CN111888482A - Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof - Google Patents
Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof Download PDFInfo
- Publication number
- CN111888482A CN111888482A CN201911406618.7A CN201911406618A CN111888482A CN 111888482 A CN111888482 A CN 111888482A CN 201911406618 A CN201911406618 A CN 201911406618A CN 111888482 A CN111888482 A CN 111888482A
- Authority
- CN
- China
- Prior art keywords
- graphene oxide
- sirna
- gpc3
- drug
- sorafenib
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
- A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/52—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an inorganic compound, e.g. an inorganic ion that is complexed with the active ingredient
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
- A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
- A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
- A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
- A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Inorganic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a preparation method of a novel functionalized graphene oxide/GPC 3-siRNA/sorafenib compound and application of the compound in hepatocellular carcinoma treatment. The graphene oxide drug-loaded compound is prepared by combining functionalized graphene oxide, GPC3-siRNA and sorafenib through electrostatic interaction and covalent bonding according to the optimal mass ratio of 3: 5: 5 is prepared. The system has a large amount of drug-loaded substances, remarkably regulates the expression of a liver cancer marker GPC3, well inhibits the proliferation and growth of a liver cell cancer cell line, and blocks the liver cancer cell cycle in a G1 stage. Therefore, the system can carry GPC3-siRNA and liver cell cancer chemotherapeutic drugs with high efficiency, adopts a combined treatment strategy of molecular targeting and chemotherapeutic drugs to resist the malignant growth of hepatocellular carcinoma, and has great clinical application value.
Description
Technical Field
The invention relates to the generation of a hepatocellular carcinoma targeted graphene oxide drug-loaded compound, in particular to a preparation method of a functionalized graphene oxide/GPC 3-siRNA/sorafenib compound and effects of inhibiting hepatocellular carcinoma proliferation and cell cycle process.
Background
Graphene Oxide (GO) is a product obtained by strongly oxidizing graphite powder with water. The graphene oxide has good water solubility due to the introduction of rich oxygen-containing functional groups such as carboxyl, hydroxyl, epoxy and the like on the surface, provides a large number of active sites for the connection of other molecules, and improves biocompatibility. And GO has a monoatomic layer structure, the surface area is large, 2 basal planes can adsorb the drug, and the GO is a better drug carrier and delivery system. Researches have been made on delivering water-insoluble anticancer drugs into cells by using GO nano-carriers, and researches have been made on modifying carboxylated GO by folic acid and sulfonic acid groups, then simultaneously adsorbing streptomycin and camptothecin, which are chemical drugs, onto the surface of GO, delivering the drugs into breast cancer cells, and greatly improving the tumor cytotoxicity. Also, doxycycline can be loaded on novel nanogel or GO/Fe3O4The composite material controls the release speed of the medicine. Even the antimetabolite fluorouracil (5-Fu) is loaded to the functional graphene oxide, thereby improving the curative effect of the chemotherapeutic drug. The GO-Ag nano composite also has stronger antibacterial action. Therefore, GO has played a great role in the research fields of drug delivery, cancer treatment, biosensing, bioimaging, antibacterial and vaccine enhancers, etc.
Hepatocellular carcinoma is one of the most main malignant tumors in China, is difficult to find in the early stage, difficult to diagnose and develop fastest and has the worst prognosis, and is called as king of cancer. The only oral drug sorafenib for hepatocellular carcinoma accepted by the FDA at present is a multi-kinase inhibitor of Raf-1, B-Raf and VEGFR-2, can inhibit angiogenesis and proliferation, and prolong the overall survival time of patients with malignant hepatocellular carcinoma, but the response rate of the patients is as low as 2.2%. No first-line or second-line drugs have achieved good results to date. RNAi technology is used to inhibit the expression of cancer gene in liver cancer, the mutation of cancer inhibiting gene, the over expression of cyclin, growth factor and its receptor and to make certain basic research progress. The siRNA drug is used for specifically acting on liver cancer oncogenes, inhibiting the expression of the oncogenes and promoting cancer cell apoptosis, and is a safe and reliable way. For example, siRNA targets MAPK p42, COX-2, CD147, STAT3, NFkBp65, RhoA and the like to inhibit the development of liver cancer. The 1 st siRNA drug Onpattro targeting hATTR was approved, and has a great excitation effect on the whole field.
GPC3 is an oncofetal glycoprotein located on the cell surface and is a serum marker of hepatocellular carcinoma. The GPC3 protein is highly expressed in over 70% of liver cancer patients, and is not expressed or is expressed in a very low amount in normal tissues. GPC3 is specifically expressed in hepatocellular carcinoma tissue, closely related to liver cancer development, and high expression thereof indicates that the prognosis of liver cancer patients is poor. Humanized GPC3 monoclonal antibody has entered clinical phase I, but does not completely eliminate HCC cells. GPC 3-based tumor polypeptide/DNA vaccines do provide patients with high tolerance. CAR-T cell therapy against GPC3, studied at the cellular and animal level, may be a promising treatment for HCC.
At present, no report of the functionalized graphene oxide/GPC 3-siRNA/sorafenib compound for hepatocellular carcinoma exists. According to the invention, PEG and PEI are covalently connected to GO by a novel preparation method, the functionalized graphene and negatively charged siRNA are subjected to electrostatic interaction and covalently combined with sorafenib to obtain a stable multimerization functional nano drug-loaded complex, the carrier can be observed by a fluorescence microscope to rapidly and efficiently carry GPC3-siRNA-cy3 into liver cancer cells, the expression of GPC3 is remarkably reduced, and the proliferation of the liver cancer cells is remarkably inhibited. The invention reports an anti-tumor delivery system, and the therapeutic effect of the drug is improved.
Disclosure of Invention
The invention aims to provide a method for preparing GO-PEG-PEI, which is characterized by easy operation, strong repeatability, high biocompatibility and strong delivery capacity. The preparation method comprises the following steps.
(1) 100mgGO powder is weighed, 20mL deionized water is poured, and ultrasonic treatment is carried out for 10min to obtain dispersion liquid.
(2) 2.4 g NaOH and 2.0g C2H3ClO2Add to GO dispersion and stir vigorously for 3 h.
(3) And centrifuging to obtain solid residues, and fully washing the solid residues to be neutral by using deionized water to obtain the carboxylated graphene oxide.
(4) 10 mgGO-COOH was ultrasonically bathed with 20mL deionized water until uniformly dispersed.
(5) Add 10 mg PEG and 10 mg EDC to GO-COOH (0.5 mg/mL, 20 mL) and react for 5min, then stir at room temperature for 30 min.
(6) 50 mL PEI (1 mg/mL) and 30 mg EDC were added, sonicated for 5min, and then stirred overnight at room temperature.
(7) And finally washing the product to be neutral by using deionized water to obtain a GO-PEG-PEI solution.
The second objective of the invention is that GO-PEG-PEI delivers siRNA and sorafenib as 3: 5: 5 (mass ratio) and is characterized in that a GO-PEG-PEI delivery system has strong drug loading capacity and strong hepatoma carcinoma cell killing capacity.
The invention aims to provide a delivery system GO-PEG-PEI for efficiently transfecting siGPC 3.
The GPC3-siRNA is siRNA for specifically inhibiting human GPC3 gene expression, corresponds to 218-bit 236 nucleotide of a coding region, and has the following base sequence:
5 ' GCUCAAGAAAGAUGGAAGAAA3 ' of sense strand of SEQ NO.1 '
The antisense strand 5 'UCUUCCAUCUUUCUUGAGCAG 3' of SEQ NO. 2.
The invention aims to provide the effect of a delivery system GO-PEG-PEI/siGPC3 on down-regulation of GPC3 protein expression.
The invention aims to provide application of a medicine carrying system GO-PEG-PEI/siGPC 3/sorafenib in inhibiting proliferation of hepatocellular carcinoma cells.
The invention aims to provide the effect of a medicine carrying system GO-PEG-PEI/siGPC 3/sorafenib on retaining a hepatocellular carcinoma cell cycle in a G1 stage.
Drawings
Fig. 1 graphene oxide bears a schematic of the siGPC3 and sorafenib structure.
FIG. 2 is a diagram of interference effect of siGPC 3.
FIG. 3 functionalized graphene oxide inhibits cell proliferation of hepatocellular carcinoma.
Figure 4 functionalized graphene oxide inhibits cell cycle progression of hepatocellular carcinoma.
Detailed Description
The following detailed description of the present invention will be made with reference to the accompanying drawings.
Example 1 preparation of graphene oxide drug-loaded complexes carrying GPC3-siRNA and sorafenib.
100mgGO is weighed into 10mL deionized water, and the dispersion is obtained by ultrasonic treatment for 10 min. 2.4 g NaOH and 2.0g C2H3ClO2Add to GO dispersion and stir vigorously for 3 h. And centrifuging to obtain solid residues, and fully washing the solid residues with deionized water until the solid residues are neutral to obtain the carboxylated graphene oxide. 10 mgGO-COOH was ultrasonically bathed in 20mL deionized water until uniformly dispersed. 10 mg of PEG and 10 mg of EDC were added to GO-COOH (0.5 mg/mL, 20 mL), reacted for 5min, and then stirred at room temperature for 30 min. 50 mL PEI (1 mg/mL) and 15mg EDC were added and sonicated for 5min, then stirred at room temperature overnight. Washing the reaction product with deionized water to neutrality to obtain GO-PEG-PEI solution. The functionalized graphene oxide is mixed with GPC3 siRNA and sorafenib by electrostatic interaction in a mass ratio of 3: 5: 5 mixing and reacting for 30min to obtain the drug-loaded compound shown in figure 1.
Example 2, the functionalized graphene oxide drug-loaded complex inhibits proliferation of hepatocellular carcinoma MHCC97h cells.
Taking MHCC97h cells in logarithmic growth phase, preparing single cell suspension by trypsinization, and dividing each well into 1 × 104The density of individual cells was seeded in 96-well plates and cultured in a 37 ℃ cell incubator for 24 h. Sucking off the original culture medium to remove the functionAnd treating the cells by oxidized graphene, graphene/GPC 3 siRNA, sorafenib, and oxidized graphene/GPC 3-siRNA/sorafenib, and placing the treated cells in a cell culture box at 37 ℃ to be respectively cultured for 24 h. Mu.l of 5mg/mL MTT stock solution was added to each well and incubation continued at 37 ℃ for 4 h. MTT stock solution was aspirated off, and 200. mu.l of DMSO was added to each well and shaken at room temperature for 10 min. The relative viability of the cells was determined by measuring the light absorbance intensity at 490nm for each well using a microplate reader.
The results of the experiment showed that GPC3 siRNA effectively knocked down the expression of GPC3 protein, see FIG. 2. The OD value absorbance value of GO-PEG-PEI/siGPC 3/Sorafenib group at the wavelength of 490nm is lower compared with that of graphene/GPC 3 siRNA and Sorafenib group, which indicates that GO-PEG-PEI/siGPC 3/Sorafenib has better inhibition effect on the proliferation of MHCC97h cells, and is shown in figure 3.
Example 3, functionalized graphene oxide drug-loaded complexes inhibit cell cycle progression of hepatocellular carcinoma MHCC97h cells.
Taking MHCC97h cells in logarithmic growth phase, preparing single cell suspension by trypsinization, and dividing each well by 5 × 105Inoculating the density of each cell in a 6-well plate, culturing for 4h in a 37 ℃ cell culture box, replacing the culture medium with a serum-free culture medium after all the cells are attached to the wall, and culturing for 24h in the 37 ℃ cell culture box. Functionalized graphene oxide, graphene/GPC 3 siRNA, sorafenib, graphene oxide/GPC 3-siRNA/sorafenib treated MHCC97h cells were cultured in a 37 ℃ cell culture box for 48 h. Cells were harvested, washed twice with PBS, then resuspended MHCC97h cells with 1mL of 70% ethanol and placed at-20 ℃ overnight. After washing with PBS, 100. mu.L of RNase A solution at a concentration of 1mg/mL was slowly added to resuspend the cells, and 400. mu.L of Propidium Iodide (PI) solution at a concentration of 50. mu.g/mL was added thereto, and the cells were stained in the dark for 15 min. Samples were tested by flow cytometry and the cell cycle was analyzed using ModFit software.
The experimental result shows that the GO-PEG-PEI/siGPC 3/sorafenib group has an increased proportion of cells in the G1 phase and a decreased S phase relative to the graphene/GPC 3 siRNA and sorafenib group, and shows that GO-PEG-PEI/siGPC 3/sorafenib enables MHCC97H cells to be blocked in the G1 phase more, as shown in figure 4.
Sequence listing
<110> university of Master in Hunan
<120> liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof
<141>2019-12-31
<160>2
<170>SIPOSequenceListing 1.0
<210>2
<211>21
<212>RNA
<213>Homo sapiens
<400>2
gcucaagaaa gauggaagaa a 21
<210>2
<211>21
<212>RNA
<213>Homo sapiens
<400>2
ucuuccaucu uucuugagca g 21
Claims (4)
1. A preparation method of a hepatocellular carcinoma targeted functional graphene oxide drug-loaded compound is characterized in that the functional graphene oxide is mixed with GPC3-siRNA in a mass ratio of 3: 5, mixing graphene oxide/GPC 3 siRNA and sorafenib in a mass ratio of 8: 5, mixing.
2. The GPC3-siRNA of claim 1, which is siRNA that specifically inhibits the expression of human GPC3 gene, and the base sequence of the siRNA corresponds to the 218 th and 236 th nucleotides of the coding region is as follows:
SEQ NO.1 5’GCUCAAGAAAGAUGGAAGAAA3’
SEQ NO.2 5’UCUUCCAUCUUUCUUGAGCAG3’ 。
3. the graphene oxide drug-loaded complex system prepared by the preparation method according to claims 1-2 is characterized by being prepared from anti-tumor gene GPC3 small interfering RNA, chemotherapeutic drugs and a delivery carrier GO-PEG-PEI, and the system has good dispersibility, high biocompatibility, strong loading capacity and strong ability of killing liver cancer cells.
4. The graphene oxide drug-loaded complex system of claims 1-2, for use in the treatment of hepatocellular carcinoma.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911406618.7A CN111888482A (en) | 2019-12-31 | 2019-12-31 | Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911406618.7A CN111888482A (en) | 2019-12-31 | 2019-12-31 | Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111888482A true CN111888482A (en) | 2020-11-06 |
Family
ID=73169710
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911406618.7A Pending CN111888482A (en) | 2019-12-31 | 2019-12-31 | Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111888482A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113203780A (en) * | 2021-05-13 | 2021-08-03 | 桂林电子科技大学 | Method for detecting GPC3 by using label-free aptamer sensor |
| US20220333108A1 (en) * | 2021-04-01 | 2022-10-20 | Sirnaomics, Inc. | Combinations of sirnas with sirnas against sulf2 or gpc3 for use in treating cancer |
-
2019
- 2019-12-31 CN CN201911406618.7A patent/CN111888482A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20220333108A1 (en) * | 2021-04-01 | 2022-10-20 | Sirnaomics, Inc. | Combinations of sirnas with sirnas against sulf2 or gpc3 for use in treating cancer |
| CN113203780A (en) * | 2021-05-13 | 2021-08-03 | 桂林电子科技大学 | Method for detecting GPC3 by using label-free aptamer sensor |
| CN113203780B (en) * | 2021-05-13 | 2022-05-31 | 桂林电子科技大学 | Method for detecting GPC3 by using label-free aptamer sensor for non-diagnostic purpose |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ding et al. | A self-assembled RNA-triple helix hydrogel drug delivery system targeting triple-negative breast cancer | |
| CN110038025B (en) | Preparation method of RNA triple-helix hydrogel for targeted therapy of triple-negative breast cancer | |
| CN110478322B (en) | Nucleic acid drug compound and preparation method and application thereof | |
| CN112353950B (en) | Preparation method of siRNA nano delivery system and application of siRNA nano delivery system in prostatic cancer | |
| CN113999846B (en) | Interference RNA for inhibiting AFAP1-AS1 expression and application thereof in increasing breast cancer radiotherapy sensitivity | |
| CN106929508B (en) | SaRNA for activating PTPRO gene expression and transport vector thereof | |
| CN111888482A (en) | Liver cancer cell targeted graphene oxide drug-loaded compound and preparation method thereof | |
| WO2019093308A1 (en) | Therapeutic pharmaceutical composition for cancer including mirna | |
| Akhtarkhavari et al. | Downregulation of miR-21 as a promising strategy to overcome drug resistance in cancer | |
| CN103834035B (en) | A kind of cationization laminarin and its preparation method and application | |
| JP6560190B2 (en) | Novel RNA sequence with antitumor activity | |
| Zhou et al. | Targeted delivery of glypican 3 (GPC3) antibody-modified microRNA (miR let-7b-5p) polymer nanoparticles to sorafenib-resistant hepatsocellular carcinoma cells | |
| EP3981473A1 (en) | Therapeutic agent for cancer | |
| CN110251531B (en) | Targeting system for treating tumors and preparation method and application thereof | |
| CN114191539A (en) | Exosome nano particle for composite co-transport of small molecule nucleic acid and active protein, and preparation method and application thereof | |
| CN113101376A (en) | Composite gene vector for gene therapy and preparation method and application thereof | |
| CN114222616A (en) | RNA and nucleic acid vector comprising same | |
| CN113308473B (en) | Super enhancer-related long-chain non-coding RNA and application thereof in treatment of liver cancer | |
| CN112316153B (en) | Antitumor pharmaceutical composition and application thereof | |
| CN110882397B (en) | ATP (adenosine triphosphate) response type nano micelle, preparation method and application | |
| US11701378B2 (en) | RNA and nucleic acid carrier including the same | |
| CN112891365B (en) | Preparation and application of 3D bionic cell implant capable of releasing microRNA nucleic acid drug | |
| CN114773418B (en) | Nucleic acid aptamer cluster modified nano structure and preparation method and application thereof | |
| CN115120736B (en) | Multifunctional gene vector and application thereof in delivery of miRNA | |
| CN115141827B (en) | Application of Gal-9 as target in screening or preparing medicine for treating B cell lymphoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20201106 |