CN111826470A - SYBR Green I-based 2019-nCoV nucleic acid constant-temperature amplification detection kit and detection method - Google Patents

Abstract

The invention discloses a 2019-nCoV nucleic acid constant-temperature amplification detection kit and a detection method based on SYBR Green I, wherein the kit comprises an ORF1ab gene primer sequence and an N gene primer sequence of 2019-nCoV virus, SYBR Green I dye, NASBA amplification buffer solution and NASBA enzyme mixed solution; the detection method by using the kit comprises the following steps: firstly, preparing NASBA amplification buffer solution, preparing NASBA enzyme mixed solution, preparing primer mixed solution and preparing an RNA sample; and (4) mixing all the solutions, reacting, incubating and finally completing detection by using a fluorescence detector. The invention shows high specificity and high sensitivity detection performance, and saves a large amount of experimental time.

Description

SYBR Green I-based 2019-nCoV nucleic acid constant-temperature amplification detection kit and detection method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a detection kit and a detection method for rapidly detecting 2019-nCoV based on a constant temperature amplification technology and an SYBR Green I technology.

Background

Currently, the more common laboratory diagnostic techniques can be divided into virus cell culture techniques, imaging examinations, electron microscopy, serological examinations and molecular biological examinations. Among them, virus cell culture and isolation are the most accurate methods at present, but lack the sensitivity and speed required by high-throughput screening, possibly leading to delay of disease conditions; serological methods such as ELISA have low specificity and cannot be used for definite diagnosis. The molecular biology detection means is most common in the qRT-PCR method, and the method has the advantages of high sensitivity, good specificity, wide linear range and accurate quantification. Has been widely applied to the detection of coronavirus and obtains good detection rate and positive coincidence rate. However, the current PCR instrument is expensive, so that the PCR instrument basically meets the conditions in the laboratory of Hospital III, has high technical requirements on operators, and cannot be popularized and used in the basic level. The method can not efficiently screen large-area people when epidemic situation is developed on a large scale.

Disclosure of Invention

The purpose of the invention is as follows: the invention aims to provide a 2019-nCoV nucleic acid isothermal amplification detection kit and a detection method based on SYBR Green I aiming at the defects of the prior art.

The technical scheme for realizing the invention is as follows:

the invention relates to a 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I, which comprises 2019-nCoV viral primers and SYBR Green I; the 2019-nCoV virus primers comprise ORF1ab gene primers and N gene primers, and the primer sequence of the ORF1ab gene is shown as ORF1ab-F and ORF1 ab-R; the N gene primer sequences are shown as N-F and N-R.

The primer sequence table is as follows:

ORF1ab gene:

AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTT TACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTA GTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTA AACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA

ORF1ab gene primer sequence: ORF1 ab-F:

TAATACGACTCACTATAGGGCCCTGTGGGTTTTACACTTAA

ORF1ab gene primer sequence: ORF1 ab-R:

TAATACGACTCACTATAGGGACGATTGTGCATCAGCTGA

n gene:

GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGG GAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCT GCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAG AAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATG GCTGGCA

n gene primer sequence: N-F:

TAATACGACTCACTATAGGGCACATTGGCACCCGCAATC

n gene primer sequence: N-R:

TAATACGACTCACTATAGGGGAGGAACGAGAAGAGGCTTG

the invention further preferably adopts the technical scheme that the kit also comprises NASBA amplification buffer solution and NASBA enzyme mixed solution.

Preferably, the NASBA amplification buffer comprises Tris-HCl, MgCl2, KCl, DTT, dNTP, NTP and pure water; the NASBA enzyme mixture contains RNase H, T7-RNA polymerase, AMV reverse transcriptase and purified water.

Preferably, the NASBA amplification buffer comprises 200mmol/L Tris-HCl, 60mmol/L MgCl2, 350mmol/L KCl, 2.5mmol/L DTT, 5mmol/L dNTP, 10mmol/L NTP and pure water; the NASBA enzyme mixture comprises 0.4U/. mu.L RNase H, 10U/. mu. L T7-RNA polymerase, 2U/. mu.L AMV reverse transcriptase and pure water; the NASBA enzyme mixture was composed of 5. mu.L of 2U RNase H, 50U T7-RNA polymerase and 10U AMV reverse transcriptase.

Preferably, when the pure water is 500ml, 31.52g of Tris-HCl, 5.71g of MgCl are added to the NASBA amplification buffer₂26.09g KCl, 0.39g DTT, 50mL 100mM dNTP and 100mL 100mM NTP, Tris-HCl, MgCl in NASBA amplification buffer₂A buffer system consisting of KCl plays a role in stabilizing PH in the environment; when the total volume of the NASBA enzyme mixture is 1ml, the mixture ratio is 8 mul of 50U/. mu.L RNase H, 200 mul of 50U/. mu.L T7-RNA polymerase, 400 mul of 5U/. mu.L AMV reverse transcriptase and pure water are added until the total volume is 1 ml; T7-RNA polymerase in NASBA enzyme mixture plays a role in identifying a promoter sequence, AMV reverse transcriptase plays a role in catalyzing reverse transcription reaction, and RNase H plays a role in hydrolyzing RNA single strands in RNA-DNA hybrid strands.

Preferably, the primer mixture comprises 50. mu.M primer ORF1ab-F, 50. mu.M primer ORF1ab-R, 50. mu.M primer N-F, 50. mu.M primer N-R and 5 XSSYBR Green I.

A detection method for detecting 2019-nCoV virus by using the kit,

the method comprises the following steps:

step one, preparing an NASBA amplification buffer solution: firstly, 500mL of pure water is measured, and 31.52g of Tris-HCl, 5.71g of MgCl2, 26.09g of KCl, 0.39g of DTT, 50mL of 100mM dNTP and 100mL of 100mM NTP are added; then, after mixing uniformly, adding pure water to a constant volume of 1L;

step two, preparing NASBA enzyme mixed liquor: adding 8. mu.l of 50U/. mu.L RNase H, 200. mu.l of 50U/. mu.L T7-RNA polymerase, 400. mu.l of 5U/. mu.L AMV reverse transcriptase and pure water to a total volume of 1 ml;

step three, preparing primer mixed liquor: preparing a gene primer mixed solution: taking 100 mu L of 0.5mM primer ORF1ab-F, 100 mu L of 0.5mM primer ORF1ab-R, 100 mu L of 0.5mM primer N-F, 100 mu L of 0.5mM primer N-R, 100 mu L of 50 × SYBR Green I, and adding pure water to the total volume of 1 mL;

step four, preparing an RNA sample: taking a throat swab RNA extract to be detected as an RNA sample;

step five, measuring 5 mu L of NASBA amplification buffer solution 5 mu L, NASBA enzyme mixed solution and 5 mu L of primer mixed solution prepared in the step one to the step three, fully and uniformly mixing the mixed solution and 10 mu L of RNA sample in the step four, reacting the uniformly mixed solution for 30min at 42 ℃, and judging a detection result by using a fluorescence detector after the reaction is finished.

By adopting the technical scheme, the invention has the following beneficial effects:

(1) the invention provides a 2019-nCoV nucleic acid constant-temperature amplification detection kit and a detection method based on SYBR Green I, wherein ORF1ab gene primers, N gene primers and SYBR Green I dye are used for reaction through a constant-temperature amplification technology to obtain high-quality and high-concentration amplification products, the reaction is carried out by combining with the SYBR Green I dye, and after the reaction is finished, a reaction solution is subjected to fluorescence interpretation by a fluorescence interpretation detector to interpret a detection result; the invention has the advantages of high sensitivity, good specificity, convenience and quickness.

(2) The detection method disclosed by the invention is based on the nucleic acid constant-temperature amplification technology of SYBR Green I, has the characteristics of high specificity and high sensitivity of nucleic acid detection, can complete detection without a PCR instrument, and has the advantages of simplicity and convenience and easiness in popularization; different from a PCR instrument, the whole process does not need the steps of denaturation, annealing and extension, only needs to react for about 30 minutes at 42 ℃ to obtain an amplification product, and can read the final result by using a small fluorescence detector after the reaction is finished; the whole detection process does not depend on large-scale instruments and professional operators, the detection time is short, a large amount of experimental time is saved, the detection quantity is not limited, the method can be popularized and used on a large scale in the basic level, and the method is particularly suitable for screening large-scale groups.

(3) The detection method has the advantages of rapid and simple constant temperature amplification and high specificity of SYBR Green I, has no significant difference in specificity and sensitivity with the PCR technology, does not depend on instruments, and has the advantages of simplicity and easy popularization; the method is suitable for detection of large-area people in basic popularization and virus outbreak period.

Drawings

In order that the present disclosure may be more readily and clearly understood, reference is now made to the following detailed description of the present disclosure taken in conjunction with the accompanying drawings, in which:

FIG. 1 is an electrophoresis chart of the isothermal amplification products of nucleic acids of the experimental group and the RT-PCR amplification products of the control group according to the present invention;

FIG. 2 is a diagram showing the results of 10 positive samples detected by the serological method according to the embodiment of the present invention;

FIG. 3 is a diagram showing the results of 10 negative samples detected by the serological method in the example of the present invention.

Detailed Description

The technical solution of the present invention is described in detail below with reference to the accompanying drawings, but the scope of the present invention is not limited to the embodiments.

Example (b): the invention relates to a 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I, which comprises 2019-nCoV viral primers and SYBR Green I; the 2019-nCoV virus primers comprise ORF1ab gene primers and N gene primers, and the primer sequence of the ORF1ab gene is shown as ORF1ab-F and ORF1 ab-R; the primer sequence of the N gene is shown as N-F and N-R.

The primer sequence table is as follows:

ORF1ab gene:

AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTT TACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTA GTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTA AACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA

ORF1ab gene primer sequence: ORF1 ab-F:

TAATACGACTCACTATAGGGCCCTGTGGGTTTTACACTTAA

ORF1ab gene primer sequence: ORF1 ab-R:

TAATACGACTCACTATAGGGACGATTGTGCATCAGCTGA

n gene:

GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGG GAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCT GCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAG AAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATG GCTGGCA

n gene primer sequence: N-F:

TAATACGACTCACTATAGGGCACATTGGCACCCGCAATC

n gene primer sequence: N-R:

TAATACGACTCACTATAGGGGAGGAACGAGAAGAGGCTTG

the further preferable technical proposal of the invention is that the kit also comprises NASBA amplification buffer solution and NASBA enzyme mixed solution; the NASBA amplification buffer comprises 200mmol/L Tris-HCl, 60mmol/L MgCl2, 350mmol/L KCl, 2.5mmol/L DTT, 5mmol/L dNTP, 10mmol/L NTP and pure water; the NASBA enzyme mixed solution comprises 0.4U/. mu.L RNaseH, 10U/. mu. L T7-RNA polymerase, 2U/. mu.L AMV reverse transcriptase and pure water; the NASBA enzyme mixture comprises 2URNase H, 50U T7-RNA polymerase and 10U AMV reverse transcriptase in a proportion of 5 mu L; preferably, when pure water is 500mL, 31.52g of Tris-HCl, 5.71g of MgCl2, 26.09g of KCl, 0.39g of DTT, 50mL of 100mM dNTP and 100mL of 100mM NTP are added into the NASBA amplification buffer, and a buffer system consisting of Tris-HCl, MgCl2 and KCl in the NASBA amplification buffer plays a role in stabilizing the pH in the environment; when the total volume of the NASBA enzyme mixture is 1ml, the mixture ratio is 8 mul of 50U/. mu.L RNase H, 200 mul of 50U/. mu.L T7-RNA polymerase, 400 mul of 5U/. mu.L AMV reverse transcriptase and pure water are added until the total volume is 1 ml; T7-RNA polymerase in the NASBA enzyme mixed liquor plays a role in identifying a promoter sequence, AMV reverse transcriptase plays a role in catalyzing reverse transcription reaction, and RNase H plays a role in hydrolyzing RNA single strands in RNA-DNA hybrid chains; the primer mixture contained 50. mu.M primer ORF1ab-F, 50. mu.M primer ORF1ab-R, 50. mu.M primer N-F, 50. mu.M primer N-R and 5 XSSYBR Green I.

A detection method for detecting 2019-nCoV virus by using the kit comprises the following steps:

step one, preparing an NASBA amplification buffer solution: firstly, 500mL of pure water is measured, and 31.52g of Tris-HCl, 5.71g of MgCl2, 26.09g of KCl, 0.39g of DTT, 50mL of 100mM dNTP and 100mL of 100mM NTP are added; then, after mixing uniformly, adding pure water to a constant volume of 1L;

step two, preparing NASBA enzyme mixed liquor: adding 8. mu.l of 50U/. mu.L RNase H, 200. mu.l of 50U/. mu.L T7-RNA polymerase, 400. mu.l of 5U/. mu.L AMV reverse transcriptase and pure water to a total volume of 1 ml;

step three, preparing primer mixed liquor: preparing a gene primer mixed solution: taking 100 mu L of 0.5mM primer ORF1ab-F, 100 mu L of 0.5mM primer ORF1ab-R, 100 mu L of 0.5mM primer N-F, 100 mu L of 0.5mM primer N-R, 100 mu L of 50 × SYBR Green I, and adding pure water to the total volume of 1 mL;

step four, preparing an RNA sample: taking a throat swab RNA extract to be detected as an RNA sample;

step five, measuring 5 mu L of NASBA amplification buffer solution 5 mu L, NASBA enzyme mixed solution and 5 mu L of primer mixed solution prepared in the step one to the step three, fully and uniformly mixing the mixed solution and 10 mu L of RNA sample in the step four, reacting the uniformly mixed solution for 30min at 42 ℃, and judging a detection result by using a fluorescence detector after the reaction is finished.

The detection method in this example was compared with the fluorescence RT-PCR method.

In this embodiment, an inactivated 2019-nCoV nasopharyngeal swab RNA extract is selected and divided into two groups, which are an experimental group and a control group, and two groups of stock solution samples are diluted by 10 times, 100 times, 1000 times and 10000 times to form RNA samples, the RNA samples of the experimental group are added into the kit of this embodiment, the RNA samples of the control group are added into a conventional fluorescence RT-PCR system, and the detection results of the experimental group and the control group are compared and analyzed through experiments; in the experiment, a group of negative samples are respectively added into an experiment group and a control group for detection and analysis, and the detection and analysis results of the negative samples are compared with the detection and analysis results of RNA samples.

Adding an RNA sample into premixed NASBA amplification buffer solution, NASBA enzyme mixed solution and primer mixed solution, uniformly mixing, carrying out amplification reaction at 42 ℃ for 30min, and carrying out interpretation on the reaction solution by using a fluorescence detector after the reaction is finished so as to interpret a detection result; in the control group, an RNA sample is added into a conventional fluorescent RT-PCR system, and reaction is carried out on ABI 7500 by using a conventional method; after the reaction is finished, the experimental group and the control group use an agarose gel electrophoresis method and a fluorescence signal acquisition method for result detection, and the electrophoresis images of the nucleic acid constant-temperature amplification product of the experimental group and the RT-PCR amplification product of the control group are shown in attached figure 1, wherein the electrophoresis results show that the experimental group and the control group do not see a strip of a 1000-time diluted sample, the samples diluted by 10 times and 100 times of the experimental group and the samples diluted by 10 times and 100 times of the control group have clear and complete strips, and the strip brightness of the samples with the same concentration of the two groups is basically consistent, which shows that the amplification effect of the NASBA constant-temperature amplification system of the low-concentration sample is equivalent to that of the RT-PCR method in the embodiment; the fluorescence RT-PCR method adopts a real-time fluorescence collection mode, the change of the nucleic acid amplification amount in a reaction system is indicated by recording the fluorescence change process through a fluorescence PCR instrument, the fluorescence RT-PCR method uses a Ct value as a reading index, the smaller the Ct value is, the larger the concentration of an initial template is, the larger the Ct value is, the smaller the concentration of the initial template is, and when the Ct value is not, the template is not detected; in the detection method of the present embodiment, the fluorescence intensity after the end of the reaction is detected by the end-point method, and the higher the relative fluorescence intensity F value, the higher the amount of the target nucleic acid amplified after the end of the reaction. The final fluorescence signal acquisition results for both experiments are shown in table 1 below:

TABLE 1

As can be seen from the data in Table 1, the experimental group data show that fluorescence signals of 10-fold and 100-fold diluted RNA samples can be detected by the NASBA constant temperature amplification system based on SYBR Green I dye, namely the detection method in the embodiment, and the F value of the fluorescence signal detected by the low concentration RNA sample diluted 100-fold by the mechanism is more than 40 times that of the negative sample; the data for the control group show that the fluorescence RT-PCR method can detect RNA samples diluted 10 times and 100 times, while RNA samples diluted 1000 times at lower concentrations are not detected. The results are combined to discover that the detection method in the embodiment has similar detection capability to the fluorescent RT-PCR method in the detection of low-concentration RNA samples, the sensitivity of the two methods is equivalent, but because the price of a PCR instrument used in the fluorescent RT-PCR method is high, the condition is basically met in a laboratory of Hospital, the PCR instrument has high technical requirements on operators, the PCR instrument cannot be popularized and used in the basic level, so that the large-area population cannot be screened efficiently in the large-scale outbreak of epidemic situations, the reagent kit is used for the detection method in the embodiment, after the reaction is finished, a small fluorescent detector can be used for reading the final result, the whole process does not depend on large-scale instruments and professional operators, the reagent kit can be popularized and used in the basic level in a large-scale manner, and the detection method of the embodiment has better detection advantages compared with the PCR instrument, is suitable for large-scale popularization and use of the base, and is particularly suitable for screening of large-scale groups.

The specificity of the detection method in this example was compared to that of the serological method.

Comparative experiment: throat swab samples of 10 confirmed 2019-nCoV positive subjects and throat swab samples of 10 confirmed 2019-nCoV negative subjects are taken in the experimental group; the detection kit in the embodiment is used for carrying out detection reaction, and a fluorescence detector is used for detecting the reaction result; in the control group, 20 blood samples of the same subject in the experimental group are used, and commercial colloidal gold test paper products on the market are used for IgG antibody detection; the test results of the experimental groups are shown in the following table 2:

TABLE 2

As shown by the results of the experimental groups in the table 2, with the F value of 2.00 as a threshold value, 10 positive samples P1-P10 of the experimental group all show positive results, and 10 negative samples N1-N10 all show negative results; the experimental results of the control group are shown in figures 2 and 3, as shown in figure 2, 2 positive samples of P1 and P2 in 10 positive samples P1-P10 of the control group show false negative results, and 1 sample of N1 in 10 negative samples N1-N10 shows false positive results as shown in figure 3; by comparing the detection results of the experimental group and the control group, the detection method in the embodiment has better sensitivity and specificity than the serology method, and can accurately detect the 2019-nCoV virus.

The kit and the detection method using the kit disclosed in the embodiment can conveniently detect the 2019-nCoV virus and can process a trace amount of virus samples. Compared with experimental results, the detection method in the embodiment shows high-specificity and high-sensitivity detection performance, does not depend on instruments and professional experimenters, saves a large amount of experimental time, and is suitable for being popularized in the basic level and detecting large-area crowds in the virus outbreak period.

As noted above, while the present invention has been shown and described with reference to certain preferred embodiments, it is not to be construed as limited thereto. Various changes in form and detail may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

Claims (7)

1. A2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I is characterized by comprising 2019-nCoV viral primers and SYBR Green I; the 2019-nCoV virus primers comprise ORF1ab gene primers and N gene primers, and the primer sequence of the ORF1ab gene is shown as ORF1ab-F and ORF1 ab-R; the primer sequence of the N gene is shown as N-F and N-R.

2. The kit of claim 1, further comprising NASBA amplification buffer and NASBA enzyme cocktail.

3. The kit of claim 2, wherein the NASBA amplification buffer comprises Tris-HCl, MgCl₂KCl, DTT, dNTP, NTP and pure water; the NASBA enzyme mixture contains RNase H, T7-RNA polymerase, AMV reverse transcriptase and purified water.

4. The kit of claim 3, wherein the NASBA amplification buffer comprises 200mmol/L LTris-HCl, 60mmol/L MgCl₂350mmol/L KCl, 2.5mmol/L DTT, 5mmol/L dNTP, 10mmol/L NTP and pure water; the NASBA enzyme mixture contained 0.4U/. mu.L RNase H, 10U/. mu. L T7-RNA polymerase and 2U/. mu.LAMV reverse transcriptase and purified water.

5. The kit according to claim 4, wherein 31.52g of Tris-HCl, 5.71g of MgCl are added to the NASBA amplification buffer when 500ml of pure water is used₂26.09g of KCl, 0.39g of DTT, 50mL of 100mM dNTP and 100mL of 100mM NTP; when the total volume of the NASBA enzyme mixture is 1ml, the mixture ratio is 8 mul of 50U/. mu.L RNaseH, 200 mul of 50U/. mu.L T7-RNA polymerase, 400 mul of 5U/. mu.L AMV reverse transcriptase and pure water are added to make the total volume 1 ml.

6. The kit of claim 4, wherein the primer mixture comprises 50 μ M primer ORF1ab-F, 50 μ M primer ORF1ab-R, 50 μ M primer N-F, 50 μ M primer N-R, and 5 XSSYBR Green I.

7. A method for detecting 2019-nCoV virus by using the kit of any one of claims 2 to 6, comprising the steps of:

step one, preparing an NASBA amplification buffer solution: 500ml of purified water was measured, and 31.52g of Tris-HCl and 5.71g of MgCl were added₂26.09g of KCl, 0.39g of DTT, 50mL of 100mM dNTP and 100mL of 100mM NTP; then, after mixing uniformly, adding pure water to a constant volume of 1L;

step two, preparing NASBA enzyme mixed liquor: adding 8. mu.l of 50U/. mu.L RNase H, 200. mu.l of 50U/. mu.L T7-RNA polymerase, 400. mu.l of 5U/. mu.L AMV reverse transcriptase and pure water to a total volume of 1 ml;

step three, preparing primer mixed liquor: preparing a gene primer mixed solution: taking 100 mu L of 0.5mM primer ORF1ab-F, 100 mu L of 0.5mM primer ORF1ab-R, 100 mu L of 0.5mM primer N-F, 100 mu L of 0.5mM primer N-R, 100 mu L of 50 × SYBR Green I, and adding pure water to the total volume of 1 mL;

step four, preparing an RNA sample: taking a throat swab RNA extract to be detected as an RNA sample;

step five, measuring 5 mu L of NASBA amplification buffer solution 5 mu L, NASBA enzyme mixed solution and 5 mu L of primer mixed solution prepared in the step one to the step three, fully and uniformly mixing the mixed solution and 10 mu L of RNA sample in the step four, reacting the uniformly mixed solution for 30min at 42 ℃, and judging a detection result by using a fluorescence detector after the reaction is finished.

Images