CN111888279A

CN111888279A - Method for promoting collagen production and corresponding medicine or cosmetic

Info

Publication number: CN111888279A
Application number: CN202010911602.8A
Authority: CN
Inventors: 王阳; 汪晓明
Original assignee: Beijing Hanmei Biotechnology Co ltd
Current assignee: Beijing Daxi Biotechnology Co., Ltd; Nuosa Union (Beijing) Biomedical Technology Co.,Ltd.
Priority date: 2020-09-02
Filing date: 2020-09-02
Publication date: 2020-11-06
Anticipated expiration: 2040-09-02
Also published as: CN111888279B

Abstract

The invention relates to a method for promoting collagen production and a corresponding medicine or cosmetic. The polypeptide capable of specifically enhancing collagen expression is obtained by screening a polypeptide library when skin fibroblasts are researched, the expression of C0L1A1 gene and Col2al gene can be enhanced by the polypeptide to enhance the expression of collagen and the secretion synthesis of hyaluronic acid, and the polypeptide has good functions of enhancing collagen synthesis and anti-wrinkle in a mouse model through verification, simultaneously enhances the moisturizing function of skin, and has good application prospect.

Description

Method for promoting collagen production and corresponding medicine or cosmetic

Technical Field

The invention relates to the field of biological medicines, in particular to a method for promoting collagen production and a corresponding medicine or cosmetic.

Background

Collagen is a type of extracellular matrix protein, is the major protein component of connective tissues, and plays an important role in maintaining the structural integrity of various tissues. Collagen has unique structure and strong tissue distribution specificity, is directly related to the functions of some organs and is also related to the aging process. Due to the good biocompatibility and wide physiological functions of collagen, unique fibrous structure, good biocompatibility and low antigenicity, collagen becomes a popular research topic in the fields of high-grade cosmetics, functional health products and biomedical materials. The collagen can effectively improve the structure of the epidermis and the dermis of the skin and promote the synthesis of the collagen in the skin.

The application of collagen in cosmetics mainly relates to 5 characteristics of collagen. (1) Is nutritious. Can supplement nutrients required by the skin layer, 17 amino acids beneficial to human body, increase collagen activity in the skin, maintain the integrity of stratum corneum water and fiber structure, improve the living environment of skin cells, promote the metabolism of skin tissues, enhance circulation, and achieve the purposes of moistening skin, delaying aging, caring skin, removing wrinkle, and nourishing hair. (2) And (4) repairing property. The collagen has unique repairing function, and the affinity between the collagen and the surrounding tissues is good, so that the collagen has the function of repairing the tissues. (3) Moisture retention. The natural moisturizing factor is an important substance for keeping skin moisture, and the main components of the natural moisturizing factor are free amino acids such as glycine, hydroxyproline, alanine, aspartic acid and serine. In the hydrolyzed collagen product, the contents of glycine, alanine, aspartic acid and serine are all rich, and the mass fractions of the glycine, the alanine, the aspartic acid and the serine respectively reach about 20-23%, 10-12%, 4% and 3%. In addition, a large amount of carboxyl, hydroxyl and the like of hydrophilic groups on the outer sides of collagen molecules enable the collagen molecules to easily form hydrogen bonds with water, so that the collagen and the polypeptide have good water retention and moisture retention performances. At a relative humidity of 70%, the collagen and the hydrolysate thereof can still keep moisture of 45% of the own mass, and when the collagen added in the cosmetic reaches a certain amount, the collagen can supply the overall moisture required by the skin. (4) Compatibility of medicines. The collagen can regulate and stabilize pH, stabilize foam, and emulsify colloid, and can be used as a functional component in cosmetic to relieve the damage of various irritative substances such as surfactant, acid, and alkali to hair and skin. (5) Affinity. Collagen has a high affinity for protein molecules on the surface of skin and hair, and is bound to skin and hair mainly by physical adsorption, and is resistant to rinsing treatment. The affinity action is enhanced along with the increase of the relative molecular mass, and the molecules with larger relative molecular mass have more binding positions, enhanced binding force and increased affinity. These molecules can penetrate into the epidermis and hair of the skin, even the cortex, and thus nourish the skin.

At present, the preparation method of collagen mainly comprises various ways such as an acid method, an oxidation method, an enzyme method, a mixing method and the like. There are of course other ways of improving. CN108066272A discloses a royal jelly extract for promoting collagen synthesis, its extraction method and application. The extraction method comprises the steps of leaching, dissolving, pH adjustment and the like. The royal jelly extract has high absorption and utilization rate in skin, and can directly reach dermis layer to activate collagen synthesis. In the application of skin care products and the like, has the advantages of convenient addition, small dosage and obvious effect. However, the method has high requirements on raw materials and high cost, and is not suitable for large-scale popularization and application. CN105213230A discloses a method for promoting collagen regeneration based on invisible light and enzyme inhibitors, comprising the following steps: cleaning skin around eyes with warm water, and uniformly smearing a layer of anti-wrinkle essence after wiping to dry; adjusting an eye protection film in the eye mask, then wearing the eye mask, opening the eye mask and selecting nursing time; the eye mask consists of 252 light emitting diodes with 660 nm wavelength, and emits invisible light with total energy output lower than 10 milliwatts per square centimeter according to a specific program and specific intensity; after any key of 5 minutes, 10 minutes or 20 minutes is pressed, the corresponding blue lamp is lighted up to enter a countdown working state; and after the timing is finished, closing the eye shield and stopping working. The invention perfectly combines invisible light, enzyme inhibitor and collagen regeneration micromolecule, promotes the regeneration of collagen, can greatly reduce eye bags in a short time, obviously relieves eye wrinkles, obviously improves black eye circles, and can be used for a long time. However, this method requires special equipment and is inconvenient to use.

The invention overcomes the defects of the prior art and provides a method for promoting the increase of collagen, which is suitable for large-scale popularization and application.

Disclosure of Invention

The invention provides a peptide capable of promoting high yield of collagen of skin cells in the aspect of the invention, and the sequence of the JYDB-5 polypeptide is shown as SEQ ID NO: 1 is shown.

More specifically, the peptide of the present invention is used to enhance the expression of collagen and the secretory synthesis of hyaluronic acid by enhancing the expression of C0L1a1 gene and Col2al gene of fibroblasts of human skin.

Furthermore, the invention provides a cosmetic for enhancing collagen secretion, which contains JYDB-5 polypeptide, wherein the sequence of the JYDB-5 polypeptide is SEQ ID NO: 1 is shown.

Further, the invention provides a pharmaceutical composition for enhancing collagen secretion, wherein the composition comprises a JYDB-5 polypeptide, the sequence of which is SEQ ID NO: 1 is shown.

In order to increase the resistance to degradation, it is necessary to use the peptides of the invention in protected form. By using R of acyl type₁Substituted by a radical (R-CO-) (wherein the R radical is saturated or unsaturated C₁To C₃₀Hydrocarbyl chain), preferably of methyl type₁The primary amine function of the N-terminal amino acid can be protected by a group or by substitution with an aryl group of the benzoyl, tosyl or benzyloxycarbonyl type.

The sequence of SEQ ID NO: 1 of the present invention.

The peptides of the invention can be obtained by typical chemical synthesis (homogeneous in solid or liquid phase) or by enzymatic synthesis from the constituent amino acids.

The peptides of the invention may be of natural or synthetic origin. Preferably, according to the invention, the peptide is of synthetic origin, obtained by chemical synthesis.

According to the invention, the active substance may be a mixture of peptides with others known in the art.

The peptides of the invention are advantageously dissolved in one or more physiologically suitable solvents, such as water, glycerol, ethanol, propylene glycol, butylene glycol, dipropylene glycol, ethoxylated or propoxylated diethylene glycol, cyclic polyols or any mixtures of these solvents.

The cosmetic products provided by the present invention are further possible, in a non-limiting manner, by reference to the following component classes: rejuvenating, anti-aging, anti-wrinkle, moisturizing, anti-free radical, anti-glycation, hydrating, anti-bacterial, anti-fungal, keratolytic, muscle relaxing, exfoliating and firming agents.

Further, all these compositions additionally comprise any additives normally used in the intended field of application, as well as the adjuvants required for their formulation, such as cosolvents (ethanol, glycerol, benzyl alcohol, humectants), thickeners, diluents, emulsifiers, antioxidants, colorants, sun screens, pigments, fillers, preservatives, fragrances, odor absorbers, essential oils, trace elements, essential fatty acids, surfactants, film-forming polymers, chemical or mineral filters, hydrating agents or hot water, etc.

Drawings

FIG. 1 Effect of JYDB-5 Polypeptides on hyaluronic acid secretion from human Normal fibroblasts

FIG. 2 expression results of JYDB-5 polypeptide on C0L1A1 gene and Col2al gene

Advantageous effects

The polypeptide capable of specifically enhancing collagen expression is obtained by screening a polypeptide library when skin fibroblasts are researched, the expression of C0L1A1 gene and Col2al gene can be enhanced by the polypeptide to enhance the expression of collagen and the secretion synthesis of hyaluronic acid, and the polypeptide has good functions of enhancing collagen synthesis and anti-wrinkle in a mouse model through verification, simultaneously enhances the moisturizing function of skin, and has good application prospect.

Detailed Description

The present invention is described in detail below by way of examples, it should be noted that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention, and those skilled in the art can make some insubstantial modifications and adaptations of the present invention based on the above-described disclosure.

EXAMPLE 1 Effect of the Polypeptides on the proliferation of human Normal fibroblasts

Human skin fibroblasts were cultured in MEM medium (containing 5% fetal calf serum) in the presence of 5% CO₂Humidity 95%, and culturing in a carbon dioxide incubator at constant temperature of 37 ℃. Cells were seeded in 96-well plates at 1X 103 cells per well.After the cells are attached, 10 μ L of 1, 10 and 100 μ g/mLJYDB-5 polypeptide solution is added into each group, and PBS buffer solution with the same volume is added to serve as a blank control group. After adding the polypeptide solution, the cells were cultured for 72 hours, the 96-well plate was taken out of the incubator, 10. mu.L of the WST-8 solution was added to each well, and CO was again returned₂And (5) incubating in an incubator to perform color reaction. After 4h, the sample was taken out and the OD was measured at 450 nm. The results are shown in Table 1.

TABLE 1 Effect of polypeptides on human skin fibroblast proliferation

Group of	OD
		Blank group (PBS)	0.281±0.031
JYDB-5(1μg/mL)	0.723±0.045*
		JYDB-5(10μg/mL)	0.889±0.052*
JYDB-5(100μg/mL)	0.816±0.044*

Compared to the blank control group, indicates a very significant difference p < 0.01.

The result is shown in table l, the proliferation activity of the human skin fibroblasts is obviously stronger than that of the blank control group, which indicates that the polypeptide has stronger promotion effect on the proliferation activity of the human skin fibroblasts cultured in vitro.

Example 2 Effect of JYDB-5 Polypeptides on hyaluronic acid secretion from human Normal fibroblasts

Taking 96-well plate, and dividing each well into 1 × 10³Cells were seeded and the medium was changed every 3 days. After the cells were attached, 10. mu.L of 100. mu.g/mL solution was added to each group, and the same volume of PBS buffer was added as a blank. After 7d of culture, the amount of hyaluronic acid secretion was determined according to the kit instructions. The results are shown in FIG. 1.

The result is shown in fig. 1, the hyaluronic acid secretion of the polypeptide group reaches 162.8 ± 5.5, which is obviously higher than that of the blank group, and has significant difference (P <0.05), which indicates that the polypeptide has significant influence on the hyaluronic acid secretion of the human skin fibroblasts cultured in vitro.

EXAMPLE 3 Effect of the Polypeptides on collagen Gene expression

Taking 96-well plate, and dividing each well into 1 × 10³Cells were seeded and the medium was changed every 3 days. After the cells were attached, 10. mu.L of 100. mu.g/mL solution was added to each group, and the same volume of PBS buffer was added as a blank. After 7 days of incubation, total RNA was extracted using Trizol reagent. Adding 20% (v/v) chloroform solution, vortexing for 30S, standing at room temperature for 10min, and centrifuging at 4 deg.C (12000r/min, 10 min). The upper aqueous phase (400-500. mu.L) was aspirated and transferred to a new centrifuge tube, and an equal amount of isopropanol was added. Gently mixing, standing at 4 deg.C for 10min, and centrifuging at 4 deg.C again (12000r/min, 10 min). Washing the sediment with a mixture of 75% (v/v) ethanol and 25% (v/v) ribozyme-free water twice, centrifuging under the same conditions again, extracting total RNA, and adding 20. mu.L ribozyme-free water to dissolve the total RNA extract. cDNA was synthesized by reverse transcription according to the instructions of Easy Script One-Step DNA Removal and cDNA synthesis super Mix kit. Reverse transcription system conditions: 30S at 94 ℃; 10s at 60 ℃; at 70 ℃ for 15S. RT-PCR was performed according to the instructions of the qualitative RT-PCR with a Green PCRMaster Mix kit. The corresponding specific primers for each cDNA are listed in Table 1. The fluorescent quantitative RT-PCR primer comprises beta-actin, C0L1A1 and Co12 al. Beta-actin is used as an internal reference primer. The PCR condition of the cDNA sample is 94 ℃ for 10 s; 30s at 94 ℃; 20S at 60 ℃; 10S at 72 ℃ for a total of 40 cycles. All fluorescent quantitative RT-PCR was performed in PCR system 7900 (ABI). By using

And (4) analyzing the experimental result by a method. The specific primer is beta-actin-F: ACTCTTCCAGCCTTCCTTCCT, beta-actin-R: TCACCTTCACCGTTCCAGTTT, respectively; col2al (collagen, type II alpha 1-F): CTCAAGTCGCTGAACAACCA, respectively; col2al (collagen, type II alpha 1-R): GTCTCCGCTCTTCCACTCTG are provided. C0L1A 1F: ACAGAGGCATAAAGGGTCA, C0L1A1R: CAAGGTCACGGTCACGAA. As shown in FIG. 2, the JYDB-5 polypeptide can remarkably promote the expression of the C0L1A1 gene and slightly weakly promote the expression of the Col2al gene.

Example 4 Effect of JYDB-5 Polypeptides on collagen Synthesis in mouse skin

Taking 50 healthy male mice, and randomly dividing the mice into a normal group, a model group and a polypeptide administration group (125 mg/kg); the normal group and the model group were given equal volume of CMC-Na; the administration simultaneous model group and each administration group are injected with 0.25mL/10g of 5 percent D-galactose subcutaneously; normal group injected equal volume of saline subcutaneously; continuously carrying out 6 weeks, carrying out intragastric administration for 1D and injecting D-galactose for 2h, killing the mice, taking the back skin of the mice, unhairing with 8% sodium sulfide, degreasing for 24h with degreasing solution (chloroform: ethanol ═ 2: 1), taking out, cleaning, carrying out vacuum drying, taking a small amount of the samples, putting the small amount of the samples into a test tube, adding 6mol/L hydrochloric acid into each sample for hydrolysis, and measuring the content of Hydroxyproline (HYP) by adopting a spectrophotometry method. The results of collagen content in mouse skin are shown in table 2.

TABLE 2 Effect of JYDB-5 Polypeptides on collagen Synthesis in mouse skin

Group of	Collagen content in skin (%)
		Normal control group (PBS)	63.8±4.4
Model set (PBS)	57.9±3.9#
		JYDB-5 polypeptide group	71.3±4.3*

# shows that the model group has a very significant difference compared with the control group, and P is less than 0.01; indicates that the polypeptide group is significantly different from the model group, P < 0.05.

As can be seen from Table 2, the model group has very significant differences compared with the normal group, which indicates that the model of skin aging of mice caused by D-galactose shows collagen loss. Compared with the model group, the polypeptide administration group has great difference, which indicates that the polypeptide can effectively relieve the loss of skin collagen caused by aging and promote the synthesis of collagen in dermis.

Example 5 Effect of reducing skin wrinkles in photoaging model mice

The mice are divided into 1 experimental group, 1 positive control group and 1 model group, each group contains 10 mice, for the experimental group, the skin of the mice is coated with polypeptide, the administration dose is prepared into aqueous solution according to 125mg/kg, the positive control group is applied with the same amount of ethanol aqueous solution (the volume ratio of ethanol to water is 5: 95), and the blank group and the model group are only applied with distilled water without active ingredients. The experimental protocol was as follows, and the extent of inhibition of wrinkle formation was examined by irradiating depilated mice with simulated sunlight at a dose of 2MED (2 times the minimum dose that causes redness of the skin) for 10 weeks for 5 days per week, while applying each active ingredient or solvent to the skin daily. The area to which the compound was applied was visually inspected with the naked eye and photographed. The degree of inhibition of wrinkle production was classified into 4 grades, i.e., ineffective (score 0), mild (score 1), moderate (score 2), and potent (score 3), and the compound-treated group and the model group were compared. The experimental data are tabulated in table 3.

TABLE 3 Effect of reducing skin wrinkles in photoaged mice

As can be seen from the results of Table 3, the polypeptide active ingredient of the present invention has a significant wrinkle-reducing effect as compared with the model group.

Example 6 improvement of skin moisture content

30 women aged more than 30 and 30 women aged more than 40 were divided into two groups, 20 persons in each group, and the polypeptide was added to moisturizing water in an amount of 10mg/mL as a comparative example, and they were asked to apply the preparation on the face twice a day in the morning and evening for 12 weeks. Then, the skin moisture content was measured using a skin moisture meter (Germany). The results are given in table 4.

TABLE 4 skin moisture measurement results

Grouping	0 week	For 12 weeks
			Comparative example	20±3	22±4
Experimental group	21±5	34±5

The results in table 4 show that the polypeptide of the present invention can significantly improve the water content of the skin, and has a good effect.

Example 7 safety evaluation results

The safety of the samples against human skin was observed by the human trial test of example 6, and upon return visit, the subjects were carefully asked, examined and recorded for any adverse events that occurred during their use of the samples, including the manifestation, timing, handling and outcome of the adverse events, and a determination was made as to the relationship of the adverse events to the samples used. The results show that 60 subjects do not have any adverse skin reactions after 12-week human trial test research, refer to the classification standard of the adverse skin reactions of human trial tests specified in 2015 edition cosmetic safety technical Specification, and the test samples of the evaluation experimental group and the control group have good safety.

Sequence listing

<110> Beijing Vast Mei Biotechnology Ltd

<120> a method for promoting collagen production and corresponding pharmaceutical or cosmetic

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>26

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Ser Trp Phe Val Ala Met Ser Val Gln Tyr Glu Arg Ser Arg Cys Trp

1 5 10 15

Trp Asp Met Ile Phe Tyr Trp Ala Arg Arg

20 25

Claims

1. A cosmetic for enhancing skin collagen secretion, which contains JYDB-5 polypeptide, wherein the amino acid sequence of the polypeptide is SEQ ID NO: 1 is shown.

2. A composition for enhancing skin collagen secretion, the composition comprising a JYDB-5 polypeptide having an amino acid sequence of SEQ ID NO: 1 is shown.

3. The amino acid sequence is SEQ ID NO: 1 in the preparation of cosmetics for enhancing skin collagen secretion.

4. Use according to claim 4, characterized in that the peptide is used to enhance the expression of collagen and the secretory synthesis of hyaluronic acid by the expression of the C0L1A1 gene and the Col2al gene of fibroblasts of the human skin.

5. Use according to claim 4 or 5, characterized in that: at the N-terminus or C-terminus or at both termini to the sequence SEQ ID NO: 1.

6. Use according to claim 6, characterized in that the peptide is advantageously dissolved in one or more physiologically suitable solvents, such as water, glycerol, ethanol, propylene glycol, butylene glycol, ethoxylated or propoxylated diethylene glycol, cyclic polyols or any mixture of these solvents.

7. The JYDB-5 polypeptide capable of promoting high yield of collagen of skin cells is characterized in that the amino acid sequence is shown as SEQ ID NO: 1 is shown.