injury, and the liquid cosmetic was randomly divided into two groups, six groups A and four groups B, wherein the two groups were applied according to a gradient of 0.05ml, 0.1ml, 0.2ml, 0.3ml, 0.4ml and 0.5ml of the liquid cosmetic added with physiological saline to form a total amount of 2ml of liquid, and the liquid cosmetic was applied to the back of the mice once a day, and the result was displayed by photographing one week later, and the liquid cosmetic added with 0ml, 0.1ml, 0.2ml and 0.4ml of the liquid cosmetic was applied to the back of the mice to form a total amount of 2ml of liquid cosmetic and physiological saline, and the total amount was displayed by photographing one day and once a week later.
The change in the ultraviolet ray-damaged part of the mice in group A and B was observed, and the results are shown in FIGS. 13 and 14, in which the liquid cosmetic was applied in a gradient manner from left to right in FIGS. 13 and 14. As can be seen from fig. 13 and 14, the liquid cosmetic prepared in example 4 has excellent effects on the repair of the skin damage, the removal of the pigmentation, and the removal of wrinkles of the mouse skin, and the effects are more apparent as the amount of the liquid cosmetic is increased.
The injured tissue of the mice in group A was subjected to tissue sectioning, and as shown in FIG. 15, the amounts of the liquid cosmetic used in the upper half of FIG. 15 were 0.05ml, 0.1ml and 0.2ml, respectively, and the amounts of the liquid cosmetic used in the lower half thereof were 0.3ml, 0.4ml and 0.5ml, respectively, from left to right, respectively. As can be seen from fig. 15, the mouse skin damaged tissue was significantly reduced in aging and damaged cells, and the effect was more significant as the amount of the liquid cosmetic used was increased.
2.2 after the final 24 hours of irradiation of the mice, the cosmetics prepared in comparative examples 1 to 4 were applied to the backs of the mice with ultraviolet injury models, and the application amount was 0.1ml/cm 2 。
The change in the ultraviolet injury site of the mouse was observed, and the injury of the mouse applied with the cosmetic was subjected to tissue sectioning, and the results are shown in fig. 16 to 19. As can be seen from fig. 16 and 17, the liquid cosmetic of example 4 had a superior effect on the repair of the skin damage of mice, and the aged damaged tissue and damaged cells were significantly reduced, compared to comparative example 1, indicating that the use of Hexapeptide-11 may inhibit the repair of the skin damage; as can be seen from fig. 18 and 19, the liquid cosmetic of example 4 had excellent effects on the repair of the damage, the removal of pigmentation, and the removal of wrinkles of the skin of mice, and the aging of the damaged tissue and the damaged cells were significantly reduced, compared to comparative examples 2 to 4, indicating that inappropriate use of the concentration of small-molecule peptides in the cosmetic caused skin damage.
Example 6
Selecting 100 healthy normal volunteers, male and female proportion 1:1, age 35-65, randomly divided into ten groups of ten people, wherein five groups are used once a day, the left half face is used with the liquid cosmetic of example 4, and the right half face is used with placebo-independent key ingredients; five additional groups were randomized into two groups, one group using the liquid cosmetic of example 4 and the other group using placebo once a day. The application time was 30 days, and the results of measurement using 10ml, VISIA skin detection system before and after the start of the test are shown in Table 2.
The results in table 2 show that the liquid cosmetic of example 4 is effective in reducing and smoothing wrinkles and increasing the smoothness of the skin.
TABLE 2 VISIA skin detection System test results
Example 7
Adding into cultured facial flora, culturing, setting experimental group, adding flora, and observing cell state. The normal flora on the face comprises staphylococcus epidermidis, sarcina, JK group corynebacteria and propionibacterium acnes, the staphylococcus epidermidis, the sarcina, the JK group corynebacteria and the propionibacterium acnes are respectively cultured on a culture medium, and after the occurrence of bacterial strains is observed, the peptide composition is added into an experimental group in a mass ratio of 5:4:7:10 peptide composition of Tetrapeptide PKEK, cope Tripeptide, pentaapeptide-18 and Glycine max, control group was controlled by adding PBS solution.
As shown in fig. 20-23, the peptide compositions had no significant effect on the normal flora of the face and did not disrupt the balance of the normal flora of the face.
The above-mentioned embodiments are only used for illustrating the technical solutions of the present invention, and not for limiting the same; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Sequence listing
<110> Dry-phase cosmetics Co., ltd, guangzhou City
<120> an anti-aging peptide composition and uses thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 210
<212> DNA
<213> Homo sapiens
<400> 1
ggagcccagc atggccgggc gggctcgccg cgccgcgcgt cccggggggc ctcggcgctt 60
ctcgctgccg cgcttctcta cgccgcgctg ggggacgtgg tgcgctcgga gcagcagata 120
ccgctctccg tgtaagtgcc ggctcctgcg ccgcccgggg aggggacctt gccgcctgcg 180
acccactgtg cccaagtttg ggcgcctgca 210
<210> 2
<211> 95
<212> DNA
<213> Homo sapiens
<400> 2
gtagcccgcc atgatttctc tccttaaagc tcgcgagaag cttctctctc ctctcgtcag 60
ttccactatc cgaagactct cctctagcct ctcct 95
<210> 3
<211> 90
<212> DNA
<213> Homo sapiens
<400> 3
ctcgtgaagg cgtcccgttc ggtcggtctg gagagcgtcg ccgaggcgct gctcgccggg 60
ggcaccgagg gtggggtcga cgcccgatga 90
<210> 4
<211> 418
<212> DNA
<213> Homo sapiens
<400> 4
atgttagttt ggctggccga acatttggtc aaatattatt ccggctttaa cgtcttttct 60
atctgacgtt tcgcgccatc gtcagcctgc tgaccgcgct gttcatctca ttgtggatgg 120
gcccgcgtat gattgctcat ttgcaaaaac tttcctttgg tcaggtggtg cgtaacgacg 180
gtcctgaatc acacttcagc aagcgcggta cgccgaccat gggcgggatt atgatcctga 240
cggcgattgt gatctccgta ctgctgtggg cttacccgtc caatccgtac gtctggtgcg 300
tgttggtggt gctggtaggt tacggtgtta ttggctttgt tgatgattat cgcaaagtgt 360
gcgtaaagac accaaagggt tgatcgctcg ttggaagtat ttctggatgt cggtcatt 418
<210> 5
<211> 308
<212> DNA
<213> Homo sapiens
<400> 5
ggagcctcgc aaagcttccc attatcgtgg gtcttgatct tcttccttac catttccttg 60
tggggagtta aggtatcaag tgaagagcac caccaccatg gcaaatctaa agagggacct 120
gtggtggaaa gggatcaaag gaggacatta cttgtcactg aatttggaga gatcactgcc 180
attgacatca aggaaggaca aaaggaacta ccctaccatc ttcagttcat cacattggag 240
ccaaactcgc tatttctccc tgtgcttctc caagcagaca tggtctttta tgttcataca 300
ggttcata 308
Claims (9)
1. An anti-aging peptide composition is characterized by consisting of tetrapeptide, copper tripeptide, pentapeptide-18 and soybean polypeptide;
the mass ratio of the tetrapeptide, the copper tripeptide, the pentapeptide-18 and the soybean polypeptide is as follows: (5-5.5): (3.2-4): (6.8-8.3): (9.3-10);
the tetrapeptide has the sequence shown in SEQ ID NO: 1;
the copper tripeptide has the amino acid sequence shown in SEQ ID NO:3, and (b) a sequence shown in the sequence table;
the pentapeptide-18 has the sequence shown in SEQ ID NO: 4;
the soybean polypeptide has the amino acid sequence shown in SEQ ID NO:5, and (c) a sequence shown in the specification.
2. The anti-senescence peptide composition of claim 1, wherein the mass ratio of the tetrapeptide, the copper tripeptide, the pentapeptide-18, and the soybean polypeptide is: 5:4:7:10.
3. use of the antiaging peptide composition of any one of claims 1 to 2 for the preparation of a personal care product.
4. An anti-aging cosmetic comprising the anti-aging peptide composition according to any one of claims 1 to 2.
5. The anti-aging cosmetic according to claim 4, further comprising: antioxidants, surfactants, whitening agents, humectants, lubricants, and water;
the lubricant is selected from glyceryl polyether-26, citric acid or potassium hydroxide.
6. The anti-aging cosmetic composition according to claim 5, wherein the moisturizer is selected from the group consisting of allantoin, hyaluronic acid, trehalose, sodium pyrrolidone carboxylate or luba gel;
the humectant is selected from propylene glycol, glycerin or sodium lactate;
the antioxidant is selected from vitamin C, cysteine, superoxide dismutase or metallothionein;
the surfactant is selected from cocamidopropyl betaine, fatty acid soap, sodium dodecyl sulfate, sodium laureth sulfate or octadecyl trimethyl ammonium chloride;
the whitening agent is selected from nicotinamide, arbutin, kojic acid, tartaric acid or salicylic acid.
7. The anti-aging cosmetic according to claim 6, wherein the peptide composition is 0.3 to 0.5 part by weight, the wetting agent is 2~3 parts by weight, the moisturizing agent is 0.1 to 0.2 part by weight, the whitening agent is 0.5 to 0.7 part by weight, the antioxidant is 0.1 to 0.3 part by weight, the surfactant is 0.1 to 0.2 part by weight, the lubricant is 0.1 to 0.2 part by weight, and the water is 93 to 94 parts by weight.
8. The anti-aging cosmetic composition of claim 7, further comprising: ethanol;
the weight portion of the ethanol 2~3 is counted.
9. The anti-aging cosmetic according to claim 8, characterized in that the peptide composition is 0.5 parts, the propylene glycol is 2 parts, the allantoin is 0.15 parts, the niacinamide is 0.5 parts, the vitamin C is 0.3 parts, the cocamidopropyl betaine is 0.2 parts, the glyceryl polyether-26.1 parts, the water is 93.95 parts by weight.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010818202.2A CN111759748B (en) | 2020-08-14 | 2020-08-14 | Anti-aging peptide composition and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010818202.2A CN111759748B (en) | 2020-08-14 | 2020-08-14 | Anti-aging peptide composition and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111759748A CN111759748A (en) | 2020-10-13 |
| CN111759748B true CN111759748B (en) | 2023-04-11 |
Family
ID=72728939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010818202.2A Active CN111759748B (en) | 2020-08-14 | 2020-08-14 | Anti-aging peptide composition and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111759748B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113201074B (en) * | 2021-05-07 | 2023-06-23 | 珠海联邦制药股份有限公司 | PKEK fusion protein and preparation method and application thereof |
| CN114010526A (en) * | 2021-12-01 | 2022-02-08 | 宇肽生物(东莞)有限公司 | Anti-aging polypeptide composition and application thereof |
| CN116098828A (en) * | 2022-12-21 | 2023-05-12 | 深圳市维琪科技股份有限公司 | New use of tetrapeptide derivatives for preparing composition for skin repair and tightening |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010049011A2 (en) * | 2008-10-31 | 2010-05-06 | Henkel Ag & Co. Kgaa | Active-ingredient combination for treating mature skin ii |
| KR20120099550A (en) * | 2011-01-28 | 2012-09-11 | (주)와이즈덤레버러토리 | Peptide composition for hyperpigmented skin |
| CN105288581A (en) * | 2006-06-01 | 2016-02-03 | 治疗剂肽有限公司 | Polymeric biosurfactants |
| CN107881216A (en) * | 2017-12-12 | 2018-04-06 | 杜立波 | A kind of anti-aging skin care product method for customizing |
| CN110840786A (en) * | 2019-09-03 | 2020-02-28 | 江苏国实电子商务有限公司 | Blue copper peptide essence and preparation method thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR3021319B1 (en) * | 2014-05-22 | 2018-08-31 | Sederma | PEPTIDES, COMPOSITIONS COMPRISING THE SAME, AND PARTICULARLY COSMETIC USES |
-
2020
- 2020-08-14 CN CN202010818202.2A patent/CN111759748B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105288581A (en) * | 2006-06-01 | 2016-02-03 | 治疗剂肽有限公司 | Polymeric biosurfactants |
| WO2010049011A2 (en) * | 2008-10-31 | 2010-05-06 | Henkel Ag & Co. Kgaa | Active-ingredient combination for treating mature skin ii |
| KR20120099550A (en) * | 2011-01-28 | 2012-09-11 | (주)와이즈덤레버러토리 | Peptide composition for hyperpigmented skin |
| CN107881216A (en) * | 2017-12-12 | 2018-04-06 | 杜立波 | A kind of anti-aging skin care product method for customizing |
| CN110840786A (en) * | 2019-09-03 | 2020-02-28 | 江苏国实电子商务有限公司 | Blue copper peptide essence and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111759748A (en) | 2020-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111759748B (en) | Anti-aging peptide composition and application thereof | |
| KR101811912B1 (en) | Skin cream | |
| US9999589B2 (en) | Culture medium of adipose-derived stem cell, method for preparing the same, and composition including the same for promoting hair growth | |
| CN106456676A (en) | Hair growth-promoting function of culture medium of stimulated stem cells and use thereof | |
| US20110177015A1 (en) | Skin and hair care using extract from conditioned medium cultured by mesenchymal stem cells and other regenerative cells | |
| CN102471769A (en) | Compositions and methods for genetic modification of cells having cosmetic function to enhance cosmetic appearance | |
| CN102272150B (en) | Novel anti-ageing peptides and cosmetic and/or pharmaceutical composition containing same | |
| CN107354127B (en) | Effect of the LncRNA-TUG1 in regulation PDLSCs Osteoblast Differentiation and regeneration | |
| US20220313658A1 (en) | YAP Inhibition for Wound Healing | |
| CN109069588A (en) | Composition comprising GDF11 and its purposes | |
| CN106943338A (en) | Personalized beauty care skin care item and preparation method thereof | |
| Wu et al. | Hair follicle reformation induced by dermal papilla cells from human scalp skin | |
| CN103827294A (en) | Adult stem cells derived from human skin dermis | |
| KR20100096447A (en) | Cosmetic composition comprising matrials cultured adult stem cells derived from swine placenta tissue and proteins extracted therefrom | |
| JP7334119B2 (en) | Bacterial secretome for use in treating skin lesions | |
| KR102178778B1 (en) | Composition for anti-aging containing epidermal stem cell conditioned medium and use thereof | |
| CN111909960A (en) | Method for screening using proportion of peptide and/or protein composition | |
| AU8451698A (en) | Gene therapy vehicle comprising dermal sheath tissue | |
| CN112791003B (en) | Use of retinoic acid receptor agonist compounds in cosmetic compositions | |
| KR20120058864A (en) | Cosmetic composition for promoting the stemness of adipose-derived stem cell and proliferating skin cell containing bifidobacteria extracts | |
| CN108602853A (en) | For preventing and the peptide of radical treatment alopecia | |
| WO2023089462A1 (en) | Medicinal products based on exosomes derived from plants, humans, algae, and medicinal mushrooms to treat the skin diseases | |
| KR102618453B1 (en) | Composition for preventing or improving striae distensae comprising culture medium of cord blood stem cell | |
| KR20120058830A (en) | Cosmetic composition for promoting the stemness of adipose-derived stem cell and proliferating skin cell containing hypericum extracts | |
| Khodaei et al. | The effect of mummy substance on matrix protein synthesis by human adipose-derived stem cells and dermal fibroblast and their behavior on plated PCL scaffold. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: Room 958, Room 406, No. 1, Yichuang Street, Huangpu District, Guangzhou City, Guangdong Province, 510000 Applicant after: Guangzhou Qianxiang Biotechnology Co.,Ltd. Address before: Room 425, 4th Floor, No. 17, Guangtang Road, Tianhe District, Guangzhou City, Guangdong Province, 510000 Applicant before: Guangzhou Qianxiang Cosmetics Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |