CN107236695B - Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof - Google Patents
Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof Download PDFInfo
- Publication number
- CN107236695B CN107236695B CN201710594500.6A CN201710594500A CN107236695B CN 107236695 B CN107236695 B CN 107236695B CN 201710594500 A CN201710594500 A CN 201710594500A CN 107236695 B CN107236695 B CN 107236695B
- Authority
- CN
- China
- Prior art keywords
- sucrose phosphorylase
- arbutin
- sucrose
- gene
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/44—Preparation of O-glycosides, e.g. glucosides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01007—Sucrose phosphorylase (2.4.1.7)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a gene engineering bacterium for expressing sucrose phosphorylase and application thereof, belonging to the field of gene engineering and enzyme engineering. The invention expresses the gene shown in SEQ ID NO.1 in escherichia coli in a heterogenous way, constructs recombinant escherichia coli, produces recombinant sucrose phosphorylase by fermenting the recombinant escherichia coli, and leads the enzyme activity in the fermented supernatant to reach 40 U.mL‑1The recombinant sucrose phosphorylase is utilized to catalyze sucrose and hydroquinone to generate α -arbutin, the conversion rate can reach 91 percent, and the method has better industrial application potential.
Description
Technical Field
The invention relates to a gene engineering bacterium for expressing sucrose phosphorylase and application thereof, belonging to the field of gene engineering and enzyme engineering.
Background
Sucrose phosphorylase is distributed mainly in bacteria. According to literature reports, many production strains of the enzyme include L.mesenteroides, Streptococcus mutans, Pseudomonas saccharophila, Bifidobacterium longum, B.adolescentis, B.megaterium and the like.
Sucrose phosphorylase (SPase, hereinafter referred to as SPase) is mainly capable of catalyzing two types of reactions: one is the transfer of phosphorylated glucose as donor to a different substance, in which sucrose can be synthesized by conversion; another catalytic mode is the transfer of the glucose groups obtained by enzymatic decomposition of sucrose to different types of acceptors, by which a variety of new products can be produced.
The application value of sucrose phosphorylase is wide, the sucrose phosphorylase has strong glucoside transfer activity and stable structure, and by applying the characteristic of the SPase, sucrose is taken as an acceptor, and the sucrose is taken as a donor to catalyze and synthesize glycosylated substances, Kitao in Japan and the like uses the SPase from L.mesenteroides, 2g of hydroquinone can be converted to obtain 2.3g of α -arbutin, and Liquliang and the like are converted by the SPase to synthesize α -arbutin, and 35 g.L can be obtained-1α -arbutin, conversion rate of hydroquinone is 74%, Wanmujia, etc. recombinant escherichia coli is utilized to produce sucrose phosphorylase, and then α -arbutin is generated by conversion under the condition of 1.6% hydroquinone concentrationThe conversion rate of the glycoside is 78%, the intracellular expression level of the glycoside is improved, and the condition for producing α -arbutin by enzymatic conversion of sucrose phosphorylase is optimized, so that the method has important significance.
As a high-efficacy medicine and cosmetic additive which is being popularized to the utmost extent internationally, α -arbutin has huge requirements at home and abroad and occupies an important position in the field of whitening and freckle removal of cosmetics, with the deep understanding of consumers, α -arbutin can be widely applied in China, the market value of α -arbutin is researched and researched about 3800 yuan per kilogram, the market value of hydroquinone serving as a raw material is about 66 yuan per kilogram, so that α -arbutin is a high value-added product, and if industrial production can be realized, great economic benefits can be brought to China.
At present, relatively few researches on preparation of α -arbutin are carried out in China, and the problem for realizing industrialization is lack of enzyme with high conversion rate and high expression level, in the report of α -arbutin synthesis at home and abroad, the highest conversion rate is that the antioxidant is added when the proportion of a donor and a receptor of amylosucrase from deinococcus geothermalis, such as Dong-Ho Seo, is 10: 1, 90% of hydroquinone can be converted into α -arbutin, and the product yield is only 0.56 g.L-1However, since the enzyme property is unstable, the substrate concentration is low, and the proportion of the donor and the acceptor is too high, the amylosucrase is not suitable for being used as an enzyme which can be industrialized, so that in order to realize the industrialization of α -arbutin, an enzyme with the characteristics of stable property, high expression level and high conversion rate must be searched.
Disclosure of Invention
The first purpose of the invention is to provide a gene engineering bacterium for producing sucrose phosphorylase, which is used for carrying out heterologous expression on a sucrose phosphorylase gene derived from L.mesenteroides, and the nucleotide sequence of the encoding sucrose phosphorylase gene is shown as SEQ ID NO. 1.
In one embodiment of the invention, the genetically engineered bacterium takes pET series plasmids as a vector and takes escherichia coli as a host.
In one embodiment of the invention, the escherichia coli comprises e.coli BL21, e.coli JM109, e.coli DH5 α, or e.coli TOP 10.
In one embodiment of the invention, the genetic engineering bacteria express the gene shown in SEQ ID NO.1 by taking pET-24a (+) as a vector and taking Escherichia coli BL21(DE3) as a host.
The second purpose of the invention is to provide a method for constructing recombinant escherichia coli expressing sucrose phosphorylase, which is to connect the gene shown in SEQ ID NO.1 with a vector and transform the gene into escherichia coli cells.
In one embodiment of the invention, the escherichia coli comprises e.coli BL21, e.coli JM109, e.coli DH5 α, or e.coli TOP 10.
In one embodiment of the invention, the method comprises the steps of:
1) amplifying a gene shown in SEQ ID NO.1, carrying out enzyme digestion, connecting the gene to a vector pET-24a (+), transforming E.coli JM109, and coating a resistant LB plate culture medium to obtain a recombinant plasmid pET-24a (+) -sp;
2) the recombinant plasmid pET-24a (+) -sp is transformed and expressed into competent cells of a host escherichia coli BL21(DE3), and the competent cells are coated with a resistant LB plate culture medium to obtain the engineering bacteria for preparing the sucrose phosphorylase.
The third purpose of the invention is to provide a method for producing sucrose phosphorylase, which is to inoculate the genetically engineered bacterium into a culture medium, culture for 1-4 h at 35-37 ℃, and induce with 0.04-0.06 mM IPTG (isopropyl thiogalactoside) of final concentration.
In one embodiment of the invention, the method is to inoculate the genetically engineered bacterium to TB medium, and after culturing for 2h in a shaker at 37 ℃, the expression of sucrose phosphorylase is induced by using 0.04mM IPTG (final concentration).
In one embodiment of the present invention, the cells are activated before the inoculation.
In one embodiment of the present invention, the fermentation broth after induction is centrifuged at 12000rpm for 10min at 4 ℃ and the supernatant is discarded, the cells are collected, and the cell pellet is precipitated with 20mM Na at pH7.02HPO4-NaH2PO4Resuspending the buffer solution, mixing, breaking cell wall of thallus suspension with ultrasonic cell crusher, centrifuging at 12000rpm for 10min, and centrifugingThe supernatant is the crude enzyme liquid in the fermentation cells.
The fourth purpose of the invention is to provide a method for preparing α -arbutin by converting hydroquinone and sucrose by using recombinant sucrose phosphorylase, wherein the method comprises the step of converting by using sucrose phosphorylase encoded by the gene shown in SEQ ID NO. 1.
In one embodiment of the invention, the sucrose phosphorylase is present in the form of an enzyme solution or a cell expressing the enzyme.
In one embodiment of the invention, the method comprises the steps of: (1) the genetic engineering bacteria are utilized to produce sucrose phosphorylase, (2) sucrose and hydroquinone are used as substrates, and 1500-3500 U.g-1Adding enzyme into hydroquinone for conversion reaction, reacting for 6-25 h at 28-30 ℃ and pH of 5.5-6.2, and converting to produce α -arbutin.
In one embodiment of the invention, the stirring speed is controlled to be 120-180 r/min during the conversion reaction.
In one embodiment of the invention, the substrate is 40 g.L-1And 500 g.L of hydroquinone-1The amount of the added enzyme is 2500U g-1Hydroquinone, the pH of a conversion system is controlled to be 6.0, and the reaction temperature is 30 ℃.
In one embodiment of the invention, the molar ratio of the sucrose to the hydroquinone is 4-6: 1.
The invention also provides the application of the genetically engineered bacterium in preparing food, medicines, health products and cosmetics.
Has the advantages that: the invention expresses the gene shown in SEQ ID NO.1 in escherichia coli in a heterogenous way, the recombinant escherichia coli obtained by construction produces the recombinant sucrose phosphorylase by fermentation, and the enzyme activity of the fermentation supernatant is 40 U.mL-1The recombinant sucrose phosphorylase is used for catalyzing sucrose and hydroquinone to generate α -arbutin, and the conversion rate can reach 91%.
Drawings
FIG. 1 is SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of intracellular wall-broken supernatant obtained by shaking flask fermentation of recombinant bacteria; m: marker, 1: fermenting the supernatant by the recombinant bacteria;
FIG. 2 is the effect of pH on the synthesis of α -arbutin by SPase;
FIG. 3 shows the effect of reaction temperature on the synthesis of α -arbutin by SPase;
FIG. 4 is a graph showing the effect of donor-acceptor ratio on the synthesis of α -arbutin by SPase;
FIG. 5 shows the effect of enzyme dosage on the synthesis of α -arbutin by SPase;
FIG. 6 shows the effect of reaction time on the synthesis of α -arbutin by SPase;
FIG. 7 shows the effect of hydroquinone concentration on the synthesis of α -arbutin by SPase.
Detailed Description
Example 1 optimization of Leuconostoc mesenteroides sucrose phosphorylase encoding Gene and construction of expression vector
(1) Obtaining of genes: analyzing and optimizing a natural SPase gene (1473bp) from L.mesenteroides to obtain a gene shown in SEQ ID NO.1, adding two enzyme cutting sites (Nde I and Hind III) to two ends of the optimized sucrose phosphorylase, and synthesizing by Shanghai Jielii bioengineering finite company to obtain pGE-sp.
(2) Construction of an expression vector: the expression vectors pET-24a (+) and pGE-sp were each digested simultaneously with Nde I and Hind III, and ligated with T4 ligase. The ligation product was transformed into competent cells of expression host E.coli BL21(DE3), and the transformation product was applied to a medium supplemented with 30. mu.g/mL-1Kan's LB plate growth; the bacteria that normally grow on the plate were inoculated to the inactivated medium and 30. mu.g/mL of the medium was added-1And (3) in a liquid LB culture medium of Kan, growing for 9h at constant temperature, extracting plasmids, carrying out double enzyme digestion verification, and then determining a DNA sequence of the recombinant plasmids which are verified to be correct, wherein a positive clone is pET-24a (+) -sp.
Example 2 preparation of sucrose phosphorylase and enzyme Activity measurement
(1) Preparation of sucrose phosphorylase
The recombinant bacterium constructed in example 1 was inoculated into a medium containing 30. mu.g.mL-1Kan's LB liquid medium, after 8h of culture, was transferred to TB medium (30. mu.g.mL) in an inoculum size of 5%-1Kan), after culturing in a shaker at 37 ℃ for 2h, adding IPTG with a final concentration of 0.2mmol L-1 to the fermentation broth while adjusting the temperature to 25 ℃ to induce enzyme production. Fermentation broth centrifugation (4)8000r/min,15min) precipitating thallus with 20mM Na (pH7.0 Na)2HPO4-NaH2PO4And after re-dissolving the buffer solution, breaking the wall and centrifuging to obtain a supernatant which is a crude enzyme solution.
From FIG. 1, it can be found that there is a clear band where 53kDa is consistent with the size of sucrose phosphorylase, indicating that optimized sucrose phosphorylase can be obtained.
(2) Enzyme activity assay
The enzyme activity of the SPase was measured by measuring the amount of NADPH released during the enzymatic reaction according to the Silverstein method to calculate the enzyme activity.
One standard assay system includes: 50mmol/L of potassium dihydrogen phosphate reagent (pH 6.7), 140mmol/L of sucrose solution, 1mmol/LEDTA-2Na, 50mmol/LMgCl2, 1mg of NADP +, L. mu.g of glucose 1, 6-diphosphate, 100. mu.g of glucose phosphoglucomutase, 20U of glucose-6-phosphate dehydrogenase, 20. mu.L of SPase of appropriate concentration, and a total reaction volume of 3.3 mL. The reaction was carried out at 25 ℃ for 5min, and the change in absorbance of NADPH in the reaction mixture was measured at 340 nm. The enzyme activity of the crude enzyme solution is measured, and the enzyme activity of the SPase reaches 40 U.mL-1。
EXAMPLE 3 conditional study of the Synthesis of α -arbutin by SPase
(1) Influence of pH on the Synthesis of α -arbutin by SPase
The reaction was carried out at an initial pH of 6.0-8.0, respectively, and the other conditions were not changed, as can be seen from FIG. 2, at a pH of 7, Hydroquinone (HQ) in the reaction participated in the enzymatic conversion to produce α -arbutin, a product having a mass concentration of 89gL-1As the pH continued to increase, the HQ conversion began to decrease, and the closer to pH7.0, the higher the α -arbutin production.
(2) Influence of reaction temperature on synthesis of α -arbutin by SPase
Performing enzyme conversion reaction at 25-45 deg.C respectively, and keeping other conditions unchanged, the result is shown in FIG. 3, with temperature rise, α -arbutin yield is increased, maximum conversion rate is obtained at 30-35 deg.C, α -arbutin yield is 91.0gL-1. When the reaction temperature was kept at 45 ℃ and the color of the reaction solution was observed to be darker after the completion of the reaction, it was presumed that the color was likely to be observedIs caused by substrate oxidation, and the concentration of α -arbutin in the solution is only 78.7gL at this time through HPLC detection-1
(3) Effect of donor-acceptor ratio on the Synthesis of α -arbutin by SPase
The synthesis with Hydroquinone (HQ) and sucrose as substrates is a reversible process. In order to improve the utilization rate of HQ, the conversion rate of HQ under the condition of substrates with different donor-acceptor ratios is respectively researched. As shown in FIG. 4, the conversion rate increased with increasing concentration of the donor sucrose, and the intermolecular transglycosylation reaction was promoted by high concentration of sucrose. A maximum conversion of 90% is obtained at a molar ratio of sucrose to HQ of 4:1, and the product has a mass concentration of 91 g.L-1When the sucrose concentration decreased, the product concentration decreased sharply, while the yield of α -arbutin remained essentially unchanged at sucrose concentrations above this point, probably due to the higher viscosity of the reaction solution at higher sucrose concentrations, and therefore slower reaction mass transfer rates.
(4) Influence of enzyme addition amount on synthesis of α -arbutin by SPase
To examine the amount of sucrose phosphorylase added corresponding to the substrate concentration, 500, 1000, 1500, 2000 to 3500 U.g each was used-1The conversion reaction was carried out by adding enzyme of Hydroquinone (HQ), and the result is shown in FIG. 5, wherein the enzyme addition amount was 2000 U.g, and the yield of α -arbutin was increased with the increase of enzyme dosage-1The yield of α -arbutin is 82g/L, and the enzyme addition amount is 2500 U.g-1The yield of α -arbutin was about 90 g/L.
(5) Influence of reaction time on synthesis of α -arbutin by SPase
Carrying out enzyme conversion at 30 ℃, taking a sample every 3h, and determining the yield of α -arbutin after the reaction is finished, wherein the result is shown in figure 6, the yield of α -arbutin is rapidly increased within 0-6h, the yield of arbutin exceeds 82g/L when reacting for 6h, the content of the arbutin slowly rises to approach 90g/L after reacting for 12h to 18h, and the yield of α -arbutin is basically unchanged and tends to balance until 21h to 24 h.
(6) Effect of Hydroquinone concentration on Synthesis of α -arbutin by SPase
To increase the yield of α -arbutin in sucrose phosphorylase reaction solution, the donor and acceptor concentrations were increased together under the condition of maintaining the ratio of 4:1 between donor and acceptor according to the substrate ratio, as shown in FIG. 7, the hydroquinone concentration was 10 g.L-1To 40 g.L-1The increase in substrate concentration between intervals promotes an increase in product yield. This is probably because in this range, the high concentration of the two molecules promotes better intermolecular contact, and the reaction rate is accelerated more toward the positive direction. When the content of HQ in the solution is 40 g.L-1At the time, 91% of the product was converted to the product, and the yield reached 90 g.L-1. When the concentration of HQ exceeds 40 g.L-1Although the α -arbutin concentration is slightly increased, the conversion rate of HQ is sharply reduced, on one hand, the result is that the higher concentration promotes the oxidation of HQ to benzoquinone, sucrose phosphorylase is chemically modified, and the enzymatic activity and the enzyme stability are reduced, on the other hand, the overhigh concentration of sucrose causes the viscosity of the reaction liquid to be greatly increased, so the flow speed of hydroquinone in the reaction liquid is slow, and the energy exchange between reaction molecules is difficult.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> gold rhyme
<120> gene engineering bacterium for expressing sucrose phosphorylase and application thereof
<160>1
<170>PatentIn version 3.3
<210>1
<211>1482
<212>DNA
<213> Artificial sequence
<400>1
catatggaaa ttcagaacaa ggccatgtta attacctatg cagatagctt aggcaaaaat 60
ctgaaagatg ttcatcaggt tctgaaagaa gatattggag atgccattgg cggtgttcat 120
ctgctgccgt ttttcccgtc aaccggcgat cgcggctttg ccccagcaga ttatacccgc 180
gtggatgcag cctttggcga ttgggccgat gtggaagcct taggtgaaga atattatctg 240
atgtttgatt ttatgattaa tcatatttca cgcgaatcag ttatgtatca ggattttaag 300
aagaaccatg atgatagtaa atataaggac ttctttattc gctgggaaaa attttgggcc 360
aaagcaggcg aaaatcgtcc gacccaggcc gatgtggatc tgatctataa gcgcaaagat 420
aaagccccga cccaggaaat tacctttgat gatgggacca ccgaaaatct gtggaatacc 480
tttggcgaag aacagattga tattgatgtg aatagcgcca ttgccaaaga gttcattaaa 540
accaccttag aagatatggt taaacatggc gccaacctta ttcgcttaga tgcctttgcc 600
tatgccgtta aaaaagtgga taccaatgac ttcttcgttg aaccggaaat ttgggatacc 660
ctgaacgaag tgcgcgaaat tctgaccccg ctgaaagccg aaattctgcc ggaaattcat 720
gaacattata gcattccgaa gaaaattaat gatcatggct attttaccta tgattttgca 780
ctgccgatga ccaccctgta taccctgtat agcggcaaaa ccaatcagtt agccaaatgg 840
ctgaaaatgt ctccgatgaa acagtttacc accttagata cccatgatgg cattggtgtt 900
gtggatgcac gcgatattct gaccgatgat gaaattgatt atgcaagcga acagctgtat 960
aaggtgggcg ccaatgttaa aaagacctat agctcagcaa gctataacaa tctggacatc 1020
tatcagatta atagtaccta ttatagtgca ctgggtaatg atgatgcagc atatctgctg 1080
tctcgcgtgt ttcaggtgtt tgcaccgggc attccgcaaa tctactatgt gggcttactg 1140
gccggtgaaa atgatattgc cctgctggaa tcaaccaaag aaggtcgtaa tattaatcgt 1200
cattattata cccgcgaaga agttaaatca gaagttaaac gtccggttgt tgccaacctg 1260
ctgaaactgc tgtcttggcg taacgagtct ccggcctttg atctggcagg ctctattacc 1320
gtggataccc cgaccgatac caccattgtt gtgacccgcc aggatgaaaa tggtcagaat 1380
aaggcagtgc tgaccgcaga tgcagccaat aagacctttg aaattgtggaaaatggtcag 1440
accgttatgt ctagcgataa tctgacccag aattaaaagc tt 1482
Claims (7)
1. A genetic engineering bacterium for producing sucrose phosphorylase is characterized in that pET-24a (+) is taken as a vector, Escherichia coli BL21(DE3) is taken as a host to heterologously express a gene of the sucrose phosphorylase, and a gene sequence for coding the sucrose phosphorylase is shown as SEQ ID No. 1.
2. A method for constructing the genetically engineered bacterium of claim 1, wherein the gene represented by SEQ ID No.1 is linked to a vector and transformed into E.coli cells.
3. A method for producing sucrose phosphorylase, characterized in that the genetically engineered bacterium of claim 1 is inoculated into a culture medium, cultured at 35-37 ℃ for 1-4 h, and induced with 0.04-0.06 mM IPTG at the final concentration.
4. A method for preparing α -arbutin is characterized in that sucrose phosphorylase encoded by a gene shown as SEQ ID NO.1 is used for conversion.
5. The method of claim 4, comprising the steps of: (1) the genetic engineering bacteria of claim 1 is used for producing sucrose phosphorylase, (2) sucrose and hydroquinone are used as substrates, and 1500-3500 U.g-1Benzene para benzeneAnd (3) carrying out conversion reaction by adding enzyme of diphenol, reacting for 6-25 h at 28-30 ℃ and pH of 5.5-6.2, and converting to produce α -arbutin.
6. The method according to claim 5, wherein the molar ratio of the sucrose to the hydroquinone is 4-6: 1.
7. The genetically engineered bacterium of claim 1 for use in the preparation of food, pharmaceutical, health product, and cosmetic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710594500.6A CN107236695B (en) | 2017-07-20 | 2017-07-20 | Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710594500.6A CN107236695B (en) | 2017-07-20 | 2017-07-20 | Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107236695A CN107236695A (en) | 2017-10-10 |
| CN107236695B true CN107236695B (en) | 2020-02-07 |
Family
ID=59991185
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710594500.6A Active CN107236695B (en) | 2017-07-20 | 2017-07-20 | Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107236695B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107858335B (en) * | 2017-12-25 | 2021-07-16 | 南京华狮新材料有限公司 | Sucrose phosphorylase mutant and application thereof in production of glycerol glucoside |
| CN108251408B (en) * | 2018-02-27 | 2021-01-29 | 贵州师范大学 | Chalcone isomerase, coding gene, expression vector, host bacterium and application thereof |
| CN109486782B (en) * | 2018-11-26 | 2020-06-09 | 江南大学 | Method for improving sucrose phosphorylase expression efficiency through molecular chaperone co-expression |
| CN109988800A (en) * | 2019-03-18 | 2019-07-09 | 合肥华恒生物工程有限公司 | A method of hydroquinone conversion ratio is improved using superoxide dismutase |
| CN109988778B (en) * | 2019-05-14 | 2020-10-27 | 南京工业大学 | Sucrose phosphorylase gene and application thereof |
| CN110343654B (en) * | 2019-08-15 | 2021-03-30 | 江南大学 | Genetic engineering bacterium for producing sucrose phosphorylase |
| CN112375724B (en) * | 2020-11-18 | 2022-12-16 | 江南大学 | Gene engineering bacterium for efficiently synthesizing alpha-arbutin and construction method and application thereof |
| CN112300977B (en) * | 2020-11-18 | 2024-01-12 | 江南大学 | Genetic engineering strain for synthesizing alpha-arbutin and construction method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105400851A (en) * | 2015-12-25 | 2016-03-16 | 天津宏顺科生物科技有限公司 | Preparation method of alpha-arbutin |
| CN107236696A (en) * | 2017-07-31 | 2017-10-10 | 江南大学 | A kind of sucrose phosphorylase recombined bacillus subtilis in expression L. mesenteroides sources |
-
2017
- 2017-07-20 CN CN201710594500.6A patent/CN107236695B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105400851A (en) * | 2015-12-25 | 2016-03-16 | 天津宏顺科生物科技有限公司 | Preparation method of alpha-arbutin |
| CN107236696A (en) * | 2017-07-31 | 2017-10-10 | 江南大学 | A kind of sucrose phosphorylase recombined bacillus subtilis in expression L. mesenteroides sources |
Non-Patent Citations (2)
| Title |
|---|
| DD139320.1;Method of thermostabilization of an sucrose phosphorylase (SP);《GenBank》;20051104;CDS1..1458 * |
| 重组大肠杆菌产蔗糖磷酸化酶的酶学性质及其催化合成 α-熊果苷;万月佳等;《生物工程学报》;20121225;第28卷(第12期);第1450-1459页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107236695A (en) | 2017-10-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107236695B (en) | Genetic engineering bacterium for expressing sucrose phosphorylase and application thereof | |
| US11203742B2 (en) | Sucrose phosphorylase mutant with improved enzyme activity and construction method thereof and use thereof | |
| JP6272485B2 (en) | Method for producing rebaudioside M by enzymatic method | |
| CN111394330B (en) | Cyclodextrin glucosyltransferase mutant T168A and preparation method thereof | |
| CN102869783B (en) | Psicose-epimerization enzyme immobilizatio and use described psicose-epimerase to prepare the method for D-Psicose | |
| US20100168061A1 (en) | Method for preparing enzymatically highly branched-amylose and amylopectin cluster | |
| Ong et al. | Cloning, extracellular expression and characterization of a predominant β-CGTase from Bacillus sp. G1 in E. coli | |
| WO1995034642A1 (en) | Novel transferase and amylase, process for producing the enzymes,use thereof, and gene coding for the same | |
| CN113817763A (en) | Beta-galactosidase family gene directed evolution method, mutant and application thereof | |
| Shao et al. | Enhanced production of α-galactosyl epitopes by metabolically engineered Pichia pastoris | |
| JP4235262B2 (en) | Production of non-native bacterial exopolysaccharides in recombinant bacterial hosts | |
| Hövels et al. | Characterization of a novel endo-levanase from Azotobacter chroococcum DSM 2286 and its application for the production of prebiotic fructooligosaccharides | |
| CN105969713B (en) | Genetic engineering bacterium for high yield of maltooligosyl trehalose hydrolase and application thereof | |
| CN110343654B (en) | Genetic engineering bacterium for producing sucrose phosphorylase | |
| CN113025590B (en) | Optimization method for improving secretion expression of cyclodextrin glucosyltransferase and application thereof | |
| CN104357371A (en) | Genetically engineered bacterium for expressing beta cyclodextrin glycosyl transferase as well as construction method and use thereof | |
| CN116200318A (en) | Recombinant bacillus subtilis for exocrine expression of D-psicose 3-epimerase | |
| CN111534498B (en) | Cyclodextrin glucosyltransferase mutant with improved disproportionation specific activity and AA-2G yield | |
| CN115838682A (en) | Bacillus licheniformis engineering strain for efficiently producing 2' -fucosyllactose by utilizing mannan | |
| CN112300977B (en) | Genetic engineering strain for synthesizing alpha-arbutin and construction method and application thereof | |
| CN114806991A (en) | Engineering escherichia coli for improving yield of fucosyllactose and production method | |
| CN113278602A (en) | Chitobiose deacetylase mutant, gene, engineering bacterium and application thereof | |
| CN106367458B (en) | Recombinant sucrose phosphorylase is preparing the application in functional oligose | |
| CN111560361B (en) | Cyclodextrin glucosyltransferase mutant for improving AA-2G yield | |
| CN115725535B (en) | N-deoxyribotransferase and application thereof in preparation of deoxynucleosides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |