CN111850065B

CN111850065B - Method for assisting whole-cell transformation to synthesize L-asparagine

Info

Publication number: CN111850065B
Application number: CN202010746696.8A
Authority: CN
Inventors: 罗玮; 许景龙
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2020-07-29
Filing date: 2020-07-29
Publication date: 2022-05-03
Anticipated expiration: 2040-07-29
Also published as: CN111850065A

Abstract

The invention discloses a method for assisting whole cell transformation to synthesize L-asparagine, which utilizes class III polyphosphate kinase 2 to construct a system for converting AMP into ATP by using a single enzyme, and applies the system to biosynthesis of L-asparagine. Expressing class III PPK2 from Deinococcus ficus in Escherichia coli Rosetta (DE3), the enzyme activity is 13.19 U.mL^‑1. E.coli RosettA (DE3)/pET21A-DfiPPK 2-III and B.subtilis WB600/pMA5-LsaAS-A whole cells are used as catalysts to catalyze L-Asp to synthesize L-Asn, and reaction conditions are optimized. The result shows that the wet cells of the two recombinant bacteria have the final concentration of 60 mmol.L through feeding twice under the optimal reaction condition^‑1The yield of the sodium hexametaphosphate, L-Asn, reaches 90.15 percent, which is more than that of the sodium hexametaphosphate added with 180 mmol.L directly^‑1The content of sodium hexametaphosphate is 80 percent higher.

Description

Method for assisting whole-cell transformation to synthesize L-asparagine

Technical Field

The invention relates to a method for assisting whole cell transformation to synthesize L-asparagine, belonging to the technical field of biotransformation.

Background

L-asparagine is also known as 2-amino-3-carbamoylpropionic acid. It is white orthorhombic crystal or crystalline powder, slightly sweet, and has melting point of about 234 deg.C. It is soluble in water, and almost insoluble in ethanol and diethyl ether, and the aqueous solution is acidic. Can be hydrolyzed into aspartic acid by alkali. The aqueous solution is easily decomposed by heating. The aspartic acid has applications in food, medical, chemical and biological fields

The preparation method of asparagine includes direct extraction method, chemical synthesis method and biological synthesis method. The direct extraction method mainly uses white lupin as main material, and after the processes of germination, pulping, heating and the like, the first-step crude product is obtained by filtering and centrifuging through diatomite under the condition that the pH value is not more than 6. Then the final finished product is obtained through concentration and crystallization. The direct extraction method is greatly influenced by the quality of raw materials, has a complex process, is not easy to control, and can cause serious pollution. The chemical synthesis method is mainly characterized in that ammonia water and L-aspartic acid are used as raw materials to carry out amidation reaction to generate L-asparagine, and the hydroxyl on the L-aspartic acid is replaced by amino. The method has the advantages of multiple side reactions, difficult downstream extraction and serious pollution. Biosynthesis is mainly based on the transamination of glutamine catalyzed by asparagine synthetase, requiring the involvement of ATP. The method has simple production process and equipment and high production efficiency, but the ATP is needed to participate in the conversion process, but the ATP is expensive, the cost is overhigh, the property is unstable, and byproducts (AMP or ADP) are accumulated in the synthesis process, so that the difficulty of separating and purifying the product is increased, and the product inhibition is possibly caused.

In the prior art, synthesis of L-asparagine by regenerating ATP through the glycolytic pathway by adding glucose to a reaction system in which only whole-cell synthesis expressing asparagine synthetase A is added was attempted, but it was not successful.

Disclosure of Invention

In order to solve the technical problems, the invention constructs the recombinant gene engineering bacteria for expressing class III polyphosphate kinase 2, and the recombinant gene engineering bacteria for producing the L-asparagine synthetase are coupled to react to regenerate ATP, and the biotransformation from L-aspartic acid to L-asparagine can be realized only by adding a small amount of ATP and substrate in the reaction solution, thereby greatly reducing the cost of biosynthesis.

The first purpose of the invention is to provide a method for assisting whole-cell transformation and synthesis of L-asparagine, which adopts a coupling reaction of a recombinant bacterium for expressing class III polyphosphate kinase 2 and a recombinant bacterium for expressing L-asparagine synthetase to catalyze the transformation of L-aspartic acid into L-asparagine.

Further, the recombinant bacterium for expressing class III polyphosphate kinase 2 is a class III polyphosphate kinase 2 with a nucleotide sequence shown in SEQ ID NO.1, which is overexpressed in an escherichia coli host.

Further, the E.coli host is Escherichia coli Rosetta (DE 3).

Furthermore, the recombinant bacteria for expressing class III polyphosphate kinase 2 takes pET21a as an expression vector.

Furthermore, the recombinant strain for expressing the L-asparagine synthetase is B.subtilis WB600/pMA 5-LsaAS-A. The construction method refers to the method of gene mining and enzymology property research of asparagine synthetase in Chinese scientific and technological thesis on line.

Furthermore, in the coupling reaction, the reaction system is 0.1-0.5 mol.L^-1L-Asp、0.1-0.8mol·L^-1NH₄Cl、1-10mmol·L^-1ATP、100-250mmol·L^-1MgCl₂、5-150mmol·L^-1Sodium hexametaphosphate, 0.5-1.5 percent triton X-100, 0.05-0.15 mol.L^-1Tris-HCl。

Further, the sodium hexametaphosphate was added to the reaction system by two feeding.

Further, the reaction temperature of the coupling reaction is 35-45 ℃, and the rotation speed is 250-250 rpm.

Furthermore, the ratio of the recombinant bacteria for expressing class III polyphosphate kinase 2 to the recombinant bacteria for expressing L-asparagine synthetase is 0.5-1.5: 1.

In the coupling reaction, the concentration of the recombinant bacteria for expressing class III polyphosphate kinase 2 is 8-12 OD 600.

In the invention, III-class polyphosphate kinase 2 catalyzes AMP to generate ADP by utilizing polyphosphate single enzyme, and the regeneration of AMP to ATP can be realized by only adding single enzyme, cheap and easily obtained substrate polyphosphate and metal ions. Asparagine synthetase synthesizes asparagine and ATP removes two phosphate groups to generate AMP, so that a large amount of product can be synthesized by using an ATP regeneration system based on class III PPK2 with the addition of only a small amount of ATP.

The invention has the beneficial effects that:

the invention constructs recombinant gene engineering bacteria for expressing class III polyphosphate kinase 2, and the recombinant gene engineering bacteria and recombinant bacteria for producing L-asparagine synthetase are coupled to react to regenerate ATP, and only a small amount of ATP and substrate are added into reaction liquid to realize high-efficiency biotransformation from L-aspartic acid to L-asparagine, thereby greatly reducing the cost of biosynthesis.

The invention utilizes OD₆₀₀Under the optimal reaction condition, the wet cells of two recombinant bacteria of which both are 10 have the final concentration of 60 mmol.L through two times of feeding^-1In the case of sodium hexametaphosphate, the L-Asn yield reached 90.15%, which is larger than the case of adding 180 mmol. L directly^-1The content of sodium hexametaphosphate is 80 percent higher.

Drawings

FIG. 1 is A schematic diagram showing the mechanism of the catalysis of L-aspartic acid by AS-A and PPK2s to produce L-asparagine;

FIG. 2 is an electrophoretogram showing the expression of class III PPK2 in different hosts; m: marker; 1: rosettagamab (DE3)/pET21a-Dfippk2_s；2：Rosetta(DE3)/pET21a-Dfippk2_s；3：BL21(DE3)/pET21a-Dfippk2_s；

FIG. 3 is a graph showing the trend of substrate conversion and product synthesis over time at an initial concentration of 0.1mM L-aspartic acid.

Detailed Description

The present invention is further described below in conjunction with the following figures and specific examples so that those skilled in the art may better understand the present invention and practice it, but the examples are not intended to limit the present invention.

Example 1: construction of Escherichia coli Rosetta (DE3)/pET21a-DfiPPK2s genetically engineered bacterium

The Deinococcus ficus genome is extracted by using a kit, and by taking the Deinococcus ficus genome as a template, a DfiPPK2s gene is amplified by PCR by using a primer PPK2s-F (SEQ ID NO.2) (ACAGCAAATGGGTCGGGATCCATGAAAACCGACCGGTACCG, carrying BamHI enzyme cutting sites) and a primer PPK2s-R (SEQ ID NO.3) (TGGTGGTGCTCGAGTGCGGCCGCGATGCGGACTTCCTTGGGG, carrying Not I enzyme cutting sites). Connecting the amplified gene with a pET21a vector, transforming the constructed recombinant plasmid into E.coli BL21(DE3), E.coli Rosetta (DE3) and E.coli RosettamiB (DE3), selecting transformants, identifying positive bacteria, obtaining recombinant bacteria capable of expressing DfiPPK2s, comparing the influence of different hosts on gene expression, and taking the E.coli Rosetta (DE3) as a host to promote the expression of the DfiPPK2s gene as shown in figure 2.

Example 2: fermentation of Escherichia coli Rosetta (DE3)/pET21a-Dfi-PPK2s

Escherichia coli Rosetta (DE3)/pET21a-Dfi-PPK2s was inoculated into LB medium (LB/Amp-Chl) supplemented with ampicillin and chloramphenicol at 37 ℃ overnight in 200rmp, and 2% was inoculated into TB/Amp and cultured to OD₆₀₀0.6, 0.1mM IPTG 16 ℃ was added and cultured at 200rmp for 24 hours.

Example 3: conditions for producing L-aspartic acid by catalyzing L-aspartic acid through whole cells

At 5mL0.1 mol.L is added into the reaction system^-1Tris-HCl(pH 8.0)，0.1mol·L^-1L-Asp、0.4mol·L^-1NH₄Cl、6mmol·L^-1ATP、200mmol·L^-1MgCl₂、60mmol·L^-1Sodium hexametaphosphate, 1% Triton X-100, OD₆₀₀10 recombinant bacteriA expressing asparagine synthetase B.subtilis WB600/pMA5-LsaAS-A and OD ₆₀₀10 recombinant bacteria expressing class III polyphosphate kinase obtained by fermentation in example 2, the reaction was started with ATP addition at 40 ℃ and 180rpm during which 60 mmol. multidot.L was fed twice in 4h and 8h^-1And (3) reacting the sodium hexametaphosphate for 12 hours, and then carrying out boiling water bath for 5min to terminate the reaction.

Wherein, the recombinant bacteriA B.subtilis WB600/pMA5-LsaAS-A for expressing the asparagine synthetase are previously constructed and deposited in laboratories and are published on line in Chinese scientific and technical papers of asparagine synthetase Gene mining and enzymology Property research.

Coupling reaction of Escherichia coli Rosetta (DE3)/pET21a-Dfi-PPK2s and recombinant bacteria expressing asparagine synthetase is adopted, sodium hexametaphosphate is fed twice under the optimal reaction condition, and the result is shown in figure 3, wherein the yield reaches 90.15%.

Comparative example 1:

the recombinant plasmid constructed in the embodiment 1 is transformed into recombinant bacteriA B.s utilis WB600/pMA5-LsaAS-A for expressing the asparaginase, transformants are picked, positive bacteriA are identified, recombinant bacteriA capable of expressing D fiPPK2s and asparaginase are obtained, the obtained recombinant bacteriA are adopted to catalyze L-aspartic acid to produce the L-aspartic acid in the transformation system of the embodiment 3 under the same reaction conditions, but the transformation rate is lower and only reaches 32%.

Comparative example 2:

0.1 mol. L was added to 5mL of the reaction system^-1Tris-HCl(pH 8.0)，0.1mol·L^-1L-Asp、0.4mol·L^-1NH₄Cl、6mmol·L^-1ATP、200mmol·L^-1MgCl₂、180mmol·L^-1Sodium hexametaphosphate, 1% Triton X-100, OD ₆₀₀10 recombinant strain B.subtilis WB600/pMA5 for expressing asparagine synthetase-LsaAS-A and OD ₆₀₀10, the recombinant bacteria expressing class III polyphosphate kinase obtained by fermentation in example 2 are reacted for 12 hours from the beginning of adding ATP at the reaction temperature of 40 ℃ and the rotation speed of 180rpm in a boiling water bath for 5 min. The result is a low conversion of only 50%.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Sequence listing

<110> university of south of the Yangtze river

<120> method for synthesizing L-asparagine by assisting whole cell transformation

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 795

<212> DNA

<213> (Artificial sequence)

<400> 1

atgaaaaccg accggtaccg cgtgaaacct ggcaagaagg tccagctggg ggcctggaac 60

acggacgacg atggcgggct caccaaggag gacgcgccgg ccctgggcgc ccggctcagc 120

gaggaacttg ccgaatggca ggagcgcctg ttcgccgagg gcaagcaggc gctcctgatc 180

gtcctgcagg cccgggacgc cggaggaaag gacggtgtgg tgaaaaaggt gatcggggat 240

ttcaatccga acggggtgcg catcgcgaac ttcaaggttc cgaccgagga ggaggctgcg 300

cacgacttcc tgtggcgcat tcacgcgcag gtgccgcgca agggcatggt gggggtgttc 360

aaccgcagcc actacgagga cgtgctggtc acccgggtgt acggcatgat cgacaggaaa 420

ggggccaagg cccgcctgga gcacatccgg aacttcgagg cgctgctggc gggcaccggt 480

acccgcatcc tcaagttcta cctgcacgtc agcccggagg aacagaagga acgactccag 540

gcacgcctgg acgagccggg caagcactgg aagttcaacc ccggcgacct caaggaccgg 600

gagcactggg acgagttcac ggcggcctac gaggaagccc tgacgaccag tacggacgat 660

gcgccctggt acgtgatccc ggcggaccgg aaatggtatc gggatctggt gatcggtcag 720

atcatcttgg acacgctgcg agatatgaat cctcagtacc cgagcatcga ctttgacccc 780

aaggaagtcc gcatc 795

<210> 2

<211> 41

<212> DNA

<213> (Artificial sequence)

<400> 2

acagcaaatg ggtcgggatc catgaaaacc gaccggtacc g 41

<210> 3

<211> 42

<212> DNA

<213> (Artificial sequence)

<400> 3

tggtggtgct cgagtgcggc cgcgatgcgg acttccttgg gg 42

Claims

1. A method for assisting whole cell transformation to synthesize L-asparagine is characterized in that a recombinant bacterium for expressing class III polyphosphate kinase 2 and a recombinant bacterium for expressing L-asparagine synthetase are adopted for coupling reaction to catalyze L-aspartic acid to be converted into L-asparagine;

the recombinant bacteria for expressing the class III polyphosphate kinase 2 is the class III polyphosphate kinase 2 with the over-expression nucleotide sequence shown as SEQ ID NO.1 in an escherichia coli host;

in the coupling reaction, the reaction system is 0.1-0.5 mol.L-1L-Asp, 0.1-0.8 mol.L-1 NH 4 Cl, 1-10 mmol.L-1 ATP, 100-250 mmol.L-1 MgCl 2, 5-150 mmol.L-1 sodium hexametaphosphate, 0.5-1.5% Triton X-100 and 0.05-0.15 mol.L-1 Tris-HCl.

2. The method of claim 1, wherein the E.coli host is Escherichia coli Rosetta (DE 3).

3. The method as claimed in claim 1, wherein the recombinant bacterium for expressing class III polyphosphate kinase 2 is pET21a as an expression vector.

4. The method according to claim 1, wherein the recombinant bacterium expressing L-asparagine synthetase is recombinant bacterium B.subtilis WB600/pMA 5-LsaAS-A.

5. The method as claimed in claim 1, wherein the sodium hexametaphosphate is added to the reaction system by two feeding operations.

6. The method as claimed in claim 1, wherein the coupling reaction is performed at a temperature of 35-45 ℃ and a rotation speed of 250-250 rpm.

7. The method according to claim 1, wherein the ratio of the cells of the recombinant bacterium expressing class III polyphosphate kinase 2 to the cells of the recombinant bacterium expressing L-asparagine synthetase is 0.5-1.5: 1.

8. The method according to claim 1, wherein the concentration of the recombinant strain expressing class III polyphosphate kinase 2 in the coupling reaction is 8-12 OD 600.