CN115120736B

CN115120736B - Multifunctional gene vector and application thereof in delivery of miRNA

Info

Publication number: CN115120736B
Application number: CN202210751176.5A
Authority: CN
Inventors: 吴宁; 万家齐; 邓真真; 张全斌
Original assignee: Institute of Oceanology of CAS
Current assignee: Institute of Oceanology of CAS
Filing date: 2022-06-28
Publication date: 2024-07-02
Anticipated expiration: 2042-06-28

Abstract

A multifunctional gene vector and application thereof in delivering miRNA. The invention belongs to the technical field of biological medicine, and particularly relates to a magnetic nanoparticle multifunctional gene vector modified by fucoidin coated Polyethyleneimine (PEI) and application thereof in miRNA delivery. The nanoparticle inner core is a Polyethyleneimine (PEI) modified Fe ₃O₄ nanoparticle, the surface of the nanoparticle is coated with fucoidin through electrostatic adsorption, and the nanoparticle can be further combined with miRNA through self-assembly for targeted delivery of miRNA. The fucoidin and miRNA are self-assembled layer by layer to the PEI modified magnetic Fe ₃O₄ inner core, the preparation method is simple, the condition is mild, and the operation and the repetition are easy. In addition, the fucose composite nano-carrier can realize tissue targeted delivery by means of the magnetic nano-cores in the carrier, so that systematic targeted treatment of tumors is realized. The nano particles have the characteristics of no immunogenicity, high targeting property and the like, and have good application prospects in functional research based on miRNA, treatment of diseases and clinical application.

Description

Multifunctional gene vector and application thereof in delivery of miRNA

Technical Field

The invention belongs to the technical field of biological medicine, and particularly relates to preparation of a multifunctional gene vector and application of the multifunctional gene vector in miRNA delivery.

Background

Unlike traditional chemotherapeutic and biological drugs (antibodies and cytodrugs), nucleic acid drugs (e.g., siRNA and miRNA) can target molecules that are not targeted by chemical or antibody drugs, and are expected to produce breakthrough progress in diseases with poor therapeutic effects, especially genetic diseases, cancers, etc. that are difficult to treat. Delivery of nucleic acid drugs is faced with significant problems. Nucleic acid drug entry into cells faces two major challenges, one is that RNA is susceptible to degradation by rnases in plasma and tissues when exposed to blood, and can elicit unwanted immune responses; the other is that negatively charged RNAs are difficult to cross membrane into cells, so a delivery system is required to deliver them into cells for function. Development of delivery platforms is an important point of the whole nucleic acid therapy industry chain, as well as a requirement for success of nucleic acid therapies.

With the development of nanotechnology, nanomaterials are a new choice for delivering mirnas. For example Hosseinpour et al encapsulate miRNA-26a-5p in mesoporous silica nanoparticles (MSN-CC-PEI) and coat them on polyethylenimine (MSN-CC-PEI) as a system for promoting osteogenic differentiation of rat bone marrow mesenchymal cells, which delivery system exhibits stability and high efficiency in vivo.

Fucoidan is a sulfated polysaccharide of marine origin that has been incorporated into the field of nanomedicine applications. The fucoidin can be used for nanometer drug delivery system, not only can stabilize nanometer carrier, but also can increase and enhance anticancer activity of chemotherapy drug. The patent of publication number CN 108451931A discloses a nanoparticle made of polyacrylamide hydrochloride and fucan by polyelectrolyte compounding method, which can increase the anticancer activity of chemotherapeutic drug methotrexate. The fucoidin multifunctional gene vector is designed to be prepared to deliver miRNA, so that the targeting delivery of miRNA can be realized, and the fucoidin multifunctional gene vector can be used as an immune activator and can improve the tumor microenvironment of immune suppression. This design will provide a new therapeutic strategy for the treatment of cancer.

Disclosure of Invention

The invention aims to provide a multifunctional gene vector loaded with miRNA with anti-tumor activity so as to realize targeting transportation of miRNA in vivo and synergistic anticancer effect of miRNA and fucoidin.

The specific technical scheme of the invention is as follows:

A multifunctional gene vector. The nanoparticle comprises a Fe ₃O₄ nanometer magnetic core modified by polyethylenimine (Polyethyleneimine, PEI) and fucoidan assembled on the outer layer. Fucoidan is bound to the outer layer of the magnetic core by means of electrostatic adsorption self-assembly. The average particle diameter of the carrier is 50-150 nm.

The invention provides a preparation method of the multifunctional gene vector, which comprises the following steps:

Uniformly mixing 10-15 mmol of anhydrous ferric chloride, preferably 15mmol, 3-5 mmol of sodium hydroxide, preferably 5mmol, 45-55 mL of ethylene glycol, preferably 50mL of sterile water and 3.6mL of sterile water, transferring into a three-mouth bottle, heating to boil, keeping boiling reflux for 8-12 h, stopping the reaction, cooling to room temperature, magnetically separating and washing to obtain Fe ₃O₄ nano particles for later use;

(2) Cross-linking of sodium tripolyphosphate and modification of Polyethyleneimine (PEI)

Dispersing the ferroferric oxide nano particles obtained in the step (1) in sterile water, and adding sodium tripolyphosphate, wherein the mass ratio of the Fe ₃O₄ nano particles to the sodium tripolyphosphate is 1:1 to 1:1.5, preferably 1:1.2, uniformly mixing, and reacting for 30-50min at room temperature to obtain ferroferric oxide phosphate nano particles; magnetically separating the reacted ferroferric oxide phosphate nano particles, and then re-dispersing the ferroferric oxide phosphate nano particles in 50-80mL of ultrapure water; slowly adding the solution into 50-80mL of Polyethyleneimine (PEI) water solution with the concentration of 80-100 mg/L, stirring for 20-30min, uniformly mixing, magnetically separating (magnetically separating into powerful magnets), and re-suspending to 100-120mL of sterile water to obtain Polyethyleneimine (PEI) coated magnetic ferric oxide nanoparticle solution;

(3) Self-assembly of fucoidan

Mixing and adsorbing the nanoparticle solution obtained in the step (1) and the fucoidin solution at room temperature for 30min, centrifuging at 7000-8000 rpm for 10min, removing the supernatant, and adding sterile water for resuspension to obtain fucoidin-combined magnetic nanoparticles (Fuc-NPs).

Wherein the molecular weight of the fucoidin is in the range of 5kDa to 130kDa, preferably 80 kDa to 130kDa.

Wherein, the mass ratio of the nanoparticle solution to the fucoidin is 3:1 to 1:1, wherein most preferably 2:1.

The invention also provides application of the multifunctional gene vector in delivering miRNA with anti-tumor activity. The binding method of miRNA and magnetic nano particles comprises the following steps:

Fuc-NPs solution and sterile water (sterile ultra pure water) DEPC dissolved miRNA (20 mu M) are mixed, the two are adsorbed for 30min at room temperature, miRNA is assembled into a magnetic core, the centrifugation is performed for 7000-8000 rpm,10min, the supernatant is discarded, and the sterile water is used for resuspension, so that the miRNA-loaded magnetic nano-particles (Fuc-5-FU-miRNA NPs) are prepared.

Wherein, the volume ratio of the nanoparticle solution to the miRNA is 10:1 to 10:3, wherein most preferably 10:2.

The invention also provides a compound obtained by loading the miRNA molecule with the anti-tumor activity by the multifunctional gene carrier.

The miRNA delivered in the invention has the following characteristics:

MIRNA MIMICS uracil in the sense strand and/or uracil in the antisense strand are replaced entirely by fluorouracil, i.e., 5-FU-MIRNA MIMICS.

Furthermore, the invention also provides application of the compound in preparing medicines and preparations for preventing or treating tumor diseases.

The invention has the advantages that:

The invention provides a multifunctional gene vector. The nanoparticle has the following advantages:

(1) The preparation process is simple: the fucoidin and miRNA are combined to the nanometer magnetic core in a layer-by-layer self-assembly mode, and the preparation method is simple, mild in condition and easy to operate and repeat.

(2) Double targeting: the targeting effect of the magnetic targeting and fucoidin on the p-selectin highly expressed in the tumor can effectively deliver miRNA into the tumor, reduce the toxic and side effects on other organ tissues and increase the effective dose of miRNA at the tumor part.

(3) Triple drug delivery system: the fucoidin loaded by the nano particles can activate an immune system as an effector molecule, improve the tumor microenvironment of immunosuppression, and generate a synergistic anti-tumor effect with 5-FU-MIRNA MIMICS; the miRNA carried by the tumor cell can target oncogenes to inhibit tumor growth, and the released free 5-FU can directly kill tumor cells and tumor interstitial cells, so that the systemic treatment of tumors is realized. The nano drug delivery system of 'one arrow three carving' designed in the project provides a new collaborative design strategy for a tumor targeting nano drug release system.

Drawings

FIG. 1 comparison of the immunoregulatory Activity of fucoidan with different molecular weights

FIG. 2 morphology and characterization of Fuc-5-FU-miRNA NPs

FIG. 3 mean particle size and Zeta potential of Fuc-5-FU-miRNA NPs

FIG. 4 uptake of Fuc-5-FU-miRNA NPs

FIG. 5 characterization of Fuc-5-FU-miRNA NPs uptake in cells by laser confocal microscopy

FIG. 6 influence of Fuc-5-FU-miRNA NPs on target Gene expression

FIG. 7 cytotoxicity of Fuc-5-FU-miRNA NPs

FIG. 8 Transwell co-culture System characterizes Fuc-5-FU-miRNA NPs and the effect of 5-FU-miRNA NPs on cell viability

FIG. 9. In vivo antitumor Activity of Fuc-5-FU-miRNA NPs. (a) a photographed image of tumor tissue;

(b) Tumor volume and weight; (c) Tumor tissues Ki67, CD68, CD206 immunohistochemical representative images. All images are scaled to 50 μm.

Detailed Description

The following examples are provided to further illustrate the present invention, but are not intended to limit the scope of the invention as claimed.

Example 1: comparison of fucoidan and Low molecular weight fucoidan immunomodulatory Activity

The present invention compares the immunomodulatory activity of low molecular weight fucoidan LF2 (7.2 kDa) and fucoidan FPS1M (130 kDa).

Raw264.7 was seeded at 7000 cells/well in 96-well plates. Uninduced raw264.7 cells were used as M0 macrophages. After incubation for 24h with 20ng/mL IFN-. Gamma. (PEPROTECH) and 100ng/mL LPS (source leaf organism), M0 macrophages were polarized as M1 macrophages. M0 macrophages were incubated with 20ng/mL IL-4 (PEPROTECH) and 20ng/mL IL-13 (PEPROTECH) for 24h to give M2 macrophages. The cells were further cultured for 12 hours, and the culture supernatant was collected. Meanwhile, FPS1M (200. Mu.g/mL) and LF2 (200. Mu.g/mL) were incubated with M0 macrophages for 36h, respectively, and supernatants from the cells were collected to determine the levels of NO and cytokines (IL-6 and TNF-. Alpha.). The levels of IL-6 and TNF- α in the supernatant of Raw264.7 cell culture broth were measured using ELISA (Boshide). Nitric Oxide (NO) was detected with the nitric oxide assay kit according to instructions (bi yun tian).

FIG. 1 shows that FPS1M and LF2 both promote macrophage release of pro-inflammatory factors (NO, IL-6 and TNF. Alpha.). Wherein, FPS1M plays a better role in promoting macrophage M1 differentiation into M1 phenotype than LF 2. This suggests that fucoidan of high molecular weight exerts better immunostimulatory activity than fucoidan of lower molecular weight. Thus, the preparation of Fuc-5-FU-miR-15a NPs is preferably high molecular weight fucoidan (80-130 kDa).

Example 2: preparation and characterization of miRNA-loaded multifunctional gene vector

2.1 Preparation of miR-15 a-loaded multifunctional Gene vector (Fuc-5-FU-miR-15 a NPs)

15Mmol of anhydrous ferric chloride, 5mmol of sodium hydroxide, 50mL of ethylene glycol and 3.6mL of deionized water are uniformly mixed, transferred into a three-mouth bottle, heated to boiling, kept at boiling reflux for 8 hours, stopped, cooled to room temperature, separated and washed to obtain Fe ₃O₄ nano particles.

Dispersing 0.2g of the obtained ferroferric oxide nano particles in 100mL of deionized water, adding 200mg of sodium tripolyphosphate, uniformly mixing, magnetically separating, and then re-dispersing in 100mL of water; slowly adding the solution into 50mL of polyethyleneimine water solution with the concentration of 100mg/L, uniformly mixing, and magnetically separating or centrifugally separating to obtain PEI coated magnetic iron oxide nano particles.

100 Mu L of nanoparticle solution and 10 mu L (1 mg/mL) of fucoidan solution are adsorbed for 30min at room temperature, so that fucoidan is self-assembled to the outer layer of the magnetic core. The solution was centrifuged at 7000rpm for 10min, the supernatant was discarded, and the mixture was resuspended in sterile water to obtain fucoidan-conjugated magnetic nanoparticles (Fuc-NPs).

100 Mu L of Fuc-NPs solution is mixed with 20 mu L of 5-FU-miR-15a mimics (20 mu M) dissolved in sterile water, the two are adsorbed for 30min at room temperature, miRNA is adsorbed and assembled to a magnetic core, centrifugation is carried out at 7000rpm for 10min, supernatant is discarded, sterile water is used for resuspension,

FIG. 2 shows a simulated binding pattern of Fuc-5-FU-miR-15a NPs, and the finally obtained Fuc-5-FU-miR-15a NPs are stable magnetic nanoparticle systems.

2.2 Characterization of Fuc-5-FU-miR-15a NPs

The size distribution and Zeta potential of the micelles at 25 ℃ were analyzed using Dynamic Light Scattering (DLS) using Malvern Zetasizer nm ZS equipment (Malvern, UK) at scattered light detection angles of 90 and 15, respectively.

The morphology of the nanoparticles was analyzed by Transmission Electron Microscopy (TEM). The sample solution (10. Mu.L; 1 mg/mL) was dropped onto a copper grid plated with amorphous carbon and dried naturally in a desiccator. A1 wt% uranyl acetate aqueous solution was dropped on a copper grid to stain the sample for 1min. After blotting with filter paper, the samples were thoroughly dried in a desiccator and then observed by TEM. The samples were finally observed on a PHILIPS CM transmission electron microscope (Philips, netherlands).

Transmission electron microscopy revealed that the multifunctional gene vector was uniformly dispersed as round particles (FIG. 2).

FIG. 3 shows that the average particle diameter of the nanocarrier is 58nm and the Zeta potential is +38.6mV. PEI-magnetic iron oxide nanoparticles were mixed with fucoidan solution and self-assembled to form Fuc-NPs, where the particle size of the nanocomposite was about 72.3nm and the zeta potential was-17.7 mV. Finally, the nano-composite is compounded with 5-FU-miR-15a mimics to form Fuc-5-FU-miR-15a NPs, the particle size of the nano-composite is 143.6nm, and the Zeta potential is-33.1 mV. With gradual combination, the charge is gradually reduced, and the particle size is gradually increased, which indicates that the 5-FU modified miRNA-15a mimics and fucoidin are successfully combined to the nanometer ferromagnetic oxide core, and the Fuc-5-FU-miR-15a-NPs magnetic nanometer particle is successfully prepared.

Example 3 cellular uptake and targeting of Fuc-5-FU-miR-15a NPs

2.1 Cellular uptake of Fuc-5-FU-miR-15a NPs

2.1.1QRT-PCR method for detecting release of miR-15a

Three pancreatic cancer cells (sw 1990, ASPC-1, paca-mia-2) were seeded at a density of 1X10 ⁵/mL in 6-well plates and after 24 hours, the cancer cells were treated with Fuc-5-FU-miR-15a NPs for 6 hours. Total RNA was extracted using Trizol method. PRIMESCRIPT ^TM RT REAGENT KIT (Taraka, japan) was used for cDNA synthesis. Quantitative RT-PCR was performed using SYBR GREEN MASTER Mix and LIGHT CYCLER PCR detection system (ABI PRISM-7900). The 5' primer sequence of miR-15a is as follows: CGCCTAGCAGCACATAATGGTTTGTG,3 'end is the mRQ' universal sequence provided for the kit. U6 gene expression level was used as an internal reference. Relative miRNA levels were calculated according to the formula: ΔΔct= ΔCT _{Detecting a sample}-ΔCT_{control sample}. The change in gene expression was calculated using the 2 ^-ΔΔCT method.

2.1.2HPLC method for detecting the release of 5-FU

The HPLC method determines the amount of 5-FU released. Three pancreatic cancer cells were seeded at a density of 1x10 ⁵/mL in 6-well plates and 24 hours later, the cancer cells were treated with Fuc-5-FU-miR-15a NPs for 6 hours. The cells were collected, sonicated for 30min, and after centrifugation, the 5-FU content was measured using a CBM-L20 liquid chromatography system (Shimadzu, japan).

Specifically, a C18 reverse phase column, mobile phase, methanol: water = 10:90, the column temperature is 30 ℃, the sample injection amount is 20 mu L, and the detection wavelength is 265nm.

2.1.3 Detection of Fuc-5-FU-miR-15a NPs@Cy3 magnetic nanoparticles uptake in cells by laser confocal

Cy3 labeling is added during synthesis of 5-FU-miR-15a mimics, and Fuc-5-FU-miR-15a NPs@Cy3 magnetic nanoparticles are prepared. Fluorescent-labeled Fuc-5-FU-miR-15a nps@cy3 magnetic nanoparticles (5-FU-miR-15 a final concentration 50 nM) were incubated with ASPC-1 cells seeded on cell slide for 0 and 6 hours, washed 3 times with PBS, stained 10min with CELLMASK GREEN STAIN (cytoplasmic membrane green dye) at 37 ℃, and after 3 washes with PBS, DAPI stained nuclei for 10min at room temperature. The tablet was sealed and observed with a laser confocal microscope.

The gene expression analysis of FIG. 4 shows that Fuc-5-FU-miR-15a-NPs can be efficiently taken up by cells, miR-15a and 5-FU are released in the cells, and the effect of inhibiting cell growth is exerted.

FIG. 5 shows the accumulation of 5-FU-miR-15a@Cy3 in cells, indicating that Fuc-5-FU-miR-15a NPs can successfully deliver 5-FU-miR-15a into cells, and exert antitumor activity.

2.2 Expression of Fuc-5-FU-miR-15a NPs target Gene

The expression of Fuc-5-FU-miR-15a NPs target gene was verified by qRT-PCR. Three pancreatic cancer cells were seeded at a density of 1x10 ⁵/mL in 6-well plates and 24 hours later, the cancer cells were treated with DMEM containing Fuc-5-FU-miR-15a NPs for 24 hours. The cells were collected and total RNA was extracted. Experimental procedure reference example 2.1.1. Primer sequence YAP-1,5'-primer:CAGAACCGTTTCCCAGACTACCTTG,3'-primer:GCAGACTTGGCATCAGCTCCTC;BCL-2,5'-primerTCGCCCTGTGGATGACTGAGTAC,3'-primerACAGCCAGGAGAAATCAAACAGAGG;TS,5'-primerCTTCAGCGAGAACCCAGACCTTTC,3'-primerAGTTGGATGCGGATTGTACCCTTC.

Fuc-5-FU-miR-15a-NPs successfully released 5-FU-miR-15a into cells, and significantly reduced expression of target genes Bcl-2, yap-1 and TS (FIG. 6).

EXAMPLE 4 cytotoxic Effect of Fuc-5-FU-miR-15a NPs

3.1 Cytotoxic effects of Fuc-5-FU-miR-15a NPs

Cell viability was determined by the 3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich). Cells were seeded in 96-well plates (7×10 ³ cells/well), fuc-5-FU-miR-15a NPs nanoparticles were added after 12 hours, after 48 hours of incubation, 10 μl of MTT solution (5 mg/mL) was added to each well, and then cells were incubated at 37℃for another 4 hours. The medium was gently discarded, 150 μl DMSO was added per well to dissolve insoluble formazan, and the mixture was removed using a microplate reader (Tecan,Switzerland) absorbance at 570 nm.

FIG. 7 shows that Fuc-5-FU-miR-15a NPs significantly reduced cell viability in sw1990 and Mia-2 cells. And compared with the single use of 5-FU-miR-15a mimics, the preparation shows better activity of killing tumor cells.

Further, we compared the effect of Fuc-5-FU-miR-15a NPs on cell viability with the nanoparticles 5-FU-miR-15a NPs that did not carry fucoidan.

A Co-culture system of SW1990 cells and macrophages was constructed using a Transwell system (0.4 μm). 5X10 ⁴ Raw264.7 cells were seeded on the bottom of a 24-well plate cell culture dish. And macrophages were induced to a different phenotype according to the method of example 1. Fuc-5-FU-miR-15a NPs and 5-FU-miR-15a NPs are respectively added to the drug group to treat lower cells. 7000 SW1990 cells were inoculated into the upper layer of the Transwell chamber and co-cultured with macrophages for 48h. NPs and macrophages in the lower lumen release' cytokines that affect the survival of SW1990 cells in the upper lumen. SW1990 cells of the upper chamber were washed 3 times with PBS, fixed with 4% paraformaldehyde for 10min, stained with 0.2% crystal violet for 15min, and washed 3 times with PBS. Stained cells were photographed under an optical microscope (Leika) and quantified by Image J software.

Fucoidan-loaded nanoparticles (Fuc-5-FU-miR 15a NPs) exert better antitumor activity than 5-FU-miR15a NPs, presumably related to the loaded fucoidan promoting macrophage expression as a pro-inflammatory phenotype (fig. 8).

EXAMPLE 5 in vivo anti-tumor Activity study of Fuc-5-FU-miR-15a NPs

Male BALB/C mice, 6-8 weeks old, purchased from Peking Vitrelli laboratory animal Co., ltd, were raised at the SPF animal center. All animals were treated as recommended by the national academy of sciences, the institute of marine research, the laboratory animal care and use health guide. HCT116 cells in the logarithmic growth phase were taken and injected subcutaneously at 1X 10 ⁷ cells/mL to the upper side of the right limb of the mice in 100. Mu.L. When tumors grew to approximately 100mm ³, mice were randomly divided into CK group, 5-FU-miR-15a group, fuc-5-FU-miR-15a NPs group, CK group tail vein injection saline, 5-FU-miR-15a group tail vein injection 80. Mu.g of 5-FU-miR-15a mimics (in vivo-jetPEI pre-package), fuc-5-FU-miR-15a NPs group tail vein injection Fuc-5-FU-miR-15a NPs (80. Mu.g of 5-FU-miR-15a in NPs) and magnetite was placed at the tumor site. The injection was given once every 3 days for a total of 7 injections. The estimated tumor volume (V) is calculated according to the formula v=w ² ×l×0.5, where W represents the largest tumor diameter (cm) and L represents the second largest tumor diameter. After anesthesia, the serum of the mice was taken for biochemical analysis (Qingdao gold medical test center). Excised tumors were fixed in 4% paraformaldehyde for at least 24h, and then 4 μm paraffin sections were prepared. The fixed tumor tissue was used for immunohistochemical studies, and the remaining tumors were frozen at-80℃for future use.

Fuc-5-FU-miR-15a NPs significantly reduced tumor volume compared to the blank. Both 5-FU-miR-15a mimics and Fuc-5-FU-miR-15a NPs significantly reduced tumor weight, but the antitumor activity of Fuc-5-FU-miR-15a NPs was superior to JetPEI pre-packaged 5-FU-miR-15a mimics (fig. 9 a-b). Immunohistochemistry showed that Fuc-5-FU-miR-15a NPs significantly increased infiltration of M1 macrophages (increased CD86 expression, decreased CD206 expression) in tumor tissue compared to JetPEI pre-packaged 5-FU-miR-15a mimics due to the loading of fucoidan, improving the immunosuppressive tumor microenvironment, which may promote the antitumor activity of Fuc-5-FU-miR-15a NPs (fig. 9 c).

Supplemental content

The above embodiments are only for illustrating the technical solution of the present invention, and are not limiting; although the invention has been described in detail with reference to the foregoing embodiments, it will be apparent to one skilled in the art that modifications may be made to the technical solutions described in the foregoing embodiments, or equivalents may be substituted for some of the technical features thereof; such modifications and substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Claims

1. A multifunctional gene vector, characterized in that: the preparation method of the magnetic nano-particles combined with the fucoidin comprises the following steps of:

(1) Preparation of nano magnetic core

Uniformly mixing 10-15 mmol of anhydrous ferric chloride, 3-5 mmol of sodium hydroxide, 45-55 mL of ethylene glycol and 3.6 mL sterile water, transferring into a three-mouth bottle, heating to boil, keeping boiling reflux for 8-12 h, stopping the reaction, cooling to room temperature, magnetically separating and washing to obtain Fe ₃O₄ nano particles for later use;

Dispersing the Fe ₃O₄ nano-particles obtained in the step (1) in 50 mL ultrapure water, and adding sodium tripolyphosphate, wherein the mass ratio of the Fe ₃O₄ nano-particles to the sodium tripolyphosphate is 1:1 to 1:1.5, uniformly mixing, and reacting for 30-50 min at room temperature to obtain ferroferric oxide phosphate nano particles; magnetically separating the reacted ferroferric oxide phosphate nano particles and then redispersing the ferroferric oxide phosphate nano particles in ultrapure water; slowly adding the obtained solution into 50-80 mL of Polyethyleneimine (PEI) water solution with the concentration of 80-100 mg/L, stirring at room temperature for 20-30 min to uniformly mix, magnetically separating, and re-suspending into 100-120 mL sterile ultrapure water to obtain a Polyethyleneimine (PEI) coated magnetic ferric oxide nanoparticle solution;

(3) Self-assembly of fucoidan

And (3) mixing and adsorbing the nanoparticle solution obtained in the step (2) and the fucoidin solution at room temperature, centrifuging for 30~40 min,7000~8000 rpm min, removing the supernatant, and adding sterile ultrapure water for resuspension to obtain the fucoidin-combined magnetic nanoparticle (Fuc-NPs).

2. A multifunctional gene vector according to claim 1, characterized in that: the average particle diameter of the magnetic nanoparticles combined with fucoidan is 50-150 nm.

3. A method for preparing the multifunctional gene vector of claim 1, wherein the method for preparing the fucoidan-combined magnetic nanoparticle comprises the following steps:

(1) Preparation of nano magnetic core

(3) Self-assembly of fucoidan

4. A method of preparation according to claim 3, characterized in that: and (2) uniformly mixing 15 mmol anhydrous ferric chloride, 5 mmol sodium hydroxide, 50 mL glycol and 3.6 mL sterile water, transferring into a three-mouth bottle, heating to boil, then keeping boiling and refluxing for 8-12 h, stopping the reaction, cooling to room temperature, magnetically separating and washing to obtain Fe ₃O₄ nano particles for later use.

5. A method of preparation according to claim 3, characterized in that: the Fe ₃O₄ nano particles obtained in the step (1) are dispersed in 50mL ultrapure water, sodium tripolyphosphate is added, and the mass ratio of the Fe ₃O₄ nano particles to the sodium tripolyphosphate is 1:1.2, uniformly mixing, and reacting for 30-50 min at room temperature to obtain ferroferric oxide phosphate nano particles; magnetically separating the reacted ferroferric oxide phosphate nano particles and then redispersing the ferroferric oxide phosphate nano particles in ultrapure water; slowly adding the obtained solution into 50-80 mL of Polyethyleneimine (PEI) water solution with the concentration of 80-100 mg/L, stirring at room temperature for 20-30 min to uniformly mix, magnetically separating, and re-suspending into 100-120 mL sterile ultrapure water to obtain a Polyethyleneimine (PEI) coated magnetic ferric oxide nanoparticle solution.

6. A method of preparation according to claim 3, characterized in that: the molecular weight of the fucoidin ranges from 5 kDa to 130 kDa.

7. The method of manufacturing according to claim 6, wherein: the molecular weight of the fucoidin ranges from 80kDa to 130kDa.

8. A method of preparation according to claim 3, characterized in that: the method is characterized in that: the mass ratio of the nanoparticle solution to the fucoidin is 3: 1-1: 1.

9. The method of manufacturing according to claim 8, wherein: the method is characterized in that: the mass ratio of the nanoparticle solution to the fucoidin is 2:1.

10. Use of the multifunctional gene vector of claim 1 in the preparation of a medicament for delivering miRNA having anti-tumor activity.

11. Use according to claim 10, characterized in that: the binding method of miRNA and magnetic nano particles comprises the following steps:

Mixing fucoidan-combined magnetic nanoparticle (Fuc-NPs) solution and sterile water-dissolved miRNA (20 mu M), adsorbing the two at room temperature for 30-40 min, assembling the miRNA into a magnetic core, centrifuging 7000~8000 rpm,10~20min, discarding the supernatant, and re-suspending with sterile water to obtain the miRNA-loaded magnetic nanoparticle (Fuc-miRNA NPs).

12. Use according to claim 11, characterized in that:

Wherein, the volume ratio of Fuc-NPs solution to miRNA is 20: 1-10: 3.

13. Use according to claim 12, characterized in that:

Wherein, the volume ratio of Fuc-NPs solution to miRNA is 10:1.

14. A complex obtained by loading the multifunctional gene vector of claim 10 with an anti-tumor active miRNA molecule.

15. Use of the complex of claim 12 in the manufacture of a medicament or formulation for the prevention or anti-neoplastic disease.